- Email: [email protected]
Ribulose-1,5-bisphosphate regeneration limitation in rice leaf photosynthetic acclimation to elevated CO2
Plant Science 175 (2008) 348–355
Contents lists available at ScienceDirect
Plant Science journal homepage: www.elsevier.com/locate/plantsci
Ribulose-1,5-bisphosphate regeneration limitation in rice leaf photosynthetic acclimation to elevated CO2 Dao-Yun Zhang a, Gen-Yun Chen a, Zi-Ying Gong a, Juan Chen a, Zhen-Hua Yong a, Jian-Guo Zhu b, Da-Quan Xu a,* a Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences; Graduate School of the Chinese Academy of Sciences, Shanghai 200032, China b State Key Laboratory of Soil and Sustainable Agriculture, Institute of Soil Science, Chinese Academy of Sciences, Nanjing 210008, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 December 2007 Received in revised form 28 April 2008 Accepted 13 May 2008 Available online 22 May 2008
Our previous study has demonstrated that both RuBP carboxylation limitation and RuBP regeneration limitation exist simultaneously in rice grown under free-air CO2 enrichment (FACE, about 200 mmol mol1 above the ambient air CO2 concentration) conditions [G.-Y. Chen, Z.-H. Yong, Y. Liao, D.-Y. Zhang, Y. Chen, H.-B. Zhang, J. Chen, J.-G. Zhu, D.-Q. Xu, Photosynthetic acclimation in rice leaves to free-air CO2 enrichment related to both ribulose-1,5-bisphosphate carboxylase limitation and ribulose1,5-bisphosphate regeneration limitation. Plant Cell Physiol. 46 (2005) 1036–1045]. To explore the mechanism for forming of RuBP regeneration limitation, we conducted the gas exchange measurements and some biochemical analyses in FACE-treated and ambient rice plants. Net CO2 assimilation rate (Anet) in FACE leaves was remarkably lower than that in ambient leaves when measured at the same CO2 concentration, indicating that photosynthetic acclimation to elevated CO2 occurred. In the meantime the maximum electron transport rate (ETR) (Jmax), maximum carboxylation rate (Vcmax) in vivo, and RuBP contents decreased significantly in FACE leaves. The whole chain electron transport rate and photophosphorylation rate reduced significantly while ETR of photosystem II (PSII) did not significantly decrease and ETR of photosystem I (PSI) was significantly increased in the chloroplasts from FACE leaves. Further, the amount of cytochrome (Cyt) f protein, a key component localized between PSII and PSI, was remarkably declined in FACE leaves. It appears that during photosynthetic acclimation the decline in the Cyt f amount is an important cause for the decreased RuBP regeneration capacity by decreasing the whole chain electron transport in FACE leaves. ß 2008 Elsevier Ireland Ltd. All rights reserved.
Keywords: Cytochrome b6f complex Electron transport FACE Photosynthetic acclimation RuBP carboxylation RuBP regeneration
1. Introduction It is well known that the net CO2 assimilation rate (Anet) by photosynthesis in plants subjected to long-term exposure to high CO2 concentrations is significantly lower than that in plants grown in ambient air when measured at the same CO2 concentration [1–3]. This phenomenon is generally termed acclimation or downregulation of photosynthesis [4]. Moore et al. [5] considered that a reduction in the ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) content is central to the photosynthetic acclimation response, and they proposed a model describing the sugar signaling control of the Rubisco protein during photosynthetic acclimation to
* Corresponding author at: Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, 300 Fenglin Road, Shanghai 200032, China. Tel.: +86 21 54924231; fax: +86 21 54924015. E-mail address: [email protected] (D.-Q. Xu). 0168-9452/$ – see front matter ß 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.plantsci.2008.05.008
elevated CO2. Further, photosynthetic acclimation to high CO2 concentrations has been almost entirely attributed to the loss of active Rubisco [6]. The decreased Rubisco content or ribulose-1,5-bisphosphate (RuBP) carboxylation limitation, however, may not be the sole limitation to photosynthesis during photosynthetic acclimation to elevated CO2. A decreased capacity for or a limitation of RuBP regeneration may also be involved in photosynthetic acclimation [7–9]. It is well known that under optimal temperature and saturating light, Anet in C3 plants is limited by the Rubisco capacity at lower CO2 levels, while it is limited by RuBP regeneration capacity at elevated CO2 levels [10]. In addition, it was predicted that a rise in the atmospheric CO2 will exacerbate RuBP limitation unless Rubisco is downregulated and/or RuBP regeneration is upregulated [11]. Indeed, some reports demonstrate the upregulation of the regeneration capacity of RuBP and inorganic phosphate (Pi) concomitant with Rubisco downregulation [12,13]. Nevertheless, whether the downregulation of Rubisco and/or upregula-
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
349
Seeds of Japonica 9915 were germinated in a seedbed in the absence of a water layer and with ambient air, and the seedlings were transplanted into the plots of the experimental field in midJune. The planting density was 17 cm 25 cm. Nitrogen (N) was supplied as urea (NH2CONH2) (85%) and (NH4)2 HPO4 (15%) at 250 kg N ha1 (normal N supply for local rice fields), with 40% of N supplied as a basal dressing, 20% on the fifth day after transplanting, and 40% at the panicle initiation stage. Phosphorus was applied at 75 kg P2O5 ha1. The soil was flooded before transplanting, and a water layer of 5 cm above soil level was maintained except during several occasions when the field was drained.
tion of RuBP regeneration are sufficient to avoid RuBP regeneration limitation and the mechanism leading to this limitation are yet unclear. Some studies imply that there are 3 possible mechanisms leading to RuBP regeneration limitation through Pi deficiency, decreased activity of enzymes related to RuBP regeneration, and decreased electron transport capacity. First, the RuBP regeneration could be limited by Pi regeneration or Pi deficiency during sucrose and starch syntheses [14], while Pi deficiency may be induced by accumulation of phosphorylated intermediates when the formation rate of the sugar phosphates exceeds the rate of sucrose synthesis and export. Second, a specific reduction in the chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPDH), chloroplastic fructose-1,6-bisphosphatase (cpFBPase), and sedoheptulose-1,7-bisphosphatase (SBPase) activities by the antisense RNA technique led to a reduction in the RuBP regeneration capacity [15–17]. Surprisingly, however, the RuBP levels did not decline until more than 60% of the phosphoribulokinase (PRK) activity had been removed [18]. Third, a reduction of the photosynthetic electron transport capacity could impair RuBP regeneration because the regeneration is limited by the supply of ATP and NADPH while the production of NADPH and ATP depends on photosynthetic electron transport [19,20]. However, based on the measurements of ATP and NADPH, Arulanantham et al. [21] suggested that RuBP regeneration is not limited directly by the supply of ATP and NADPH. It is more likely that photosynthetic electron transport influences the RuBP regeneration through PRK modulation in the photosynthetic carbon reduction cycle. It is still unclear which of the 3 possible mechanisms could be responsible for RuBP regeneration limitation under elevated CO2 conditions. In a previous paper [9], we suggested that both RuBP carboxylation limitation and RuBP regeneration limitation exist simultaneously in rice grown under FACE (free-air CO2 enrichment conditions) and the former is mainly due to the decreased Rubisco. The mechanism for forming of RuBP regeneration limitation, however, is not yet clear. The main objective of this study was to reveal the mechanism.
Gas exchange measurements were performed in situ using the portable gas analysis system LI-6400 (LI-COR Inc., Lincoln, NE, USA) with 10–12 fully expanded leaves per ring between 10:00 and 14:30 (Beijing time). These measurements were performed alternately in FACE and ambient rings. At the tillering and jointing stages, the second most fully expanded leaves counted from the top of the plant were used, while the fully expanded flag leaves were used at the heading and filling stages. The leaf Anet value of rice plants grown in FACE and ambient rings were measured at 580 mmol CO2 mol1. During the measurements, the CO2 concentration was controlled with the LI-COR CO2 injection system, and a saturating photosynthetic photon flux density (PPFD) of 1200 mmol m2 s1 from the LI-COR LED light source was supplied. Air temperature of the leaf chamber was maintained at approximately 30 8C. Before recording the data, the measured leaves were kept in the leaf chamber for at least 2 min to attain a steady state of photosynthesis. To plot the Anet–Ci curve, CO2 was set at concentrations of 380 (580 for FACE leaves), 250, 200, 150, 100, 50, 380, 480, 580, 650, 750, 900, and 1050 mmol mol1, and the PPFD was maintained at 1200 mmol m2 s1. The maximum carboxylation rate (Vcmax) and the maximum electron transport rate (ETR) (Jmax) in vivo were calculated as described by Farquhar et al. [19] and Long and Bernacchi [24], respectively.
2. Materials and methods
2.3. Chlorophyll fluorescence measurements
2.1. FACE facilities and rice growth
We measured the chlorophyll fluorescence in flag rice leaves in situ at a PPFD of 1200 mmol m2 s1 and 580 mmol CO2 mol1 using the portable gas analysis system LI-6400 with a leaf chamber fluorometer (LCF) (LI-COR Inc., Lincoln, NE, USA) according to the method described in the manual (Book 5). The in vivo electron transport rate was calculated from the measured chlorophyll fluorescence parameters (F 0m and Fs: maximal fluorescence intensity in any light adapted state and fluorescence intensity in the steady state, respectively) using the following equation: 0 ðF m F s Þ ETR ¼ f I aleaf F 0m
The FACE facilities were located at Xiaoji village (1198420 000 E, 328350 0500 N), Yangzhou City, in Jiangsu Province, East China. This site is located in a region for rice production in China. The running and controlling systems of the facilities were transferred from a Japanese FACE site [22]. A full description of Chinese FACE facilities has been provided by Liu et al. [23]. Briefly, there were 6 rings in the experimental field, and each ring had a diameter of 15 m. Of these, 3 were sprayed with pure CO2 as FACE treatment, and the others were in the normal atmosphere as ambient control. The distances between the FACE and ambient rings were greater than 90 m. The target CO2 concentration at the center of the FACE rings was 200 mmol mol1 above the ambient air CO2 concentration. We initiated CO2 enrichment of rice plants in FACE rings immediately after transplanting rice seedlings, and the enrichment was continuously applied until the plants were harvested. In this study, we used the rice (Oryza sativa L.) cultivar Japonica 9915, which is a new cultivar that is commonly cultivated in this region. Its growth duration (from the time of transplantation to harvest) is approximately 130 days (from mid-June to midOctober). It was cultivated using the typical agronomic management techniques employed for this region.
2.2. Gas exchange measurements
where f is the fraction of absorbed quanta that is used by photosystem II (PSII), and it is typically assumed to be 0.5 for C3 plants, I is incident photon flux density (mmol m2 s1), and aleaf is the leaf absorbance and is assumed to be 0.84 as described by Gesch et al. [25]. 2.4. Leaf sampling At the filling stage, about 60 flag leaves per ring were collected in the light during 10:30–13:00. The detached leaves were excised
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
350
into 7.5-cm long segments (excluding the tip and base) and immediately dropped into liquid N2 and preserved at 80 8C for biochemical analysis.
