Ribozyme Cleavage Reveals Connections between mRNA Release from the Site of Transcription and Pre-mRNA Processing

Molecular Cell, Vol. 20, 747–758, December 9, 2005, Copyright ª2005 by Elsevier Inc.

DOI 10.1016/j.molcel.2005.11.009

Ribozyme Cleavage Reveals Connections between mRNA Release from the Site of Transcription and Pre-mRNA Processing Gregory Bird,1 Nova Fong,1 Jesse C. Gatlin,2,3 Susan Farabaugh,1 and David L. Bentley1,* 1 Department of Biochemistry and Molecular Genetics 2 Department of Cell and Developmental Biology University of Colorado School of Medicine UCHSC at Fitzsimons Aurora, Colorado 80045

Summary We report a functional connection between splicing and transcript release from the DNA. A Pol II CTD mutant inhibited not only splicing but also RNA release from the site of transcription. A ribozyme situated downstream of the gene restored accurate splicing inhibited by the CTD mutant or a mutant poly(A) site, suggesting that cleavage liberates RNA from a niche that is inaccessible to splicing factors. Although ribozyme cleavage enhanced splicing, 30 end processing was impaired, indicating that an intact RNA chain linking the poly(A) site to Pol II is required for optimal processing. Surprisingly, poly(A)2 b-globin mRNA with a ribozyme-generated 30 end was exported to the cytoplasm. Ribozyme cleavage can therefore substitute for normal 30 end processing in stimulating splicing and mRNA export. We propose that mRNA biogenesis is coordinated by preventing splicing near the 30 end until the transcript is released by poly(A) site cleavage. Introduction Maturation of the mRNA precursor (pre-mRNA) into functional mRNA that is exported from the nucleus requires coupled cotranscriptional RNP assembly, capping, splicing, and cleavage/polyadenylation followed by termination and release from the DNA template. The three major processing steps, capping, splicing, and 30 end processing, are interdependent. The 50 cap stimulates splicing of the first intron (Lewis et al., 1996; Konarska et al., 1984; Krainer et al., 1984) and cleavage/polyadenylation (Flaherty et al., 1997); splicing enhances cleavage/polyadenylation (Lu and Cullen, 2003; Niwa et al., 1990; Nott et al., 2003) and, conversely, cleavage/polyadenylation enhances splicing (Niwa and Berget, 1991; Vagner et al., 2000). The interdependence of terminal intron splicing and 30 end processing could fulfill a quality control function by ensuring that the final product of mRNA biogenesis has a mature 30 end and all introns removed. Numerous connections between processing events and transcription have been uncovered, many of which are mediated by the C-terminal heptad repeat domain (CTD) of the RNA polymerase II (Pol II) large subunit. Specific protein:protein interactions between processing factors and the CTD are thought to facilitate cotran*Correspondence: [email protected] 3 Present address: Department of Biology, University of North Carolina, Chapel Hill, Chapel Hill, North Carolina 27599.

scriptional maturation of the pre-mRNA while it is attached to Pol II (Bentley, 2005; Hirose and Manley, 2000; Proudfoot et al., 2002). CTD-deleted Pol II does not support efficient capping, splicing, or polyadenylation (McCracken et al., 1997a, 1997b). Furthermore, the CTD is necessary for recruitment of splicing factors to sites of transcription in vivo (Misteli and Spector, 1999). According to the model of CTD-dependent mRNA maturation (see Figure 6A), the processing site is tethered to the catalytic center of the polymerase by a length of nascent RNA and is bound by factors that are localized via protein contacts with the CTD. This model has not been tested in detail, however, and the importance of the RNA tether, in particular, is not known. Whether or not a specific mechanism coordinates release from the site of transcription with removal of 30 terminal introns is not known. It is intriguing to note, however, that poly(A) site cleavage and excision of the last intron appear to occur simultaneously with transcript release at the termination site of the Chironomus BR1 gene (Bauren et al., 1998). A connection between processing and release is also supported by the fact that failure to correctly process pre-mRNA correlates with transcript retention at or near the site of transcription. Mutation of either a splice site or the poly(A) site of the b-globin gene caused retention of unprocessed transcripts in mammalian cells (Custodio et al., 1999). Furthermore, in budding yeast, retention of abnormally processed transcripts was found to require the exosome (Hilleren et al., 2001; Libri et al., 2002). It is not known whether the Pol II CTD also participates in RNA release from the site of transcription. The relationship between processing of the transcript and mRNA export is complex (Cullen, 2003). Neither splicing nor 30 end formation is essential for export of synthetic mRNAs injected into the Xenopus oocyte nucleus (Jarmolowski et al., 1994; Rodrigues et al., 2001); however, the processing requirements for export of mRNAs synthesized in situ by Pol II may be more stringent. Failure to remove introns causes transcripts to be retained in the nucleus by a mechanism that recognizes splicing intermediates (Chang and Sharp, 1989; Legrain and Rosbash, 1989). Splicing is not essential for export of microinjected RNA, but it can help direct a transcript to the mRNA-specific export pathway (Ohno et al., 2002). Although splicing has been reported to enhance the rate of mRNA export (Luo and Reed, 1999), recent studies indicate that splicing does not have a direct role in export (Lu and Cullen, 2003; Nott et al., 2003). Several lines of evidence argue that maturation of the 30 end by cleavage/polyadenylation (Brodsky and Silver, 2000; Dower et al., 2004; Dower and Rosbash, 2002; Eckner et al., 1991; Hammell et al., 2002; Huang and Carmichael, 1996; Wickens and Gurdon, 1983) is important for mRNA export. Generation of a 30 end by ribozyme cleavage in vivo is not sufficient to permit mRNA export in most cases (Eckner et al., 1991; Huang and Carmichael, 1996; Libri et al., 2002); however, there are some exceptions. In yeast (Dower et al., 2004) but not mammalian cells (Huang and Carmichael, 1996), ribozyme

