- Email: [email protected]
Reverse transcription and cDNA amplification by the polymerase chain reaction of equine arteritis virus (EAV)
of Virological Methods, 30 ( 1990)133-140
lourd
133
Elsevier
VIRhfET 01073
Reverse transcription and cDNA amplification by the polymerase chain reaction of equine arteritis virus (EAV) Ewan D. Chimside’*’ and Willy J.M. Spaan’ ‘Insritute of Virolog Faculty of Veterinary Sciences, The Uhiversity of Utrecht, Utrechr, The NetherIan&
and PDepartment of Virology, Faculty of Medicine, Leiden, The Netherlands
(Accepted
2 July 1990)
Summary A technique is described for the amplification and specific identification of equine arteritis virus (EAV) nucleotide sequences. The polymerase chain reaction (PCR) was evaluated initially by amplification of cloned virus specific cDNA sequences prior to amplification of single-stranded (ss) cDNA produced by reverse transcription (RT) of viral genomic RNA. Three separate primer pairs were used for RT/PCR of EAV genomic RNA, each pair producing only one band in agarose gels of the predicted size from the genomic nucleotide sequence. The viral origin of cDNA products was confkned by hybridisation analysis with EAV-specific probes. RT/PCR analysis of clinical material indicates the methodology is sensitive enough to detect 600 pfu/ml EAV in seminal plasma. Polymerase chain reaction; Vii
diagnosis; Equine arteritis virus
Introduction Equine arteritis virus (EAV) is a positive single-stranded (ss) RNA virus classified as the sole member of the genus arterivirus within the family Togaviridae (Westaway et al., 1985). The only reported animal host for EAV is the horse in which the clinical signs of infection vary widely but generally include pyrexia, lacrimation, conjunctivitis, nasal discharge and oedema. The most severe form of natural infection occurred in Bucyrus, Ohio, in 1953 (Doll, Knappenberger and ‘Corrqortdence to: E.D. Chirnside, Equine Viilogy Kennett, Suffolk, CE38 7PN, U.K.
Unit, The Animal Health Trust, Lanwades Park,
0168-8510/9O/W3.50@ 1990 Elsevier Science Publishers B.V. (Biomedical Division)
134
Bryans, 1957), during which EAV caused abortions in 31 pregnant mares. In the most recent Kentucky outbreak, 159 horses had clinical signs of infection (Timoney, 1985), although no abortions were caused directly by EAV. During this outbreak a live attenuated vaccine (Arvac, Fort Dodge Laboratories) was administered to susceptible animals to contain the spread of infection. Consequently since 1984 mares bred to seropositive stallions in the USA have been vaccinated. A carrier state exists amongst stallions seropositive through infection (Timoney et al., 1986, 1987a,b), These stallions may infect’broodmares by a venereal route, as they shed virus in their semen and act as a reservoir for future disease outbreaks. Semen samples are therefore screened for EAV by virus isolation in cell culture. .This method is laborious and time consuming because at least two cycles in cell culture are needed for virus growth followed by identification in a n~u~isation test (Timoney et al., 1986) and this may be complicated by difficulties in culturing field isolates. Screening results also affect impo~/expo~ potential of valuable animals as the majority of countries are free of EAV ~~umford, 1985). In this paper we report the development of a rapid, sensitive and specific test for the detection of EAV based on the polymerase chain reaction (PCR) (Saiki et al., 1985) and indicate its potential use for clinical detection of EAV in seminal plasma.
Materials and Methods
A concen~ated stock of sucrose gradient purified EAV was prepared as described previously (van Berlo et al., 1980, 1982). The cloning strategy, isolation, identification and characterisation of EAV genomic cDNA clones 106, 535 and 586 (Fig. 1) used for PCR standardisation will be described elsewhere (Boon et al., submitted for publication). Oligonucleotides were synthesised using a Biosearch Model 8600 DNA synthesiser and purified by high performance liquid ~~omato~aphy. Oligonu~leotides 8, D and F have sequences ~ompIemen~ to the EAV genome (-ve oligos), oligos A, C and E are of genome polarity f-t-ve oligos). The genomic location and sequence of each primer pair is shown in Fig. 1. A.&IVreverse ~~sc~pt~ was purchased from Pharmacia, the~os~ble Taq polymerase from Cetus ~~pliTaq) and a-[32P@YI’P from Amersham. Equine seminal plasma samples were kindly donated by Dr P.J. Timoney (Gluck Equine Research Centre, Lexington, Kentucky U.S.A.). Aqueous solutions used for RNA extraction and reverse transcription were sterile and RNase free. Standard molecular biology techniques were as described by Maniatis et al. (1982).