2.8. RNA Isolation and RT-PCR (Rreverse-transcription polymerase chain reaction)
For enzyme activity assays, the liquid N2-frozen leaves were used. GAPDH and 3-phosphoglyceric acid kinase (PGK) activities were measured spectrophotometrically at 25 8C by the methods described by Wolosiuk and Buchanan [26] and Pacold and Anderson [27], respectively. For determining the PRK activity, leaf discs (total area, 1 cm2) were ground in liquid N2 and extracted using 1 ml of 200 mM Tris–HCl (pH 7.8) containing 200 mM KCl, 0.5 mM EDTA, 20 mM isoascorbate, and 20 mM 2-mercaptoethanol at 4 8C. After centrifugation at l0,000 g for 3 min, the obtained supernatant was diluted 20-fold with the extraction buffer mentioned above and assayed immediately at 25 8C by coupling ADP formation to NADH oxidation by using pyruvate kinase and lactate dehydrogenase (Sigma, St. Louis, MC, USA) in the presence of 20 mM dithiothreitol to ensure full activation of PRK, exactly as described by Kagawa [28].
Total RNA was extracted from rice leaves by using TRIzol, according to the instructions of the manufacturer (Invitrogen, Carlsbad, CA, USA). RNA was quantified by UV spectrophotometry at 260 and 280 nm (A260/A280 2.0) and confirmed by 1.5% denaturing agarose gel electrophoresis and ethidium bromide staining. Primer pairs were designed based on the gene sequence for the specific amplification of mRNAs of certain genes by reverse-transcription polymerase chain reaction. The primers and the genes amplified are listed in Table 1. DNA was removed from total RNA extracts by treatment with RNase-free DNase I (Promega, Madison, WI, USA). RT-PCR was performed in a 25-ml reaction mixture containing 5 ml Superscript III buffer and 0.5 ml Superscript III reverse transcriptaseTaq polymerase enzyme (Invitrogen) with 1.0 mg total RNA and gene-specific primer pair (10 ng each, approximately 20-mer). The RT-PCR products were separated by electrophoresis on 1.2% agarose gels, stained with ethidium bromide, and photographed under UV light using Tanon Imaging System (GIS 2010, Tanon Corporation, China). The amplification product of each RT-PCR reaction was cloned into a pMD18-T vector (Promega) and sequenced.
2.6. Determination of RuBP and 3-PGA contents
2.9. Reverse Northern blot
RuBP was extracted according to Vu et al. [7] with some modifications. RuBP was extracted from the liquid N2-frozen leaf powder with 0.5 M HCl. After centrifugation at 16,000 g for 5 min at 2 8C, the supernatant was adjusted to pH 8.2 with 2 M Tris-Base and 4 M KOH. The RuBP was then transformed into 3-PGA by adding the pH-adjusted supernatant to an assay buffer (0.1 M Tris–HCl (pH 8.2), 10 mM NaHCO3, 20 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, and 150 mg Rubisco from spinach). Then, 3-PGA was determined as described by Seemann and Sharkey [29].
In order to prepare hybridization templates more conveniently, a pair of specific primers were designed according to pMD18-T vector sequence at the cloning site (F: 50 -GCGGATAACAATT-TCACACAG-30 and R: 50 -CCAGGGTTTTCCCAGTCAC-30 ). Equal amount of each PCR product (approximately 1 mg) was loaded into 1.5% agarose gels. These DNA samples were then transferred to nylon membranes (Amersham Biosciences). Total RNAs were extracted from rice flag leaves collected at the filling stage. Radiolabeled cDNA probes were synthesized by reverse transcription of 10 mg of total RNA for 1 h in the presence of 100 mCi [32P]-dCTP with the Superscript III reverse transcriptase (Invitrogen). Hybridization of probes derived from each RNA sample and one set of transcript-derived fragments obtained above was performed in 0.5 M Na-phosphate buffer (pH 7.2) containing 7% SDS at 65 8C for 16 h. The hybridization product was washed first for 5 min twice with washing buffer I (40 mM Naphosphate, 1 mM EDTA, and 5% SDS), and then it was washed 4 times with washing buffer II for 10 min (40 mM Na-phosphate, 1 mM EDTA, and 1% SDS). Hybridization signals were first observed on Kodak X-ray films and then quantified by a dot hybridization system (Tanon 2.20, China).
2.5. Enzyme activity assays
2.7. Assay of chloroplast electron transport and photophosphorylation Chloroplasts were isolated from fresh rice leaves according to the method of Jagendorf and Avron [30]. Measurements of chloroplast non-cyclic electron transport (with H2O as the electron donor and FeCN as the electron acceptor) rates were performed according to the method of Krogmann and Jagendorf [31]. The electron transport rates of PSII and PSI were measured as described by Baena-Gonza´lez et al. [32]. Chloroplast photophosphorylation was measured as described by Wei et al. [33], and the amount of ATP formed in the reaction was analyzed using the luciferin–luciferase method [34]. Chlorophyll content was determined according to the method described by Arnon [35].
2.10. Western blot Thylakoids were isolated from frozen rice flag leaves as described by Hong and Xu [36] and all solutions contained
Table 1 Nomenclature and specific primers designed for RT-PCR of genes in rice Gene
Accession no.
Protein
Forward primer sequence
Reverse primer sequence
lhcb2 psbA petA petD petE lhca psaA psaB atpA atpB ubi
D00642 P0048G02.44 P0018C10.41 NP_039416 P20423 OJ1065_B06.19-1 NP_039383 NP_039382 OSJNBb005J14.21 AB037543 AY954394
LHCb2 D1 protein Cyt f Cyt b6/f complex subunit IV Plastocyanin Lhca Psa A Psa B CF1 a subunit CF1 b subunit Ubiqutin
ATCACCATGCGCCGCACCGT TTCCAGGCAGAGCATAACATCC CCCCGACCCTGCTATGAAGA ATGGGAGTAACAAAGAAACCTGA CGGGCGGAGGAGGATGAGAT ACCCCATCTTTCCCCAACAACA ATGAGTGCTTTAGGTCGTCCC GTTGAATGCTGTTAACGAGAA GGGACTAGGGGTATTGCTCTGA ATTAATGAAAAAAATCTTGAGGA ATGCAGATCTTTGTGAAGAC
CGCCTCCCCGAACTTCACCC CGTTCGTGCATTACTTCCATAC GACGGATGCGAAGAAGAACAA AACAAGAAGAAGCGTAGGCAG GGTGAGCGTGACGGAGAAGGT CACCATTCACAGCCTACTCCGA CCAAGATTTGCTTTATCGGGT CCCTGCCATAATGTGATGTGT CTACTGCTGTTTTGCCGGTTTG TGTTGTAGCAGGAGCAGGGTCGG ACCACCACGGAGACGGAG
Primer sequences are listed from 50 to 30 terminal.
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
1 mM phenylmethane-sulfonyl fluoride (PMSF, Merck, Germany). Thylakoid membrane proteins were loaded on 15% SDS-PAGE gels containing 4 M urea. For Western blot analysis, the polypeptides were transferred from the gel of the SDS-PAGE to the nitrocellulose membrane (Amersham Pharmacia, Buckinghamshire, England) with a semi-dry transfer cell (Amersham Pharmacia). Antibodies against couple factor 1 (CF1) and LHCII b2 were prepared from rabbit antisera by respective immunization with the purified CF1 from tobacco leaves and soybean LHCII b2 subunit expressed in Escherichia coli in our laboratory. Cyt f antibody was a gift from Dr. Li-Xin Zhang and the D1 protein antibody is a commercial polyclonal antibody obtained from the AgriSera Company, Sweden. For quantification of the above proteins, bands of the Western blots were scanned using a laser densitometer (Gel-Doc, Tanon, China).
351
3.4. Effects of FACE on activities of several enzymes in the photosynthetic carbon reduction cycle In FACE leaves, the activity of PRK was significantly enhanced while those of GAPDH and PGK exhibited no significant change (Fig. 4). These results may indicate that the declined RuBP regeneration capacity in FACE leaves is not related to the changes in activities of these enzymes. 3.5. Effects of FACE on electron transport and photophosphorylation To explore the relation of RuBP regeneration to photosynthetic electron transport, ETR was measured in rice leaves. The results revealed that the ETR in vivo calculated from the chlorophyll
2.11. Statistical analysis The effect of elevated CO2 on photosynthesis was analyzed by the general linear model (GLM) procedure of the SPSS 12 for Windows (SPSS Inc., Chicago, USA). Measurements were made in all the 6 rings. Data were arranged in a block design and analyzed for the effects of rings (blocks) and elevated CO2. This analysis revealed no significant ring effects on the gas exchange. Consequently, the ring factor was excluded from the analysis of the biochemical parameters, and measurement data were then analyzed using a t-test for the effect of elevated CO2. 3. Results 3.1. Photosynthetic acclimation to FACE Our previous work revealed that when measured at their growth CO2 concentration, the Anet of rice plants grown in FACE rings was significantly higher than those grown in ambient rings [9]. However, when measured at the same CO2 concentration of 580 mmol mol1, the Anet in FACE leaves was significantly lower than that in ambient leaves at the jointing, heading, and filling stages, but not at the tillering stage (Fig. 1). This indicates that acclimation or downregulation of photosynthesis occurs at the last 3 stages but not at the tillering stage in rice plants grown under FACE conditions. Although stomatal conductance (Gs) decreased significantly in most cases, no significant change in intercellular CO2 concentration (Ci) was observed in FACE leaves, as compared with that in ambient leaves (Fig. 1), suggesting that photosynthetic acclimation to elevated CO2 is not due to the decreased Gs in FACE leaves. 3.2. Anet–Ci curve The Anet–Ci curve revealed that FACE leaves had a lower CO2saturated Anet value and a smaller initial slope (Fig. 2A). The in vivo Jmax and Vcmax values calculated from the Anet–Ci curve data (Fig. 2A) were significantly decreased in FACE leaves (Fig. 2B). The decreases in these values indicate that photosynthetic acclimation or decreased Anet in FACE leaves is related to limitation of both RuBP carboxylation and RuBP regeneration. 3.3. Effects of FACE on RuBP and 3-PGA contents The RuBP content was significantly reduced and the 3-PGA content was significantly increased in FACE leaves as compared to those in ambient leaves (Fig. 3). This may imply that the capacities of both RuBP regeneration and triose-phosphate utilization were declined in FACE leaves.
