rev-like transcripts of caprine arthritis encephalitis virus

VIROLOGY

(1991)

183,786-792

rev-like Transcripts HAGAR KALINSKI,*

ABRAHAM

YANIV,*

of Caprine Arthritis

PNINA MASHIAH,*

*Department of Human Microbiology, Sackler School tLaboratory of Cellular and Molecular Biology, Received

November

TORU MlKl,t

Encephalitis

Virus

STEVEN R. TRONICK,t

AND ARNONA GAZIT*~'

of Medicine, Tel Aviv University, Tel Aviv 69978, Israel, National Cancer Institute, Bethesda, Matyland 20892

73, 1990;

accepted

April

and

7 7, 799 I

The pattern of expression of the caprine arthritis encephalitis virus genome (CAEV) in acutely infected tahr lung ceils was found to be complex and temporally regulated. Employing Northern analysis, five CAEV-specific transcripts, 9,6.5, 5.0, 2.5, and 1.4 kb, were detected. Nucleotide sequence analysis established the genetic structure of two species of cDNA, isolated from a library of CAEV-infected tahr cells, and suggested that they represent rev-like transcripts. One of these cDNA species was composed of three exons-the leader, an exon derived from the 5’ region of env, and an exon which spanned the 3’ orf. The second cDNA species consisted of four exons-three of which were identical with those of the former species. The additional exon (the second) was located at the 3’end of pal. These transcripts could potentially encode three proteins-a Rev-like protein, which is a fusion of 38 amino acids derived from the N-terminus of env and 91 residues from the 3’ orf; a truncated form of the env transmembrane protein, and a novel protein, designated X composed of 73 amino acids. Thus, CAEV, like other lentiviruses, displays a complex pattern of gene expression, characterized by alternative splicing and the production of potentially polycistronic transcripts. o 1991 Academic

Press, Inc.

CAEV, a lentivirus, causes a slowly progressive multiorgan disease, characterized by leukoencephalomyelitis in young goats, occasional chronic pneumonia and mastitis, and progressive arthritis in older animals (for reviews, see (1, 2)). The progressive evolution of the pathological process is associated with prolonged virus persistence and spread in the face of a significant host immune response. Although the basis for persistence is unknown, one possible mechanism may involve restriction of viral gene expression which could enable virus-infected cells to evade elimination by the immune system. The genomes of the primate lentiviruses-human (HIV) and the simian (SIV) immunodeficiency viruses (reviewed in (3-5)), as well as the ungulate lentiviruses -equine infectious anemia virus (EIAV) (6-g), and visna (lo- 12), were shown to encode proteins which regulate virus replication and likely play a role in virus pathogenesis and latency. In contrast, the regulatory proteins of CAEV have not been characterized in as much detail. Sequence analysis of the CAEV genome (Refs. 13, 13a) and our unpublished results) established that it is most similar to that of visna (14, 15) and the visna-related ovine lentivirus (16). In addition to the three openreading frames (ORFs), gag, PO/, and env, found in all retroviruses, several other small ORFs, termed orfl, orf2 and 3’orf( 73) are present, which, by analogy to the

’

To whom

0042-6822191

reprint

requests

other lentiviruses, may encode viral regulatory proteins. As an approach toward determining the products of the CAEV genome that regulate its expression, we first sought to identify the various viral mRNA species in CAEV-infected tahr cells. To determine the optimum conditions for detecting CAEV mRNAs, Himalayan tahr lung cells were infected with 10 plaque forming units (PFU) per cell. At various times after infection, total cellular RNA was extracted and analyzed by the Northern procedure as previously described (17). At least five species of CAEV-specific transcripts, 9.0,6.5,5.0,2.5, and 1.4 kb, were detected (Fig. 1). This pattern of expression is characteristic of other lentiviruses such as HIV (18-20), SIV (21), visna (22-24), and EIAV (9, 17, 25, 26). The highest levels of CAEV transcripts were observed 72 hr after infection. However, the relative amounts of the 6.5, 2.5, and 1.4-kb transcripts were higher 24 hr postinfection (data not shown), versus 48 and 72 hr. HIV-1 (27-30) and visna virus (23) have been found to be similar in this regard. The five species of CAEV transcripts were initially characterized by Northern analysis and hybridization with a series of riboprobes and oligonucleotide probes representing various regions of the viral genome (Fig. 2). The 9-kb transcript hybridized with all the probes used, strongly suggesting that it represents the viral genomic RNA. The 6.5-kb transcript hybridized with riboprobes A to F, and with oligonucleotides 1 and 19, but not with oligonucleotide 37, indicating that this species is a subgenomic transcript generated by at