135
AB
CD
1-1
PRltdfS7
E F
586
5
mimers 106
Product size
3
A
CACC.~TATACACTC~.~AAC~A
B
AGATCGACGACGATGGCAGT
2Omer 2Cmer
c
GATGTCTATGCTCCATCATT
2Omer
D
GGCGTAGGCTCCAATTGAA
1Qmef
E
GACTCACGTACACCGTCAGT
2Omer
F
TGGTTCCTGGGTGG
15W
169 276 133
bp bp bp
Fig. 1. Illustration of primer target sequences on the genome of EAV. The position of genomic cDNA clones 586 (leader sequence), 535 (polymerase gene), and 106 (nucleocapsid gene) is shown. Hmer sequences are displayed with the expected target size indicated.
RNA purification
Genomic RNA from sucrose gradient purified virions (van Berlo et al., 1982) and from seminal plasma were prepared by an adap~tion of the ~~i~urn isothiocyanate method of Chirgwin et al. (1979). To each 100 ~1 sample 5 ~1 of proteinase K (20 mg/ml) was added and the mixture incubated for 15 mm at 37°C followed by addition of 500 ~1 4 M guanidium isothiocyanate. The tube remained at RT for 10 min and the following was then added: 2 ,LL~ calf liver tRNA (1 mg/ml) and 60 j~l 2 M sodium acetate, pH 4.0, with mixing between additions. The sample was then extracted with phenol/chloroform and the RNA precipitated from a final volume of 600 ~1 by the addition of 1 ~1 glycogen (20 &nl) and 2.5 vol 96% EtOH. The tube was left for 16 h at -2OOC. After centrifugation the pellet was washed with 70% EtOH, the tube centrifuged and the RNA pellet dried under vacuum. Each pellet was dissolved in a final volume of 20 ~1 water. Reverse transcription The RNA was reverse transcribed in a final volume of 10 ~1 containing 5 1.11 RNA, 1 ~1 FCR buffer (Cetus), 1 ~1 supplementary buffer (400 mM Tris-Cl, pH 8.3,50 mM MgClz), 1 ~1 dNTB mix (10 mM each dNTP), 20 pmol -ve ohgo (B, D or E), 12.5 units RNAsin (Promega) and 5 units AMV reverse transcriptase. After 15 min incubation at 37OC the tube was transferred to a 42OC waterbath for a further 90 min to synthesise EAV ss cDNA.
136
Amplification by PCR Single-stranded cDNA (10 ~1) produced by RT and ds cDNA from a genomic pUC9 library were amplified according to the protocol of the supplier (Cetus). The amplification mix was incubated at 95OC for 5 min and the tube allowed to cool to room temp. Prior to thermal cycling, 2.5 units Amplitaq Taq polymerase were added and the 100 /-11samples overlaid with an equal volume of liquid paraffin to prevent evaporation. Forty cycles were performed; samples were incubated at 95OC for 1 min, 50°C for 1.5 min and 72OC for 2 min. The extension time during the final cycle was increased to 6 min to complete cDNA synthesis on all strands.
Analysis and detection of products After amplification 10 ~1 of product was electrophoresed through a 2% (w/v) agarose gel in TBE buffer (80 mM Tris-borate, 1 mM EDTA, according to Maniatis et al. 1982) containing 0.5 &ml ethidium bromide. DNA was visualised on a UV transilluminator (260 nm) and transferred to nitrocellulose by Southern blotting. The DNA was fixed to the filter by baking at 80°C for 2 h. After prehybridisation the filters were hybridised with 200 ng of a random labelled cDNA probe for 16 h at 42°C. After washing, the filters were exposed to X-ray film.
Results
Amplification of genomic cDNA clones Oligonucleotide primers for reverse transcription (RT) and subsequent cDNA amplification were selected on the basis of sequence information obtained from genomic EAV cDNA clones (Boon et al., submitted). Fig. 1 indicates the location of cDNA clones and oligonucleotide primers used in this study. The primer pairs were selected within anticipated conserved genomic sequences (A and B viral leader sequence; C and D 3’ end polymerase gene; E and F 3’ end nucleocapsid gene). Prior to the use of these three primer pairs in RT/PCR they were used to prime amplification of EAV cDNA by the polymerase chain reaction to determine their specificity for viral sequences. Each set of primers produced a discrete band in agarose gels (Fig. 2) which correlated well with the calculated size as determined from the EAV cDNA sequence (primers A and B 169 bp; C and D 276 bp; E and F 133 bp).