Fig. 1. Net CO2 assimilation rate (Anet), stomatal conductance (Gs), and intercellular CO2 concentration (Ci) in rice leaves measured at the same CO2 concentration (580 mmol mol1). Open and filled columns represent the ambient and FACE leaves, respectively. Each value in this figure is the mean of 3 rings (10 leaves were measured per ring). Asterisks (*) and (**) represent significant (P < 0.05) and very significant (P < 0.01) differences between the FACE and ambient leaves, respectively. T: tillering stage, J: jointing stage, H: heading stage, and F: filling stage.
352
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
Fig. 4. The activities of GAPDH, PGK and PRK in rice flag leaves. Open and filled columns represent the ambient and FACE leaves, respectively. Each value in this figure is the mean of 6 determinations (each determination used 6 leaves from the three FACE or ambient rings). The asterisk (*) represents a significant (P < 0.05) difference between the FACE and ambient leaves.
ited a slight change (Fig. 5B). This may imply that the component leading to the reduced ETR of the whole chain in FACE leaves is between PSII and PSI but not within them. Consistent with the reduced electron transport rate, the photophosphorylation rate in the chloroplasts from FACE leaves was significantly lower than that in those from ambient leaves (Fig. 5C). Fig. 2. The responses of light-saturated net assimilation rate (Anet) to the intercellular CO2 concentration (Ci) in the flag leaves of rice plants cultured in ambient (open circles and columns) and FACE (filled circles and columns) rings. Measurements were made at the filling stage. Each value in this figure is the mean of 3 rings (two leaves were measured in each rings). Vcmax and Jmax were calculated from Anet–Ci curve data. Asterisk (*) and (**) represent significant (P < 0.05) and very significant (P < 0.01) differences between FACE and ambient leaves, respectively.
fluorescence data was significantly reduced in FACE leaves (Fig. 5A). In chloroplasts isolated from FACE leaves, ETR of the whole chain or non-cyclic electron transport was also decreased significantly. However, the PSI electron transport activity was significantly increased and PSII electron transport activity exhib-
3.6. Effects of FACE on some components involved in forming of assimilatory power To seek the reason for the decrease of RuBP regeneration capacity in FACE leaves, the contents of some proteins involved in the formation of assimilatory power were determined. The results of western blot analysis showed that in FACE leaves Cyt f content was significantly decreased, while the LHCb2 and D1 protein contents were significantly increased but CF1 content had no significant change in FACE leaves (Fig. 6). In consonance with the significant decrease in Cyt f amount, the mRNA level of petA gene which encodes Cyt f protein was significantly declined (Fig. 7). These results indicate that the decreased RuBP regeneration capacity in FACE leaves is mainly due to a significant decrease in the Cyt f, a key component of the whole photosynthetic electron transport chain. 4. Discussion
Fig. 3. Effects of FACE on RuBP and 3-PGA contents in rice flag leaves. Open and filled columns represent the ambient and FACE leaves, respectively. Each value in this figure is the mean of 6 determinations (each determination used 6 leaves from the three FACE or ambient rings). Asterisk (*) and (**) represent significant (P < 0.05) and very significant (P < 0.01) differences between FACE and ambient leaves, respectively.
The results reported here indicate that photosynthetic acclimation to FACE occurs in rice plants when they exposed to elevated CO2 for a long time (Fig. 1). Also the photosynthetic acclimation is related to both RuBP regeneration limitation and RuBP carboxylation limitation in rice leaves (Fig. 2). The RuBP carboxylation limitation may be attributed to the decreased Rubisco content, as discussed by Chen et al. [9]. With respect to the RuBP regeneration limitation there are 3 possible reasons. The first is Pi shortage. At high CO2 and high light, a limited capacity for triose-phosphate utilization in starch and/or sucrose synthesis may result in the shortages of both Pi and ATP [11]. However, the previous study has shown that Pi content is significantly increased but not decreased in FACE leaves [9]. So the RuBP regeneration limitation in FACE leaves is unlikely to be due to Pi shortage. Indeed, the significantly raised PGA content (Fig. 3) means a limited capacity of triose-phosphate utilization (TPU) in FACE leaves. The increased PGA content may be also a symptom of enhanced Rubisco activity. Nevertheless, this possi-
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
353
Fig. 6. Effects of FACE on LHCb2, D1, Cyt f and CF1 contents in rice flag leaves. (A) Western blot of LHCb2, D1, Cyt f and CF1 on the basis of equal chlorophyll amount. (B) Quantification of Western blot as shown in (A). Each value in the part B is the mean of three repeats with SE as a bar. Considering the fact that chlorophyll content (expressed per leaf area) in FACE leaves was significantly higher than that in ambient leaves, each protein content on the basis of equal chlorophyll amount in the (A) is normalized into the amount per unit leaf area in the (B). Further, protein content in FACE leaves is shown as the percentage of ambient leaves. Asterisk (*) represents significant (P < 0.05) differences between FACE and ambient leaves.
Fig. 5. Photosynthetic electron transport rates (ETRs) and photophosphorylation rate in FACE (filled columns) and ambient (open columns) flag leaves. (A) In vivo ETR calculated on the basis of chlorophyll fluorescence parameters measured by the LI6400 leaf chamber fluorometer (LCF). Measurements were made at a saturating PPFD of 1200 mmol m2 s1 at the filling stage. Each value is the mean of 3 rings (3 leaves were measured per ring). (B) ETR of PSII, PSI and the whole electron transport chain in the chloroplasts obtained from rice leaves. (C) Photophosphorylation rates in rice chloroplasts. Each value in (B) and (C) is the mean of six determinations (Each determination used 6 leaves from the three FACE or ambient rings). Asterisks (*) and (**) represent significant (P < 0.05) and very significant (P < 0.01) differences between FACE and ambient leaves, respectively.
bility has been eliminated by the significantly decreased Vcmax (Fig. 2) and Rubisco content in FACE leaves [9]. The second is a reduction in the amount and/or activity of several enzymes catalyzing RuBP regeneration reactions. The GAPDH, PGK, and PRK are 3 essential enzymes in the RuBP regeneration process. In our FACE experiments the activities of GAPDH and PGK did not decreased significantly and that of PRK increased remarkably in FACE leaves (Fig. 4). Therefore, they are
also unlikely to be the factors leading to RuBP regeneration limitation in FACE leaves. The third is a decline in the photosynthetic electron transport capacity. It is well known that the photosynthetic carbon reduction cycle including RuBP regeneration consumes ATP and NADPH produced through chloroplast photosynthetic electron transport and coupled photophosphorylation. Therefore, the decrease in the RuBP level or RuBP regeneration capacity is associated with a reduced electron transport capacity [37]. In our study the declined RuBP content (Fig. 3) was accompanied by significantly decreased whole chain electron transport and photophosphorylation rates in FACE leaves (Fig. 5). Considering the unchanged CF1 content in FACE leaves (Fig. 6), the declined RuBP level or RuBP regeneration capacity in FACE leaves is due to a decrease in the whole chain electron transport rate (Fig. 5A and B) rather than the CF1 content. Then, where is the rate-limiting site in the photosynthetic electron transport process? It is neither in PSII nor PSI because the ETR of PSII was not significantly decreased and that of PSI was remarkably increased in FACE leaves (Fig. 5B). The D1 protein, a
354
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
transport chain but not in both PSII and PSI (Fig. 5A and B), indicating that the rate-limiting factor may be a component, e.g., Cty f or plastocyanin, between PSII and PSI rather than within them. Second, the Cyt f protein content and mRNA level were significantly lower in FACE leaves than in ambient leaves (Figs. 6 and 7). Similarly, the deficiency of Cyt f induced by growth at elevated CO2 in wheat leaves has been reported [41]. Some studies showed that the plastocyanin amount was correlated with the light-saturated photosynthetic electron transport rate in tobacco thylakoids and the gene encoding plastocyanin was repressed in the high-sugar state [42,43]. In our experiments, however, although the sugar content was higher [9], the mRNA level of the gene petE encoding plastocyanin did not exhibit any significant change in FACE leaves (Fig. 7). This may indicate that plastocyanin is not a limiting-rate site in the whole electron transport chain including PSII and PSI in FACE leaves. Unfortunately, we did not determine the plastocynin content in our study because the antibody to plastocynin was not available. It is noteworthy that upregulation of the D1 protein and LHCb2 contents (Fig. 6) as well as PRK activity (Fig. 4) was observed in FACE leaves. However, the RuBP content was significantly decreased (Fig. 3), indicating that the upregulation of these components and activity, being of benefit to RuBP regeneration is not yet sufficient to eliminate RuBP regeneration limitation to photosynthesis in FACE leaves. In conclusion, our results indicate that during photosynthetic acclimation to elevated CO2 in FACE rice leaves, the decline in Cyt f content is an important factor inducing RuBP regeneration limitation through decreasing of photosynthetic electron transport capacity of the whole chain. Acknowledgements
Fig. 7. Reverse Northern blot analysis of the expressions of some genes encoding some enzymes involved in the assimilatory power formation. (A) Electropherogram of methanol denaturing gel electrophoresis of total RNA extracted from the ambient and FACE leaves. (B) Autoradiograms of reverse Northern hybridization. The duplicate membranes were hybridized against total cDNA probes. (C) Quantification of the mRNA levels. The bands in (B) were scanned and normalized with ubiquitin control. Significance level of the differences between FACE and ambient leaves were determined by Student’s t-test (N = 3,). Asterisk indicates the difference between FACE and ambient leaves is significant (P < 0.05). For the proteins encoded by these genes in this figure, see Table 1.