Molecular Cell 748

cleavage downstream of a poly(A) tract rescued some mRNA export. Furthermore, export has been observed for ribozyme-terminated, nonadenylated TRP4 mRNA in yeast (Duvel et al., 2002) and histone mRNA in HeLa cells (Eckner et al., 1991). These exceptions notwithstanding, it is widely accepted that natural 30 end formation is critical for export of mRNAs transcribed in situ, although these studies have been confined to unspliced mRNAs. Because splicing and 30 end processing are interdependent, it has been difficult to clearly distinguish their effects on export. It is not known, for example, if a 30 end generated by ribozyme cleavage is sufficient for export of a spliced mRNA. In this report, we investigated whether there is a functional connection between transcript release from the DNA template and pre-mRNA processing. We show that transcripts synthesized by Pol II with a mutant CTD (mutC-ter) have impaired splicing and are retained at the gene after transcription is shut off. When RNAs were released from the site of transcription by a selfcleaving hepatitis d ribozyme in the 30 flanking region, splicing was restored both to transcripts synthesized by Pol II mutC-ter and to those with a mutant poly(A) site. Previously, the site of transcription has been operationally defined as a focus of nuclear FISH signal. For the purposes of discussion, we use the term release from the site of transcription interchangeably with release from the DNA template. It should be noted, however, that a fraction of the RNA could remain in the vicinity of the gene after it has been cleaved with a ribozyme. Ribozyme cleavage appears to bypass a mechanism that normally retains transcripts in a niche where they are not accessible to the splicing machinery if they have not completed poly(A) site cleavage. Spliced but not unspliced b-globin mRNAs with 30 ends formed by a ribozyme were exported to the cytoplasm. The cleavagepolyadenylation requirement for splicing and export of this mRNA can therefore be avoided if release from the site of transcription is effected by a ribozyme. Results RNAs Synthesized by a Pol II CTD Mutant Are Retained at the Site of Transcription We asked if the Pol II CTD was required for mRNA release from the site of transcription. For these experiments, we used a mutant of the CTD called mut-Cter in which the sequence of the 10 amino acid motif that lies C-terminal of heptad 52 has been scrambled. We chose mut-Cter because it causes a less drastic disruption of pre-mRNA processing than large deletions of the heptad repeats (see Figure S1 in the Supplemental Data available with this article online). This mutation destabilizes the Pol II large subunit (Chapman et al., 2004) and inhibits splicing and poly(A) site cleavage but not capping (Fong et al., 2003). Expression vectors for a-amanitinresistant Pol II large subunits (wt and mut-Cter) were transiently transfected into a 293 EBNA cell line with multiple copies of an episome with an EBV ori and an intronless hygromycin resistance (hygror) gene. Using RNA FISH, we monitored nuclear hygror transcripts synthesized by Pol II with either wt CTD or mutC-ter in cells treated with a-amanitin. Hybridization signals were quantified before and after inhibiting transcription with actino-

mycin D (Act D) to monitor release of transcripts from sites of transcription as previously described (Custodio et al., 1999). As expected, in cells expressing wt Pol II CTD, Act D substantially reduced the number of nuclear hybridization foci per cell by 67%, consistent with most transcripts being released from sites of transcription (Figures 1Aa–1Af; Figure 1B). In contrast, cells expressing Pol II mutC-ter showed only a 16% reduction in the number of RNA hybridization foci (Figures 1Ag–1Al; Figure 1B). We conclude from these experiments that transcripts synthesized by Pol II mutC-ter are not efficiently released from the site of transcription. Ribozyme Cleavage Downstream of the Gene Reverses Splicing Defects Caused by Mutation of the CTD Transcripts made by Pol II with the mutC-ter CTD mutation are not only retained at the site of transcription but are also poorly spliced and cleaved at the poly(A) site in both mammalian cells and microinjected Xenopus oocytes (Fong et al., 2003). Using the oocyte system, we investigated whether there is coupling between release and processing by splicing or cleavage/polyadenylation. We asked if these pre-mRNA processing events are affected if the transcript is released from the DNA by the action of a self-cleaving ribozyme. For these experiments, a CMV b-globin reporter gene was made with a variant hepatitis d ribozyme inserted 265 bases downstream of the strong synthetic poly(A) site (SPA) (b-globinSPA Ribo+265, Figure 2A). This ribozyme, which generates 20 30 cyclic phosphate and 50 OH ends, was shown previously to cleave efficiently in yeast cells (Coller et al., 1998), and in oocytes, cleavage was greater than 95% as determined by ribonuclease protection assay (RPA) (Figure 3B, lanes 5 and 6). As a control, a mutant ribozyme sequence with a single inactivating C76-U substitution (Perrotta et al., 1999) was used (b-globinSPA mutRibo+265, Figure 2A). We inserted a hairpin loop derived from the 30 end of histone mRNA one base 50 of the ribozyme cleavage site to stabilize the upstream RNA (Eckner et al., 1991; Huang and Carmichael, 1996). Oocytes were first injected with expression vectors for a-amanitin-resistant Rpb1 with either wt CTD or mutCter. After an interval for protein expression, the oocytes were reinjected with VA and ribozyme containing CMV b-globin reporter genes plus a-amanitin. Under these conditions, all transcription is exclusively carried out by Pol II that has incorporated the a-amanitin-resistant large subunit. Consistent with previous results (Fong et al., 2003), the Pol II mutCter CTD mutant reduced splicing (Figure 2B, lanes 1 and 3), though the effect is less than that observed for a deletion of the CTD (Figure S1), probably because capping is inhibited to a greater extent by CTD deletion. Remarkably, a functional ribozyme (wt) situated downstream of the b-globin gene rescued splicing of introns 1 and 2 in transcripts made by the Pol II mutCter mutant compared to the mutant ribozyme (mut) control. In the experiment shown in Figure 2B, ribozyme cleavage improved splicing of both introns 1 and 2 by over 30% relative to the mutant ribozyme control (Figure 2B, lanes 3, 4, 7, and 8). For reasons we do not understand, in some batches of oocytes, the percent splicing of mut-Cter transcripts cleaved by the ribozyme

Transcript Release and Pre-mRNA Processing 749

Figure 1. CTD Mutation Causes RNA Retention at the Site of Transcription (A) 293EBNA CAT hygro #15 cells with multiple copies of a stable EBV-based episome with a hygror gene were transfected with a-amanitinresistant expression vectors for Rpb1 with wt and mutant CTD C termini and selected with a-amanitin. Hygror transcripts were visualized by RNA FISH 2 and + Act D (5 mg/ml) for 30 min. (B) Quantitation of hygror RNA at sites of transcription by RNA FISH. Mean values for numbers of transcription foci from three independent experiments are shown with standard deviations. For each experimental condition, an average of 28 cells was analyzed. Data was normalized to mean value (3.1 per cell) for the wt Pol II Cter without Act D. Note that the sites of transcription are reduced in Act D-treated cells expressing Pol II wt but not Pol II mutC-ter.

was actually greater than with the wt CTD C terminus. In contrast, the ribozyme had little or no effect on splicing of transcripts made by Pol II with the wt CTD C terminus (Figure 2B, lanes 1, 2, 5, and 6). The difference between the effect of the ribozyme on splicing of RNAs made by wt versus mut C-ter Pol II could not be explained by altered frequency of exon 2 skipping caused by CTD mutation as determined by RT-PCR (data not shown). The total amount of b-globin transcripts relative to the VA injection control was not significantly affected by the wt ribozyme relative to the mutant (Figure 2B, lanes 5–8), indicating that ribozyme cleavage does not have a marked effect on stability of these RNAs. Consistent with this conclusion, ribozyme cleavage does not affect the stability of pre-mRNA in mammalian cells (Nott et al., 2003). We conclude from these experiments that ribozyme cleavage at the 30 end of a message can rescue the splicing defect in transcripts synthesized by Pol II mutC-ter. We also investigated whether ribozyme cleavage enhanced 30 end processing of transcripts made by Pol II mutCter. For transcripts made by Pol II mutCter, pro-