Amplification of genomic RNA The PCR is highly efficient and theoretically capable of synthesising >106 copies of product from a single target DNA sequence (Saiki et al., 1985). However, for RT/PCR the effectiveness of RNA purification and oligonucleotide spe-
137
1
2_ 3
4
5
6
7
Fig. 2. Two percent agarose gel of amplified EAV products. Amplification of EAV cDNA clones 583 (lane l), 535 (lane 2) and 106 (lane 3) using primer pairs A and B, C and D, E and F respectively (see Fig. 1). Lane 4, molecular weight marker PBS KS+ x Sau 3A (1031, 740, 341, 258, 189 bp). Lanes 5, 6 and 7 amplification of EAV gehomic RNA by RT/PCR with primers A and B, C and D, E and F, respectively.
citic priming of RT will be the ultimate limiting factors determining the specificity, and sensitivity of cDNA amplification. Genomic EAV RNA (1 ng) was used for RT by the -ve oligos B, D, and F followed by PCR amplification. Each of the three primer pairs successfully produced a discrete band of the expected size after 40 cycles of amplification (Fig. 2). These bands were recognised in Southern blots by 32P-labelled nick-probes specific for each amplified target sequence (not shown) which confirmed these bands as virus specific cDNA. Identification of products amplified from equine seminal plasma
Prior to work on EAV RNA amplification from seminal plasma the PCR buffer [Mg]*+ concentration was increased from 1.5 mM to 3.0 n&I, improving the efficiency of ss cDNA amplification of the genomic 5’ region with oligos A and B. Six equine seminal plasma samples with virus titres of 6 x 105, 2.5
138
ABCDEFG
H
ABCDEFGH
Fig. 3. Two percent agarose gel of amplified seminal plasma products. (a) Lane A EAV genomic RNA, lanes B-G seminal plasma samples l-6, lane H molecular weight markers (PBS KS+ x Sau3A). (b) Autoradiograph of the amplified EAV cDNA. The samples in Figure 3a were transferred to nitrocellulose membrane and hybridised with an EAV-specific cDNA probe (clone 586 x Pstl x PvuII 500 bp fragment). The only DNA showing hybridisation is the 169nt band present in semen samples 1, 2 and 3 (all virus isolation +ve) and genomic RNA.. The band in lane H is due to hybridisation between sequences in the cloning sites of the pUC9 vector and the PBS molecular weight marker.
x lo3 and 7 x lo5 PFU/ml (samples 1, 2 and 3 respectively) and samples 4, 5 and 6 (virus negative in tissue culture infection assays) were amplified by RT/PCR using the 5’ primer pair (oligos A and B) and the products analysed by agarose gel electrophoresis in parallel with genomic EAV RT/PCR products. Seminal samples 1,2,3 and genomic EAV RNA produced a 169 bp cDNA band visualised under UV light, with samples 4, 5 and 6 producing no visible product (Fig. 3a). Hybridisation of a target-specific cDNA probe to a Southern blot of this gel (Fig. 3b) and to dot-blots (not shown) confirms semen samples l-3 as positive for virus. As calculated from initial seminal plasma titres the RT/PCR is currently sensitive enough to amplify visible quantities of viral cDNA from 60 PFU of EAV in a 100 ~1 sample. Only 10% of the PCR mix is loaded onto the agarose gel so the RT/PCR may be significantly more sensitive than this figure.
Discussion
Cell culture methods currently used for the diagnostic identification of EAV do not provide a specific diagnosis at the acute phase of illness or rapidly detect semen shedders. Our results indicate that the RT/PCR could replace cell
139
culture amplification of EAV from clinical material allowing rapid, specific viral identification. Similar tests using a reverse transcription step prior to cDNA amplification have been developed for several RNA viruses including rhinovirus (Gama et al., 1989), HIV (Byrne et al., 1988; Hart et al., 1988; Murakawa et al., 1988), rubella virus (Carman et al., 1989) and human picornaviruses (Hyypia et al., 1989). Our aim was to develop such a test for screening equine semen samples initially, but with the objective of identifying EAV in samples from as wide a range of clinical material as possible. The ever widening acceptability of the technique for clinical diagnosis is due to the extremely high sensitivity and fidelity of the PCR. A limiting factor in RT/PCR is the successful isolation of undamaged RNA from the clinical sample and specific priming of an efficient RT reaction. The addition of tRNA and glycogen in the initial RNA purification steps proved essential in attaining high quality, repeatable results in this RT/PCR. Similarly protection of RNA with an RNase inhibitor resulted in increasingly efficient RT (based on incorporation studies). The viral origin of bands visible in agarose gels was confirmed by hybridisation analysis of gel blots with radiolabelled probes from an EAV cDNA bank. Virusspecific bands were detected with cDNA probes after RT/PCR of sucrose gradient purified EAV which correlated exactly with the calculated size from direct sequencing of EAV-specific cDNA clones. The results obtained with seminal plasma indicate that the EAV RT/PCR is extremely sensitive: after 40 cycles a virus specific band was apparent in EAV +ve seminal plasma samples, one of which contained only 60 PFU of virus. Amongst the semen samples tested no false positives were detected either by PCR or in hybridisation confirmation of specificity, and all virus positive samples produced an EAV-specific cDNA band. The specificity, sensitivity, simplicity and reduced time scale of the EAV RT/PCR test indicates its feasability as a rapid laboratory test for the clinical identification of EAV in semen samples. Work is currently in progress on the analysis of larger numbers of semen and tissue samples to investigate the wider use of this test protocol and to fully assess its sensitivity in comparison with virus isolation in tissue culture.