core component of the PSII reaction center complex, is unlikely to be responsible for the remarkably decreased ETR of the whole chain because the amount of the D1 protein was significantly increased in FACE leaves (Fig. 6). Moreover, it is well known that in the whole photosynthetic electron transport chain the Cyt b6/f complex, a plastoquinol–plastocyanin oxidoreductase, occupies a central position and plays a unique role in both the non-cyclic electron transport involved in two photosystems and the cyclic electron transport surrounding PSI. A study suggested that Cyt f content limited the non-cyclic electron transport in spinach grown under different growth irradiances [38]. Morever, Cyt f content was highly correlated with the photosynthetic rate and the RuBP pool size at normal CO2 concentration [39]. Similarly, Sudo et al. [40] also reported that the Cyt f content was highly correlated with CO2saturated photosynthesis. Therefore, it is very probable that the Cyt b6/f complex is a rate-limiting site in the whole electron transport chain in FACE leaves. The following experimental results support this supposition. First, in the chloroplasts isolated from FACE leaves, ETR decreased significantly in the whole electron
The Chinese Rice/Wheat FACE project is a research program that is a part of the China-Japan Science and Technology Cooperation Agreement. The main instruments and apparatus of the FACE system for this project were supplied by the National Institute for Agro-Environmental Sciences (NIAES), Japan, and the National Agricultural Research Center for Tohoku Region (NARCT), Japan. This project was funded by the Chinese Academy of Sciences (CAS, KSCX2-YW-N-059, KZCX2-408, and KSCX-SW-133), the Ministry of Science and Technology, China (2005cb121106). We thank Dr. Li-Xin Zhang for the gift of the Cyt f antibody, and Prof. Jia-Mian Wei for the advice on the photosynthetic electron transport and photophosphorylation assays. References [1] D.-Q. Xu, R.M. Gifford, W.S. Chow, Photosynthetic acclimation in pea and soybean to high atmospheric CO2 partial pressure, Plant Physiol. 106 (1994) 661–671. [2] D.-Q. Xu, K. Terashima, R.F.E. Crang, X.-M. Chen, J.D. Hesketh, Stomatal and nonstomatal acclimation to a CO2-enriched atmosphere, Biotronics 23 (1994) 1–9. [3] S.P. Long, E.A. Ainsworth, A. Rogers, D.R. Ort, Rising atmospheric carbon dixide: plant FACE the future, Annu. Rev. Plant Biol. 55 (2004) 591–628. [4] B.G. Drake, M.A. Gonzalez-Meier, S.P. Long, More efficient plants: a consequence of rising atmospheric CO2? Annu. Rev. Plant Physiol. Plant Mol. Biol. 48 (1997) 609–639. [5] B.D. Moore, S.H. Cheng, D. Sims, J.R. Seemann, The biochemical and molecular basis for photosynthetic acclimation to elevated atmospheric CO2, Plant Cell Environ. 22 (1999) 567–582. [6] A. Rogers, S.W. Humpheries, A mechanistic evaluation of photosynthetic acclimation at elevated CO2, Global Change Biol. 6 (2000) 1005–1011. [7] J.C.V. Vu, L.H. Allen, K.J. Boote, G. Bowes, Effects of elevated CO2 and temperature on photosynthesis and Rubisco in rice and soybean, Plant Cell Environ. 20 (1997) 68–76. [8] A. Rey, P.G. Jarvis, Long-term photosynthetic acclimation to increased atmospheric CO2 concentration in young birch (Betula pendula) trees, Tree Physiol. 18 (1998) 441–450.
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355 [9] G.-Y. Chen, Z.-H. Yong, Y. Liao, D.-Y. Zhang, Y. Chen, H.-B. Zhang, J. Chen, J.-G. Zhu, D.-Q. Xu, Photosynthetic acclimation in rice leaves to free-air CO2 enrichment related to both ribulose-1,5-bisphosphate carboxylation limitation and ribulose1,5-bisphosphate regeneration limitation, Plant Cell Physiol. 46 (2005) 1036– 1045. [10] S. von Caemmerer, Modeling C3 Photosynthesis. Biochemical Models of Leaf Photosynthesis, CSIRO Publishing, Australia, 2000, pp. 29–71. [11] G. Bowes, Facing the inevitable: plants and increasing atmospheric CO2, Annu. Rev. Plant Physiol. Plant Mol. Biol. 44 (1993) 309–332. [12] L.H. Ziska, A.H. Teramura, Intraspecific variation in the response of rice (Oryza sativa) to increase CO2 concentration––photosynthetic, biomass and reproductive characteristics, Physiol. Plant 84 (1992) 269–274. [13] M.W. Hussain, L.H. Allen Jr., G. Bowes, Up regulation of sucrose phosphate synthase in rice grown under elevated CO2 and temperature, Photosynth. Res. 60 (1999) 199–208. [14] T.D. Sharkey, J.A. Berry, K. Raschke, Starch and sucrose synthesis in Phaseolus vulgaris as affected by light CO2 and abscisic acid, Plant Physiol. 77 (1985) 617–620. [15] J. Kobmann, U. Sonnewald, L. Willmitzer, Reduction of chloroplastic fructose-1, 6bisphosphatase in transgenic potato plants impairs photosynthesis and plant growth, Plant J. 6 (1994) 637–650. [16] G.D. Price, J.R. Evans, S. von Caemmerer, J.W. Yu, M.R. Badger, Specific reduction of chloroplast glyceraldehyde-3-phosphate dehydrogenase activity by antisense RNA reduces CO2 assimilation via a reduction in ribulose bisphosphate regeneration in transgenic tobacco plants, Planta 195 (1995) 69–378. [17] E.P. Harrison, H. Olcer, L.C. Lloyd, S.P. Long, C.A. Raines, Small decrease in SBPase cause a liner decline in the apparent RuBP regeneration rate, but not affect Rubisco carboxylation capacity, J. Exp. Bot. 52 (2001) 1779–1784. [18] M.J. Paul, J.S. Knight, D. Habash, M.A.J. Parry, D.W. Lawlor, S.A. Barnes, A. Loynes, J.C. Gray, Reduction in phosphoribulokinase activity by antisense RNA in transgenic tobacco: effect on CO2 assimilation and growth in low irradiance, Plant J. 7 (1995) 535–542. [19] G.D. Farquhar, S. von Caemmerer, J.A. Berry, A biochemical model of photosynthetic CO2 assimilation in leaves of C3 species, Planta 149 (1980) 78–90. [20] G.D. Farquhar, S. von Caemmerer, Modeling of photosynthetic responses to environmental conditions., in: O.L. Lange, P.S. Nobel, C.B. Osmond, H. Ziegler (Eds.), Encyclopedia of Plant Physiology, Physiological Plant Ecology II, New Series, vol. 12B, Springer-Verlag, Berlin, Germany, 1982, pp. 548–577. [21] A.R. Arulanantham, I.M. Rao, N. Terry, Limiting factor to photosynthesis. VI. Regeneration of ribulose1,5-bisphosphate limits photosynthesis at low photochemical capacity, Plant Physiol. 93 (1990) 1466–1475. [22] M. Okada, M. Lieffering, M. Nakamura, M. Yoshimoto, M. Kim, K. Kobayashi, Freeair CO2 enrichment (FACE) using pure CO2 injection: system description, New Phytol. 150 (2001) 251–260. [23] G. Liu, Y. Han, J.-G. Zhu, M. Okada, H. Nakamura, M. Yoshimoto, Rice–wheat rotational FACE platform. I. system structure and control, Chin. J. Appl. Ecol. 13 (2002) 1253–1258 (in Chinese). [24] S.P. Long, C.J. Bernacchi, Gas exchange measurements, what can they tell us about the underlying limitations to photosynthesis? Procedures and sources of error, J. Exp. Bot. 54 (2003) 2393–2401. [25] R.W. Gesch, L.H. Kang, M. Gallo-Meagher, J.C.V. Vu, K.J. Boote, L.H. Allen, G. Bowes, Rubisco expression in rice leaves is related to genotypic variation of photosynthesis under elevated CO2 and temperature, Plant Cell Environ. 26 (2003) 1941–1950.
355
[26] R.A. Wolosiuk, B.B. Buchanan, Studies on the regulation of chloroplast NADPlinked glyceraldehyde-3-phosphate dehydrogenase, J. Biol. Chem. 251 (1976) 6456–6461. [27] I. Pacold, L.E. Anderson, Energy charge control of the Calvin cycle enzyme 3-phosphoglyceric acid kinase, Biochem. Biophys. Res. Commun. 51 (1973) 139–143. [28] T. Kagawa, Isolation and purification of ribulose-5-phosphate kinase from Nicotiana glutinosa, in: M. Edelman, K.B. Hallick, N.H. Chua (Eds.), Methods in Chloroplast Molecular Biology, Elsevier Biomadical Press, Amsterdam, 1982, pp. 695– 705. [29] J.R. Seemann, T.D. Sharkey, Salinity and nitrogen effects on photosynthesis, ribulose-1,5-bisphosphate carboxylase and metabolite pool sizes in Phaseolus vulgaris, Plant Physiol. 82 (1986) 555–560. [30] A.T. Jagendorf, M. Avron, Cofactors and rates of photosynthetic phosphorylation by spinach chloroplasts, J. Biol. Chem. 231 (1958) 277–290. [31] D.W. Krogmann, A.T. Jagendorf, A spectrophotometric assay of the Hill reaction with ferricyanide, Plant Physiol. 32 (1957) 373–374. [32] E. Baena-Gonza´lez, Y. Allahverdiyeva, Z. Svab, P. Maliga, E.M. Josse, M. Kuntz, P. Ma¨enpa¨a¨, E.M. Aro, Deletion of the tobacco plastid psbA gene triggers an upregulation of the thylakoid-associated NAD(P)H dehydrogenase complex and the plastid terminal oxidase (PTOX), Plant J. 35 (2003) 704–716. [33] J.-M. Wei, B. Howlett, A.T. Jagendorf, Azide inhibition of chloroplast ATPase is prevented by a high protonmotive force, Biochim. Biophys. Acta 934 (1988) 72–79. [34] Mc.D.J. Stewart, G. Guinn, Chilling injury and changes in adenosine triphosphate of cotton seedlings, Plant Physiol. 44 (1969) 605–608. [35] D.I. Arnon, Copper enzymes in isolated chloroplasts, Plant Physiol. 24 (1949) 1–15. [36] S.-S. Hong, D.-Q. Xu, Light-induced increase in initial chlorophyll fluorescence Fo level and the reversible inactivation of PS II reaction centers in soybean leaves, Photosynth. Res. 61 (1999) 269–280. [37] S.A. Ruuska, T.J. Andrews, M.R. Badger, G.D. Price, S. von Caemmerer, The role of chloroplast electron transport and metabolites in modulating Rubisco activity in tobacco. Insights from transgenic plants with reduced amounts of cytochrome b/f complex or glyceraldehyde 3-phosphate dehydrogenase, Plant Physiol. 122 (2000) 491–504. [38] I. Terashima, J.R. Evans, Effects of light and nitrogen nutrition on the organization of the photosynthetic apparatus in spinach, Plant Cell Physiol. 29 (1988) 143–155. [39] G.D. Price, S. von Caemmerer, J.R. Evans, K. Siebke, J.M. Anderson, M.R. Badger, Photosynthesis is strongly reduced by antisense suppression of chloroplastic cytochrome b/f complex in transgenic tobacco, Aust. J. Plant Physiol. 25 (1998) 445–452. [40] E. Sudo, A. Makino, T. Mae, Differences between rice and wheat in ribulose-1,5bisphosphate regeneration capacity per unit of leaf-N content, Plant Cell Environ. 26 (2003) 255–263. [41] E.J. Robertson, R.M. Leech, Significant changes in cell and chloroplast development in young wheat leaves (Triticum aestivum cv Hereward) grown in elevated CO2, Plant Physiol. 107 (1995) 63–71. [42] M.A. Scho¨ttler, M. Kirchhoff, E. Weis, The role of plastocynin in the adjustment of photosynthetic electron transport to the carbon metabolism in tobacco, Plant Physiol. 136 (2004) 4265–4274. [43] O. Oswald, T.P. Martin, J. Dominy, I.A. Graham, Plastid redox state and sugars: interactive regulators of nuclear-encoded photosynthetic genes expression, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 2047–2205.
