Revisiting the age, evolutionary history and species level diversity of the genus Hydra (Cnidaria: Hydrozoa)

Molecular Phylogenetics and Evolution 91 (2015) 41–55

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev

Revisiting the age, evolutionary history and species level diversity of the genus Hydra (Cnidaria: Hydrozoa) q Martin Schwentner a,b, Thomas C.G. Bosch a,⇑ a b

Zoological Institute and Interdisciplinary Centre Kiel Life Science, Christian-Albrechts-University of Kiel, 24098 Kiel, Germany Museum of Comparative Zoology, Harvard University, Cambridge, MA 02138, USA

a r t i c l e

i n f o

Article history: Received 12 November 2014 Revised 13 May 2015 Accepted 15 May 2015 Available online 23 May 2015 Keywords: Divergence times Evolutionary history Hydra Molecular clock Molecular systematics Phylogeny

a b s t r a c t The genus Hydra has long served as a model system in comparative immunology, developmental and evolutionary biology. Despite its relevance for fundamental research, Hydra’s evolutionary origins and species level diversity are not well understood. Detailed previous studies using molecular techniques identified several clades within Hydra, but how these are related to described species remained largely an open question. In the present study, we compiled all published sequence data for three mitochondrial and nuclear genes (COI, 16S and ITS), complemented these with some new sequence data and delimited main genetic lineages (=hypothetical species) objectively by employing two DNA barcoding approaches. Conclusions on the species status of these main lineages were based on inferences of reproductive isolation. Relevant divergence times within Hydra were estimated based on relaxed molecular clock analyses with four genes (COI, 16S, EF1a and 28S) and four cnidarians fossil calibration points All in all, 28 main lineages could be delimited, many more than anticipated from earlier studies. Because allopatric distributions were common, inferences of reproductive isolation often remained ambiguous but reproductive isolation was rarely refuted. Our results support three major conclusions which are central for Hydra research: (1) species level diversity was underestimated by molecular studies; (2) species affiliations of several crucial ‘workhorses’ of Hydra evolutionary research were wrong and (3) crown group Hydra originated 200 mya. Our results demonstrate that the taxonomy of Hydra requires a thorough revision and that evolutionary studies need to take this into account when interspecific comparisons are made. Hydra originated on Pangea. Three of four extant groups evolved 70 mya ago, possibly on the northern landmass of Laurasia. Consequently, Hydra’s cosmopolitan distribution is the result of transcontinental and transoceanic dispersal. Ó 2015 Elsevier Inc. All rights reserved.

1. Introduction Since its first discovery in 1702 and its use in experimental studies in the early 18th century (van Leeuwenhoek, 1702; Trembley, 1744), Hydra has been an important model organism for studies on regeneration, development, pattern formation, symbiosis and more recently also for genome evolution and innate immunity. As a result of this work, and because Hydra belongs to the basal animal phylum Cnidaria, studies on Hydra have contributed significantly to our understanding of the origin and evolution of developmental genes and pathways, the evolution of the immune system and the concept of the metaorganisms or holobiont (Bosch, 2013, 2014; David, 2012; Franzenburg et al., 2013;

q

This paper has been recommended for acceptance by Bernd Schierwater.

⇑ Corresponding author. Tel.: +49 0431 880 4169.

E-mail address: [email protected] (T.C.G. Bosch). http://dx.doi.org/10.1016/j.ympev.2015.05.013 1055-7903/Ó 2015 Elsevier Inc. All rights reserved.

Fujisawa and Hayakawa, 2012; Galliot, 2012; Grimmelikhuijzen and Hauser, 2012; Holstein, 2012; Khalturin et al., 2009; Lasi et al., 2010; Meinhardt, 2012; Nebel and Bosch, 2012; Shimizu, 2012; Steele et al., 2011; Tanaka and Reddien, 2011; Technau and Steele, 2011; Watanabe et al., 2009). One of the most important tools for identifying relevant genes is the genome of Hydra magnipapillata (Chapman et al., 2010) and the ever-increasing transcriptome datasets of other Hydra and cnidarian species (http:// www.compagen.org). Despite Hydra’s long history as a model organism for animal evolution, key features of the evolution of Hydra itself such as the evolutionary origins of Hydra and its species level diversity are still not well understood. As a consequence, the pace and timeframe of crucial evolutionary processes and novelties, like the emergence of numerous orphan genes specific for Hydra or some of its species (Khalturin et al., 2008, 2009), cannot be assessed. Thus, as Hydra species differ in morphology, development,

42

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

physiology, and ecology (Campbell, 1983; Hemmrich et al., 2007; Koizumi, 2007), the lack of a solid species level taxonomy hampers research on species specific differences in gene expression and development (Khalturin et al., 2008; Thomsen and Bosch, 2006). Moreover, in every animal species divergence in host genes seems positively correlated with differentiation of the microbiome (Fraune and Bosch, 2007; McFall-Ngai et al., 2013; Brucker and Bordenstein, 2013; Bosch, 2014). Parallel cladograms between the host phylogeny and the microbiome relationships is one test of a pattern termed ‘‘phylosymbiosis’’ (Brucker and Bordenstein, 2012, 2013). Each Hydra species is equipped with a unique composition of antimicrobial peptides (Franzenburg et al., 2013). Loss-of-function experiments have shown that species-specific AMPs sculpture species-specific bacterial communities by selecting for co-evolved bacterial partners (Franzenburg et al., 2013). Current lack of information on precise phylogenetic placement of the Hydra species, however, makes it impossible to investigate the diversity of the Hydra specific microbiota within a co-evolutionary framework. Finally, unambiguous phylogenetic placement and species identification of commonly used lab strains of Hydra is crucial to ascertain the reproducibility of experiments (requiring the usage of identical species) and to allow intra- and interspecific comparisons. Resolving the evolutionary origins of Hydra has been impeded by the absence of fossilized remains. Recent phylogenetic analyses unambiguously placed Hydra within the hydrozoan taxon Aplanulata (Nawrocki et al., 2013), but the age of Hydra and the timing of its diversifications are largely unknown. Different molecular clock approaches diverged greatly in their estimates: while the age of the viridissima group was estimated to be 156–174 million years based on the divergence of its symbiotic Chlorella (Kawaida et al., 2013), the age of crown group Hydra was estimated to be only 60 million years based on assumed substitution rates for COI and 16S (Martínez et al., 2010). The taxonomy of Hydra species is characterized by relatively large numbers of synonymizations and wrongly applied species names (e.g. Hydra attenuata; see Campbell, 1989). Well accepted and supported by molecular phylogenetic studies (Hemmrich et al., 2007; Kawaida et al., 2010; Martínez et al., 2010) is the distinction of four species groups within Hydra – viridissima group (the ‘green’ Hydra featuring symbiotic Chlorella), braueri group, oligactis group and vulgaris group – which were outlined by Schulze (1917) and Campbell (1987). Over the last centuries 80 species of Hydra have been described (Jankowski et al., 2008). Many of these species have been subsequently synonymized and the taxonomic status of others is still controversial (Campbell, 1987). For example, Jankowski et al. (2008) suggested less than 15 valid species of Hydra whereas the World Register of Marine Species lists 40 (Schuchert, 2014). In the last years several molecular phylogenetic studies shed light on the diversity within Hydra (Campbell et al., 2013; Hemmrich et al., 2007; Kawaida et al., 2010; Martínez et al., 2010; Reddy et al., 2011; Wang et al., 2012). The most detailed studies regarding the number of studied individuals (=strains) were those by Kawaida et al. (2010) and Martínez et al. (2010). However, since these two studies were published nearly simultaneously they could not take each other’s data into account and later studies included small fractions of the previously published data only. Apart from a few shared lab strains, all of these studies were based on different sets of strains from different species and geographic origins, limiting comparability among studies. Furthermore, despite identifying several monophyletic clades within Hydra and within its four groups, few explicit conclusions regarding the validity of Hydra species were drawn. For example, Kawaida et al. (2010) identified three monophyletic ‘‘sub-groups’’ within the vulgaris group, but it remained unclear whether these