Acknowledgements E.C. thanks the European Breeders Fund, and the New York Jockey Club for their continued support. E.C. was a recipient of a postdoctoral EMBO fellowship ALTF 131-1988.
References Byrne, B.C., Li, J.J., Sninsky, J. and Poiesz, B.J. (1988) Detection of HIV-l RNA sequences by in vitro DNA amplification. Nucl. Acids Res. 16, 4165.
140
Carman, W.F., Williamson, C., Cunliffe, B.A. and Kidd, A.H. (1989) Reverse transcription and subsequent DNA amplification of rubella virus. J. Virol. Methods 25, 21-30. Chirgwin, J.J., Przbyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294-5299. Doll, R.E., Knappenberger, E.R. and Bryans, J.T. (1957) An outbreak of abortion caused by equine arteritis virus. Cornell Vet. 47, 69-75. Gama, R.E., Hughs, P.J., Bruce, C.B. and Stanway, G. (1988) Polymerase chain reaction amplification of rhinovirus nucleic acids from clinical material. Nucl. Acids Res. 16, 9346. Hart, C., Schochetman, G., Spira, T., Lifson, A., Moore, J., Galphin, J., Sninsky, J.J. and Ott, C.Y. (1988) Direct detection of HIV RNA expression in seropositive persons. Lancet ii, 596-599. Hyypia, T., Auvinen, P. and Maaronen, M. (1989) Polymerase chain reaction for human picomaviruses. J. Gen. Virol. 70, 3261-3268. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory, New York. Mumford, J.A. (1985) Preparing for equine arteritis. Equine Vet. J. 17, (ill. Murakawa, G.J., Zaia, J.A., Spallone, P.A., Stephena, D.A., Kaplan, B.E., Wallace, R.B. and Rossi, J.J. (1988) Direct detection of HIV-l RNA from AIDS and ARC patient samples. DNA 7, 287-295. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Amheim, N. (1985) Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 487491. Timoney P.J. (1985) Epidemiological features of the 1984 outbreak of equine viral arteritis in the thoroughbred population in Kentucky, USA. Proc. Sot. Vet. Epidemiology and Preventative Medicine, Reading 1985, pp. 84-89. Timoney, P.J., McCollum, W.H., Roberts, A.W. and Murphy, T.W. (1986) Demonstration of the carrier state in naturally acquired equine arteritis virus infection in the stallion. Res. Vet. Sci. 41, 279-280. Timoney, P.J., McCollum, W.H., Murphy T.W., Roberts, A.W., Willard, J.G. and Carswell, G.D. (1987a) The carrier state in equine arteritis virus infection in the stallion with specific emphasis on the venereal mode of virus transmission. J. Reprod. Fert. Suppl. 35, 95-102. Timoney, P.J., McCollum W.H. and Roberts, A.W. (1987b) Detection of the carrier state in stallions persistently infected with equine arteritis virus. Proc. Am. Assoc. Equine Pratt. 32, 57-65. van Berlo, M.F., Horzinek, M.C. and van der Zeijst, B.A.M. (1980) Temperature-sensitive mutants of equine arteritis virus. J. Gen. Viral. 4, 97-104. van Berlo, M.F., Horzinek, M.C. and van der Zeijst, B.A.M. (1982) Equine arteritis virus-infected cells contain six polyadenylated virus-specific RNAs. Virology 118, 345-352. Westaway, E.G., Brinton, M.A., Gaidamovich, S.Y., Horzinek, M.C., Igarashi, A., Kaariainen, L., Lvov, D.K., Porterfield, J.S., Russell, P.K. and Trent, D.W. (1985) Togaviridae. Intervirology 24, 125-139.