should be addressed

$3.00

Copyright 0 1991 by Academic Press. Inc. All rights of reproduction I” any form reserved.

786

SHORT

A

COMMUNICATIONS

B

C

.28S

- 18s

FIG. 1. Northern analysis of CAEV specific transcripts at different times postinfection. The Himalayan tahr lung cell line (ATCC No. 6277) was grown in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum and infected with CAEV (10 PFU per cell) as previously described (59). Forty-eight (A) and 72 hr (B) after infection, total cellular RNA was isolated by the guanidinium isothiocyanate method (60) and analyzed by the Northern procedure as previously described (17). 0.15 pg of polyadenylated RNA was applied to each lane and the blot was probed with oligonucleotide 1 (see Fig. 2). The arrows indicate the mobilities of 28 S and 18 S ribosomal RNAs.

least one splicing event that occurs within the 3’orf The 5.0-kb mRNA hybridized with probes representing the leader region (probes A and 1) and the 3’ half of the genome (probes E, F, and 37), but not with probes representing the gag (B) or PO/(C) region and the middle part of the genome (probes D and 19). It should be noted that lane D, Fig. 2, II, was greatly overexposed to reveal the 2.5-kb species. In lighter exposures there is no band detectable at the position corresponding to the 5.0-kb mRNA. These results suggest that the 5.0kb species is the env mRNA. The 2.5-kb transcript hybridized with probes representing the gag region (probe B) and the orfl and orf2 regions (probe D), but not to probes representing the pal, env, and 3’orf (probes C, 19, E, F, and 37). These data indicate that the 2.5-kb transcript is generated by at least two splicing events that occur within pal and env. The 1.4-kb transcript hybridized with probes representing the leader (probes A and l), orf2 (probe E), and 3’orf(probe

787

37), but did not hybridize with gag, PO/, or env probes (probes B, C, 19, D, and F), suggesting that it is a multiply-spliced transcript, containing part of the env and 3’orf sequences. Based on previously published reports on visna virus transcripts (70, 11) and on the nucleotide sequence of SA-OMVV (16), it is likely that the 1.4-kb transcripts encode the CAEV Rev protein. In order to characterize the putative revtranscripts, a cDNA library was prepared from CAEV-infected tahr cells using the expression vector pCEV27, a derivative of the X vector pCEV9 (31), in which expression of cDNA inserts is driven by the long terminal repeat (LTR) of Moloney murine leukemia virus (MO-MuLV). The library was screened for putative full-length cDNAs by using 30-mer oligonucleotide probes representing the U3 and U5 domains of the CAEV LTR (32). Recombinant phages were digested with NotI (3 I) and religated in order to generate the expression plasmids. The cDNA clones were hybridized with oligonucleotide probes representing various regions of the viral genome (data not shown). Sixteen out of 28 full-length clones (group dl) contained a leader exon spliced to 5’env, and then to S’orf sequences. One clone (group d2) was composed of four exons-three exons similar to those of group dl , and an additional exon residing immediately upstream of orfl These two cDNA species likely represented the 1.4-kb transcripts revealed by the Northern analysis and might represent the CAEV rev transcript. The cDNA of group dl was 1140 nucleotides long and commenced 27 nucleotides downstream of the transcriptional start site in the LTR. (The numbering system used here is based on the CAEV CO sequence (13, 13a), where +1 represents the transcription initiation site). The position of the poly(A) tail indicated that the 3’ boundary of the R region is at nucleotide 9173 of the genomic sequence, in accordance with our previous sequence analysis of the LTR of CAEV clone 1244 (32). Analysis of the LTR U3 region, revealed a complex pattern of direct repeats. The first set of 56-bp repeats, designated 1A and 1 B, overlap by three bases and represent the 3’ half of the 71-bp repeats of the sequence determined by Saltarelli et al. (13). A second set of 54-bp repeats (2A and 2B) starts by overlapping the last 7 bases of repeat 1 B. Only one of these repeats is present in the CAEV LTR sequence of Hess et a/. (33). Comparison of the nucleotide sequence of the group dl transcript to the genomic sequence (13) revealed that it is composed of three exons (Fig. 3). Exon 1 extends up to the consensus splice donor at 336. The second exon starts at base 6012, the putative start site of env, and terminates at a splice donor site at 6123. This exon is further spliced to base 8505, located within the 34th codon of the 3’orf. Sequence