cessing at the SPA poly(A) site was unaffected by ribozyme cleavage (Figure 2C, lanes 3 and 4). This result therefore shows that the stimulation of splicing caused by the ribozyme (Figure 2B) cannot be explained as a secondary effect of improved 30 end processing. Unlike the Pol II CTD mutant, ribozyme cleavage reproducibly inhibited 30 end processing at SPA for transcripts made by wt Pol II (Figure 2C, lanes 1 and 2). This phenomenon is investigated further below (Figure 4). Ribozyme Cleavage Restored Splicing of Transcripts with a Mutant Poly(A) Site We next asked whether ribozyme cleavage downstream of the gene could also rescue the splicing defect caused by mutation of the poly(A) site. For these experiments, wt or mutant hepatitis d ribozyme sequences were inserted 115 bases downstream of the AAGAAA mutant b-globin poly(A) site in a reporter gene that contains the fibronectin splicing enhancer in exon 3. In the context of the AAGAAA mutant, human b-globin transcripts are completely inactive for poly(A) site cleavage (Fong and Bentley, 2001). As a result of the poly(A) site

Molecular Cell 750

Figure 2. Ribozyme Cleavage Downstream of the Gene Partially Rescues the Splicing Defect Caused by a Pol II CTD Mutant (A) Map of b-globin reporter genes with wild-type (Ribo) and mutant ribozyme (mut) hepatitis d ribozymes preceded by a histone stem loop. The poly(A) site SPA is marked by down arrow and the ribozyme cut site by an up arrow. Antisense RNase protection probes are marked below the maps. (B) RPA of b-globin intron 1 (lanes 1–4) and intron 2 (lanes 5–8) splicing of pCMV b-globinSPARibo/mutRibo+265 transcripts in Xenopus oocytes expressing a-amanitin-resistant Pol II wt or Pol II mutC-ter. a-amanitin was coinjected to inhibit host cell Pol II. Percent spliced relative to total RNA is noted below each lane. Total b-globin RNA normalized to VA varied by less than 12% between Ribo and mutRibo constructs. Similar stimulation of splicing of Pol II mutC-ter transcripts with a functional ribozyme was observed in three batches of oocytes. (C) RPA analysis of cleavage at SPA poly(A) site of pCMV b-globinSPARibo/mutRibo+265 in oocytes. RNA samples are the same as in (B). An irrelevant band (*) appeared in RNA from some but not all oocyte batches (see Figure 4B). Note that the ribozyme reduced SPA cleavage for transcripts synthesized by Pol II wt but not mutC-ter.

mutation, splicing of introns 1 and 2 is inhibited (Fong and Bentley, 2001). Oocytes were injected with the bglobin A2GA3FNRibo/mutRibo+115 reporter genes (Figure 3A), and splicing of introns 1 and 2 was assayed by RPA. Remarkably, the wt ribozyme significantly stimulated splicing of introns 1 and 2 relative to mutant ribozyme (Figure 3B, lanes 1–4). The wt ribozyme also slightly increased the ratio of exon 2 inclusion to exon 2 exclusion (Figure 3C), suggesting that it also helps enforce the correct order of exon splicing. 50 end mapping showed that the start site and the efficiency of transcription initiation were unaffected by the ribozyme (Figure 3B, lanes 1 and 2, top panel). It is conceivable that ribozyme cleavage could influence the stability of RNA with a mutant poly(A) site and thereby alter the ratio of spliced to unspliced transcripts, although it did not appear to affect the stability of transcripts with a wt poly(A) site (Figure 2B). We tested whether the ribozyme specifically stabilized b-globin mRNA lacking introns by asking if it enhanced the accumulation of cDNA transcripts. b-globin cDNA reporter genes (Figure 3A) with wt or mutant ribozyme inserted 115 bases 30 of the mutant poly(A) site, AAGAAA, were coinjected with a VA control plasmid, and transcripts were quantified by RPA. Wt ribozyme did not significantly enhance the steady-state level of b-globin cDNA transcripts relative to the mutant ribozyme after normal-

izing to the VA injection control (Figure 3D). We conclude that ribozyme cleavage does not detectably stabilize b-globin mRNA-lacking introns. We examined whether the effect of ribozyme cleavage on splicing of pre-mRNA with a mutant poly(A) site is conserved in mammalian cells. 293 cells were transfected with the b-globin reporter genes that have wt or mutant ribozymes inserted 600 bases 30 of the AAGAAA mutant poly(A) site (Figure 3A). As a positive control, we used a b-globin reporter with a strong poly(A) site, SPA, and mutant ribozyme (CMV b-globinSPA mutRibo+265, Figure 2A). The results in Figure 3E (lanes 1 and 2) showed that, as in oocytes, ribozyme cleavage restored splicing that had been impaired by a mutant poly(A) site, though not to the same level as in the control with SPA poly(A) site (Figure 3E, lane 3). As in oocytes, ribozyme cleavage did not selectively stabilize globin cDNA transcripts relative to a mutant ribozyme control (data not shown). This control indicates that the apparent increase in splicing caused by the ribozyme (Figure 3E, lanes 1 and 2) is not caused by differential RNA stability. In summary, the results in Figures 2 and 3 show that splicing defects resulting from either CTD mutation or poly(A) site mutation can be at least partially reversed by cleaving with a ribozyme situated at either of two positions (+265 or +600) downstream of the gene (Figures 6C and 6D).

Transcript Release and Pre-mRNA Processing 751

Figure 3. Ribozyme Cleavage Restored Splicing of Transcripts with a Mutant Poly(A) Site (A) Maps of reporter genes pCMVb-globinA2GA3FNRibo/mutRibo+115, pCMV b-globinA2GA3Ribo/mutRibo+600, and pCMVb-globincDNAA2 GA3 Ribo/mutRibo+115 as in Figure 2A. Fibronectin splicing enhancer (FN) and mutant AAGAAA poly(A) site (t) are marked, as well as antisense riboprobes and ribozyme cut site (up arrow). (B) RPA of b-globin intron 1 (lanes 1 and 2), intron 2 (lanes 3 and 4), and ribozyme cleavage (lanes 5 and 6) of pCMV b-globin A2GA3FNRibo/mutRibo+115 transcripts in Xenopus oocytes. RNA accumulation from Ribo and mutRibo constructs differed by less than 2%, as determined by the 50 end probe (lanes 1 and 2, top panel) relative to VA (bottom panel). Similar stimulation of splicing by the ribozyme was observed in each of four independent batches of oocytes tested. (C) Ribozyme cleavage inhibits skipping of b-globin exon 2. 32P-RT-PCR analysis of oocyte RNA as in (B), using primers in exons 1 and 3. There was no signal in RT2 controls. Percent inclusion of exon 2 after compensating for 32P content is marked. (D) Ribozyme cleavage does not stabilize b-globin cDNA transcripts in Xenopus oocytes. RPA mapping 50 ends of pCMVb-globincDNA A2GA3 Ribo/mutRibo+115 transcripts in oocytes. The amount of b-globin relative to the VA injection control differed by less than 3% between Ribo and mutRibo. (E) RPA of b-globin intron 2 splicing of pCMV b-globinA2GA3FN Ribo/mutRibo+115 and pCMV b-globinSPA mutRibo+265 (Figure 2A) transcripts plus VA control from transiently transfected 293 cells. Note improved splicing with ribozyme cleavage (lane 2).