lourd
133
Elsevier
VIRhfET 01073
Reverse transcription and cDNA amplification by the polymerase chain reaction of equine arteritis virus (EAV) Ewan D. Chimside’*’ and Willy J.M. Spaan’ ‘Insritute of Virolog Faculty of Veterinary Sciences, The Uhiversity of Utrecht, Utrechr, The NetherIan&
and PDepartment of Virology, Faculty of Medicine, Leiden, The Netherlands
(Accepted
2 July 1990)
Summary A technique is described for the amplification and specific identification of equine arteritis virus (EAV) nucleotide sequences. The polymerase chain reaction (PCR) was evaluated initially by amplification of cloned virus specific cDNA sequences prior to amplification of single-stranded (ss) cDNA produced by reverse transcription (RT) of viral genomic RNA. Three separate primer pairs were used for RT/PCR of EAV genomic RNA, each pair producing only one band in agarose gels of the predicted size from the genomic nucleotide sequence. The viral origin of cDNA products was confkned by hybridisation analysis with EAV-specific probes. RT/PCR analysis of clinical material indicates the methodology is sensitive enough to detect 600 pfu/ml EAV in seminal plasma. Polymerase chain reaction; Vii
diagnosis; Equine arteritis virus
Introduction Equine arteritis virus (EAV) is a positive single-stranded (ss) RNA virus classified as the sole member of the genus arterivirus within the family Togaviridae (Westaway et al., 1985). The only reported animal host for EAV is the horse in which the clinical signs of infection vary widely but generally include pyrexia, lacrimation, conjunctivitis, nasal discharge and oedema. The most severe form of natural infection occurred in Bucyrus, Ohio, in 1953 (Doll, Knappenberger and ‘Corrqortdence to: E.D. Chirnside, Equine Viilogy Kennett, Suffolk, CE38 7PN, U.K.
Unit, The Animal Health Trust, Lanwades Park,
0168-8510/9O/W3.50@ 1990 Elsevier Science Publishers B.V. (Biomedical Division)
134
Bryans, 1957), during which EAV caused abortions in 31 pregnant mares. In the most recent Kentucky outbreak, 159 horses had clinical signs of infection (Timoney, 1985), although no abortions were caused directly by EAV. During this outbreak a live attenuated vaccine (Arvac, Fort Dodge Laboratories) was administered to susceptible animals to contain the spread of infection. Consequently since 1984 mares bred to seropositive stallions in the USA have been vaccinated. A carrier state exists amongst stallions seropositive through infection (Timoney et al., 1986, 1987a,b), These stallions may infect’broodmares by a venereal route, as they shed virus in their semen and act as a reservoir for future disease outbreaks. Semen samples are therefore screened for EAV by virus isolation in cell culture. .This method is laborious and time consuming because at least two cycles in cell culture are needed for virus growth followed by identification in a n~u~isation test (Timoney et al., 1986) and this may be complicated by difficulties in culturing field isolates. Screening results also affect impo~/expo~ potential of valuable animals as the majority of countries are free of EAV ~~umford, 1985). In this paper we report the development of a rapid, sensitive and specific test for the detection of EAV based on the polymerase chain reaction (PCR) (Saiki et al., 1985) and indicate its potential use for clinical detection of EAV in seminal plasma.
Materials and Methods
A concen~ated stock of sucrose gradient purified EAV was prepared as described previously (van Berlo et al., 1980, 1982). The cloning strategy, isolation, identification and characterisation of EAV genomic cDNA clones 106, 535 and 586 (Fig. 1) used for PCR standardisation will be described elsewhere (Boon et al., submitted for publication). Oligonucleotides were synthesised using a Biosearch Model 8600 DNA synthesiser and purified by high performance liquid ~~omato~aphy. Oligonu~leotides 8, D and F have sequences ~ompIemen~ to the EAV genome (-ve oligos), oligos A, C and E are of genome polarity f-t-ve oligos). The genomic location and sequence of each primer pair is shown in Fig. 1. A.&IVreverse ~~sc~pt~ was purchased from Pharmacia, the~os~ble Taq polymerase from Cetus ~~pliTaq) and a-[32P@YI’P from Amersham. Equine seminal plasma samples were kindly donated by Dr P.J. Timoney (Gluck Equine Research Centre, Lexington, Kentucky U.S.A.). Aqueous solutions used for RNA extraction and reverse transcription were sterile and RNase free. Standard molecular biology techniques were as described by Maniatis et al. (1982).