would represent three species or three clades of several species each. Martínez et al. (2010) recovered eight morphologically identified species as monophyletic (H. viridissima, H. hymanae, H. utahensis, H. circumcincta, H. oligactis, H. oxycnida, H. canadensis, and H. vulgaris), of which H. viridissima was subdivided into several clades, H. circumcincta into two clades and H. vulgaris into five clades matching geographic regions. Again, for most of these clades their species status was not discussed, the exception being the North American vulgaris group species – H. littoralis, H. carnea, and H. vulgaris AEP – which were believed to belong to a single species. The latter would have far reaching consequences for evolutionary studies on Hydra as H. carnea and H. vulgaris AEP are commonly used lab strains. Hydra vulgaris AEP is an artificially generated strain from which all transgenic Hydra are derived (Wittlieb et al., 2006). The Hydra vulgaris AEP strain originated from crossing two different Hydra vulgaris strains from North America (Martin et al., 1997), though Martínez et al. (2010) stated that the parental strains resembled H. carnea and H. littoralis morphologically. Similarly, two other important ‘workhorses’ – H. magnipapillata and the European H. vulgaris – are genetically very similar and were assigned to the same clade (Kawaida et al., 2010; Martínez et al., 2010). To obtain a comprehensive overview of the species diversity and the evolutionary origins of Hydra, we compiled all available sequence data of Hydra from GenBank and BOLD for those genes with the highest coverage of species and individuals (e.g. those published by Campbell et al., 2013; Hemmrich et al., 2007; Kawaida et al., 2010; Martínez et al., 2010; Reddy et al., 2011 and Wang et al., 2012). This extensive dataset was complemented with some newly sequenced strains (mainly of the viridissima group). Species diversity was assessed by a combination of phylogenetic and genetic distance analyses. Such analyses have become very popular tools for studies of species diversities and are commonly subsumed under the term DNA barcoding. However, whether entities delimited by such approaches indeed represent distinct species is strongly dependent on the applied species concept (Agapow et al., 2004; Schwentner et al., 2011; Tan et al., 2008). For example, following the Phylogenetic Species Concept (Mishler and Theriot, 2000), which defines species as the ‘‘smallest monophyletic groups worthy of formal recognition’’, all entities delimited by DNA barcoding can be treated as species, if species delimitation is based on phylogenetic analysis. The Biological Species Concept (Mayr, 1942), on the other hand, requires reproductive isolation among species. Reproductive isolation can be inferred with barcoding techniques in an integrative framework, if the respective species are consistently differentiated by mitochondrial and an independent marker system – like nuclear markers or morphology – and occur in sympatry (see also Schwentner et al., 2015). As a first step, we identified ‘main lineages’ (=hypothetical species) by independently analyzing three molecular markers: mitochondrial COI (cytochrome c oxidase subunit I), mitochondrial 16S and nuclear ITS region (internal transcribed spacer; spanning ITS1, 5.8S and ITS2). Two different analytical approaches were employed for each marker: Automatic Barcode Gap Discovery (ABGD; Puillandre et al., 2011), which identifies barcoding gaps in genetic distance matrixes, and the general mixed Yule coalescent model (GMYC; Pons et al., 2006), which identifies species thresholds based on changes in branching rates in a phylogenetic tree. The results are then evaluated to identify main lineages, which are consistently delimited across markers and analytical methods. These were then assessed under the different species concepts. The age of crown group Hydra (monophylum comprising all extant and ‘internal’ extinct species) and the timing of diversification events within Hydra were assessed by molecular clock analyses based on four molecular markers – COI, 16S, EF1a

43

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

(elongation factor 1-alpha) and 28S – and previously reported fossilized cnidarians as calibration points. These results establish both a molecular phylogeny and a biogeographic history of the genus Hydra. 2. Material and methods 2.1. DNA isolation, PCR amplification, sequencing and alignments Total genomic DNA of several strains, which are cultured permanently in the Bosch lab (Table 1), was isolated using the DNeasy Blood and Tissue kit (Qiagen, Germany) following manufacturer’s instructions. Depending on their sizes, one or two individuals (clones) were used per extraction. PCR reactions of all gene fragments comprised 4 ll of each primer with 10 lM each (Table 2), 0.4 ll dNTPs (100 mM each), 8 ll 5 Colorless GoTaq Reaction Buffer (Promega) and 0.2 ll GoTaq polymerase (Promega) in a total volume of 40 ll. PCR amplifications had an initial denaturation step at 94 °C for 2 min; followed by 35 cycles of 2 min at 94 °C, 1 min annealing (COI and 16S: 47 °C, ITS: 55 °C) and 1:30 min at 72 °C (16S 1 min) and a final elongation step of 10 min at 72 °C. Because of the length of the amplified product internal primer were derived for ITS to ensure sequencing of the whole length (Table 2). Annealing temperature was 52 °C for the internal ITS primer. Success of PCR was assessed on 1.5% TAE/Agarose gel stained with peqGreen DNA/RNA Dye (Peqlab). PCR product purification and Sanger sequencing were performed by the Institute of Clinical Molecular Biology in Kiel. Each gene fragment was sequenced bi-directionally using the same primers as for the PCR amplifications. Sequences were manually corrected and submitted to GenBank (accession numbers are provided in Table 1). Alignments for each of the gene fragments including all sequences available from GenBank and BOLD were computed with MAFFT 7.1.4 (Katoh and Standley, 2013) using standard settings. The ITS alignment featuring all available Hydra sequences contained a very large fraction of Indels which greatly reduced the quality of the alignment. Therefore, ITS alignments were created separately for each of the four main groups of Hydra, whose reciprocal monophyly is well supported (e.g. Hemmrich et al., 2007; Kawaida et al., 2010; Martínez et al., 2010). 2.2. Identification of main genetic lineages Main lineages were delimited based on the three markers for which large datasets were available: COI, 16S and ITS. Each marker was analyzed independently; for ITS all analyses were performed independently for each of the main groups (see Section 2.1).

Strains, for which two or all three markers were available, facilitated the identification of consistently delimited main lineages across markers. Phylogenetic trees were reconstructed including all available sequences of each marker to assess the monophyly of potential main lineages. Trees were reconstructed with MrBayes 3.2 (Ronquist and Huelsenbeck, 2003) with four chains of for 6 ⁄ 106 generations sampling every 1200th generation. The first 10% were discarded as burn-in. The best fitting model was determined with MEGA6 (Tamura et al., 2013). All trees were visualized with FigTree v1.4.2 (Rambaut, 2014). Main lineages were first assessed using the general mixed Yule coalescent model (GMYC; Pons et al., 2006), which partitions an ultrametric tree by identifying changes in branching rates. The required ultrametric trees were generated with BEAST version 2.1.3 (Bouckaert et al., 2014) employing a Yule speciation prior and a relaxed molecular clock. Analyses were run for 5 ⁄ 107 generations, sampling every 5000th generation and discarding the first 10% as burn-in. Trees were annotated with TreeAnnotator v2.1.2 (part of the BEAST package). The single threshold GMYC model was then fitted onto the resulting tree using the GMYC web interface (http://species.h-its.org/gmyc/). As a second method to delimit main lineages the Automated Barcode Gap Discovery (ABGD; Puillandre et al., 2012) was employed. Based on a pairwise genetic distance matrix sequences are partitioned into main lineages, which are separated by a potential barcoding gap. Across the whole range of genetic distances more than one putative barcoding gap (and respective partition) may be identified. Herein we focused on those derived barcoding gaps that resulted in similar partitions across markers and which agreed with known levels of intra- and interspecific genetic distances (Dawson, 2005a,b; Holland et al., 2004; Laakmann and Holst, 2014; Moura et al., 2008; Ortman et al., 2010; Pontin and Cruickshank, 2012; Schroth et al., 2002). Genetic distances were calculated as uncorrected p-distances with MEGA6 (Table 3). The web interface of ABGD (http://wwwabi.snv.jussieu.fr/public/abgd/) was used, setting the number of steps to 100 and the relative gap width to 0.1; otherwise standard settings were kept. 2.3. Molecular clock analyses Molecular clock analyses were performed with the BEAST package version 2.1.3 (Bouckaert et al., 2014) using two mitochondrial (COI and 16S) and two nuclear (EF1a and 28S) markers. The ITS region was not used because of difficulties aligning sequences of distantly related cnidarian species. For each main lineage one sequence per gene was included, as far as possible these were from

Table 1 Strains newly sequenced for this study. Species names refer to species identification prior to molecular genetic analyses, species assignment after molecular analyses provided in brackets. Locality details are provided as far known, GenBank accession numbers are provided for all sequenced gene fragments. Specimen/strain

Species

Hy1 NC64 Hy2 Würzburg Hy3 M9 Hy4 A250 Hy5 Husum Hy6 M120 Hy7 M10 Hy8 A99 Hy10 A14c Hy11 reg16–105 Hy16 reg-16 Hy17 St. Petersburg Hy18 L7 Hy19 Pohlsee Hy20 M7

H. H. H. H. H. H. H. H. H. H. H. H. H. H. H.

viridissima (6; H. sinensis) viridissima (6; H. sinensis) viridissima (5) viridissima (4) viridissima (3) viridissima (5) viridissima (5) viridissima (3) viridissima (6; H. sinensis) magnipapillata (H. vulgaris 7) magnipapillata (H. vulgaris 7) oligactis robusta oxycnida circumcincta

Locality details

Aquarium in Jerusalem, Israel New South Wales, Australia Husum, Germany Madagascar Japan Queensland, Australia Japan Japan St. Petersburg, Russia Pohlsee near Kiel, Germany Japan

COI

16S

ITS

KP895128 KP895121 KP895122 KP895123 KP895124 KP895125 KP895126 KP895127 KP895129 – KP895117 KP895118 KP895119 KP895120 –

KP895104 KP895110 KP895111 KP895112 KP895113 KP895114 KP895115 KP895116 KP895105 – KP895106 KP895107 KP895108 KP895109 –

KP895137 KP895136 KP895135 KP895138 KP895142 KP895140 KP895141 KP895143 KP895139 KP895130 KP895131 KP895133 – KP895134 KP895132

44

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55 Table 2 List of all primer used in this study and its respective reference. COI CO1.Dawson.F.LCOjf CO1.Folmer.R.HC02198

GGTCAACAAATCATAAAGATATTGGAAC TAAACTTCAGGGTGACCAAAAAATCA

Martínez et al. (2010) Martínez et al. (2010)

16S rRNA Forward Reverse

TCGACTGTTTACCAAAAACATAGC ACGGAATGAACTCAAATCATGTAAG

Martínez et al. (2010) Martínez et al. (2010)