Ribozyme Cleavage of the Tether between Pol II and the Poly(A) Site Disrupts 30 End Processing We also investigated how release of the RNA transcript from the polymerase by a ribozyme would affect cleavage at the poly(A) site. For these experiments WT and mutant hepatitis d ribozyme sequences were inserted either 265 or 745 bases downstream of the synthetic poly(A) site in CMV b-globinSPA (Figure 4A). These constructs were injected into Xenopus oocytes and the effi-

ciency of cleavage at the synthetic poly(A) site (SPA) was assayed. As a control, the parent plasmid without a ribozyme insertion was also injected (Figure 4B, lane 1). The mutant ribozyme at either +265 or +745 did not significantly alter 30 end processing relative to the control without a ribozyme sequence (Figure 4B, lanes 1, 2, and 4). The wt ribozyme also had no effect when inserted at +745, but it inhibited poly(A) site cleavage from 94% to 73% when inserted at position +265 relative

Molecular Cell 752

Figure 4. Ribozyme Cleavage within a Short Distance Downstream of the Poly(A) Site Inhibits 30 End Processing (A) Maps of pCMVb-globinSPARibo/mutRibo+265 and +745. (B) RPA of cleavage at SPA in oocytes injected with pCMVb-globinSPA without ribozyme (lane 1), pCMV b-globinSPA mutRibo/Ribo+265 (lanes 2 and 3), or pCMV b-globinSPA mutRibo/Ribo+745 (lanes 4 and 5). Note inhibition of cleavage by the ribozyme at +265 (lane 3) but not at +745 (lane 5).

to SPA (Figure 4B, lanes 2 and 3). A similar inhibition of poly(A) site cleavage by the ribozyme at +265 occurred in the experiment shown in Figure 2C (lanes 1 and 2) and was observed in each of three independent batches of oocytes tested. These data suggest that ribozyme cleavage within a particular distance downstream of the poly(A) site inhibits processing at that site. This result is consistent with the model that an intact RNA linking Pol II to the poly(A) site is necessary for efficient cotranscriptional 30 end processing (Figures 6A and 6B). Transcripts Released from the Site of Transcription by Ribozyme Cleavage Are Exported to the Cytoplasm We asked whether spliced transcripts with 30 ends formed by a ribozyme rather than by factor-mediated cleavage/polyadenylation could be exported to the cytoplasm. Oocytes were coinjected with b-globin genes with a mutated poly(A) site plus wt or mutant ribozyme (Figure 3A) as well as VA control plasmid, and RNA was isolated from nucleus and cytoplasm. VA transcripts partitioned to both nuclear and cytoplasmic fractions in oocytes, although a cryptic Pol II VA transcript (asterisk in Figure 5A, bottom panel) was predominantly cytoplasmic. b-globin transcripts with an AAGAAA mu-

tant poly(A) site and an inactive downstream ribozyme were mostly unspliced and nuclear (Figure 5A, lanes 1 and 2). In contrast, transcripts with the mutant poly(A) site that were cleaved by wt ribozyme were spliced to a significant extent and, surprisingly, these spliced mRNAs were almost entirely cytoplasmic (Figure 5A, lanes 3 and 4). As expected, spliced transcripts from the control plasmid with a strong poly(A) site were also mostly cytoplasmic (Figure 5A, lanes 5 and 6). Most of the cytoplasmic transcripts made from the b-globin AA GAAA-FN wt ribozyme construct were in fact cleaved at the ribozyme as determined by RPA (Figure 5B, lanes 3 and 4). Furthermore, they were predominantly poly(A)2 as determined by oligo dT fractionation (Figure 5B, lanes 5 and 6). The export of these spliced transcripts to the cytoplasm confirms that ribozyme cleavage does actually cause release from the site of transcription. The export is unlikely to be influenced by the terminal histone 30 end sequence, because stem-loop binding protein (SLBP), which may bind this element, does not have an mRNA export function (Erkmann et al., 2005), and our constructs lack sequences upstream of the stem loop that enhance export. As previously reported (Wickens and Gurdon, 1983), we observed a fraction of mRNAs in oocytes that was not spliced but was nevertheless

Transcript Release and Pre-mRNA Processing 753

Figure 5. Spliced b-globin mRNA with a Ribozyme-Cleaved 30 End Is Exported to the Cytoplasm (A) RPA of b-globin intron 2 splicing of nuclear (N) and cytoplasmic (C) transcripts from oocytes injected with pCMV b-globin A2GA3FNmutRibo/ Ribo+115 (lanes 1–4, Figure 3A) and pCMV b-globinSPA mutRibo+265 (lanes 5 and 6, Figure 2A). Percent total RNA in the cytoplasm (%cyto) is marked. Asterisk denotes cryptic Pol II VA transcripts. Efficient export of spliced ribozyme-terminated b-globin transcripts (lane 4) was observed in three batches of oocytes. (B) RPA of ribozyme cleavage (lanes 1–4) from oocyte nuclear (N) and cytoplasmic (C) transcripts of CMVb-globinA2GA3FN mutRibo/Ribo+115 as in (A). Lanes 5, 6 RPA of oligo dT-fractionated cytoplasmic CMVb-globinA2GA3FN Ribo+115 transcripts from injected oocytes. The control is rabbit b-globin mRNA that was spiked in. Note that most cytoplasmic transcripts are cleaved at the wt ribozyme and poly(A)2. (C) RPA of b-globin intron 2 splicing of nuclear (N) and cytoplasmic (C), transcripts from 293 cells transfected with pCMV b-globin A2GA3 mutRibo/Ribo+600 (lanes 1–4, Figure 3A) and pCMVb-globinSPA mutRibo+265 (lanes 5 and 6, Figure 2A). Note export of ribozyme-terminated, spliced transcripts (lanes 3 and 4). (D) RPA of nuclear and cytoplasmic b-globin transcripts from oocytes injected with genomic (pCMVb-globinA2GA3FNRibo+115; lanes 1 and 2, Figure 3A) or cDNA (pCMVb-globincDNA A2GA3Ribo+115; lanes 3 and 4, Figure 3A) reporter genes. Percent cytoplasmic is given for the spliced genomic and cDNA transcripts marked by the asterisk. Note that cDNA transcripts were exported as well or slightly better than spliced genomic transcripts in all three batches of oocytes tested.