Contents lists available at ScienceDirect
Plant Science journal homepage: www.elsevier.com/locate/plantsci
Ribulose-1,5-bisphosphate regeneration limitation in rice leaf photosynthetic acclimation to elevated CO2 Dao-Yun Zhang a, Gen-Yun Chen a, Zi-Ying Gong a, Juan Chen a, Zhen-Hua Yong a, Jian-Guo Zhu b, Da-Quan Xu a,* a Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences; Graduate School of the Chinese Academy of Sciences, Shanghai 200032, China b State Key Laboratory of Soil and Sustainable Agriculture, Institute of Soil Science, Chinese Academy of Sciences, Nanjing 210008, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 December 2007 Received in revised form 28 April 2008 Accepted 13 May 2008 Available online 22 May 2008
Our previous study has demonstrated that both RuBP carboxylation limitation and RuBP regeneration limitation exist simultaneously in rice grown under free-air CO2 enrichment (FACE, about 200 mmol mol1 above the ambient air CO2 concentration) conditions [G.-Y. Chen, Z.-H. Yong, Y. Liao, D.-Y. Zhang, Y. Chen, H.-B. Zhang, J. Chen, J.-G. Zhu, D.-Q. Xu, Photosynthetic acclimation in rice leaves to free-air CO2 enrichment related to both ribulose-1,5-bisphosphate carboxylase limitation and ribulose1,5-bisphosphate regeneration limitation. Plant Cell Physiol. 46 (2005) 1036–1045]. To explore the mechanism for forming of RuBP regeneration limitation, we conducted the gas exchange measurements and some biochemical analyses in FACE-treated and ambient rice plants. Net CO2 assimilation rate (Anet) in FACE leaves was remarkably lower than that in ambient leaves when measured at the same CO2 concentration, indicating that photosynthetic acclimation to elevated CO2 occurred. In the meantime the maximum electron transport rate (ETR) (Jmax), maximum carboxylation rate (Vcmax) in vivo, and RuBP contents decreased significantly in FACE leaves. The whole chain electron transport rate and photophosphorylation rate reduced significantly while ETR of photosystem II (PSII) did not significantly decrease and ETR of photosystem I (PSI) was significantly increased in the chloroplasts from FACE leaves. Further, the amount of cytochrome (Cyt) f protein, a key component localized between PSII and PSI, was remarkably declined in FACE leaves. It appears that during photosynthetic acclimation the decline in the Cyt f amount is an important cause for the decreased RuBP regeneration capacity by decreasing the whole chain electron transport in FACE leaves. ß 2008 Elsevier Ireland Ltd. All rights reserved.
Keywords: Cytochrome b6f complex Electron transport FACE Photosynthetic acclimation RuBP carboxylation RuBP regeneration
1. Introduction It is well known that the net CO2 assimilation rate (Anet) by photosynthesis in plants subjected to long-term exposure to high CO2 concentrations is significantly lower than that in plants grown in ambient air when measured at the same CO2 concentration [1–3]. This phenomenon is generally termed acclimation or downregulation of photosynthesis [4]. Moore et al. [5] considered that a reduction in the ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) content is central to the photosynthetic acclimation response, and they proposed a model describing the sugar signaling control of the Rubisco protein during photosynthetic acclimation to
* Corresponding author at: Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, 300 Fenglin Road, Shanghai 200032, China. Tel.: +86 21 54924231; fax: +86 21 54924015. E-mail address: [email protected] (D.-Q. Xu). 0168-9452/$ – see front matter ß 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.plantsci.2008.05.008
elevated CO2. Further, photosynthetic acclimation to high CO2 concentrations has been almost entirely attributed to the loss of active Rubisco [6]. The decreased Rubisco content or ribulose-1,5-bisphosphate (RuBP) carboxylation limitation, however, may not be the sole limitation to photosynthesis during photosynthetic acclimation to elevated CO2. A decreased capacity for or a limitation of RuBP regeneration may also be involved in photosynthetic acclimation [7–9]. It is well known that under optimal temperature and saturating light, Anet in C3 plants is limited by the Rubisco capacity at lower CO2 levels, while it is limited by RuBP regeneration capacity at elevated CO2 levels [10]. In addition, it was predicted that a rise in the atmospheric CO2 will exacerbate RuBP limitation unless Rubisco is downregulated and/or RuBP regeneration is upregulated [11]. Indeed, some reports demonstrate the upregulation of the regeneration capacity of RuBP and inorganic phosphate (Pi) concomitant with Rubisco downregulation [12,13]. Nevertheless, whether the downregulation of Rubisco and/or upregula-
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
349
Seeds of Japonica 9915 were germinated in a seedbed in the absence of a water layer and with ambient air, and the seedlings were transplanted into the plots of the experimental field in midJune. The planting density was 17 cm 25 cm. Nitrogen (N) was supplied as urea (NH2CONH2) (85%) and (NH4)2 HPO4 (15%) at 250 kg N ha1 (normal N supply for local rice fields), with 40% of N supplied as a basal dressing, 20% on the fifth day after transplanting, and 40% at the panicle initiation stage. Phosphorus was applied at 75 kg P2O5 ha1. The soil was flooded before transplanting, and a water layer of 5 cm above soil level was maintained except during several occasions when the field was drained.
tion of RuBP regeneration are sufficient to avoid RuBP regeneration limitation and the mechanism leading to this limitation are yet unclear. Some studies imply that there are 3 possible mechanisms leading to RuBP regeneration limitation through Pi deficiency, decreased activity of enzymes related to RuBP regeneration, and decreased electron transport capacity. First, the RuBP regeneration could be limited by Pi regeneration or Pi deficiency during sucrose and starch syntheses [14], while Pi deficiency may be induced by accumulation of phosphorylated intermediates when the formation rate of the sugar phosphates exceeds the rate of sucrose synthesis and export. Second, a specific reduction in the chloroplast glyceraldehyde-3-phosphate dehydrogenase (GAPDH), chloroplastic fructose-1,6-bisphosphatase (cpFBPase), and sedoheptulose-1,7-bisphosphatase (SBPase) activities by the antisense RNA technique led to a reduction in the RuBP regeneration capacity [15–17]. Surprisingly, however, the RuBP levels did not decline until more than 60% of the phosphoribulokinase (PRK) activity had been removed [18]. Third, a reduction of the photosynthetic electron transport capacity could impair RuBP regeneration because the regeneration is limited by the supply of ATP and NADPH while the production of NADPH and ATP depends on photosynthetic electron transport [19,20]. However, based on the measurements of ATP and NADPH, Arulanantham et al. [21] suggested that RuBP regeneration is not limited directly by the supply of ATP and NADPH. It is more likely that photosynthetic electron transport influences the RuBP regeneration through PRK modulation in the photosynthetic carbon reduction cycle. It is still unclear which of the 3 possible mechanisms could be responsible for RuBP regeneration limitation under elevated CO2 conditions. In a previous paper [9], we suggested that both RuBP carboxylation limitation and RuBP regeneration limitation exist simultaneously in rice grown under FACE (free-air CO2 enrichment conditions) and the former is mainly due to the decreased Rubisco. The mechanism for forming of RuBP regeneration limitation, however, is not yet clear. The main objective of this study was to reveal the mechanism.
Gas exchange measurements were performed in situ using the portable gas analysis system LI-6400 (LI-COR Inc., Lincoln, NE, USA) with 10–12 fully expanded leaves per ring between 10:00 and 14:30 (Beijing time). These measurements were performed alternately in FACE and ambient rings. At the tillering and jointing stages, the second most fully expanded leaves counted from the top of the plant were used, while the fully expanded flag leaves were used at the heading and filling stages. The leaf Anet value of rice plants grown in FACE and ambient rings were measured at 580 mmol CO2 mol1. During the measurements, the CO2 concentration was controlled with the LI-COR CO2 injection system, and a saturating photosynthetic photon flux density (PPFD) of 1200 mmol m2 s1 from the LI-COR LED light source was supplied. Air temperature of the leaf chamber was maintained at approximately 30 8C. Before recording the data, the measured leaves were kept in the leaf chamber for at least 2 min to attain a steady state of photosynthesis. To plot the Anet–Ci curve, CO2 was set at concentrations of 380 (580 for FACE leaves), 250, 200, 150, 100, 50, 380, 480, 580, 650, 750, 900, and 1050 mmol mol1, and the PPFD was maintained at 1200 mmol m2 s1. The maximum carboxylation rate (Vcmax) and the maximum electron transport rate (ETR) (Jmax) in vivo were calculated as described by Farquhar et al. [19] and Long and Bernacchi [24], respectively.
2. Materials and methods
2.3. Chlorophyll fluorescence measurements
2.1. FACE facilities and rice growth
We measured the chlorophyll fluorescence in flag rice leaves in situ at a PPFD of 1200 mmol m2 s1 and 580 mmol CO2 mol1 using the portable gas analysis system LI-6400 with a leaf chamber fluorometer (LCF) (LI-COR Inc., Lincoln, NE, USA) according to the method described in the manual (Book 5). The in vivo electron transport rate was calculated from the measured chlorophyll fluorescence parameters (F 0m and Fs: maximal fluorescence intensity in any light adapted state and fluorescence intensity in the steady state, respectively) using the following equation: 0 ðF m F s Þ ETR ¼ f I aleaf F 0m
The FACE facilities were located at Xiaoji village (1198420 000 E, 328350 0500 N), Yangzhou City, in Jiangsu Province, East China. This site is located in a region for rice production in China. The running and controlling systems of the facilities were transferred from a Japanese FACE site [22]. A full description of Chinese FACE facilities has been provided by Liu et al. [23]. Briefly, there were 6 rings in the experimental field, and each ring had a diameter of 15 m. Of these, 3 were sprayed with pure CO2 as FACE treatment, and the others were in the normal atmosphere as ambient control. The distances between the FACE and ambient rings were greater than 90 m. The target CO2 concentration at the center of the FACE rings was 200 mmol mol1 above the ambient air CO2 concentration. We initiated CO2 enrichment of rice plants in FACE rings immediately after transplanting rice seedlings, and the enrichment was continuously applied until the plants were harvested. In this study, we used the rice (Oryza sativa L.) cultivar Japonica 9915, which is a new cultivar that is commonly cultivated in this region. Its growth duration (from the time of transplantation to harvest) is approximately 130 days (from mid-June to midOctober). It was cultivated using the typical agronomic management techniques employed for this region.
2.2. Gas exchange measurements
where f is the fraction of absorbed quanta that is used by photosystem II (PSII), and it is typically assumed to be 0.5 for C3 plants, I is incident photon flux density (mmol m2 s1), and aleaf is the leaf absorbance and is assumed to be 0.84 as described by Gesch et al. [25]. 2.4. Leaf sampling At the filling stage, about 60 flag leaves per ring were collected in the light during 10:30–13:00. The detached leaves were excised
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
350
into 7.5-cm long segments (excluding the tip and base) and immediately dropped into liquid N2 and preserved at 80 8C for biochemical analysis.