135
AB
CD
1-1
PRltdfS7
E F
586
5
mimers 106
Product size
3
A
CACC.~TATACACTC~.~AAC~A
B
AGATCGACGACGATGGCAGT
2Omer 2Cmer
c
GATGTCTATGCTCCATCATT
2Omer
D
GGCGTAGGCTCCAATTGAA
1Qmef
E
GACTCACGTACACCGTCAGT
2Omer
F
TGGTTCCTGGGTGG
15W
169 276 133
bp bp bp
Fig. 1. Illustration of primer target sequences on the genome of EAV. The position of genomic cDNA clones 586 (leader sequence), 535 (polymerase gene), and 106 (nucleocapsid gene) is shown. Hmer sequences are displayed with the expected target size indicated.
RNA purification
Genomic RNA from sucrose gradient purified virions (van Berlo et al., 1982) and from seminal plasma were prepared by an adap~tion of the ~~i~urn isothiocyanate method of Chirgwin et al. (1979). To each 100 ~1 sample 5 ~1 of proteinase K (20 mg/ml) was added and the mixture incubated for 15 mm at 37°C followed by addition of 500 ~1 4 M guanidium isothiocyanate. The tube remained at RT for 10 min and the following was then added: 2 ,LL~ calf liver tRNA (1 mg/ml) and 60 j~l 2 M sodium acetate, pH 4.0, with mixing between additions. The sample was then extracted with phenol/chloroform and the RNA precipitated from a final volume of 600 ~1 by the addition of 1 ~1 glycogen (20 &nl) and 2.5 vol 96% EtOH. The tube was left for 16 h at -2OOC. After centrifugation the pellet was washed with 70% EtOH, the tube centrifuged and the RNA pellet dried under vacuum. Each pellet was dissolved in a final volume of 20 ~1 water. Reverse transcription The RNA was reverse transcribed in a final volume of 10 ~1 containing 5 1.11 RNA, 1 ~1 FCR buffer (Cetus), 1 ~1 supplementary buffer (400 mM Tris-Cl, pH 8.3,50 mM MgClz), 1 ~1 dNTB mix (10 mM each dNTP), 20 pmol -ve ohgo (B, D or E), 12.5 units RNAsin (Promega) and 5 units AMV reverse transcriptase. After 15 min incubation at 37OC the tube was transferred to a 42OC waterbath for a further 90 min to synthesise EAV ss cDNA.
136
Amplification by PCR Single-stranded cDNA (10 ~1) produced by RT and ds cDNA from a genomic pUC9 library were amplified according to the protocol of the supplier (Cetus). The amplification mix was incubated at 95OC for 5 min and the tube allowed to cool to room temp. Prior to thermal cycling, 2.5 units Amplitaq Taq polymerase were added and the 100 /-11samples overlaid with an equal volume of liquid paraffin to prevent evaporation. Forty cycles were performed; samples were incubated at 95OC for 1 min, 50°C for 1.5 min and 72OC for 2 min. The extension time during the final cycle was increased to 6 min to complete cDNA synthesis on all strands.
Analysis and detection of products After amplification 10 ~1 of product was electrophoresed through a 2% (w/v) agarose gel in TBE buffer (80 mM Tris-borate, 1 mM EDTA, according to Maniatis et al. 1982) containing 0.5 &ml ethidium bromide. DNA was visualised on a UV transilluminator (260 nm) and transferred to nitrocellulose by Southern blotting. The DNA was fixed to the filter by baking at 80°C for 2 h. After prehybridisation the filters were hybridised with 200 ng of a random labelled cDNA probe for 16 h at 42°C. After washing, the filters were exposed to X-ray film.
Results
Amplification of genomic cDNA clones Oligonucleotide primers for reverse transcription (RT) and subsequent cDNA amplification were selected on the basis of sequence information obtained from genomic EAV cDNA clones (Boon et al., submitted). Fig. 1 indicates the location of cDNA clones and oligonucleotide primers used in this study. The primer pairs were selected within anticipated conserved genomic sequences (A and B viral leader sequence; C and D 3’ end polymerase gene; E and F 3’ end nucleocapsid gene). Prior to the use of these three primer pairs in RT/PCR they were used to prime amplification of EAV cDNA by the polymerase chain reaction to determine their specificity for viral sequences. Each set of primers produced a discrete band in agarose gels (Fig. 2) which correlated well with the calculated size as determined from the EAV cDNA sequence (primers A and B 169 bp; C and D 276 bp; E and F 133 bp).