ITS ITS_18S ITS_28S ITS_rev_intern

CACCGCCCGTCGCTACTACCGATTGAATGG CCGCTTCACTCGCCGTTACTAGGGGAATCC GGACARAAGCRAGTTGAGCCTTCCG

Martínez et al. (2010) Martínez et al. (2010) This study

the same individuals. Only Hydra main lineages for which at least two of these genes were available were included in the analyses. Several other cnidarians and the sponge Amphimedon queenslandica were included to employ calibration points derived from known fossils to date the resulting phylogenetic tree. Care was taken to include members of all relevant cnidarians main taxa, with special emphasis of representatives of the Aplanulata. Hydra is thought to belong to Aplanulata (Nawrocki et al., 2013) and including as many other Aplanulata as possible is important to infer the potential sister group of Hydra and to assess Hydra’s divergence time. Because large sections with numerous Indels were present in the alignments of 16S and 28S Gblocks (Talavera and Castresana, 2007) was used to identify and removed ambiguously aligned stretches of the alignment. Gblocks was run with standard settings of the online version with all ‘less stringent’ parameters enabled. This led to the removal of 25% of the 16S and 7% of the 28S alignment. Calibration points were chosen based on the oldest known fossil cnidarians assigned to extant cnidarian main taxa. Because these fossils may represent the stem group of the respective main taxa, we calibrated the split between the taxon represented by the fossil and its putative sister group included in the phylogenetic analysis and used the ages of these fossils as the minimum age for the respective calibration points. This conservative coding strategy should result in underestimations of divergence times rather than overestimations. The calibration points were: 570 mya for all studied Cnidaria (cnidarian microfossils like putative embryos; see Chen et al., 2002; Xiao et al., 2000), 540 mya for the split between Hydrozoa and Scyphozoa (see Waggoner and Collins (2004), Young and Hagadorn (2010) suggested an age of only 505 mya, but Cartwright and Collins (2007) identified numerous crown groups of both taxa for this time period, suggesting an earlier diversification); 500 mya for Hydrozoa (see Young and Hagadorn, 2010) and 450 mya for the split between Leptomedusa and Anthomedusa (see Young and Hagadorn, 2010). All these were assigned uniform priors with the maximum age constrained to 640 mya. The maximum age is based on the earliest fossilized metazoan biomarkers (i.e. of sponges) in the late Cryozoan (Love et al., 2009) and coincides with the estimated divergence time between sponges and cnidarians (Peterson et al., 2004). Other studies employing molecular clocks suggested earlier origins of Cnidaria (up to 2000 mya), which is not mirrored in the fossil record (Park et al., 2012; Waggoner and Collins, 2004; see also Peterson et al., 2004). We did not employ such extreme ages as these may lead to overestimations of Hydra divergence times. Four nodes were constrained as monophyletic – i.e. Cnidaria, Hexacorallia, Hydrozoa and Medusozoa. To assess the impact of the different genes and taxa included, we re-ran the analyses with two different partitions: (1) including the same taxa but only the two mitochondrial markers (COI and 16S) and (2) including all four genes but reducing the number of Hydra and other Aplanulata species (including only H. viridissima 3, H. vulgaris 4, H. circumcincta 1,

Candelabrum cocksii and Ralpharia gorgoniae). The first of these additional analyses was performed to assess whether the mitochondrial genes estimates deviate from estimates of the whole data set (a separate analysis for the nuclear genes was not performed as the amount of missing data was higher for these genes). The number of taxa was reduced to ascertain that the overrepresentation of Aplanulata and especially of Hydra species in the data set did not affect divergence time estimates. All molecular clock analyses were performed with BEAST version 2.1.3 employing a relaxed log normal clock with a Yule prior. The best fitting substitution model was determined for each gene with MEGA6, these was the GTR + I + G for COI, 28S and EF1a and the GTR + G for 16S. The MCMC chains were run twice for 100 million generations, storing every 5000th trees (20.000 trees in total). The tree files of both runs were combined with LogCombiner (part of the BEAST package). Convergence of runs was assessed with Tracer v1.6 (Rambaut et al., 2013) and trees were generated with the burn-in removed with TreeAnnotator v2.1.2 (part of the BEAST package). The resulting trees were visualized with FigTree v1.4.2 (Rambaut, 2014).

3. Results 3.1. Resolving phylogenetic relationships of the Hydra group The phylogenetic analyses of COI and the combined data set support the four Hydra groups: viridissima group, braueri group, oligactis group and vulgaris group (Figs. 1 and 2; Supplement Figs. 1–4). Only the analyses of 16S alone did not fully recover these groups, probably due to overall lower resolution of the tree (Fig. 2, Supplement Fig. 2). viridissima group: Within the viridissima group six main genetic lineages were delimited by COI and 16S with H. viridissima 5 and 6 each being further subdivided in analyses of ITS (Figs. 1 and 2; Supplement Figs. 1, 2 and 4). Furthermore, some individuals of these two main lineages shared an identical ITS sequence (Tables 3 and 4) and H. viridissima 5 and 6 are the main lineages with the lowest interlineage distances in COI (3.9–4.1%) and 16S (1.5– 3.0%), while all others exceed 10.5% and 3.5% in this group, respectively. braueri group: Four main lineages were consistently differentiated within the braueri group: H. circumcincta 1, H. circumcincta 2, H. hymanae and H. utahensis (Figs. 1 and 2; Supplement Figs. 1, 2 and 4; Tables 3 and 4). The H. circumcincta 1 lineage was further split into an European and an Alaskan lineage (the latter represented by only a single individual) by ABGD of 16S (threshold below 1.4%) and COI (threshold below 1.3%) and GMYC of COI. However, the ITS sequence of this individual was well nested within the other sequences and was not differentiated. Hydra hymanae was split into two lineages in the GMYC of 16S, but not in any other analysis (Table 4).

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

45

Table 3 Genetic distances among main lineages. Uncorrected p-distances for each single marker are reported within (along diagonal) and among (above diagonal) all main lineages of (a) viridissima group, (b) oligactis group, (c) braueri group and (d) vulgaris group. From top to bottom in each cell: COI, 16S and ITS (see also bottom let of each table). Main lineages pairs that occur sympatrically (i.e. the same region) are highlighted in gray. Individuals identified as H. oligactis that were genetically closer related to H. robusta were assigned to H. robusta in this representation. H. vulgaris strain 1005 is not included in this table due to uncertainties regarding its assignment. It shares an identical COI sequence with H. vulgaris 4 (H. carnea) but its ITS sequence differs by 1.9–2.5% from other members of this group and >1.1% from members of H. vulgaris 5 and 6. H. vulgaris 7 is probably the ‘true’ H. vulgaris Pallas (1766), H. vulgaris 4 the ‘true’ H. carnea Agassiz (1851) and H. viridissima 6 the ‘true’ H. sinensis Wang et al. (2009).

(continued on next page)

46

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

Table 3 (continued)

oligactis group: Within the oligactis group H. canadensis and H. oxycnida were well differentiated from each other and all other main lineages, but were each further subdivided in a few analyses (Figs. 1 and 2; Supplement Figs. 1, 2 and 4; Table 4). Hydra robusta was usually not delimited as a separate species, but grouped with some or all representatives of H. oligactis. Even though they did not share identical DNA sequences, the observed genetic distances between representatives of both nominal species were lower than among most other main lineages (Table 3). vulgaris group: The vulgaris group is by far the most complex and diverse group. 14 different main lineages were differentiated, but not all three markers were available for each of the main lineages (Figs. 1 and 2; Supplement Figs. 1–3; Tables 3 and 4). Most individuals of this group were originally assigned to the species H. vulgaris. Of the other species only H. polymorphus and H. zhujiangensis were consistently differentiated. Individuals identified as H. carnea grouped with H. litoralis and some H. vulgaris individuals (main lineage H. vulgaris 4; this main lineage includes the H. vulgaris AEP strain); Japanese H. magnipapillata and H. japonica clustered with European and South African H. vulgaris and H. attenuata individuals (main lineage H. vulgaris 7). There is only one case of incongruence among the three studied genetic markers in the vulgaris group and this related to main lineages H. vulgaris 4, 5 and 6 which all occur in North America. One individual (strain 1005a from Wyoming) is well nested within H. vulgaris 4 in the analyses of COI and 16S, but in ITS this individual is in a sister group relationship to H. vulgaris 5 (Supplement Figs. 1–3). The closer relationship to H. vulgaris 5 is mirrored in genetic distances of ITS which are 1.9–2.5% toward all other member of H. vulgaris 4 and 1.1–1.5% to members of H. vulgaris 5 and 1.4–1.8% toward H. vulgaris 6 (for H. vulgaris 6 only ITS is available). Among all three of these lineages genetic distances in ITS are lower than among most other main lineages, however, this is not the case for COI and 16S (Tables 3 and 4).

Several main lineages have been recorded only from geographically restricted areas: e.g. H. vulgaris 1, 2 and 3 from South America; H. vulgaris 10 from South Africa; H. vulgaris 9 from Iceland; H. vulgaris 11 and 12 from Australia and New Zealand; H. vulgaris 8 from Switzerland (Supplement Figs. 1–3). As a consequence, only few main lineages of the vulgaris group can be considered to occur sympatrically (Table 3). Main lineages H. vulgaris 4 & 7 as well as H. vulgaris 7 & 10 and H. vulgaris 1 & 2 appear to be sympatrically distributed and all of these lineage pairs are consistently differentiated in the mitochondrial and nuclear genes (Supplement Figs. 1–3; Tables 3 and 4), thus there is no indication of on-going reproduction among them. 3.2. Establishing a time scale for Hydra evolution We used known Cnidarian fossils (e.g. Chen et al., 2002; Love et al., 2009; Waggoner and Collins, 2004; Xiao et al., 2000; Young and Hagadorn, 2010) as calibration points to infer divergence times among Hydra lineages and accounted for rate heterogeneity among lineages by applying relaxed-clock models. Our divergence date estimates indicate for the crown group Hydra an age of 193 million years ago (mya) (95% highest posterior density [HPD] interval 149– 241 mya; Fig. 3), representing the split between the viridissima group and all other Hydra. The inferred sister taxon (Candelabrum cocksii) diverged 326 mya (254–404). Within Hydra the viridissima group has an estimated age of 112 mya (77–152 mya), the braueri group of 69 mya (39–110 mya), the oligactis group of 71 mya (43– 102 mya) and the vulgaris group of 62 mya (35–98 mya). The latter two groups diverged about 101 mya (72–132 mya) and in turn separated from the braueri group 147 mya (108–187 mya; Fig. 3; Table 5). The two additional molecular clock analyses, either with only mitochondrial genes or with less Aplanulata and Hydra species, resulted in relatively similar estimates of divergence times with