SHORT COMMUNICATIONS

788

1

2 I

I

1

gag

3 I

4 I

5 I

6 I

7 I

8

9

I

I

Kb

I

LTR r-l’

PO1

U

1 I

II

A

B

A

B

Kb 9.06.55.0-

2.5-

1.4-

C

19D

E

F

37

2. Characterization of CAEV-specific mRNAs. I. Schematic representation of CAEV genome and the hybridization probes used. The designation of ORFs is according to Saltarelli eta/. (13a). Single-stranded, uniformly labeled antisense riboprobes were derived from CAEV clone 1244 (59) by subcloning into Bluescript SK vectors (Stratagene), followed by labeling with [(u-~‘P]UTP (3000 Ci/mmol) and T7 or T3 RNA polymerase as previously described (17). The riboprobes (horizontal bars) were derived from the following regions: nucleotides -176 to 46 (A); 1136 to 1874 (B); 3897 to 4025 (C); 4863 to 5910 (D); 5610 to 6328 (E); 7142 to 7959 (F). Oligonucleotides (vertical bars numbered 1, 19, and 37) were synthesized according to our unpublished sequence data of the CAEV cloned genome 1244, by using a Biosearch Model 8700 synthesizer. End labeling with [Y-~~P]ATP (3000 Ci/mmol) and T4 polynucleotide kinase was performed as previously described (7 7). The 30.mer oligonucleotide probes began at nucleotide 132 (I), 5397 (Is), and 8626 (38). II. Northern analysis. Polyadenylated RNAfrom CAEV-infected tahr cells was extracted 48 hr after infection and analyzed by Northern blotting (0.15 rg per lane). Lanes are designated according to the probes used for hybridization. Some samples were run in different gels, thus, horizontal bars indicate the positions of the five CAEV specific transcripts whose sizes are given on the left. As a control the blots were stripped of probe and then rehybridized with probe 1 which recognized all five RNAs. FIG.

analysis of two cDNAs representing the dl group of cDNA (Fig. 3) and the one representative of group d2 (not shown), showed that their sequences are more closely related to that of the CAEV clone 1244 (our unpublished data), than to that of the CAEV strain CO (13, 13a). The sequences divergence made assignment of splice sites ambiguous when cDNA sequences were compared to CAEV CO, so assignment of splice sites was determined according to the clone 1244 sequence. The splice acceptor and donor sites of this cDNA (see legend to Fig. 3) closely matched the mammalian 3’ and 5’ splice-site consensus sequences (NCAGIG and CIA)AGIGURAGU, respectively (34, 35). Sequence analysis of the cDNA representing group d2 (not shown) showed that it was composed of four exons (Fig. 4). The first exon terminates at the same splice donor at 336 used by the dl cDNA, and is then spliced to position 4884. The third and fourth exons are identical with the second and third exons, respectively, of group dl cDNA.

Translation of group dl (Fig. 3) and d2 cDNAs (not shown) revealed the presence of three ORFs with potential initiator AUG codons (Fig. 3). The first ORF, designated Rev-like ORF (nucleotide 303 to 710) contains a methionine codon at position 312, which has the optimal context for efficient recognition as an initiation signal (36, 37) and thus could initiate the translation of a 133-amino acid, 15-kDa protein. This protein would contain 38 N-terminal amino acids encoded by the env ORF, while the remaining 95 amino acids are contributed by the third reading frame of the 3’orf The structure of the protein encoded by the Rev-like ORF is analogous to the predicted Rev proteins of other ungulate lentiviruses such as visna (IO, 17, 24), the visna-like SA-OMVV ovine virus (16), bovine immunodeficiency virus (38) and EIAV (Refs. 9, 39) and our unpublished results). In these cases, the first coding exon corresponds to the N-terminus of the env gene, while the C-terminus overlaps the 3’ border of the env, but in a different reading frame.