exported to the cytoplasm (Figure 5A, lane 6) in a process that is probably stimulated by cleavage/polyadenylation at SPA. We investigated whether the export of globin transcripts with 30 ends formed by a ribozyme also occurred in mammalian cells. 293 cells were transfected with globin reporter genes bearing the AAGAAA mutant poly(A) site and either wt or mutant ribozyme (Figure 3A). As expected, the wt ribozyme enhanced splicing relative to the mutant (Figure 5C, compare lanes 1 and 2 with 3 and 4). Furthermore, the spliced mRNAs with a ribozyme 30 end were largely cytoplasmic (Figure 5C, lanes 3 and 4), similar to spliced mRNAs from a control gene with the SPA poly(A) site (Figure 5C, lanes 5 and 6). Eighty-five

percent of total RNA with the wt ribozyme was cytoplasmic, relative to 30% with the mutant ribozyme. These results therefore show that spliced transcripts released from the site of transcription by a self-cleaving ribozyme are competent for export to the cytoplasm independent of normal 30 end processing in both Xenopus oocytes and mammalian cells. To determine whether splicing was essential for export of globin mRNAs with ribozyme-generated 30 ends, we compared export of mRNAs transcribed from genes with and without introns. Oocytes were injected with the b-globin cDNA and genomic DNA constructs with mutant poly(A) site (AAGAAA) and a hepatitis d ribozyme situated downstream (Figure 3A). Nuclear and

Molecular Cell 754

Figure 6. The Connections between Transcript Release and pre-mRNA Processing (A) Cotranscriptional splicing and 30 end processing aided by recruitment of 30 end processing factors, CstF, and CPSF to the Pol II CTD. The 50 cap and spliced intron lariat are marked. Exons are yellow. The RNA tether connecting Pol II to the poly(A) site (AAUAAA) is red. Poly(A) site cleavage is marked by scissors. (B) Cleavage by a ribozyme (scissors) downstream of the gene inhibits 30 end processing by severing the RNA tether linking the poly(A) site to the polymerase, thereby destabilizing the 30 end processing complex. It is not known whether ribozyme cleavage causes release of CstF/CPSF from the CTD. (C) CTD mutation (mut CTD) or poly(A) site mutation (AAGAAA) inhibits splicing and 30 end processing. (D) Ribozyme cleavage rescues splicing, perhaps by releasing the RNA from a niche where it is inaccesible to splicing factors.

cytoplasmic RNA was assayed by RPA. As we observed previously, spliced transcripts with 30 ends generated by the ribozyme partitioned mostly to the cytoplasm, whereas unspliced pre-mRNAs were retained in the nucleus (Figure 5D, lanes 1 and 2). Sixty percent of spliced genomic mRNA and 68% of unspliced cDNA transcripts with ribozyme-generated 30 ends were cytoplasmic (Figure 5D). In summary, these results show that ribozymeinduced release from the DNA template can bypass the cleavage/polyadenylation requirement for mRNA export, although it cannot bypass the nuclear retention of intron-containing transcripts. Discussion Disruption of 30 End Processing by Severing the RNA Tether between Pol II and the Poly(A) Site We investigated whether transcript release from the DNA template affects pre-mRNA processing by splicing and cleavage/polyadenylation. According to current models of 30 end processing and termination, poly(A) site cleavage occurs in the context of pre-mRNA that is still tethered to the elongating Pol II. Cleavage is thought to be aided by recruitment of processing factors to the Pol II CTD. We tested this model by asking whether 30 end processing would be affected if the transcript was severed downstream of the poly(A) site by a ribozyme, thereby disrupting its connection to the polymerase. A functional ribozyme located 265 bases down-

stream of the poly(A) site consistently inhibited processing relative to a mutant ribozyme control (Figures 2C and 4B). In contrast, a ribozyme located 745 bases downstream of the poly(A) site had no inhibitory effect (Figure 4B). A similar inhibition of 30 end processing was observed in a coupled in vitro transcription/30 end processing system when RNA downstream of the poly(A) site was severed by RNaseH (Rigo et al., 2005 [this issue of Molecular Cell]). Note that when the CTD was mutated and recruitment of processing factors was therefore probably impaired, the inhibitory effect of ribozyme cleavage on 30 end processing was lost (Figure 2C). These results are consistent with the model that an RNA tether between the poly(A) site and Pol II is indeed important for efficient cotranscriptional 30 end formation but that this tether is only required within a window of time corresponding to the period for polymerase to transcribe about 700 bases past the poly(A) site. In close agreement with this result, previous experiments showed that polymerase transcribes 500–700 nucleotides past the poly(A) site before cleavage actually takes place (Bauren et al., 1998; Chao et al., 1999). Together, these observations suggest that an intact RNA chain between the poly(A) site and polymerase enhances assembly or stabilization of an active cleavage/polyadenylation complex within the interval, during which polymerase transcribes approximately 500–700 bases past the poly(A) site (Figures 6A and 6B). The importance of an RNA tether linking polymerase with the 30 end

Transcript Release and Pre-mRNA Processing 755

processing site furthermore suggests that efficient processing must precede termination of transcription that would disrupt this connection. CTD-Dependent Release from the Site of Transcription Normally, release of the mRNA involves cotranscriptional pre-mRNA cleavage at the poly(A) site and a less-well-defined step mediated by the exosome that clears mRNA away from the site of transcription (Hilleren et al., 2001). Mutation of splicing and poly(A) consensus sites or 30 end processing factors causes RNA retention at the site of transcription (Custodio et al., 1999; Hilleren et al., 2001; Libri et al., 2002). We report that the CTD is also required for efficient transcript release from the site of transcription. Mutation of the CTD by scrambling of the 10 residue C-terminal motif (mutC-ter) inhibited splicing and 30 end processing but not capping (Fong et al., 2003). Intronless hygror pre-mRNAs synthesized by Pol II mutC-ter were mostly retained at the site of transcription for at least 30 min after inhibition of transcription by Act D (Figure 1). In contrast, RNA synthesized by wt Pol II mostly disappeared from sites of transcription over this period (Figure 1). These results show that the CTD is required for transcript release from the site of transcription, which is, at least in part, a consequence of its role in facilitating pre-mRNA processing. Splicing Is Stimulated by Ribozyme-Induced Release from the DNA Template To analyze further the relationship between processing and mRNA release from the DNA template, we induced release by inserting a hepatitis d ribozyme in the 30 flanking region of the b-globin gene. Ribozyme cleavage stimulated splicing that had been inhibited by transcribing the gene with a Pol II CTD mutant, mutC-ter (Figure 2B). Splicing is also inhibited by mutation of the poly(A) site (Fong and Bentley, 2001; Niwa and Berget, 1991), possibly due to disruption of interactions between 30 end processing factors and splicing factors (Lutz et al., 1996; Vagner et al., 2000). When the ribozyme was inserted downstream of a b-globin gene with an inactive poly(A) site, splicing of both introns 1 and 2 was enhanced relative to a control with a mutant ribozyme (Figures 3B, 3E, 6C, and 6D). We also noted that ribozyme cleavage caused a small increase in exon 2 inclusion relative to an abnormal splicing pattern that skips exon 2 (Figure 3C). This observation indicates that transcript release may affect not only the efficiency of splicing but also its fidelity. Together, these results suggest that a 30 cleavage event, independent of processing factors, is able to enhance splicing of upstream introns. One possible explanation for how a ribozyme stimulates splicing is that the 30 end itself functions to permit definition of the last exon; however, this is not consistent with in vitro splicing of transcripts with defined 30 ends. Instead, we interpret these experiments to suggest that liberation of the RNA from the DNA template permits it to become accessible to splicing factors. These results highlight a significant difference between cotranscriptional 30 end processing, which requires an intact RNA tether to the polymerase, and splicing of 30 introns, which is enhanced by severing the RNA tether.