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

47

Fig. 1. Bayesian inference phylogenetic analyses of COI. Nodes were collapsed to depict the inferred main lineages of Hydra only (refer to Supplement Fig. 1 for full representations showing all individuals and their geographic origins). Please note that H. vulgaris 7 is probably the ‘true’ H. vulgaris Pallas, 1766 (and includes all individuals identified as H. magnipapillata), H. vulgaris 4 the ‘true’ H. carnea Agassiz (1851) and H. viridissima 6 the ‘true’ H. sinensis Wang et al. (2009). The outgroup has been removed for a better graphic representation. ⁄⁄Posterior probability 1; ⁄Posterior probability >0.95.

all divergence time estimates being well within the 95% HPD range of the initial analysis (Table 5). When fewer taxa were included the divergence estimates for crown group Hydra and the split between the braueri and the oligactis plus vulgaris group were about 10% (20 million years) younger. The analysis based solely on the two mitochondrial markers also resulted in a 20 million year younger divergence time for the split between the braueri and the oligactis plus vulgaris group as well as for the split between the oligactis and vulgaris groups. Conversely, the age of the viridissima group was estimated to be 30 million years older (Table 5). The divergence times between crown group Hydra and its inferred sister groups were increased by 30 million years in the analysis with fewer genes and decreased by 30 million years in the analysis with less taxa (see Table 6). 4. Discussion Our study for the first time compiled all the available data and employed objective delimitation approaches to study the species level diversity of Hydra. With 28 delimited main lineages we uncovered a much greater diversity of genetic lineages, which may correspond to species, than suggested by previous studies that were based on subsets of the present dataset (Campbell et al., 2013; Hemmrich et al., 2007; Kawaida et al., 2010; Martínez et al., 2010; Reddy et al., 2011; Wang et al., 2012). This underlines the importance of (1) taking into account all available data and (2) to employ specific and objective criteria for delimiting lineages

which may subsequently be translated into species. In the following we will discuss the species identities of the delimited main lineages and we will explicitly discuss potential taxonomic implications (e.g. synonymies). All 28 main lineages identified herein were differentiated in at least one of the studied markers. Consequently, all main lineages can be assumed to fulfill the species criterion of the Phylogenetic Species Concept (Mishler and Theriot, 2000) and may thus be treated as phylogenetic species. This is corroborated by a comparison with intra- and interspecific genetic distances observed in other Medusozoa, which are of similar extend as those within and among Hydra main lineages (e.g. Dawson, 2005a,b; Holland et al., 2004; Laakmann and Holst, 2014; Moura et al., 2008; Ortman et al., 2010; Pontin and Cruickshank, 2012; Schroth et al., 2002). A more conservative approach would be to identify reproductively isolated main lineages and to accept only these as species: main lineages that are in concordance with the Biological Species Concept (Mayr, 1942). Because of the overall congruence between the two mitochondrial markers and the nuclear ITS, the absence of recent reproduction among most main lineages can be postulated. True reproductive isolation, however, can only be inferred for those main lineage pairs that occur in sympatry as only these had the chance to reproduce, for all others a delimitation based on the Biological Species Concept has to remain ambiguous for now (see Sections 4.1–4.4 for more details). Our results highlight several instances where the delimited main lineages and inferred biological species (see Sections 4.1–

48

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

Fig. 2. Bayesian inference phylogenetic analyses of (A) 16S and (B)–(E) ITS. Nodes were collapsed to depict the inferred main lineages of Hydra only (refer to Supplement Figs. 2–4 for full representations showing all individuals and their geographic origins). For ITS analyses were run independently for each group: (B) vulgaris group, (C) viridissima group, (D) oligactis group and (E) braueri group. Please note that H. vulgaris 7 is probably the ‘true’ H. vulgaris Pallas (1766) (and includes all individuals identified as H. magnipapillata), H. vulgaris 4 the ‘true’ H. carnea Agassiz (1851) and H. viridissima 6 the ‘true’ H. sinensis Wang et al. (2009). All phylogenetic trees are mid-point rooted. ⁄⁄ Posterior probability 1; ⁄Posterior probability >0.95.

4.4) are at odds with current taxonomy. This seems particularly to be the case in the viridissima and vulgaris groups in which numerous species were subsumed under a single species name, i.e. H. viridissima and H. vulgaris (see Sections 4.1 and 4.4 for details). In addition, several individuals of the vulgaris group – which were identified as different species – obviously belong to the same species, suggesting synonymy of the respective species. Whether the underlying taxonomy is erroneous and in need of revision or whether it is only wrongly applied (i.e. misidentifications of individuals) cannot be answered in all cases, as we had to rely on the species identifications provided by the respective studies. Nevertheless, at least in the viridissima group several of the delimited species could be assigned to previously described species based on the species’ geographic distribution, suggesting inconsistent application of current taxonomy (see Section 4.1). The same may be true for the vulgaris group as numerous species have been described for this group but these are not represented in the current dataset (see Section 4.4). Assigning individuals (or their clones) to putative species by molecular phylogenetic analyses prior to morphological investigation can greatly improve morphological species differentiation and may result in a clearer distinction between intraspecific variability and interspecific variation. Such approaches have been very successful in other taxa where consistent morphological differentiation was shown for

supposedly cryptic species (e.g. Pepper et al., 2011; Schroth et al., 2002; Schwentner et al., 2012). The results of this and previous molecular phylogenetic studies (e.g. Campbell et al., 2013; Hemmrich et al., 2007; Kawaida et al., 2010; Martínez et al., 2010; Wang et al., 2012) are an ideal starting point for future analyses combining morphological and molecular phylogenetic analyses to revise the taxonomy and species descriptions of Hydra. Given the restricted geographic distribution of several main lineages delimited herein, it appears plausible that only a subset of Hydra’s total diversity has been included in molecular analyses so far. Fine-scale sampling may reveal an even greater diversity. The phylogenetic analyses support the four groups proposed by Schulze (1917) and Campbell (1987), which were also recovered in earlier phylogenetic studies (Hemmrich et al., 2007; Kawaida et al., 2010; Martínez et al., 2010). The lack of support in the analyses of 16S may be an artifact cause by the overall low level of resolution provided by this marker in the present analyses. Their reciprocal monophyly highlights the usefulness of morphological characteristic to delimit Hydra species groups. Additional genus names were proposed for the viridissima group – Chlorohydra (Schulze, 1914) – and Pelmatohydra (Schulze, 1914) for some members of the oligactis group. These two genera were rejected by several other authors (e.g. Ewer, 1948; Hyman, 1929; Jankowski et al., 2008;

Table 4 Summary of main lineages delimited by different markers and methods. The presence (X) or absence (–) of all main lineage is summarized across all markers and methods. H. vulgaris 7 is probably the ‘true’ H. vulgaris Pallas (1766), H. vulgaris 4 the ‘true’ H. carnea Agassiz (1851) and H. viridissima 6 the ‘true’ H. sinensis Wang et al. (2009).

H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H. H.

viridissima 1 viridissima 2 viridissima 3 viridissima 4 viridissima 5 viridissima 6 circumcincta 1 circumcincta 2 utahensis hymanae oligactis robusta canadensis oxycnida vulgaris 1 vulgaris 2 vulgaris 3 vulgaris 4 vulgaris 5 vulgaris 6 vulgaris 7 vulgaris 8 vulgaris 9 vulgaris 10 vulgaris 11 vulgaris 12 polymorphus zhujiangensis

COI

16S

ITS

COI GMYC

COI ABGD (1.1–1.29%)

COI ABGD (1.3–3.7%)

16S GMYC

16S ABGD (0.5–0.97%)

16S ABGD (0.3–0.48%)

ITS GMYC

ITS ABGD

X X X X X X X X X X – (CO) – (CO) X X X X X X X n.a. X X X X n.a. n.a. X X

X X X X X X X X X X – (CO) X X X X X X X X n.a. X n.a. n.a. X n.a. X X n.a.

X X X X – (CO) – (CO) X X X X X X X X X X X – X X X n.a. X X X X n.a. n.a.

X X X X X X – (FS) X X X – – (CO) X – (FS) X X X X X n.a. X X X X (FS) n.a. n.a. X X

X X X X X X – (FS) X X X – – (CO) X X X – (FS) X X X n.a. X X X – (FS) n.a. n.a. X X

X X X X X X X X X X – (CO) – (CO) X X X – (CO) X X X n.a. – (CO) X – (CO) – (FS) n.a. n.a. X X

X X X X X X – (FS) X X – (FS) – – (CO) – (FS) X X – (FS) X X X n.a. – (FS) n.a. n.a. X n.a. X X n.a.

X X X X X X – (FS) X X X – (CO) – (CO) – (FS) X – (CO) – (FS) X – (CO) – (CO) n.a. – (CO) n.a. n.a. X n.a. X X n.a.

X X X X X X – (FS)

X X X X – (CO) – (FS, CO) X X X X – (CO) – (CO) – (FS) X – (CO) X – (CO) – – (CO) X X n.a. X X X X n.a. n.a.

X X X X – (FS, CO) – (FS, CO) X X X X – (CO) – (CO) X X – (CO) X – (CO) – (FS) X X X n.a. X X X – (FS) n.a. n.a.

X X – (CO) – (CO) – (FS) X X – (FS) X X X n.a. X n.a. n.a. X n.a. X X n.a.

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

Phylogenetic analyses

CO = clusters with other lineages (all or some individuals cluster with individuals of one or several other lineages; in case of H. oligactis and H. robusta this includes always member of the respective other lineages); FS = further subdivision into two to three main lineages; n.a. = not applicable (no sequence of this marker was available for the respective main lineage).