2.8. RNA Isolation and RT-PCR (Rreverse-transcription polymerase chain reaction)
For enzyme activity assays, the liquid N2-frozen leaves were used. GAPDH and 3-phosphoglyceric acid kinase (PGK) activities were measured spectrophotometrically at 25 8C by the methods described by Wolosiuk and Buchanan [26] and Pacold and Anderson [27], respectively. For determining the PRK activity, leaf discs (total area, 1 cm2) were ground in liquid N2 and extracted using 1 ml of 200 mM Tris–HCl (pH 7.8) containing 200 mM KCl, 0.5 mM EDTA, 20 mM isoascorbate, and 20 mM 2-mercaptoethanol at 4 8C. After centrifugation at l0,000 g for 3 min, the obtained supernatant was diluted 20-fold with the extraction buffer mentioned above and assayed immediately at 25 8C by coupling ADP formation to NADH oxidation by using pyruvate kinase and lactate dehydrogenase (Sigma, St. Louis, MC, USA) in the presence of 20 mM dithiothreitol to ensure full activation of PRK, exactly as described by Kagawa [28].
Total RNA was extracted from rice leaves by using TRIzol, according to the instructions of the manufacturer (Invitrogen, Carlsbad, CA, USA). RNA was quantified by UV spectrophotometry at 260 and 280 nm (A260/A280 2.0) and confirmed by 1.5% denaturing agarose gel electrophoresis and ethidium bromide staining. Primer pairs were designed based on the gene sequence for the specific amplification of mRNAs of certain genes by reverse-transcription polymerase chain reaction. The primers and the genes amplified are listed in Table 1. DNA was removed from total RNA extracts by treatment with RNase-free DNase I (Promega, Madison, WI, USA). RT-PCR was performed in a 25-ml reaction mixture containing 5 ml Superscript III buffer and 0.5 ml Superscript III reverse transcriptaseTaq polymerase enzyme (Invitrogen) with 1.0 mg total RNA and gene-specific primer pair (10 ng each, approximately 20-mer). The RT-PCR products were separated by electrophoresis on 1.2% agarose gels, stained with ethidium bromide, and photographed under UV light using Tanon Imaging System (GIS 2010, Tanon Corporation, China). The amplification product of each RT-PCR reaction was cloned into a pMD18-T vector (Promega) and sequenced.
2.6. Determination of RuBP and 3-PGA contents
2.9. Reverse Northern blot
RuBP was extracted according to Vu et al. [7] with some modifications. RuBP was extracted from the liquid N2-frozen leaf powder with 0.5 M HCl. After centrifugation at 16,000 g for 5 min at 2 8C, the supernatant was adjusted to pH 8.2 with 2 M Tris-Base and 4 M KOH. The RuBP was then transformed into 3-PGA by adding the pH-adjusted supernatant to an assay buffer (0.1 M Tris–HCl (pH 8.2), 10 mM NaHCO3, 20 mM MgCl2, 0.2 mM EDTA, 1 mM DTT, and 150 mg Rubisco from spinach). Then, 3-PGA was determined as described by Seemann and Sharkey [29].
In order to prepare hybridization templates more conveniently, a pair of specific primers were designed according to pMD18-T vector sequence at the cloning site (F: 50 -GCGGATAACAATT-TCACACAG-30 and R: 50 -CCAGGGTTTTCCCAGTCAC-30 ). Equal amount of each PCR product (approximately 1 mg) was loaded into 1.5% agarose gels. These DNA samples were then transferred to nylon membranes (Amersham Biosciences). Total RNAs were extracted from rice flag leaves collected at the filling stage. Radiolabeled cDNA probes were synthesized by reverse transcription of 10 mg of total RNA for 1 h in the presence of 100 mCi [32P]-dCTP with the Superscript III reverse transcriptase (Invitrogen). Hybridization of probes derived from each RNA sample and one set of transcript-derived fragments obtained above was performed in 0.5 M Na-phosphate buffer (pH 7.2) containing 7% SDS at 65 8C for 16 h. The hybridization product was washed first for 5 min twice with washing buffer I (40 mM Naphosphate, 1 mM EDTA, and 5% SDS), and then it was washed 4 times with washing buffer II for 10 min (40 mM Na-phosphate, 1 mM EDTA, and 1% SDS). Hybridization signals were first observed on Kodak X-ray films and then quantified by a dot hybridization system (Tanon 2.20, China).
2.5. Enzyme activity assays
2.7. Assay of chloroplast electron transport and photophosphorylation Chloroplasts were isolated from fresh rice leaves according to the method of Jagendorf and Avron [30]. Measurements of chloroplast non-cyclic electron transport (with H2O as the electron donor and FeCN as the electron acceptor) rates were performed according to the method of Krogmann and Jagendorf [31]. The electron transport rates of PSII and PSI were measured as described by Baena-Gonza´lez et al. [32]. Chloroplast photophosphorylation was measured as described by Wei et al. [33], and the amount of ATP formed in the reaction was analyzed using the luciferin–luciferase method [34]. Chlorophyll content was determined according to the method described by Arnon [35].
2.10. Western blot Thylakoids were isolated from frozen rice flag leaves as described by Hong and Xu [36] and all solutions contained
Table 1 Nomenclature and specific primers designed for RT-PCR of genes in rice Gene
Accession no.
Protein
Forward primer sequence
Reverse primer sequence
lhcb2 psbA petA petD petE lhca psaA psaB atpA atpB ubi
D00642 P0048G02.44 P0018C10.41 NP_039416 P20423 OJ1065_B06.19-1 NP_039383 NP_039382 OSJNBb005J14.21 AB037543 AY954394
LHCb2 D1 protein Cyt f Cyt b6/f complex subunit IV Plastocyanin Lhca Psa A Psa B CF1 a subunit CF1 b subunit Ubiqutin
ATCACCATGCGCCGCACCGT TTCCAGGCAGAGCATAACATCC CCCCGACCCTGCTATGAAGA ATGGGAGTAACAAAGAAACCTGA CGGGCGGAGGAGGATGAGAT ACCCCATCTTTCCCCAACAACA ATGAGTGCTTTAGGTCGTCCC GTTGAATGCTGTTAACGAGAA GGGACTAGGGGTATTGCTCTGA ATTAATGAAAAAAATCTTGAGGA ATGCAGATCTTTGTGAAGAC
CGCCTCCCCGAACTTCACCC CGTTCGTGCATTACTTCCATAC GACGGATGCGAAGAAGAACAA AACAAGAAGAAGCGTAGGCAG GGTGAGCGTGACGGAGAAGGT CACCATTCACAGCCTACTCCGA CCAAGATTTGCTTTATCGGGT CCCTGCCATAATGTGATGTGT CTACTGCTGTTTTGCCGGTTTG TGTTGTAGCAGGAGCAGGGTCGG ACCACCACGGAGACGGAG
Primer sequences are listed from 50 to 30 terminal.
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
1 mM phenylmethane-sulfonyl fluoride (PMSF, Merck, Germany). Thylakoid membrane proteins were loaded on 15% SDS-PAGE gels containing 4 M urea. For Western blot analysis, the polypeptides were transferred from the gel of the SDS-PAGE to the nitrocellulose membrane (Amersham Pharmacia, Buckinghamshire, England) with a semi-dry transfer cell (Amersham Pharmacia). Antibodies against couple factor 1 (CF1) and LHCII b2 were prepared from rabbit antisera by respective immunization with the purified CF1 from tobacco leaves and soybean LHCII b2 subunit expressed in Escherichia coli in our laboratory. Cyt f antibody was a gift from Dr. Li-Xin Zhang and the D1 protein antibody is a commercial polyclonal antibody obtained from the AgriSera Company, Sweden. For quantification of the above proteins, bands of the Western blots were scanned using a laser densitometer (Gel-Doc, Tanon, China).
351
3.4. Effects of FACE on activities of several enzymes in the photosynthetic carbon reduction cycle In FACE leaves, the activity of PRK was significantly enhanced while those of GAPDH and PGK exhibited no significant change (Fig. 4). These results may indicate that the declined RuBP regeneration capacity in FACE leaves is not related to the changes in activities of these enzymes. 3.5. Effects of FACE on electron transport and photophosphorylation To explore the relation of RuBP regeneration to photosynthetic electron transport, ETR was measured in rice leaves. The results revealed that the ETR in vivo calculated from the chlorophyll
2.11. Statistical analysis The effect of elevated CO2 on photosynthesis was analyzed by the general linear model (GLM) procedure of the SPSS 12 for Windows (SPSS Inc., Chicago, USA). Measurements were made in all the 6 rings. Data were arranged in a block design and analyzed for the effects of rings (blocks) and elevated CO2. This analysis revealed no significant ring effects on the gas exchange. Consequently, the ring factor was excluded from the analysis of the biochemical parameters, and measurement data were then analyzed using a t-test for the effect of elevated CO2. 3. Results 3.1. Photosynthetic acclimation to FACE Our previous work revealed that when measured at their growth CO2 concentration, the Anet of rice plants grown in FACE rings was significantly higher than those grown in ambient rings [9]. However, when measured at the same CO2 concentration of 580 mmol mol1, the Anet in FACE leaves was significantly lower than that in ambient leaves at the jointing, heading, and filling stages, but not at the tillering stage (Fig. 1). This indicates that acclimation or downregulation of photosynthesis occurs at the last 3 stages but not at the tillering stage in rice plants grown under FACE conditions. Although stomatal conductance (Gs) decreased significantly in most cases, no significant change in intercellular CO2 concentration (Ci) was observed in FACE leaves, as compared with that in ambient leaves (Fig. 1), suggesting that photosynthetic acclimation to elevated CO2 is not due to the decreased Gs in FACE leaves. 3.2. Anet–Ci curve The Anet–Ci curve revealed that FACE leaves had a lower CO2saturated Anet value and a smaller initial slope (Fig. 2A). The in vivo Jmax and Vcmax values calculated from the Anet–Ci curve data (Fig. 2A) were significantly decreased in FACE leaves (Fig. 2B). The decreases in these values indicate that photosynthetic acclimation or decreased Anet in FACE leaves is related to limitation of both RuBP carboxylation and RuBP regeneration. 3.3. Effects of FACE on RuBP and 3-PGA contents The RuBP content was significantly reduced and the 3-PGA content was significantly increased in FACE leaves as compared to those in ambient leaves (Fig. 3). This may imply that the capacities of both RuBP regeneration and triose-phosphate utilization were declined in FACE leaves.