Amplification of genomic RNA The PCR is highly efficient and theoretically capable of synthesising >106 copies of product from a single target DNA sequence (Saiki et al., 1985). However, for RT/PCR the effectiveness of RNA purification and oligonucleotide spe-
137
1
2_ 3
4
5
6
7
Fig. 2. Two percent agarose gel of amplified EAV products. Amplification of EAV cDNA clones 583 (lane l), 535 (lane 2) and 106 (lane 3) using primer pairs A and B, C and D, E and F respectively (see Fig. 1). Lane 4, molecular weight marker PBS KS+ x Sau 3A (1031, 740, 341, 258, 189 bp). Lanes 5, 6 and 7 amplification of EAV gehomic RNA by RT/PCR with primers A and B, C and D, E and F, respectively.
citic priming of RT will be the ultimate limiting factors determining the specificity, and sensitivity of cDNA amplification. Genomic EAV RNA (1 ng) was used for RT by the -ve oligos B, D, and F followed by PCR amplification. Each of the three primer pairs successfully produced a discrete band of the expected size after 40 cycles of amplification (Fig. 2). These bands were recognised in Southern blots by 32P-labelled nick-probes specific for each amplified target sequence (not shown) which confirmed these bands as virus specific cDNA. Identification of products amplified from equine seminal plasma
Prior to work on EAV RNA amplification from seminal plasma the PCR buffer [Mg]*+ concentration was increased from 1.5 mM to 3.0 n&I, improving the efficiency of ss cDNA amplification of the genomic 5’ region with oligos A and B. Six equine seminal plasma samples with virus titres of 6 x 105, 2.5
138
ABCDEFG
H
ABCDEFGH
Fig. 3. Two percent agarose gel of amplified seminal plasma products. (a) Lane A EAV genomic RNA, lanes B-G seminal plasma samples l-6, lane H molecular weight markers (PBS KS+ x Sau3A). (b) Autoradiograph of the amplified EAV cDNA. The samples in Figure 3a were transferred to nitrocellulose membrane and hybridised with an EAV-specific cDNA probe (clone 586 x Pstl x PvuII 500 bp fragment). The only DNA showing hybridisation is the 169nt band present in semen samples 1, 2 and 3 (all virus isolation +ve) and genomic RNA.. The band in lane H is due to hybridisation between sequences in the cloning sites of the pUC9 vector and the PBS molecular weight marker.
x lo3 and 7 x lo5 PFU/ml (samples 1, 2 and 3 respectively) and samples 4, 5 and 6 (virus negative in tissue culture infection assays) were amplified by RT/PCR using the 5’ primer pair (oligos A and B) and the products analysed by agarose gel electrophoresis in parallel with genomic EAV RT/PCR products. Seminal samples 1,2,3 and genomic EAV RNA produced a 169 bp cDNA band visualised under UV light, with samples 4, 5 and 6 producing no visible product (Fig. 3a). Hybridisation of a target-specific cDNA probe to a Southern blot of this gel (Fig. 3b) and to dot-blots (not shown) confirms semen samples l-3 as positive for virus. As calculated from initial seminal plasma titres the RT/PCR is currently sensitive enough to amplify visible quantities of viral cDNA from 60 PFU of EAV in a 100 ~1 sample. Only 10% of the PCR mix is loaded onto the agarose gel so the RT/PCR may be significantly more sensitive than this figure.
Discussion
Cell culture methods currently used for the diagnostic identification of EAV do not provide a specific diagnosis at the acute phase of illness or rapidly detect semen shedders. Our results indicate that the RT/PCR could replace cell
139
culture amplification of EAV from clinical material allowing rapid, specific viral identification. Similar tests using a reverse transcription step prior to cDNA amplification have been developed for several RNA viruses including rhinovirus (Gama et al., 1989), HIV (Byrne et al., 1988; Hart et al., 1988; Murakawa et al., 1988), rubella virus (Carman et al., 1989) and human picornaviruses (Hyypia et al., 1989). Our aim was to develop such a test for screening equine semen samples initially, but with the objective of identifying EAV in samples from as wide a range of clinical material as possible. The ever widening acceptability of the technique for clinical diagnosis is due to the extremely high sensitivity and fidelity of the PCR. A limiting factor in RT/PCR is the successful isolation of undamaged RNA from the clinical sample and specific priming of an efficient RT reaction. The addition of tRNA and glycogen in the initial RNA purification steps proved essential in attaining high quality, repeatable results in this RT/PCR. Similarly protection of RNA with an RNase inhibitor resulted in increasingly efficient RT (based on incorporation studies). The viral origin of bands visible in agarose gels was confirmed by hybridisation analysis of gel blots with radiolabelled probes from an EAV cDNA bank. Virusspecific bands were detected with cDNA probes after RT/PCR of sucrose gradient purified EAV which correlated exactly with the calculated size from direct sequencing of EAV-specific cDNA clones. The results obtained with seminal plasma indicate that the EAV RT/PCR is extremely sensitive: after 40 cycles a virus specific band was apparent in EAV +ve seminal plasma samples, one of which contained only 60 PFU of virus. Amongst the semen samples tested no false positives were detected either by PCR or in hybridisation confirmation of specificity, and all virus positive samples produced an EAV-specific cDNA band. The specificity, sensitivity, simplicity and reduced time scale of the EAV RT/PCR test indicates its feasability as a rapid laboratory test for the clinical identification of EAV in semen samples. Work is currently in progress on the analysis of larger numbers of semen and tissue samples to investigate the wider use of this test protocol and to fully assess its sensitivity in comparison with virus isolation in tissue culture.