49

50

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

Fig. 3. Molecular clock dated phylogenetic tree. Tree reconstruction is based on four genes, COI, 16S, EF1a and 28S, and the application of four cnidarians fossil calibration points. Bars represent 95% highest posterior densities (HPD) intervals. All main lineages of Hydra which may correspond to distinct species and for which at least two of the four genes were available were included in the analysis. Numbers indicate the four implemented fossil calibration points, (1) all Cnidaria (570–640 mya), (2) split between Hydrozoa and Scyphozoa (540–640 mya), (3) Hydrozoa (500–640 mya) and (4) split between Anthomedusa and Leptomedusa (450–640 mya). ⁄⁄Posterior probability 1; ⁄ Posterior probability >0.95.

Table 5 Estimated divergence times. For a set of nodes relevant in the evolution of Hydra the respective divergence times are reported for all three molecular clock analyses. All estimates are in million years ago (mya) and include the 95% HPD interval; see also Fig. 3.

Split between Hydra and its sister taxon Crown group Hydra viridissima group braueri + oligactis + vulgaris group oligactis + vulgaris group braueri group oligactis group vulgaris group

All taxa, all genes

All taxa, COI+16S

Less taxa, all genes

326 (254–404)a

358 (270–443)a

193 (149–241) 112 (77–152) 147 (108–187)

202 (134–276) 150 (94–210) 123 (74–181)

294 (193– 422)b 175 (119–236) – 121 (75–174)

101 (72–132)

84 (49–127)

–

69 (39–110) 71 (43–102) 62 (35–98)

80 (45–121) 63 (45–121) 63 (33–97)

– – –

a

Split between crown group Hydra and Candelabrum cocksii. Split between crown group Hydra and Candelabrum cocksii plus Ralpharia gorgoniae. b

Schuchert, 2010) and were adopted only rarely in the literature. Although both genera would be monophyletic (if Pelmatohydra was applied to all species of the oligactis group), we follow the other authors and suggest retaining the genus Hydra for all species of all four groups.

Table 6 Summary of proposed species affiliation for several common ‘lab strains’ of Hydra. Common lab strains

Species affiliation

H. H. H. H. H.

H. carnea H. circumcincta 1 H. vulgarisa H. oligactis Several different species

carnea circumcincta M7 magnipapillata (all strains) oligactis (all strains) viridissima (or its synonym H. viridis) H. viridissima A14c H. viridissima A250 H. viridissima A99 H. viridissima M9 H. viridissima M10 H. viridissima M120 H. viridissima NC64 H. vulgaris ‘AEP’ H. vulgaris ‘Basel’ Pelmatohydra robusta

H. sinensis H. viridissima 5 H. viridissima 3 H. viridissima 5 H. viridissima 5 H. viridissima 5 H. sinensis H. carnea H. vulgarisa H. robusta (possibly synonymous to H. oligactis)

a Herein identified as H. vulgaris 7 but probably represent the ‘true’ H. vulgaris Pallas (1766).

4.1. Translating main lineages into species: viridissima group Although four species of ‘green’ Hydra have been described – H. viridissima Pallas, 1766 from Europe; H. hadleyi (Forrest, 1959) from North America; H. plagiodesmica Dioni, 1968 from South

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

America and H. sinensis Wang et al., 2012 from China – it has become common practice to refer to all ‘green’ Hydra as H. viridissima (e.g. Habetha et al., 2003; Habetha and Bosch, 2005; Hemmrich et al., 2007; Jankowski et al., 2008; Kawaida et al., 2010, 2013; Martínez et al., 2010). That this may be an oversimplification became apparent by high levels of genetic differentiation observed among various strains of this group (Kawaida et al., 2010; Martínez et al., 2010). But also earlier studies based on morphology alone suggested the presence of additional species of ‘green’ Hydra (Hyman, 1929; McAuley, 1984; Schulze, 1917). By analyzing all the data available we could identify six main lineages within the viridissima group, which translate to five or even six biological species. Most of them occur sympatrically with no indication of gene flow and reproduction. The sole exceptions are lineages H. viridissima 5 and 6. Their symbiotic Chlorella are genetically nearly identical (Kawaida et al., 2013) and individuals assigned to either H. viridissima 5 or 6 mitochondrially featured ITS sequences of the other lineage. Whether this is an artifact (i.e. an ancestral polymorphism) or an indication of ongoing reproduction has to remain open for now. Linking the herein delimited species to existing species names is not unambiguously possible. With the data currently available two cases appear straight forward giving the geographic distribution of the species. The South American H. plagiodesmica Dioni, 1968 most likely corresponds to H. viridissima 4 and H. sinensis Wang et al., 2009 to H. viridissima 6. Hydra viridissima Pallas, 1766 was first described from Europe without a precise type locality (see Schuchert, 2010). Thus, H. viridissima 2, 3 and 4 all are possible candidates to represent H. viridissima Pallas, 1766. Similarly, one of the three species identified from North America – H. viridissima 1, 2, and 5 (the latter potentially including H. viridissima 6) – may represent H. hadleyi (Forrest, 1959). If H. viridissima 5 and 6 represent a single species and if this species is the ‘true’ H. hadleyi, H. sinensis would be a junior synonym of H. hadleyi. Given the wide distribution of ‘green’ Hydra, only few strains were incorporated into this and all previous analyses. Most likely, more species will be discovered if sampling is performed more densely, as exemplified by the three species recorded from Switzerland. This may further complicate the correct assignment of existing species names. If one keeps in mind that the divergence within the extant member of the viridissima group is nearly as old as among all other Hydra species, a much greater number of species can be anticipated for this particular group. 4.2. Translating main lineages into species: oligactis group The main lineage pairs H. oxycnida & H. oligactis and H. canadensis & H. oligactis can be considered to have sympatric distributions, the former in Europe and the latter in northern North America. Due to their consistent differentiation in mitochondrial and nuclear markers they qualify as biological species. The additional subdivision within H. oxycnida and H. canadensis proposed by some analyses are viewed as a result of intraspecific genetic variation, as this subdivision is not supported by all markers. The species status of H. robusta is questionable. Previous studies identified H. robusta and H. oligactis as closely related sister species (Hemmrich et al., 2007; Kawaida et al., 2010), which were not reciprocally monophyletic in the phylogenetic analyses of each single marker. Of course, reciprocal monophyly is not a prerequisite for species differentiation and shared identical sequences could be the result of ancestral polymorphisms (Funk and Omland, 2003). However, the additional COI sequences of European individuals morphologically identified as H. oligactis obtained from the BOLD database (submitted by P. Schuchert) clustered within the H. robusta clade. This questions the distinctiveness of H. robusta. Regrettably, no ITS sequences were available for these important

51

individuals. If their ITS sequences correspond to the ITS sequences found so far in H. robusta (which are distinct from those of H. oligactis), this would strongly support reproductive isolation among these two species and would expand the distribution of H. robusta from Japan to central Europe. Conversely, if their ITS sequences correspond to those of other H. oligactis from central Europe, the species status of H. robusta would be doubtful. 4.3. Translating main lineages into species: braueri group All four main lineages identified in the braueri group can each be ascribed to a distinct biological species: H. circumcincta 1, H. circumcincta 2, H. hymanae and H. utahensis. Because all of them occur in northern North America (Alaska) and H. circumcincta 1 and H. circumcincta 2 also in northern Europe, their distributions can be considered as sympatric. All four are consistently differentiated in the studied mitochondrial and nuclear markers, which strongly imply reproductive isolation among these species. A further subdivision of H. circumcincta 1, as indicate by a few analyses, is doubtful and may rather be caused by intraspecific genetic diversity. Which of the two H. circumcincta species is the true H. circumcincta Schulze, 1914 cannot be determined unambiguously here. The available data points to H. circumcincta 1. It was recorded also in central Europe including northern Germany and the type locality for H. circumcincta is in Berlin (Germany). The respective other species may correspond to one of the species previously synonymized with H. circumcincta (see Schuchert, 2010). 4.4. Translating main lineages into species: vulgaris group The vulgaris group seems to be the most diverse group of Hydra. Across all markers 14 main lineages were delimited; however, of only seven main lineages all three markers were available. This and the fact that the majority of main lineages appear to be allopatrically distributed impedes their delimitation as biological species and impedes reliable estimated of biological species numbers, even though for most main lineages no evidence points against them representing separate biological species. Nevertheless, several important conclusions can be drawn. First of all, H. magnipapillata and several H. vulgaris strains from Eurasia and South Africa belong to a single species (H. vulgaris 7). This includes H. vulgaris strain Basel, which is an important lab strain and which has been used in comparative studies alongside H. magnipapillata, and strains identified as H. japonica, H. attenuata and H. shenzhensis. The synonymy of H. magnipapillata and some H. vulgaris is not surprising as previous studies had revealed only little genetic differentiation among strains (Kawaida et al., 2010; Martínez et al., 2010); albeit Martínez et al. (2010) summarized all member of the vulgaris group as H. vulgaris. Hydra shenzhensis was only recently described (Wang et al., 2012) which may be attributed to the erroneous assumption that H. japonica and H. attenuata referred to valid species. H. vulgaris 7 is most likely the true H. vulgaris Pallas, 1766. Following Pallas (1766) H. vulgaris is supposed to be common throughout Europe and the other European H. vulgaris main lineage identified herein (H. vulgaris 8) seems to be rarer and possibly restricted to Switzerland. Secondly, the majority of North American H. vulgaris strains constitute a single species (H. vulgaris 4) including strains from Japan and South America and those identified as H. carnea and H. littoralis. It also includes H. vulgaris AEP, the strain used for generating transgenic Hydra (e.g. Wittlieb et al., 2006), as it is a cross between strains identified as H. carnea and H. littoralis (Martínez et al., 2010). The valid name for this species is most likely H. carnea Agassiz, 1851. Previous studies suggested a close relationship between H. carnea and H. vulgaris AEP (Hemmrich et al., 2007; Kawaida et al., 2010), but not necessarily them being conspecific.