Fig. 1. Net CO2 assimilation rate (Anet), stomatal conductance (Gs), and intercellular CO2 concentration (Ci) in rice leaves measured at the same CO2 concentration (580 mmol mol1). Open and filled columns represent the ambient and FACE leaves, respectively. Each value in this figure is the mean of 3 rings (10 leaves were measured per ring). Asterisks (*) and (**) represent significant (P < 0.05) and very significant (P < 0.01) differences between the FACE and ambient leaves, respectively. T: tillering stage, J: jointing stage, H: heading stage, and F: filling stage.
352
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
Fig. 4. The activities of GAPDH, PGK and PRK in rice flag leaves. Open and filled columns represent the ambient and FACE leaves, respectively. Each value in this figure is the mean of 6 determinations (each determination used 6 leaves from the three FACE or ambient rings). The asterisk (*) represents a significant (P < 0.05) difference between the FACE and ambient leaves.
ited a slight change (Fig. 5B). This may imply that the component leading to the reduced ETR of the whole chain in FACE leaves is between PSII and PSI but not within them. Consistent with the reduced electron transport rate, the photophosphorylation rate in the chloroplasts from FACE leaves was significantly lower than that in those from ambient leaves (Fig. 5C). Fig. 2. The responses of light-saturated net assimilation rate (Anet) to the intercellular CO2 concentration (Ci) in the flag leaves of rice plants cultured in ambient (open circles and columns) and FACE (filled circles and columns) rings. Measurements were made at the filling stage. Each value in this figure is the mean of 3 rings (two leaves were measured in each rings). Vcmax and Jmax were calculated from Anet–Ci curve data. Asterisk (*) and (**) represent significant (P < 0.05) and very significant (P < 0.01) differences between FACE and ambient leaves, respectively.
fluorescence data was significantly reduced in FACE leaves (Fig. 5A). In chloroplasts isolated from FACE leaves, ETR of the whole chain or non-cyclic electron transport was also decreased significantly. However, the PSI electron transport activity was significantly increased and PSII electron transport activity exhib-
3.6. Effects of FACE on some components involved in forming of assimilatory power To seek the reason for the decrease of RuBP regeneration capacity in FACE leaves, the contents of some proteins involved in the formation of assimilatory power were determined. The results of western blot analysis showed that in FACE leaves Cyt f content was significantly decreased, while the LHCb2 and D1 protein contents were significantly increased but CF1 content had no significant change in FACE leaves (Fig. 6). In consonance with the significant decrease in Cyt f amount, the mRNA level of petA gene which encodes Cyt f protein was significantly declined (Fig. 7). These results indicate that the decreased RuBP regeneration capacity in FACE leaves is mainly due to a significant decrease in the Cyt f, a key component of the whole photosynthetic electron transport chain. 4. Discussion
Fig. 3. Effects of FACE on RuBP and 3-PGA contents in rice flag leaves. Open and filled columns represent the ambient and FACE leaves, respectively. Each value in this figure is the mean of 6 determinations (each determination used 6 leaves from the three FACE or ambient rings). Asterisk (*) and (**) represent significant (P < 0.05) and very significant (P < 0.01) differences between FACE and ambient leaves, respectively.
The results reported here indicate that photosynthetic acclimation to FACE occurs in rice plants when they exposed to elevated CO2 for a long time (Fig. 1). Also the photosynthetic acclimation is related to both RuBP regeneration limitation and RuBP carboxylation limitation in rice leaves (Fig. 2). The RuBP carboxylation limitation may be attributed to the decreased Rubisco content, as discussed by Chen et al. [9]. With respect to the RuBP regeneration limitation there are 3 possible reasons. The first is Pi shortage. At high CO2 and high light, a limited capacity for triose-phosphate utilization in starch and/or sucrose synthesis may result in the shortages of both Pi and ATP [11]. However, the previous study has shown that Pi content is significantly increased but not decreased in FACE leaves [9]. So the RuBP regeneration limitation in FACE leaves is unlikely to be due to Pi shortage. Indeed, the significantly raised PGA content (Fig. 3) means a limited capacity of triose-phosphate utilization (TPU) in FACE leaves. The increased PGA content may be also a symptom of enhanced Rubisco activity. Nevertheless, this possi-
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
353
Fig. 6. Effects of FACE on LHCb2, D1, Cyt f and CF1 contents in rice flag leaves. (A) Western blot of LHCb2, D1, Cyt f and CF1 on the basis of equal chlorophyll amount. (B) Quantification of Western blot as shown in (A). Each value in the part B is the mean of three repeats with SE as a bar. Considering the fact that chlorophyll content (expressed per leaf area) in FACE leaves was significantly higher than that in ambient leaves, each protein content on the basis of equal chlorophyll amount in the (A) is normalized into the amount per unit leaf area in the (B). Further, protein content in FACE leaves is shown as the percentage of ambient leaves. Asterisk (*) represents significant (P < 0.05) differences between FACE and ambient leaves.
Fig. 5. Photosynthetic electron transport rates (ETRs) and photophosphorylation rate in FACE (filled columns) and ambient (open columns) flag leaves. (A) In vivo ETR calculated on the basis of chlorophyll fluorescence parameters measured by the LI6400 leaf chamber fluorometer (LCF). Measurements were made at a saturating PPFD of 1200 mmol m2 s1 at the filling stage. Each value is the mean of 3 rings (3 leaves were measured per ring). (B) ETR of PSII, PSI and the whole electron transport chain in the chloroplasts obtained from rice leaves. (C) Photophosphorylation rates in rice chloroplasts. Each value in (B) and (C) is the mean of six determinations (Each determination used 6 leaves from the three FACE or ambient rings). Asterisks (*) and (**) represent significant (P < 0.05) and very significant (P < 0.01) differences between FACE and ambient leaves, respectively.
bility has been eliminated by the significantly decreased Vcmax (Fig. 2) and Rubisco content in FACE leaves [9]. The second is a reduction in the amount and/or activity of several enzymes catalyzing RuBP regeneration reactions. The GAPDH, PGK, and PRK are 3 essential enzymes in the RuBP regeneration process. In our FACE experiments the activities of GAPDH and PGK did not decreased significantly and that of PRK increased remarkably in FACE leaves (Fig. 4). Therefore, they are
also unlikely to be the factors leading to RuBP regeneration limitation in FACE leaves. The third is a decline in the photosynthetic electron transport capacity. It is well known that the photosynthetic carbon reduction cycle including RuBP regeneration consumes ATP and NADPH produced through chloroplast photosynthetic electron transport and coupled photophosphorylation. Therefore, the decrease in the RuBP level or RuBP regeneration capacity is associated with a reduced electron transport capacity [37]. In our study the declined RuBP content (Fig. 3) was accompanied by significantly decreased whole chain electron transport and photophosphorylation rates in FACE leaves (Fig. 5). Considering the unchanged CF1 content in FACE leaves (Fig. 6), the declined RuBP level or RuBP regeneration capacity in FACE leaves is due to a decrease in the whole chain electron transport rate (Fig. 5A and B) rather than the CF1 content. Then, where is the rate-limiting site in the photosynthetic electron transport process? It is neither in PSII nor PSI because the ETR of PSII was not significantly decreased and that of PSI was remarkably increased in FACE leaves (Fig. 5B). The D1 protein, a
354
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355
transport chain but not in both PSII and PSI (Fig. 5A and B), indicating that the rate-limiting factor may be a component, e.g., Cty f or plastocyanin, between PSII and PSI rather than within them. Second, the Cyt f protein content and mRNA level were significantly lower in FACE leaves than in ambient leaves (Figs. 6 and 7). Similarly, the deficiency of Cyt f induced by growth at elevated CO2 in wheat leaves has been reported [41]. Some studies showed that the plastocyanin amount was correlated with the light-saturated photosynthetic electron transport rate in tobacco thylakoids and the gene encoding plastocyanin was repressed in the high-sugar state [42,43]. In our experiments, however, although the sugar content was higher [9], the mRNA level of the gene petE encoding plastocyanin did not exhibit any significant change in FACE leaves (Fig. 7). This may indicate that plastocyanin is not a limiting-rate site in the whole electron transport chain including PSII and PSI in FACE leaves. Unfortunately, we did not determine the plastocynin content in our study because the antibody to plastocynin was not available. It is noteworthy that upregulation of the D1 protein and LHCb2 contents (Fig. 6) as well as PRK activity (Fig. 4) was observed in FACE leaves. However, the RuBP content was significantly decreased (Fig. 3), indicating that the upregulation of these components and activity, being of benefit to RuBP regeneration is not yet sufficient to eliminate RuBP regeneration limitation to photosynthesis in FACE leaves. In conclusion, our results indicate that during photosynthetic acclimation to elevated CO2 in FACE rice leaves, the decline in Cyt f content is an important factor inducing RuBP regeneration limitation through decreasing of photosynthetic electron transport capacity of the whole chain. Acknowledgements
Fig. 7. Reverse Northern blot analysis of the expressions of some genes encoding some enzymes involved in the assimilatory power formation. (A) Electropherogram of methanol denaturing gel electrophoresis of total RNA extracted from the ambient and FACE leaves. (B) Autoradiograms of reverse Northern hybridization. The duplicate membranes were hybridized against total cDNA probes. (C) Quantification of the mRNA levels. The bands in (B) were scanned and normalized with ubiquitin control. Significance level of the differences between FACE and ambient leaves were determined by Student’s t-test (N = 3,). Asterisk indicates the difference between FACE and ambient leaves is significant (P < 0.05). For the proteins encoded by these genes in this figure, see Table 1.