SHORT COMMUNICATIONS

789

CTCCGACTCCGAGGAGGTACCGAGACCTCACMT~~AGTGATT~CTTACT~CGAGT~AGAGTGATTACTGA~~C~TGTATC~AGTCGTCCCTTMT~TGT~MT~~ [271 0 0 0 0 0 e 0 * 0 e

0

0

End Exon

End Exe”

2 -71 IExon I61231[85051

1 ->IlExon I3361[60121

0

120

0

360

2 ->

3 ->

XBEhDGLETTsKIKK 0

N

S

P

K

K

K[ E

CAGAACTCACCTTGGAGGAAGCCATGGCAGAGGAGCCTG~TGA~GCT~TAGTCCCACC~TGA~GAT~ATCT~~~AT~T~A~~TT~AGA~TACCTC~~~G~ 0 0 0 0 0 0 0 0 0

0

0

720

(GWTVRHGEKGTENRLGPILVNHLCCYKKS~FTWTK~N~VT~A~ RVDCETWGKGD* AGGGTGGACTGTGAGACATGGGGAAAAGGGGACTGAGMCAGACTAG~CCMTTCTTGT~TCACTTGT~TGTTATMG-~MGTTCACTATGAC~~~TGTMCC~ 0 0 0 0 0 0 0 IU3 START ' 71 bp DR CRlA YRKASHYDKAKCNRKC* iSACC AAGTGCGTGCTGTTATAGAARAGCAAGTCACTATGAC~GC-TGTMCC~MGT~TGAC~TGTMCA~TGACACATCA~TGAT~TT~TCAT~TGACAGT~~ACM

0

0

840

0

lOS0

ATGTAACAGCTGACACATCAGCTGATGCTTGCTCATGCTGACMTGTA~TCTGA~TGTATATMGGA~A~TTT~T~TT~ACTTCAGAGTTCTA~AGAGTTCCTCCTAGTCTT 0 0 0 0 0 0 0 0 0 0 CCTCCGAGGAGGTACCGAGACCTCACAATAAAGGAGTGATTGCCTTA 0 0 0 0

FIG. 3. Nucleotide sequence and the deduced amino acid sequence of the cDNA representing group dl. The cDNA was subcloned into pBluescript SK vector and sequenced by the chain termination method (6 I), using the Sequenase DNA sequencing kit (United States Biochemical Corp.). Sequences were analyzed with the aid of IntelliGenetics software. Numbers under the right end of each line indicate nucleotide numbers of the cDNA sequence. The first nucleotide of the cDNA sequence corresponds to number 27 of the genomic CAEV sequence of Saltarelli et al. (73, 13a). Numbers in brackets below the sequence indicate the nucleotide positions of the CAEV genomic sequence (73, 13a) along with exon borders. The predicted amino acids of the putative functional ORFs are given in standard single-letter code. Stop codons are designated by asterisks. The splice junctions, with the conserved sequences bold-faced, are as follows (numbers according to the genomic sequence): donor splice sites: exon 1 (nucleotide 336) GTAAG/GTAAGTGAC; exon 2 (nucleotide 6123) GCAAG/GTAAGTATA. Acceptor splice sites: exon 2 (nucleotide 6012) TACTAG/ATGGA; exon 3 (nucleotide 8505) ATACAG/ATATA. This figure was prepared with the aid of a computer program, “DNAdraw,” written by M. Shapiro, NIH.