52

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

Fig. 4. Scheme of inferred evolutionary history of Hydra groups. It highlights important times of divergence among and within the various Hydra groups. Divergence within each Hydra group is limited to the first divergence, for viridissima group the first two divergence events are shown due the group’s greater age. The branch leading to Hydra is depicted in red and the one leading to viridissima group in green, as these indicate the time intervals in which the Hydra and viridissima group specific traits (e.g. taxonomically restricted genes/orphan genes) evolved, respectively. The scheme is based on the fossil dated molecular clock analysis depicted in Fig. 3. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Whether H. carnea is the only representative of the vulgaris group in North America or whether the two other main lineages (H. vulgaris 5 and 6) present in North America constitute separate biological species has to remain an open question for now. All other main lineages are genetically well separated in all available markers and it seems likely that they represent distinct species each. Apart from the erroneous application of the species name H. vulgaris there is no further apparent conflict with taxonomic nomenclature. Given their high levels of intralineage genetic diversity H. vulgaris 2 and H. vulgaris 10 may each represent two distinct species. However, given the low number of sequences available from each of these lineages we hesitated to split them further. Hydra polymorphus Chen and Wang (2008) and H. zhujiangensis Liu and Wang (2010) are both genetically differentiated from other Asian species and thus well supported as valid species. Hydra vulgaris 1 and 2 both occur sympatrically in South America (Chile and Argentina) and are genetically well differentiated in mitochondrial and nuclear markers and are thus most likely biological species. One of these could be H. vulgaris pedunculata Deserti et al. (2011), which was described from eastern Argentina. If this were the case, H. vulgaris pedunculata would need to be raised from sub-species to species level. Similarly, other main lineages identified herein may correspond to previously described species of the vulgaris group; however, elucidating this issue requires detailed morphological and taxonomic studies. 4.5. Evolutionary origins and biogeographic implications Current hypotheses regarding the origin and biogeographic history of Hydra are widely diverging. While the age of the viridissima group was estimated to be 156–174 million years (Kawaida et al., 2013), the age of crown group Hydra was estimated to be only 60 million years (Martínez et al., 2010). These are highly contradictory estimates. Accordingly, in the latter study Hydra was assumed to have originated on the prehistoric northern hemisphere continent Laurasia. Members of the vulgaris and viridissima group would have colonized the southern continents by intercontinental dispersal, whereas the oligactis and braueri group did not disperse to southern continents. Conversely, based purely on the distribution of the four groups is has been assumed that the

viridissima and vulgaris groups evolved prior to the separation of continents (possibly on Pangea) and the braueri and oligactis groups evolved after the separation of northern and southern continents (Jankowski et al., 2008). This scenario does not require any intercontinental dispersal. The divergence time estimates obtained in the present study date the evolutionary origins of crown group Hydra to the late Triassic or early Jurassic (Fig. 4). This finding is somehow intermediate to the divergence time estimates of previous studies (Kawaida et al., 2013; Martínez et al., 2010). In the late Triassic/early Jurassic all continental plates were still part of Pangaea, though Pangea started breaking apart into northern Laurasia and southern Gondwana (Bortolotti and Principi, 2005). Given its Pangean origin, today’s global distribution of Hydra could be a result of vicariance with little or no large-scale (i.e. without trans-oceanic) dispersal as suggested by Jankowski et al. (2008). But the divergence between the oligactis, braueri and vulgaris groups and the ages of each of these groups are younger than the separation between Gondwana and Laurasia. Even Gondwana most likely broke apart before the four extant groups of Hydra evolved (Upchurch, 2008). Consequently, the cosmopolitan distributions of the vulgaris group and most likely also of the viridissima group are due to transcontinental and transoceanic dispersal as suggested by Martínez et al. (2010), although the underlying timeframe differs greatly. This is in direct contrast to the prevailing assumption that Hydra is not capable of transoceanic dispersal (Campbell, 1999; Jankowski et al., 2008). Of course, Hydra species may have spread across all continents through the global trade of aquatic organisms. This may explain why genetically identical individuals (or strains) were recovered from different continents (Campbell et al., 2013; Martínez et al., 2010), for example identical genotypes of H. vulgaris 4 in America and New Zealand, of H. viridissima 3 in Australia and Germany and of H. viridissima 5 in Europe, North America and Africa (a potential source of error could be the long-term maintenance of some strains in different laboratories). However, for several species with wide geographic distributions – like H. vulgaris 7 across Eurasia and South Africa or H. oligactis and H. circumcincta 1 & 2 across northern Europe and North America – the recovered genotypes were closely related but not identical as would be expected for recent human-mediated dispersal. In addition, the presence of endemic and genetically divergent species of the vulgaris group in South Africa, Australia/New Zealand and South America corroborates transoceanic dispersal in pre-human times. These are strong indications that Hydra species are well capable of longdistance and even trans-oceanic dispersal. Also members of the oligactis and braueri group seem to be present on southern continents as well (e.g. Campbell, 1999; Deserti et al., 2012), questioning cross-equatorial dispersal limitations, which have been suggested for these groups (Martínez et al., 2010), given the time-frame of diversification proposed herein. It is noteworthy that the diversification of three Hydra groups – oligactis, braueri and vulgaris groups – as well as the diversification within the two largest monophyletic clades within the viridissima group occurred between 60 and 70 mya. This coincides roughly with the Cretaceous-Paleogene boundary, a time of severe climatic change and of global mass extinction. Possibly former Hydra diversity was reduced to few species, which subsequently gave rise to today’s groups. Because the majority of extant species occur in North America and/or Eurasia, the ancestors of today’s groups most likely survived on Laurasia and spread further south from there. Transoceanic dispersal after the separation of all main land masses would explain why Hydra species from Africa, South America and Australia do not show the close relationship expected for taxa with

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

Gondwana distributions, however, this may also be due to the overall low resolution of interspecific relationships. Our results provide a robust framework to assess the timing and rate of key evolutionary processes. Of course, all molecular clock estimates should be treated with some caution, but our analysis allows setting certain limits for the timing of evolutionary processes. For example, Hydra specific genes that are present in all extant Hydra but missing in all other taxa must have evolved after Hydra split from its proposed sister taxon and before crown group Hydra diversified; thus in a 130 million year window between 325 and 195 mya. Another important question regards the acquisition of symbiotic Chlorella by all members of the viridissima group. We can assume that the ancestor of all extant Hydra lacked Chlorella because this is the plesiomorphic condition observed in all other Aplanulata and all non-green Hydra species. Therefore, the acquisition of Chlorella symbionts and related adaptations and evolutionary novelties (like taxon specific genes) would have occurred between 110 and 195 mya over a period of 80 million years. Of course, comparable estimates are possible among all groups of Hydra, offering new possibilities to assess the rates of genomic changes.

5. Conclusion One may think that the taxonomy of Hydra and the precise assignment of single individuals (or clonal strains) to certain species is a mere academic exercise, which is of little importance for others than taxonomists or possibly ecologist. However, Hydra is an important model system in both evolutionary developmental biology and research on the metaorganism or holobiont. Such studies rely on a precise and unambiguous assignment of the studied individuals to species as the prerequisite for intraspecific or interspecific comparisons and for the identification of common or diverging processes and functions among species. With respect to Hydra research three findings are crucial: (1) species level diversity was underestimated by previous molecular studies; (2) species affiliations of several crucial ‘workhorses’ of Hydra evolutionary research were wrong and (3) the evolutionary origins of the genus Hydra date back nearly 200 million years to the late Triassic or early Jurassic. Our re-analysis of existing data highlights the need for a careful and extensive revision of the taxonomy of Hydra species. For evolutionary research the fact that H. vulgaris strain Basel and H. magnipapillata as well as H. carnea and H. vulgaris AEP are conspecific and that H. viridissima features several species have far reaching consequences as inter- and infraspecific differences may have been wrongly assessed. Informative examples are the associated bacterial communities of H. carnea and H. vulgaris AEP, which show great similarity (Franzenburg et al., 2013). In light of the present study, this is not surprising given the fact that both belong to the same species. Previous studies have indicated their close relationships, but not necessarily them being conspecific. Our divergence time estimates set the time frame to date the origins of evolutionary novelties and to assess the rates of genomic changes for Hydra and its groups and species.

Acknowledgments The work was supported in part by grants from the Deutsche Forschungsgemeinschaft (DFG) and by grants from the DFG Clusters of Excellence programs ‘‘The Future Ocean’’ and ‘‘Inflammation at Interfaces’’. We thank four anonymous reviewers for their helpful comments on an earlier version of the manuscript.

53

Appendix A. Supplementary material Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ympev.2015.05. 013.