Export of mRNA with a 30 End Made by a Ribozyme In several previous studies, unspliced mRNAs with 30 ends generated by ribozyme cleavage were not efficiently exported to the cytoplasm (Dower et al., 2004; Eckner et al., 1991; Huang and Carmichael, 1996; Libri et al., 2002). The implication of these experiments is that 30 end formation by the cleavage/polyadenylation machinery is required for export. We examined export of spliced mRNA that underwent ribozyme cleavage to generate a 30 end. Surprisingly, the majority of these RNAs were exported to the cytoplasm, both in Xenopus oocytes and mammalian cells (Figures 5A, 5C, and 5D). In contrast, unspliced RNAs were mostly nuclear, consistent with retention of splicing intermediates (Chang and Sharp, 1989; Legrain and Rosbash, 1989). These results therefore show that 30 end processing at the poly(A) site is not essential for export of spliced mRNAs. Splicing could contribute to export of these mRNAs independently of cleavage/polyadenylation (Luo and Reed, 1999). However, this possibility was not supported by our finding that a ribozyme-terminated b-globin cDNA transcript was exported comparably to a spliced RNA with the same 30 end (Figure 5D). In contrast to our results, poor export of ribozyme-terminated RNAs was observed in some (Dower et al., 2004; Libri et al., 2002) but not all (Duvel et al., 2002) studies in yeast. This discrepancy may reflect a closer connection between export and 30 end processing in yeast than in metazoans. Because only a small minority of yeast genes has introns, tight integration with 30 end processing may be the best way to select mature mRNAs for export. Our observations are consistent with previous results employing in vitro-synthesized and microinjected mRNAs, which demonstrate that export does not absolutely require in vivo cleavage/polyadenylation or splicing (Jarmolowski et al., 1994; Rodrigues et al., 2001). These results do not eliminate the possibility, however, of a difference in the kinetics of export depending on whether the transcript has been processed by splicing or cleavage/polyadenylation. The export of nonadenylated b-globin mRNA with a ribozyme-generated 30 end differs from the poor export in mammalian cells of ribozyme-terminated HIV and neor RNA (Eckner et al., 1991; Huang and Carmichael, 1996). One explanation for these apparent discrepancies is that 30 end processing may be more important for export of unspliced HIV proviral RNA than it is for b-globin mRNA lacking introns. It is also possible that b-globin RNA may be exported independently of 30 end processing to a greater degree than other sequences, such as the prokaryotic neor RNA, because of tighter association with RNA binding proteins that promote export, such as SR proteins and REF1 (Huang et al., 2003; Rodrigues et al., 2001). Coupling of Splicing with Transcript Release Although most or all introns are probably marked for splicing cotranscriptionally, actual excision does not always occur at the site of transcription. Introns at the 50 end of the 40 kb long BR1 gene are predominantly removed from the nascent transcript, whereas those at the 30 end are mostly removed posttranscriptionally (Bauren et al., 1998; Bauren and Wieslander, 1994). Our results suggest that posttranscriptional excision of 30 introns is enforced by a mechanism that couples

Molecular Cell 756

transcript release with splicing. Ribozyme cleavage downstream of the poly(A) site can stimulate splicing of b-globin introns 1 and 2 in the context of a mutant Pol II CTD or a mutant poly(A) site. Under these circumstances, splicing is actually dependent on transcript release. This conclusion is consistent with the fact that little or no splicing of the last intron of the Chironomus BR1 gene occurred before polymerase was released at a position 500–700 bp downstream of the poly(A) site (Bauren et al., 1998). The b-globin gene is relatively short, and this may account for why a ribozyme 30 of the poly(A) site can stimulate splicing of the 50 and 30 introns. In longer genes, it is likely that a ribozyme in the 30 flanking region would only stimulate splicing of those introns closest to the 30 end. Our results imply that transcripts that have extended to the 30 end but have yet to be processed at the poly(A) site are retained in a niche at the transcription site where they are not available to be spliced. If a transcript is released from the DNA by a ribozyme, it can escape this niche and become competent to complete splicing. Based on these observations, we propose that the late stages of mRNA biogenesis are coordinated by a mechanism that prevents splicing of introns near the 30 end of the gene until the transcript has been released. Coordination of release from the site of transcription with removal of the last introns would ensure that transcripts are not fully spliced unless proper 30 end processing by cleavage at the poly(A) site had been completed. This mechanism could serve a quality control function by preventing production of spliced RNAs lacking correctly processed 30 ends. Such transcripts could be deleterious if they were exported to the cytoplasm. Ribozyme-induced release of the RNA bypasses this mechanism and rescues splicing in the absence of normal 30 end processing. In summary, our results suggest a new connection between splicing and transcript release that coordinates the final steps in mRNA biogenesis. Experimental Procedures Oocyte Injections Oocytes were injected as previously described (Bird et al., 2004), with 1 ng of each plasmid in 23 nl. a-amanitin was injected at 25 mg/ml. The Pol III-transcribed pSPVA plasmid (1 pg/oocyte) was a control for injection efficiency and RNA recovery. RNA was isolated using RNA-Bee (Tel-Test Inc.). Nuclear and cytoplasmic fractionation of oocytes was done under mineral oil. RNA Analysis Nuclear and cytoplasmic RNA from 293 cells was prepared by lysing in 10 mM HEPES (pH 7.6), 10 mM NaCl2, 3 mM CaCl2, and 0.5% NP40. Nuclei were pelleted, and the cytoplasmic supernatant fraction was ethanol precipitated. RNA was isolated using RNA-Bee. RNase protection with globin and VA RNase protection probes has been described (Fong and Bentley, 2001). Undigested probe was resolved from protection products in all cases. VA was used as a loading control. Results were quantified by Molecular Dynamics Phosphor-Imager, and the percent processed was calculated as the signal for spliced or cleaved product divided by the sum of processed plus unprocessed signals after compensating for 32P-U content. 32 P-dC-labeled b-globin RT-PCR products were amplified (30 cycles, 59º annealing) with exon 1 forward (50 -GAAGTTGGTGGTG AGGCCCTG-30 ) and exon 3 reverse (50 -AAAGCGAGCTTAGTGATA CTTG-30 ) primers.