Alignment of the predicted Rev-like protein sequence of CAEV with those of other lentiviruses, revealed significant similarity to the predicted Rev proteins of visna and SA-OMVV (Fig. 5). The presence of three short stretches of conserved amino acids is noteworthy. The first, an N-terminal glutamic acid-rich domain (residues 23 to 26), is analogous to that found at the N-terminus of the primate Rev proteins although the latter are not derived from the env ORF (40-42). The second stretch is a highly charged region composed of several basic amino acids in the second coding exon (KSRRRRR, residues 57 to 63) which is also present in the predicted Rev sequences of visna and SA-OMVV (Fig. 5) as well as in those of HIV-1 (27), HIV-2 (42) and SIV MAC (41). Mutational analysis of

the highly arginine-rich sequence present within the Rev of HIV-1 suggested that this sequence functions as part of a sequence-specific RNA binding domain (43) which interacts with the Rev response element, RRE, thus activating the nuclear export of the viral structural transcripts from the nucleus to the cytoplasm (4446). lmmunocytochemistry and subcellular fractionation studies demonstrated that the Rev of HIV-1 is a nuclear protein (47) that accumulates primarily in the nucleoli (48, 49). Recent studies suggested that this basic domain is an essential determinant of nucleolar localization (50). However, it is noteworthy that in contrast to Rev of HIV-l, the Rev protein of visna has been shown to accumulate in the cytoplasmic fraction of infected cells, and to be packaged

SHORT

790 1 I

I

gag LTR

d,[fj]-

____e__

2

3

4

5

6

7

8

9

I

I

I

I

I

I

I

I 1

Kb

I I

Cl’

COMMUNICATIONS

PO1

-----+--e--e-

d2[1]----------,---~-------

FIG. 4. Genetic structures of the putative rev cDNAs. Location of mRNA exons relative to the CAEV genome. extends to nucleotide 336, exon 2 from 6012 to 6123, and exon 3 from 8505 to 9173. In the cDNA representing exon which spans nucleotides 4884 to 4928. Its splice sites are as follows: acceptor splice site (nucleotide splice site (nucleotide 4928) CTCAG/GTACTGTGG.

in mature virions (51). The third conserved domain located at the carboxy terminus of the CAEV Rev-like protein spans residues 96 to 103 (LAELTLEE), and is reminiscent of the acidic domain of HIV Rev (LERLTLDCNED). Mutation within this domain lead to a rev trans-dominant phenotype suggesting that it may bind to a cellular factor involved in RNA transport

(52, 53). The identification of a rev-like transcript indicated that the CAEV genome must possess a Rev responsive element (RRE). Following the submission for publication of the present work, Saltarelli eT al. (13a) published computer analyses supporting the existence of such a structure. Examination of the nucleotide sequence of CAEV clone 1244 supported their conclusions. Thus, the env transmembrane (TM) sequences of CAEV strains CO (13, 13a)and clone 1244 (present report)

In the cDNA of group dl , exon 1 group d2, there is an additional 4884). TTACAGIAATAA; donor

are 88.34% identical, whereas in the region corresponding to a putative RRE (nucleotides 7907-8108 (13, 13a))there is 93.7% identity. The minimum free energy for the putative RRE of CAEV clone 1244 was -74.0 kcal/mol. Using the same computer program to analyze the experimentally defined RRE of HIV-l (44) a value of -78.4 was obtained. The predicted structure of the putative RRE of CAEV clone 1244 is shown in Fig. 6. The second ORF present in this cDNA, designated TM ORF (Fig. 3) spans nucleotides 371 to 754, contains a methionine codon at 472 and thus could initiate the translation of a truncated transmembrane glycoprotein of 94 amino acids with a calculated molecular weight of 10 kDa. A truncated envelope protein was suggested to be encoded also by the rev transcript of visna virus (10) and by the polycistronic rat mRNA of

CAEVREV CAEVCG SAOMVV

118)

VISNA

1171

CAFS’REV CAEVCG SAOMVV

185)

VISNA

I841

FIG. 5. Amino acid sequence comparisons of the predicted Rev proteins of CAEV cDNA (CAEVREV) and CAEV genomic clone CAEVCG (13, (14, 70) and SA-OMVV (76). Asterisks and open circles indicate, respectively, identical and conserved residues, in three out of four sequences compared. Underlined residues indicate similar regions that were obvious by eye but which were not scored high enough to be aligned by the computer program. The numbers for the first residues displayed in the visna and SA-OMW sequences are shown. Shaded and boxed residues indicate identities among the sequences within, Identities between the pairs CAEVREV-CAEVCG and SAOMW-VISNA, but not to each other, are boxed separately. The alignments were produced with the aid of the FASTA program (62).