References Agapow, P.-M., Bininda-Emonds, O.R.P., Crandall, K.A., Gittleman, J.L., Mace, G.M., Marshall, J.C., Purvis, A., 2004. The impact of species concepts on biodiversity studies. Quat. Rev. Biol. 79, 161–179. Agassiz, L., 1851. On the little bodies seen on Hydra. Proc. Bost. Soc. Nat. Hist. 3, 354–355. Bortolotti, V., Principi, G., 2005. Tethyan ophiolites and Pangea break-up. Isl. Arc 14, 442–470. Bosch, T.C.G., 2013. Cnidarian-microbe interactions and the origin of innate immunity in metazoans. Annu. Rev. Microbiol. 67, 499–518. Bosch, T.C.G., 2014. Rethinking the role of immunity: lessons from Hydra. Trends Immunol. 35, 495–502. Bouckaert, R., Heled, J., Kühnert, D., Vaughan, T., Wu, C.H., Xie, D., Suchard, M.A., Rambaut, A., Drummond, A.J., 2014. BEAST 2: A software platform for Bayesian evolutionary analysis. PLoS Comput. Biol. 10, e1003537. 3537. Brucker, R.M., Bordenstein, S.R., 2012. Speciation by symbiosis. Trends Ecol. Evol. 27, 443–451. Brucker, R.M., Bordenstein, S.R., 2013. The hologenomic basis of speciation: gut bacteria cause hybrid lethality in the genus Nasonia. Science 341, 667–669. Campbell, R.D., 1983. Identifying Hydra species. In: Lenhoff, H.M. (Ed.), Hydra Research Methods. Plenum Publishing, New York. Campbell, R., 1987. A new species of Hydra (Cnidaria Hydrozoa) from North America with comments on species clusters within the genus. Zool. J. Linn. Soc. 91, 253– 263. Campbell, R., 1989. Taxonomy of the European Hydra (Cnidaria: Hydrozoa): a re-examination of its history with emphasis on the species H. vulgaris Pallas, H. attenuata Pallas and H. circumcincta Schulze. Zool. J. Linn. Soc. 95, 219–244. Campbell, R., 1999. The Hydra of Madagascar (Cnidaria: Hydrozoa). Ann. Limnol. 35, 95–104. Campbell, R.D., Iñiguez, A.R., Iñiguez, A.J., Martínez, D.E., 2013. Hydra of Hawaii: phylogenetic relationships with continental species. Hydrobiologia 713, 199– 205. Cartwright, P., Collins, A., 2007. Fossils and phylogenies: integrating multiple lines of evidence to investigate the origin of early major metazoan lineages. Integr. Comp. Biol. 47, 744–751. Chapman, J.A., Kirkness, E.F., Simakov, O., Hampson, S.E., Mitros, T., Weinmaier, T., Rattei, T., Balasubramanian, P.G., Borman, J., Busam, D., Disbennett, K., Pfannkoch, C., Sumin, N., Sutton, G.G., Viswanathan, L.D., Walenz, B., Goodstein, D.M., Hellsten, U., Kawashima, T., Prochnik, S.E., Putnam, N.H., Shu, S., Blumberg, B., Dana, C.E., Gee, L., Kibler, D.F., Law, L., Lindgens, D., Martinez, D.E., Peng, J., Wigge, P.A., Bertulat, B., Guder, C., Nakamura, Y., Ozbek, S., Watanabe, H., Khalturin, K., Hemmrich, G., Franke, A., Augustin, R., Fraune, S., Hayakawa, E., Hayakawa, S., Hirose, M., Hwang, J.S., Ikeo, K., NishimiyaFujisawa, C., Ogura, A., Takahashi, T., Steinmetz, P.R.H., Zhang, X., Aufschnaiter, R., Eder, M.-K., Gorny, A.-K., Salvenmoser, W., Heimberg, A.M., Wheeler, B.M., Peterson, K.J., Böttger, A., Tischler, P., Wolf, A., Gojobori, T., Remington, K.A., Strausberg, R.L., Venter, J.C., Technau, U., Hobmayer, B., Bosch, T.C.G., Holstein, T.W., Fujisawa, T., Bode, H.R., David, C.N., Rokhsar, D.S., Steele, R.E., 2010. The dynamic genome of Hydra. Nature 464, 592–596. Chen, Z., Wang, A., 2008. A new species of the genus Hydra from China (Hydrozoa, Hydraridae). Acta Zootaxonomica Sin. 33, 737–741. Chen, J.-Y., Oliveri, P., Gao, F., Dornbos, S.Q., Li, C.-W., Bottjer, D.J., Davidson, E.H., 2002. Precambrian animal life: probable developmental and adult cnidarian forms from southwest China. Dev. Biol. 248, 182–196. David, C.N., 2012. Interstitial stem cells in Hydra: multipotency and decisionmaking. Int. J. Dev. Biol. 56, 489–497. Dawson, M.N., 2005a. Five new subspecies of Mastigias (Scyphozoa: Rhizostomeae: Mastigiidae) from marine lakes, Palau. Micronesia. J. Mar. Biol. Assoc. UK 85, 679–694. Dawson, M.N., 2005b. Incipient speciation of Catostylus mosaicus (Scyphozoa, Rhizostomeae, Catostylidae), comparative phylogeography and biogeography in south-east Australia. J. Biogeogr. 32, 515–533. Deserti, M., Zamponi, M., Escalante, A., 2011. The genus Hydra from Argentina. I. Hydra vulgaris pedunculata subsp. nov. (Cnidaria, Hydrozoa). Rev. Real Acad. Galega Ciencias 30, 5–14. Deserti, M.I., Zamponi, M.O., Escalante, A.H., 2012. The genus Hydra from Argentina. II. Hydra pseudoligactis Hyman, 1931 (Cnidaria; Hydrozoa), a new record. Rev. Real Acad. Galega Ciencias 31, 5–14. Dioni, W., 1968. Hydra (Chlorohydra) plagiodesmica sp. nov. una hidra verde del Rio Salado, Republica Argentina (Cnidaria, Hydrozoa). Phys., B. Aires 28, 203–210. Ewer, R., 1948. A review of the Hydridae and two new species of Hydra from Natal. Proc. Zool. Soc. Lond. 118, 226–244. Forrest, H., 1959. Taxonomic studies on the Hydras of North America. VII. Description of Chlorohydra hadleyi, new species, with a key to the North American species of Hydras. Am. Midl. NAt. 62, 441.

54

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55

Franzenburg, S., Walter, J., Künzel, S., Wang, J., Baines, J.F., Bosch, T.C.G., 2013. Distinct antimicrobial peptide expression determines host species-specific bacterial associations. PNAS E 3730–E 3738. Fraune, S., Bosch, T.C.G., 2007. Long-term maintenance of species-specific bacterial microbiota in the basal metazoan Hydra. PNAS 104, 13146–13151. Fujisawa, T., Hayakawa, E., 2012. Peptide signaling in Hydra. Int. J. Dev. Biol. 56, 543–550. Funk, D.J., Omland, K.E., 2003. Species-level paraphyly and polyphyly: frequency, causes, and consequences, with insights from animal mitochondrial DNA. Annu. Rev. Ecol. Evol. Syst. 34, 397–423. Galliot, B., 2012. Hydra, a fruitful model system for 270 years. Int. J. Dev. Biol. 56, 411–423. Grimmelikhuijzen, C.J., Hauser, F., 2012. Mini-review: the evolution of neuropeptide signaling. Regul. Pept. 177, 6–9. Habetha, M., Bosch, T.C.G., 2005. Symbiotic Hydra express a plant-like peroxidase gene during oogenesis. J. Exp. Biol. 208, 2157–2164. Habetha, M., Anton-Erxleben, F., Neumann, K., Bosch, T.C.G., 2003. The Hydra viridis/ Chlorella symbiosis. Growth and sexual differentiation in polyps without symbionts. Zoology 106, 101–108. Hemmrich, G., Anokhin, B., Zacharias, H., Bosch, T.C.G., 2007. Molecular phylogenetics in Hydra, a classical model in evolutionary developmental biology. Mol. Phylogenet. Evol. 44, 281–290. Holland, B.S., Dawson, M.N., Crow, G.L., Hofmann, D.K., 2004. Global phylogeography of Cassiopea (Scyphozoa: Rhizostomeae): molecular evidence for cryptic species and multiple invasions of the Hawaiian Islands. Mar. Biol. 145, 1119–1128. Holstein, T.W., 2012. A view to kill. BMC Biol. 10, 18. Hyman, L.H., 1929. Taxonomic studies on the Hydras of North America. I. General remarks and descriptions of Hydra americana, new species. Trans. Am. Microcop. Soc. 48, 242–255. Jankowski, T., Collins, A.G., Campbell, R., 2008. Global diversity of inland water cnidarians. Hydrobiologia 595, 35–40. Katoh, K., Standley, D.M., 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol. Biol. Evol. 30, 772– 780. Kawaida, H., Shimizu, H., Fujisawa, T., Tachida, H., Kobayakawa, Y., 2010. Molecular phylogenetic study in genus Hydra. Gene 468, 30–40. Kawaida, H., Ohba, K., Koutake, Y., Shimizu, H., Tachida, H., Kobayakawa, Y., 2013. Symbiosis between Hydra and Chlorella: molecular phylogenetic analysis and experimental study provide insight into its origin and evolution. Mol. Phylogenet. Evol. 66, 906–914. Khalturin, K., Anton-Erxleben, F., Sassmann, S., Wittlieb, J., Hemmrich, G., Bosch, T.C.G., 2008. A novel gene family controls species-specific morphological traits in Hydra. PLoS Biol. 6, e278. Khalturin, K., Hemmrich, G., Fraune, S., Augustin, R., Bosch, T.C.G., 2009. More than just orphans: are taxonomically-restricted genes important in evolution? Trends Genet. 25, 404–413. Koizumi, O., 2007. Nerve ring of the hypostome in Hydra: is it an origin of the central nervous system of bilaterian animals. Brain Behav. Evol. 69, 151–159. Laakmann, S., Holst, S., 2014. Emphasizing the diversity of North Sea hydromedusae by combined morphological and molecular methods. J. Plankton Res. 36, 64–76. Lasi, M., David, C.N., Böttger, A., 2010. Apoptosis in pre-Bilaterians: Hydra as a model. Apoptosis 15, 269–278. Liu, H., Wang, A., 2010. A new species of the genus Hydra from Guangdong, China (Hydrozoa, Anthoathecatae, Hydraridae). Acta Zootaxonomica Sin. 35, 857–862. Love, G.D., Grosjean, E., Stalvies, C., Fike, D.A., Grotzinger, J.P., Bradley, A.S., Kelly, A.E., Bhatia, M., Meredith, W., Snape, C.E., Bowring, S.A., Condon, D.J., Summons, R.E., 2009. Fossil steroids record the appearance of Demospongiae during the Cryogenian period. Nature 457, 718–721. Martin, V., Littlefield, C., Archer, W., Bode, H., 1997. Embryogenesis in Hydra. Biol. Bull. 192, 345–363. Martínez, D.E., Iñiguez, A.R., Percell, K.M., Willner, J.B., Signorovitch, J., Campbell, R.D., 2010. Phylogeny and biogeography of Hydra (Cnidaria: Hydridae) using mitochondrial and nuclear DNA sequences. Mol. Phylogenet. Evol. 57, 403–410. Mayr, E., 1942. Systematics and The Origin of Species from the Viewpoint of a Zoologist. Columnia University Press, New York. McAuley, P., 1984. Variation in green Hydra. A description of three cloned strains of Hydra viridissima Pallas 1766 (Cnidaria: Hydrozoa) isolated from a single site. Biol. J. Linn. Soc. 1766, 1–13. McFall-Ngai, M., Hadfield, M.G., Bosch, T.C., Carey, H.V., Domazet-Loso, T., Douglas, A.E., Dubilier, N., Eberl, G., Fukami, T., Gilbert, S.F., et al., 2013. Animals in a bacterial world, a new imperative for the life sciences. Proc. Natl. Acad. Sci. USA 110, 3229–3236. Meinhardt, H., 2012. Modeling pattern formation in hydra: a route to understanding essential steps in development. Int. J. Dev. Biol. 56, 447–462. Mishler, B.D., Theriot, E.C., 2000. The phylogenetic species concept (sensu Mishler & Theriot): monophyly, apomorphy and phylogenetic species concepts. In: Wheeler, Q., Meier, R. (Eds.), Species and Phylogenetic Theory. Columbia University Press, New York, pp. 44–54. Moura, C.J., Harris, D.J., Cunha, M.R., Rogers, A.D., 2008. DNA barcoding reveals cryptic diversity in marine hydroids (Cnidaria, Hydrozoa) from coastal and deep-sea environments. Zool. Scr. 37, 93–108.