Plasmids pAT7Rpb1DC+WTCter, pAT7Rpb1DC +mutCter, pAT7Rpb1DCTD (Fong et al., 2003), pSPVA, and pCMVb-globinSPA (Bird et al., 2004) were described previously. pCMVb-globinSPARibo/mutRibo+265 and pCMVb-globinA2GA3 FNRibo/mutRibo+115 were made by inserting fragments comprising a histone stem loop and a variant hepatitis d ribozyme or mutant ribozyme with a C76-U substitution into the SapI site 115 bases 30 of the b-globin poly(A) site. Ribozyme cleavage occurs 1 base after the histone stem loop sequence GGCCCT TATC AGGGCC (stem underlined). The ribozyme sequence that immediately follows the stem loop is A*GGGCGGCATGGTCCCAGCCTCCTCGCTGGCGCCGCC TGGGCAACATGCTTCGGCATGGCGAATGGGACCAAAT. C76 is underlined and the cut site is marked by an asterisk. CMVbglobinSPARibo/mutRibo+745 and pCMV b-globinA2GA3 Ribo/mutRibo+600 were made by inserting the ribozyme sequences into a PstI site 600 bases 30 of the b-globin poly(A) site. CMV b-globincDNA A2GA3Ribo/mutRibo+115 were made by cloning a b-globin RT-PCR product into SacI-EcoRI-digested pCMVbglobinA2GA3FNRibo/MutRibo+115. pHEBOlexop2Gal5HIV2CAT contains the CAT reporter gene in the HindIII site of the EBV ori plasmid pHEBO1 (a gift from W. Sugden, University of Wisconsin). pBS globin wt Ribo+115 used to make riboprobe is derived from pCMVb-globinA2GA3FNRibo+115 and extends 220 bases 50 of the cut site. Cell Culture 293 EBNA cells (Invitrogen) were transfected with pHEBOlexop2 Gal5HIV2CAT bearing the HSVTKhygror gene. A stable hygromycinresistant clone (293 EBNACAThygro #15) with multiple copies of the episome was selected and verified by Southern blotting. 293 cells were transiently transfected using CaPO4 precipitation as described (Fong and Bentley, 2001). RNA FISH 293 EBNACAThygro #15 cells were grown on polylysine-coated coverslips and transfected with Rpb1 expression vectors using Lipofectamine 2000 (GIBCO). After 12–16 hr, a-amanitin (5 mg/ml) was added, and cells were incubated overnight. Cells were fixed (4% paraformaldehyde, 120 mM glucose, in PBS) for 20 min and permeabilized with PBS 0.2% Triton X-100 for 5 min on ice and washed three times with PBS and twice with 23 SSC for 5 min each at room temperature. Nick-translated dig-dUTP-labeled pJ6Uhygro probe (100–200 ng) was hybridized to cover slips overnight at 37º in 23 SSC, 1 mg/ml yeast tRNA, 5% dextran sulfate, 1 mM EDTA (pH 8.0), and 10 mM Tris-HCl (pH 7.2), washed in 23 SSC, and reacted with a-dig-fluorescein ab (Roche 1 mg/ml) in 43 SSC, 0.25% BSA, and 1 mg/ml Hoechst 33342. Images were acquired using a Zeiss Axiovert 200M and Cooke Sensicam camera with SlideBook software (Intelligent Imaging Innovations). Optical sections were taken at 1 mm spacing and deconvolved using a nearest-neighbor algorithm. Foci were counted in compressed Z stacks using NIH ImageJ. Supplemental Data Supplemental Data include one figure and can be found with this article online at http://www.molecule.org/cgi/content/full/20/5/747/ DC1/. Acknowledgments We thank D. Spector and T. Misteli for advice on RNA FISH; J. Kieft, T. Blumenthal, M. Macmorris, S. Kim, K. Glover, and S. Kuersten for helpful discussions; and H. Martinson for communicating unpublished results. We are particularly grateful to K. Pfenninger for support of J.C.G. and for microscope facilities. We thank the UCHSC Cancer Center Sequencing Laboratory and Animal Care facilities. Supported by NIH Grant GM58163 to D.L.B. and a predoctoral training grant NIH T32-GM0870 to G.B. Received: August 12, 2005 Revised: October 21, 2005

Transcript Release and Pre-mRNA Processing 757

Accepted: November 9, 2005 Published: December 8, 2005

Hilleren, P., McCarthy, T., Rosbash, M., Parker, R., and Jensen, T.H. (2001). Quality control of mRNA 30 -end processing is linked to the nuclear exosome. Nature 413, 538–542.

References

Hirose, Y., and Manley, J.L. (2000). RNA polymerase II and the integration of nuclear events. Genes Dev. 14, 1415–1429.

Bauren, G., and Wieslander, L. (1994). Splicing of Balbiani ring 1 gene pre-mRNA occurs simultaneously with transcription. Cell 76, 183–192.

Huang, Y., and Carmichael, G.C. (1996). Role of polyadenylation in nucleocytoplasmic transport of mRNA. Mol. Cell. Biol. 16, 1534–1542.

Bauren, G., Belikov, S., and Wieslander, L. (1998). Transcriptional termination in the Balbiani ring 1 gene is closely coupled to 30 -end formation and excision of the 30 -terminal intron. Genes Dev. 12, 2759–2769.

Huang, Y., Gattoni, R., Stevenin, J., and Steitz, J.A. (2003). SR splicing factors serve as adapter proteins for TAP-dependent mRNA export. Mol. Cell 11, 837–843.

Bentley, D.L. (2005). Rules of engagement: co-transcriptional recruitment of pre-mRNA processing factors. Curr. Opin. Cell Biol. 17, 251–256. Bird, G., Zorio, D.A., and Bentley, D.L. (2004). RNA polymerase II carboxy-terminal domain phosphorylation is required for cotranscriptional pre-mRNA splicing and 30 -end formation. Mol. Cell. Biol. 24, 8963–8969. Brodsky, A.S., and Silver, P.A. (2000). Pre-mRNA processing factors are required for nuclear export. RNA 6, 1737–1749.

Jarmolowski, A., Boelens, W.C., Izaurralde, E., and Mattaj, I.W. (1994). Nuclear export of different classes of RNA is mediated by specific factors. J. Cell Biol. 124, 627–635. Konarska, M.M., Padgett, R.A., and Sharp, P.A. (1984). Recognition of cap structure in splicing in vitro of mRNA precursors. Cell 38, 731–736. Krainer, A.R., Maniatis, T., Ruskin, B., and Green, M.R. (1984). Normal and mutant human b-globin pre-mRNAs are faithfully and efficiently spliced in vitro. Cell 36, 993–1005.

Chang, D.D., and Sharp, P.A. (1989). Regulation by HIV Rev depends upon recognition of splice sites. Cell 59, 789–795.

Legrain, P., and Rosbash, M. (1989). Some cis- and trans-acting mutants for splicing target pre-mRNA to the cytoplasm. Cell 57, 573–583.

Chao, L.C., Jamil, A., Kim, S.J., Huang, L., and Martinson, H.G. (1999). Assembly of the cleavage and polyadenylation apparatus requires about 10 seconds in vivo and is faster for strong than for weak poly(A) sites. Mol. Cell. Biol. 19, 5588–5600.