13a), visna

SHORT

791

COMMUNICATIONS

GJo FIG. 6. Predicted secondary structure (63) was used to analyze overlapping

If

of the RRE of CAEV. The FOLD program (University of Wisconsin segments of the env gene of CAEV clone 1244. The minimum

EIAV (Ref. (9) and our unpublished results). Moreover, the existence of a truncated C-terminal nonglycosylated protein was detected recently in EIAV virions (54). The third ORF of this cDNA, designated X ORF (Fig. 3), which spans nucleotides 683 to 902, contains an AUG codon at 682 and thus could code for a 73-residue protein (8 kDa). It is not similar to any known sequence and has no characteristics in common with the nef gene present in an analogous position in HIV and SIV. The potential of the two rev-like transcripts, dl and d2, to direct the synthesis of three viral proteins by a “leaky scanning” model (55, 56) is reminiscent of the existence of polycistronic transcripts coding for regulatory proteins of other lentiviruses, such as HIV-1 (57), visna (10, 1 I), and EIAV (9, 26, 39). In addition to the existence of polycistronic transcripts, the complex pattern of gene expression displayed by CAEV genome is also characterized by the use of alternative splicing mechanism as is the case for other ungulate (9, 11, 26, 39, 40) as well as mammalian (57, 58) lentiviruses. It is noteworthy that as in the case of HIV-1 (19, 57) and visna (10, 1 I), the noncoding exon derived from the 3’ border of pal was also acquired by the CAEV putative rev-like transcript of group d2. This is an alternative exon in the rev transcripts of HIV, visna, and CAEV. In fact, our data suggest that in productively infected tahr cells, the abundance of the CAEV rev-like mRNA spe-

Sequence free energy

Analysis Software Package) was -74.0 kcalimol.

ties which lacks the upstream noncoding exon is higher than that of the rev-like transcript which possesses it. ACKNOWLEDGMENTS We thank Dr. agement. This 6007-00, from Program, US.

S. A. Aaronson for his continued support and encourresearch was supported by Grant DPE-5544-G-%the U.S.-Israel Cooperative Development Research Agency for International Development.

REFERENCES 1. CHEEVERS, W. P., and MCGUIRE, T. C., A& virus Res. 34, 189215 (1988). 2. NARAYAN, O., Curr. Opinion Immunol. 2, 399-402 (1990). 3. CULLEN, B. R., and GREENE, W. C., Cell 58, 423-426 (1989). 4. CULLEN, B. R., and GREENE, W. C., Krology 178, l-5 (1990). 5. GREENE, W. C., Annu. Rev. Immunol. 8,453-475 (1990). 6. DERSE, D., DORN, P. L., LEVY, L., STEPHENS, R. M., RICE, N. R., and CASEY, J. W., J. Viol. 61, 743-747 (1987). 7. SHERMAN, L., GAZIT, A., YANIV, A., KAWAKAMI. T., DAHLBERG, J. E., and TRONICK, S. R., J. Viral. 62, 120-126 (1988). 8. DORN, P. L. and DERSE, D., J. Viral. 62, 3522-3526 (1988). 9. NOIMAN, S., GAZIT, A., TORI, O., SHERMAN, L., MIKI, T., TRONICK, S. R., and YANIV, A., L/iro/ogy 176, 280-288 (1990). 70. MAZARIN, V., GOURDOU, I., QUERAT, G., SAUZE, N.. and VIGNE, R., /. Viral. 62, 4813-4818 (1988). 11. GOURDOU, I., MAZARIN, V., QU-~ERAT, G., SAUZE, N., ~~~VIGNE, R., virology 171, 170-178(1989). 12. DAVIS, J. L., and CLEMENT.% J. E., froc. Nat/. Acad. Ski. USA 86, 414-418 (1988).

792

73.