core component of the PSII reaction center complex, is unlikely to be responsible for the remarkably decreased ETR of the whole chain because the amount of the D1 protein was significantly increased in FACE leaves (Fig. 6). Moreover, it is well known that in the whole photosynthetic electron transport chain the Cyt b6/f complex, a plastoquinol–plastocyanin oxidoreductase, occupies a central position and plays a unique role in both the non-cyclic electron transport involved in two photosystems and the cyclic electron transport surrounding PSI. A study suggested that Cyt f content limited the non-cyclic electron transport in spinach grown under different growth irradiances [38]. Morever, Cyt f content was highly correlated with the photosynthetic rate and the RuBP pool size at normal CO2 concentration [39]. Similarly, Sudo et al. [40] also reported that the Cyt f content was highly correlated with CO2saturated photosynthesis. Therefore, it is very probable that the Cyt b6/f complex is a rate-limiting site in the whole electron transport chain in FACE leaves. The following experimental results support this supposition. First, in the chloroplasts isolated from FACE leaves, ETR decreased significantly in the whole electron
The Chinese Rice/Wheat FACE project is a research program that is a part of the China-Japan Science and Technology Cooperation Agreement. The main instruments and apparatus of the FACE system for this project were supplied by the National Institute for Agro-Environmental Sciences (NIAES), Japan, and the National Agricultural Research Center for Tohoku Region (NARCT), Japan. This project was funded by the Chinese Academy of Sciences (CAS, KSCX2-YW-N-059, KZCX2-408, and KSCX-SW-133), the Ministry of Science and Technology, China (2005cb121106). We thank Dr. Li-Xin Zhang for the gift of the Cyt f antibody, and Prof. Jia-Mian Wei for the advice on the photosynthetic electron transport and photophosphorylation assays. References [1] D.-Q. Xu, R.M. Gifford, W.S. Chow, Photosynthetic acclimation in pea and soybean to high atmospheric CO2 partial pressure, Plant Physiol. 106 (1994) 661–671. [2] D.-Q. Xu, K. Terashima, R.F.E. Crang, X.-M. Chen, J.D. Hesketh, Stomatal and nonstomatal acclimation to a CO2-enriched atmosphere, Biotronics 23 (1994) 1–9. [3] S.P. Long, E.A. Ainsworth, A. Rogers, D.R. Ort, Rising atmospheric carbon dixide: plant FACE the future, Annu. Rev. Plant Biol. 55 (2004) 591–628. [4] B.G. Drake, M.A. Gonzalez-Meier, S.P. Long, More efficient plants: a consequence of rising atmospheric CO2? Annu. Rev. Plant Physiol. Plant Mol. Biol. 48 (1997) 609–639. [5] B.D. Moore, S.H. Cheng, D. Sims, J.R. Seemann, The biochemical and molecular basis for photosynthetic acclimation to elevated atmospheric CO2, Plant Cell Environ. 22 (1999) 567–582. [6] A. Rogers, S.W. Humpheries, A mechanistic evaluation of photosynthetic acclimation at elevated CO2, Global Change Biol. 6 (2000) 1005–1011. [7] J.C.V. Vu, L.H. Allen, K.J. Boote, G. Bowes, Effects of elevated CO2 and temperature on photosynthesis and Rubisco in rice and soybean, Plant Cell Environ. 20 (1997) 68–76. [8] A. Rey, P.G. Jarvis, Long-term photosynthetic acclimation to increased atmospheric CO2 concentration in young birch (Betula pendula) trees, Tree Physiol. 18 (1998) 441–450.
D.-Y. Zhang et al. / Plant Science 175 (2008) 348–355 [9] G.-Y. Chen, Z.-H. Yong, Y. Liao, D.-Y. Zhang, Y. Chen, H.-B. Zhang, J. Chen, J.-G. Zhu, D.-Q. Xu, Photosynthetic acclimation in rice leaves to free-air CO2 enrichment related to both ribulose-1,5-bisphosphate carboxylation limitation and ribulose1,5-bisphosphate regeneration limitation, Plant Cell Physiol. 46 (2005) 1036– 1045. [10] S. von Caemmerer, Modeling C3 Photosynthesis. Biochemical Models of Leaf Photosynthesis, CSIRO Publishing, Australia, 2000, pp. 29–71. [11] G. Bowes, Facing the inevitable: plants and increasing atmospheric CO2, Annu. Rev. Plant Physiol. Plant Mol. Biol. 44 (1993) 309–332. [12] L.H. Ziska, A.H. Teramura, Intraspecific variation in the response of rice (Oryza sativa) to increase CO2 concentration––photosynthetic, biomass and reproductive characteristics, Physiol. Plant 84 (1992) 269–274. [13] M.W. Hussain, L.H. Allen Jr., G. Bowes, Up regulation of sucrose phosphate synthase in rice grown under elevated CO2 and temperature, Photosynth. Res. 60 (1999) 199–208. [14] T.D. Sharkey, J.A. Berry, K. Raschke, Starch and sucrose synthesis in Phaseolus vulgaris as affected by light CO2 and abscisic acid, Plant Physiol. 77 (1985) 617–620. [15] J. Kobmann, U. Sonnewald, L. Willmitzer, Reduction of chloroplastic fructose-1, 6bisphosphatase in transgenic potato plants impairs photosynthesis and plant growth, Plant J. 6 (1994) 637–650. [16] G.D. Price, J.R. Evans, S. von Caemmerer, J.W. Yu, M.R. Badger, Specific reduction of chloroplast glyceraldehyde-3-phosphate dehydrogenase activity by antisense RNA reduces CO2 assimilation via a reduction in ribulose bisphosphate regeneration in transgenic tobacco plants, Planta 195 (1995) 69–378. [17] E.P. Harrison, H. Olcer, L.C. Lloyd, S.P. Long, C.A. Raines, Small decrease in SBPase cause a liner decline in the apparent RuBP regeneration rate, but not affect Rubisco carboxylation capacity, J. Exp. Bot. 52 (2001) 1779–1784. [18] M.J. Paul, J.S. Knight, D. Habash, M.A.J. Parry, D.W. Lawlor, S.A. Barnes, A. Loynes, J.C. Gray, Reduction in phosphoribulokinase activity by antisense RNA in transgenic tobacco: effect on CO2 assimilation and growth in low irradiance, Plant J. 7 (1995) 535–542. [19] G.D. Farquhar, S. von Caemmerer, J.A. Berry, A biochemical model of photosynthetic CO2 assimilation in leaves of C3 species, Planta 149 (1980) 78–90. [20] G.D. Farquhar, S. von Caemmerer, Modeling of photosynthetic responses to environmental conditions., in: O.L. Lange, P.S. Nobel, C.B. Osmond, H. Ziegler (Eds.), Encyclopedia of Plant Physiology, Physiological Plant Ecology II, New Series, vol. 12B, Springer-Verlag, Berlin, Germany, 1982, pp. 548–577. [21] A.R. Arulanantham, I.M. Rao, N. Terry, Limiting factor to photosynthesis. VI. Regeneration of ribulose1,5-bisphosphate limits photosynthesis at low photochemical capacity, Plant Physiol. 93 (1990) 1466–1475. [22] M. Okada, M. Lieffering, M. Nakamura, M. Yoshimoto, M. Kim, K. Kobayashi, Freeair CO2 enrichment (FACE) using pure CO2 injection: system description, New Phytol. 150 (2001) 251–260. [23] G. Liu, Y. Han, J.-G. Zhu, M. Okada, H. Nakamura, M. Yoshimoto, Rice–wheat rotational FACE platform. I. system structure and control, Chin. J. Appl. Ecol. 13 (2002) 1253–1258 (in Chinese). [24] S.P. Long, C.J. Bernacchi, Gas exchange measurements, what can they tell us about the underlying limitations to photosynthesis? Procedures and sources of error, J. Exp. Bot. 54 (2003) 2393–2401. [25] R.W. Gesch, L.H. Kang, M. Gallo-Meagher, J.C.V. Vu, K.J. Boote, L.H. Allen, G. Bowes, Rubisco expression in rice leaves is related to genotypic variation of photosynthesis under elevated CO2 and temperature, Plant Cell Environ. 26 (2003) 1941–1950.
355
[26] R.A. Wolosiuk, B.B. Buchanan, Studies on the regulation of chloroplast NADPlinked glyceraldehyde-3-phosphate dehydrogenase, J. Biol. Chem. 251 (1976) 6456–6461. [27] I. Pacold, L.E. Anderson, Energy charge control of the Calvin cycle enzyme 3-phosphoglyceric acid kinase, Biochem. Biophys. Res. Commun. 51 (1973) 139–143. [28] T. Kagawa, Isolation and purification of ribulose-5-phosphate kinase from Nicotiana glutinosa, in: M. Edelman, K.B. Hallick, N.H. Chua (Eds.), Methods in Chloroplast Molecular Biology, Elsevier Biomadical Press, Amsterdam, 1982, pp. 695– 705. [29] J.R. Seemann, T.D. Sharkey, Salinity and nitrogen effects on photosynthesis, ribulose-1,5-bisphosphate carboxylase and metabolite pool sizes in Phaseolus vulgaris, Plant Physiol. 82 (1986) 555–560. [30] A.T. Jagendorf, M. Avron, Cofactors and rates of photosynthetic phosphorylation by spinach chloroplasts, J. Biol. Chem. 231 (1958) 277–290. [31] D.W. Krogmann, A.T. Jagendorf, A spectrophotometric assay of the Hill reaction with ferricyanide, Plant Physiol. 32 (1957) 373–374. [32] E. Baena-Gonza´lez, Y. Allahverdiyeva, Z. Svab, P. Maliga, E.M. Josse, M. Kuntz, P. Ma¨enpa¨a¨, E.M. Aro, Deletion of the tobacco plastid psbA gene triggers an upregulation of the thylakoid-associated NAD(P)H dehydrogenase complex and the plastid terminal oxidase (PTOX), Plant J. 35 (2003) 704–716. [33] J.-M. Wei, B. Howlett, A.T. Jagendorf, Azide inhibition of chloroplast ATPase is prevented by a high protonmotive force, Biochim. Biophys. Acta 934 (1988) 72–79. [34] Mc.D.J. Stewart, G. Guinn, Chilling injury and changes in adenosine triphosphate of cotton seedlings, Plant Physiol. 44 (1969) 605–608. [35] D.I. Arnon, Copper enzymes in isolated chloroplasts, Plant Physiol. 24 (1949) 1–15. [36] S.-S. Hong, D.-Q. Xu, Light-induced increase in initial chlorophyll fluorescence Fo level and the reversible inactivation of PS II reaction centers in soybean leaves, Photosynth. Res. 61 (1999) 269–280. [37] S.A. Ruuska, T.J. Andrews, M.R. Badger, G.D. Price, S. von Caemmerer, The role of chloroplast electron transport and metabolites in modulating Rubisco activity in tobacco. Insights from transgenic plants with reduced amounts of cytochrome b/f complex or glyceraldehyde 3-phosphate dehydrogenase, Plant Physiol. 122 (2000) 491–504. [38] I. Terashima, J.R. Evans, Effects of light and nitrogen nutrition on the organization of the photosynthetic apparatus in spinach, Plant Cell Physiol. 29 (1988) 143–155. [39] G.D. Price, S. von Caemmerer, J.R. Evans, K. Siebke, J.M. Anderson, M.R. Badger, Photosynthesis is strongly reduced by antisense suppression of chloroplastic cytochrome b/f complex in transgenic tobacco, Aust. J. Plant Physiol. 25 (1998) 445–452. [40] E. Sudo, A. Makino, T. Mae, Differences between rice and wheat in ribulose-1,5bisphosphate regeneration capacity per unit of leaf-N content, Plant Cell Environ. 26 (2003) 255–263. [41] E.J. Robertson, R.M. Leech, Significant changes in cell and chloroplast development in young wheat leaves (Triticum aestivum cv Hereward) grown in elevated CO2, Plant Physiol. 107 (1995) 63–71. [42] M.A. Scho¨ttler, M. Kirchhoff, E. Weis, The role of plastocynin in the adjustment of photosynthetic electron transport to the carbon metabolism in tobacco, Plant Physiol. 136 (2004) 4265–4274. [43] O. Oswald, T.P. Martin, J. Dominy, I.A. Graham, Plastid redox state and sugars: interactive regulators of nuclear-encoded photosynthetic genes expression, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 2047–2205.