Lewis, J.D., Izaurralde, E., Jarmolowski, A., Mcguigan, C., and Mattaj, I.W. (1996). A nuclear cap-binding complex facilitates association of u1-snrnp with the cap-proximal 50 splice-site. Genes Dev. 10, 1683–1698.

Chapman, R.D., Palancade, B., Lang, A., Bensaude, O., and Eick, D. (2004). The last CTD repeat of the mammalian RNA polymerase II large subunit is important for its stability. Nucleic Acids Res. 32, 35–44.

Libri, D., Dower, K., Boulay, J., Thomsen, R., Rosbash, M., and Jensen, T.H. (2002). Interactions between mRNA export commitment, 30 -end quality control, and nuclear degradation. Mol. Cell. Biol. 22, 8254–8266.

Coller, J.M., Gray, N.K., and Wickens, M.P. (1998). mRNA stabilization by poly(A) binding protein is independent of poly(A) and requires translation. Genes Dev. 12, 3226–3235.

Lu, S., and Cullen, B.R. (2003). Analysis of the stimulatory effect of splicing on mRNA production and utilization in mammalian cells. RNA 9, 618–630.

Cullen, B.R. (2003). Nuclear RNA export. J. Cell Sci. 116, 587–597.

Luo, M.J., and Reed, R. (1999). Splicing is required for rapid and efficient mRNA export in metazoans. Proc. Natl. Acad. Sci. USA 96, 14937–14942.

Custodio, N., Carmo-Fonseca, M., Geraghty, F., Pereira, H.S., Grosveld, F., and Antoniou, M. (1999). Inefficient processing impairs release of RNA from the site of transcription. EMBO J. 18, 2855–2866. Dower, K., and Rosbash, M. (2002). T7 RNA polymerase-directed transcripts are processed in yeast and link 30 end formation to mRNA nuclear export. RNA 8, 686–697. Dower, K., Kuperwasser, N., Merrikh, H., and Rosbash, M. (2004). A synthetic A tail rescues yeast nuclear accumulation of a ribozymeterminated transcript. RNA 10, 1888–1899. Duvel, K., Valerius, O., Mangus, D.A., Jacobson, A., and Braus, G.H. (2002). Replacement of the yeast TRP4 30 untranslated region by a hammerhead ribozyme results in a stable and efficiently exported mRNA that lacks a poly(A) tail. RNA 8, 336–344. Eckner, R., Ellmeier, W., and Birnstiel, M.L. (1991). Mature mRNA 30 end formation stimulates RNA export from the nucleus. EMBO J. 10, 3513–3522. Erkmann, J.A., Sanchez, R., Treichel, N., Marzluff, W.F., and Kutay, U. (2005). Nuclear export of metazoan replication-dependent histone mRNAs is dependent on RNA length and is mediated by TAP. RNA 11, 45–58. Flaherty, S.M., Fortes, P., Izaurralde, E., Mattaj, I.W., and Gilmartin, G.M. (1997). Participation of the nuclear cap binding complex in premRNA 30 processing. Proc. Natl. Acad. Sci. USA 94, 11893–11898. Fong, N., and Bentley, D. (2001). Capping, splicing and 30 processing are independently stimulated by RNA polymerase II: different functions for different segments of the CTD. Genes Dev. 15, 1783–1795. Fong, N., Bird, G., Vigneron, M., and Bentley, D.L. (2003). A 10 residue motif at the C-terminus of the RNA pol II CTD is required for transcription, splicing and 30 end processing. EMBO J. 22, 4274–4282. Hammell, C.M., Gross, S., Zenklusen, D., Heath, C.V., Stutz, F., Moore, C., and Cole, C.N. (2002). Coupling of termination, 30 processing, and mRNA export. Mol. Cell. Biol. 22, 6441–6457.

Lutz, C.S., Murthy, K.G., Schek, N., O’Connor, J.P., Manley, J.L., and Alwine, J.C. (1996). Interaction between the U1 snRNP-A protein and the 160-kD subunit of cleavage-polyadenylation specificity factor increases polyadenylation efficiency in vitro. Genes Dev. 10, 325–337. McCracken, S., Fong, N., Rosonina, E., Yankulov, K., Brothers, G., Siderovski, D., Hessel, A., Foster, S., Shuman, S., and Bentley, D.L. (1997a). 50 -capping enzymes are targeted to pre-mRNA by binding to the phosphorylated carboxy-terminal domain of RNA polymerase II. Genes Dev. 11, 3306–3318. McCracken, S., Fong, N., Yankulov, K., Ballantyne, S., Pan, G.H., Greenblatt, J., Patterson, S.D., Wickens, M., and Bentley, D.L. (1997b). The C-terminal domain of RNA polymerase II couples messenger RNA processing to transcription. Nature 385, 357–361. Misteli, T., and Spector, D.L. (1999). RNA polymerase II targets pre-mRNA splicing factors to transcription sites in vivo. Mol. Cell 3, 697–705. Niwa, M., and Berget, S.M. (1991). Mutation of the AAUAAA polyadenylation signal depresses in vitro splicing of proximal but not distal introns. Genes Dev. 5, 2086–2095. Niwa, M., Rose, S.D., and Berget, S.M. (1990). In vitro polyadenylation is stimulated by the presence of an upstream intron. Genes Dev. 4, 1552–1559. Nott, A., Meislin, S.H., and Moore, M.J. (2003). A quantitative analysis of intron effects on mammalian gene expression. RNA 9, 607–617. Ohno, M., Segref, A., Kuersten, S., and Mattaj, I.W. (2002). Identity elements used in export of mRNAs. Mol. Cell 9, 659–671. Perrotta, A.T., Shih, I., and Been, M.D. (1999). Imidazole rescue of a cytosine mutation in a self-cleaving ribozyme. Science 286, 123–126.

Molecular Cell 758

Proudfoot, N.J., Furger, A., and Dye, M.J. (2002). Integrating mRNA processing with transcription. Cell 108, 501–512. Rigo, F., Kazerouninia, A., Nag, A., and Martinson, H.G. (2005). The RNA tether from the Poly(A) signal to the polymerase mediates coupling of transcription to cleavage and polyadenylation. Mol. Cell 20, this issue, 733–745. Rodrigues, J.P., Rode, M., Gatfield, D., Blencowe, B.J., Carmo-Fonseca, M., and Izaurralde, E. (2001). REF proteins mediate the export of spliced and unspliced mRNAs from the nucleus. Proc. Natl. Acad. Sci. USA 98, 1030–1035. Vagner, S., Vagner, C., and Mattaj, I.W. (2000). The carboxyl terminus of vertebrate poly(A) polymerase interacts with U2AF 65 to couple 30 -end processing and splicing. Genes Dev. 14, 403–413. Wickens, M.P., and Gurdon, J.B. (1983). Post-transcriptional processing of simian virus 40 late transcripts in injected frog oocytes. J. Mol. Biol. 163, 1–26.