SHORT

COMMUNICATIONS

SALTARELLI, M., QUERAT, G., KONINGS, D. A. M., VIGNE, R., and CLEMENTS, J. E., HIVSequence Database (I 990). 13a.SALTARELL1, M., QUERAT, G., KONINGS, D. A. M., VIGNE, R., and CLEMENTS, J. E., Virology 179, 347-364 (1990). 14. SONIGO, P., ALIZON, M., STASKUS, K., KLATZMAN, D., COLE, S., DANOS, O., RETZEL, E., TIOLLAIS, P.. HAASE, A., and WAIN-HOBSON, S., cell 42, 369-382 (1985). 15. BRAUN, M. J., CLEMENTS, J. E., and GONDA, M. A. /. Viral. 61, 4046-4054 (1987). 76. QUERT, G., AUDOLY, G., SONIGO, P., and VIGNE, R., Virology 175, 434-447 (1990). 77. NOIMAN, S., YANIV, A., SHERMAN, L., TRONICK, S. R., and GAZIT, A., J. Viral. 64, 1839-l 843 (1990). 18. ARYA, S. K., Guo, C., JOSEPHS, S. F., and WONG-STAAL, F., Science 229, 69-73 (1985). 79. MUESING, M. A., SMITH, D. H., CABRADILLA, C. D., BENTON, C. V., LASKY, L. A., and CAPON, D. J., Nature 313, 450-458 (1985). 20. RABSON, A. B., DAUGHERPI, D. F., VENKATESAN, S., BOULUKOS, K. E., BENN, S. I., FOLKS, T. M., FEORINO, P., and MARTIN, M. A., Science 229, 1388-l 390 (1985). 27. VIGLIANTI, G. A., SHARMA, P. L., and MULLINS, J. I., /. Viral. 64, 4207-4216 (1990). 22. DAVIS, 1. L., MOLINEAUX, S., and CLEMENTS, J. E., J. Viral. 61, 1325-1331 (1987). 23. VIGNE, R., BARBAN, V., QUERAT, G.. MAZARIN, V., GOURDOU, V. I., and SAUZE, N., Virology 161, 218-227 (1987). 24. SARGAN, D., and BENNET, I. D., 1. Gen. Viral. 70, 1995-2006 (1989). 25. RASP/, S., DHRUVA, B. R., SCHILT~. R. L., SHIH, D. S., ISSEL, C. J., and MONTELARO, C., /. Viral. 64, 86-95 (1990). 26. DORN, P., DASILVA, L., MARTARANO, L., and DERSE, D., J. Viral. 64, 1616-1624 (1990). 27. SODROSKI, I., GOH, W. C., ROSEN, C., DAMON, A., TERWILLIGER, E., and HASELTINE, W.. Nature 321, 412-417 (1986). 28. FEINBERG, M. B., JARRET, R. F., ALDOVINI, A., GALLO, R. C., and WONG-STAAL, F., Cell 46, 807-817 (1986). 29. KNIGHT, D. M., FLOMERFELT, F. A., and GHRAYEB, J., Science 236, 837-840 (1987). 30. KIM, S.. BYRN, R., GROOPMAN, J., and BALTIMORE, D.. f. Viral. 63, 3708-3713 (1989). 37. MIKI, T., MATSUI, T., HEIDARAN, M. A., and AARONSON, S. A., Gene 63, 137-l 46 (1989). 32. SHERMAN, L., GAZIT, A., YANIV, A., DAHLBERG, J. E., and TRONICK, S. R. Virus Res. 5, 145-l 55 (1986). 33. HESS, J. L.. PYPER, I. M., and CLEMENTS, J. E. 1. Viral. 60, 385393 (1986). 34. MOUNT, S. M., Nucleic Acids Res. 10, 459-472 (1982). 35. SHAPIRO, M. B., and SENAPATHY, P., Nucleic Acids Res. 15, 7155-7172 (1987). 36. KOZAK, M., Nature 308, 241-246 (1984). 37. KOZAK, M., Cell 44, 283-292 (1986). 38. GARVEY, K. J., OBERSTE, M. S., ELSER, J. E., BRAUN, M. J., and GONDA, M. A., Virology 175, 391-409 (1990).

39. 40.