Nawrocki, A.M., Collins, A.G., Hirano, Y.M., Schuchert, P., Cartwright, P., 2013. Phylogenetic placement of Hydra and relationships within Aplanulata (Cnidaria: Hydrozoa). Mol. Phylogenet. Evol. 67, 60–71. Nebel, A., Bosch, T.C.G., 2012. Evolution of human longevity: lessons from Hydra. Aging 4, 730–731. Ortman, B.D., Bucklin, A., Pagès, F., Youngbluth, M., 2010. DNA Barcoding the Medusozoa using mtCOI. Deep Sea Res. Part II Top. Stud. Oceanogr. 57, 2148– 2156. Pallas, P.A., 1766. Elenchus zoophytorum sistens generum adumbrationes generaliores et specierum cognitarium succinctas descriptiones cum selectis auctorum synonymis. Fransiscum Varrentrapp, Hagae. Park, E., Hwang, D.-S., Lee, J.-S., Song, J.-I., Seo, T.-K., Won, Y.-J., 2012. Estimation of divergence times in cnidarian evolution based on mitochondrial protein-coding genes and the fossil record. Mol. Phylogenet. Evol. 62, 329–345. Pepper, M., Doughty, P., Hutchinson, M.N., Scott Keogh, J., 2011. Ancient drainages divide cryptic species in Australia’s arid zone: morphological and multi-gene evidence for four new species of Beaked Geckos (Rhynchoedura). Mol. Phylogenet. Evol. 61, 810–822. http://dx.doi.org/10.1016/j.ympev.2011. 08.012. Peterson, K.J., Lyons, J.B., Nowak, K.S., Takacs, C.M., Wargo, M.J., McPeek, M., 2004. Estimating metazoan divergence times with a molecular clock. Proc. Natl. Acad. Sci. USA 101, 6536–6541. Pons, J., Barraclough, T., Gomez-Zurita, J., Cardoso, A., Duran, D., Hazell, S., Kamoun, S., Sumlin, W., Vogler, A., 2006. Sequence-based species delimitation for the DNA taxonomy of undescribed insects. Syst. Biol. 55, 595–609. Pontin, D.R., Cruickshank, R.H., 2012. Molecular phylogenetics of the genus Physalia (Cnidaria: Siphonophora) in New Zealand coastal waters reveals cryptic diversity. Hydrobiologia 686, 91–105. Puillandre, N., Lambert, A., Brouillet, S., Achaz, G., 2012. ABGD, Automatic Barcode Gap Discovery for primary species delimitation. Mol. Ecol. 21, 1864–1877. Rambaut, A., 2014. FigTree 1.4.2, Available from . Rambaut, A., Suchard, M.A., Xie, D., Drummond, A.J., 2013. Tracer v1.6, Available from . Reddy, P.C., Barve, A., Ghaskadbi, S., 2011. Description and phylogenetic characterization of common Hydra from India. Curr. Sci. 101, 736–738. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572–1574. Schroth, W., Jarms, G., Streit, B., Schierwater, B., 2002. Speciation and phylogeography in the cosmopolitan marine moon jelly. Aurelia sp. BMC Evol. Biol. 10, 2. Schuchert, P., 2010. The European athecate hydroids and their medusae (Hydrozoa, Cnidaria): Capitata Part 2. Rev. Suisse Zool. 117, 337–555. Schuchert, P., 2014. World Hydrozoa database. Accessed through: World Register of Marine Species at (06.11.14). Schulze, P., 1914. Bestimmungstabelle der deutschen Hydraarten. Sitzungsberichte der Gesellschaft naturforschender Freunde zu Berlin 9, 395–398. Schulze, P., 1917. Neue Beiträge zu einer Monographie der Gattung Hydra. Arch. Biontol. 4, 39–119. Schwentner, M., Timms, B.V., Richter, S., 2011. An integrative approach to species delineation incorporating different species concepts: a case study of Limnadopsis (Branchiopoda: Spinicaudata). Biol. J. Linn. Soc. 104, 575–599. Schwentner, M., Timms, B.V., Richter, S., 2012. Description of four new species of Limnadopsis from Australia (Crustacea: Branchiopoda: Spinicaudata). Zootaxa 3315, 42–64. Schwentner, M., Just, F., Richter, S., 2015. Evolutionary systematics of the Australian Cyzicidae (Crustacea, Branchiopoda, Spinicaudata) with the description of a new genus. Zool. J. Linn. Soc. 173, 271–295. Shimizu, H., 2012. Transplantation analysis of developmental mechanisms in Hydra. Int. J. Dev. Biol. 56, 463–472. Steele, R.E., David, C.N., Technau, U., 2011. A genomic view of 500 million years of cnidarian evolution. Trends Genet. 27, 7–13. Talavera, G., Castresana, J., 2007. Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Syst. Biol. 56, 564–577. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Tan, D., Ali, F., Kutty, S., Meier, R., 2008. The need for specifying species concepts: how many species of silvered langurs (Trachypithecus cristatus group) should be recognized? Mol. Phylogenet. Evol. 49, 688–689. Tanaka, E.M., Reddien, P.W., 2011. The cellular basis for animal regeneration. Dev. Cell. 21, 172–185. Technau, U., Steele, R.E., 2011. Evolutionary crossroads in developmental biology: Cnidaria. Development 138, 1447–1458. Thomsen, S., Bosch, T.C.G., 2006. Foot differentiation and genomic plasticity in Hydra: lessons from the PPOD gene family. Dev. Genes Evol. 216, 57–68. Trembley, A., 1744. Mémoires, pour servir à l’historie d’un genre de polypes d’eau douce, à bras en forme de cornes (Jean and Herman Verbeek). Upchurch, P., 2008. Gondwanan break-up: legacies of a lost world? Trends Ecol. Evol. 23, 229–236. http://dx.doi.org/10.1016/j.tree.2007.11.006. van Leeuwenhoek, A., 1702. In: Palm, L.C. (Ed.). The Collected Letters of Antoni van Leeuwenhoek, vol. XIV, pp. 169–173 (Swets and Zeitlinger, 1996). Waggoner, B., Collins, A.G., 2004. Reducto ad absurdum: testing the evolutionary relationships of ediacaran and paleaozoic problematic fossils using molecular divergence dates. J. Paleont. 78, 51–61.

M. Schwentner, T.C.G. Bosch / Molecular Phylogenetics and Evolution 91 (2015) 41–55 Wang, A.-T., Deng, L., Lai, J.-Q., Li, J., 2009. A new species of green Hydra (Hydrozoa: Hydrida) from China. Zool. Sci. 26, 664–668. Wang, A.-T., Deng, L., Liu, H.-T., 2012. A new species of Hydra (Cnidaria: Hydrozoa: Hydridae) and molecular phylogenetic analysis of six congeners from China. Zool. Sci. 29, 856–862. Watanabe, H., Hoang, V.T., Mättner, R., Holstein, T.W., 2009. Immortality and the base of multicellular life: lessons from cnidarian stem cells. Semin Cell Dev. Biol. 20, 1114–1125.

55

Wittlieb, J., Khalturin, K., Lohmann, J.U., Anton-Erxleben, F., Bosch, T.C.G., 2006. Transgenic Hydra allow in vivo tracking of individual stem cells during morphogenesis. Proc. Natl. Acad. Sci. USA 103, 6208–6211. Xiao, S., Yuan, X., Knoll, A.H., 2000. Eumetazoan fossils in terminal Proterozoic phosphorites? PNAS 97, 13684–13689. Young, G.A., Hagadorn, J.W., 2010. The fossil record of cnidarian medusae. Palaeoworld 19, 212–221.