Acknowledgements E.C. thanks the European Breeders Fund, and the New York Jockey Club for their continued support. E.C. was a recipient of a postdoctoral EMBO fellowship ALTF 131-1988.
References Byrne, B.C., Li, J.J., Sninsky, J. and Poiesz, B.J. (1988) Detection of HIV-l RNA sequences by in vitro DNA amplification. Nucl. Acids Res. 16, 4165.
140
Carman, W.F., Williamson, C., Cunliffe, B.A. and Kidd, A.H. (1989) Reverse transcription and subsequent DNA amplification of rubella virus. J. Virol. Methods 25, 21-30. Chirgwin, J.J., Przbyla, A.E., MacDonald, R.J. and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18, 5294-5299. Doll, R.E., Knappenberger, E.R. and Bryans, J.T. (1957) An outbreak of abortion caused by equine arteritis virus. Cornell Vet. 47, 69-75. Gama, R.E., Hughs, P.J., Bruce, C.B. and Stanway, G. (1988) Polymerase chain reaction amplification of rhinovirus nucleic acids from clinical material. Nucl. Acids Res. 16, 9346. Hart, C., Schochetman, G., Spira, T., Lifson, A., Moore, J., Galphin, J., Sninsky, J.J. and Ott, C.Y. (1988) Direct detection of HIV RNA expression in seropositive persons. Lancet ii, 596-599. Hyypia, T., Auvinen, P. and Maaronen, M. (1989) Polymerase chain reaction for human picomaviruses. J. Gen. Virol. 70, 3261-3268. Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory, New York. Mumford, J.A. (1985) Preparing for equine arteritis. Equine Vet. J. 17, (ill. Murakawa, G.J., Zaia, J.A., Spallone, P.A., Stephena, D.A., Kaplan, B.E., Wallace, R.B. and Rossi, J.J. (1988) Direct detection of HIV-l RNA from AIDS and ARC patient samples. DNA 7, 287-295. Saiki, R.K., Scharf, S., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and Amheim, N. (1985) Enzymatic amplification of B-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230, 487491. Timoney P.J. (1985) Epidemiological features of the 1984 outbreak of equine viral arteritis in the thoroughbred population in Kentucky, USA. Proc. Sot. Vet. Epidemiology and Preventative Medicine, Reading 1985, pp. 84-89. Timoney, P.J., McCollum, W.H., Roberts, A.W. and Murphy, T.W. (1986) Demonstration of the carrier state in naturally acquired equine arteritis virus infection in the stallion. Res. Vet. Sci. 41, 279-280. Timoney, P.J., McCollum, W.H., Murphy T.W., Roberts, A.W., Willard, J.G. and Carswell, G.D. (1987a) The carrier state in equine arteritis virus infection in the stallion with specific emphasis on the venereal mode of virus transmission. J. Reprod. Fert. Suppl. 35, 95-102. Timoney, P.J., McCollum W.H. and Roberts, A.W. (1987b) Detection of the carrier state in stallions persistently infected with equine arteritis virus. Proc. Am. Assoc. Equine Pratt. 32, 57-65. van Berlo, M.F., Horzinek, M.C. and van der Zeijst, B.A.M. (1980) Temperature-sensitive mutants of equine arteritis virus. J. Gen. Viral. 4, 97-104. van Berlo, M.F., Horzinek, M.C. and van der Zeijst, B.A.M. (1982) Equine arteritis virus-infected cells contain six polyadenylated virus-specific RNAs. Virology 118, 345-352. Westaway, E.G., Brinton, M.A., Gaidamovich, S.Y., Horzinek, M.C., Igarashi, A., Kaariainen, L., Lvov, D.K., Porterfield, J.S., Russell, P.K. and Trent, D.W. (1985) Togaviridae. Intervirology 24, 125-139.