41.

42. 43. 44. 45.

46. 47. 48. 49. 50. 57.

52. 53. 54.

55. 56. 57. 58. 59. 60. 67. 62. 63.

STEPHENS, R. M., DERSE, D., and RICE, N. R., 1. Vim/. 64, 37 163725 (1990). COLOMBINI, S., ARYA, S. K., REITZ, M. S., JAGODZINSKI, L., BEAVER, B., and WONG-STAAL, F., Proc. Nafl. Acad. SC;. USA 86,48 13481 7 (1989). CHAKRABARTI, L., GUYADER, M., ALIZON, M., DANIEL, M. D.. DESROSIERS, R. C., TIOLIAIS, P., and SONIGO, P., Nature 328, 543-547 (1987). GUYADER, M., EMMERMAN, M., SONIGO, P., CLAVEL, F., MONTAGNIER, L., and ALIZON, M., Nature 326, 662-669 (1987). MALIM, M. H., RILEY, L. S., MCCARN, D. P., RUSCHE, 1. R., HAUBER, J., and CULLEN, B. R., Cell 60, 675-683 (1990). MALIM, M. H., HAUBER, J., LE, S-Y, MAIZEL, J. V., and CULLEN, B. R., Nature 338, 254-257 (1989). HADZOPOULOU-CLADARAS, M., FELBER, B. K., CLADARAS, C., ATHANASSOPOVLOS, A. T., and PAVLAKIS, G. N., J. Viral. 63, 12651274 (1989). EMMERMAN, M., VAZEUX, R., and PEDEN, K., Cell 57,1155-l 165 (1989). CULLEN, B. R., HAUEIER, J., CAPBELL, K., SODROSKI, J. G., HASELTINE, W. A., and ROSEN, C. A.. 1. Viral. 62, 2498-2501 (1988). PERKINS, A., COCHRANE, A. W., RUBEN, S. M., and ROSEN, C. A., ADS 2, 256-263 (1989). VENKATESH, L. K., MOHAMMAD, S., and CHINNADVRA, G., Virology 176, 39-47 (1990). COCHRANE, A., PERKINS, A., and ROSEN, C., /. Viral. 64, 881-885 (1990). MAZARIN, V., GOURDOU, I., QUERAT, G., SAUZE, N., AUDOLY, G., VITU. C., Russo, P., ROUSSELOT, C., FILIPPI, P., and VIGNE, R., Virology 178, 305-310 (1990). MALIM, M. H., BOHNLEIN, S.. HAUBER, J., and CULLEN, B. R., Cell 58, 205-214 (1989). MERMER, B., FELBER, B. K., CHAPBELL, M., and PAVLAKIS, G. N., Nucleic Acids Res. 18, 2037-2044 (1990). RICE, N. R., HENDERSON, L. E., SOWDER, R. C., COPELAND, T. D., OROSZLAN, S., and EDWARDS, J. F., J. Viral. 64, 3770-3778 (1990). KOZAK, M., Nucleic Acids Res. 15, 8125-8148 (1987). KOZAK, M., /. Cell Biol. 108, 229-241 (1989). SCHWARTZ, S., FELBER, B. K., BENKO, D. M., FENYO, E. M., and PAVLAKIS, G. N., J. Viral. 64, 2519-2529 (1990). GUATELLI, J. C., GINGERAS, T. R., and RICHMAN. D. D., /. Viral. 64, 4093-4098 (1990). YANIV, A., DAHLBERG, J. E., TRONICK, S. R.. CHIU, L-M., and AARONSON, S. A., Virology 145, 340-345 (1985). CHIRGWIN, J., PR~~BYLA, A. E., MACDONALD, R. J., and RUTTER, W. J., Biochemistry 18, 5294-5299 (1979). SANGER, F., NICKLEN, S., and COULSON, A. R., Proc. Nat/. Acad. Sci. USA 74, 5463-5467 (1977). PEARSON, W. R., and LIPMAN, D. J., froc. Nat/. Acad. Sci. USA 85, 2444-2448 (1988). ZUCKER, M.. and STIEGLER, P., Nucleic Acids Res. 9, 133-148 (1981).