Rln3a is a prerequisite for spermatogenesis and fertility in male fish

Journal Pre-proof Rln3a is a prerequisite for spermatogenesis and fertility in male fish Lanying Yang, Yanlong Li, You Wu, Shaohua Sun, Qiang Song, Jing Wei, Lina Sun, Minghui Li, Deshou Wang, Linyan Zhou

PII:

S0960-0760(19)30505-9

DOI:

https://doi.org/10.1016/j.jsbmb.2019.105517

Reference:

SBMB 105517

To appear in:

Journal of Steroid Biochemistry and Molecular Biology

Received Date:

28 August 2019

Revised Date:

10 October 2019

Accepted Date:

25 October 2019

Please cite this article as: Yang L, Li Y, Wu Y, Sun S, Song Q, Wei J, Sun L, Li M, Wang D, Zhou L, Rln3a is a prerequisite for spermatogenesis and fertility in male fish, Journal of Steroid Biochemistry and Molecular Biology (2019), doi: https://doi.org/10.1016/j.jsbmb.2019.105517

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Rln3a is a prerequisite for spermatogenesis and fertility in male fish Lanying Yang1, #, Yanlong Li1, #, You Wu1, #, Shaohua Sun1, Qiang Song2, Jing Wei1, Lina Sun1, Minghui Li1, Deshou Wang1, *, Linyan Zhou1, * 1

Key Laboratory of Freshwater Fish Reproduction and Development (Ministry of

Southwest University, Chongqing, 400715, China 2

ro of

Education), Key Laboratory of Aquatic Science of Chongqing, School of Life Sciences,

Chongqing Three Gorges Central Hospital, Chongqing, 400715, China

-p

#, the authors contribute to this work equally. *, address all correspondence and requests for reprints to:

re

Prof. Linyan Zhou

School of Life Sciences, Southwest University

lP

Tiansheng Road No.1, 400715, Beibei, Chongqing, China E-mail: [email protected],

na

Or Prof. Deshou Wang

School of Life Sciences, Southwest University Tiansheng Road No.1, 400715, Beibei, Chongqing, China

Jo

ur

E-mail: [email protected])

Highlight: 

Mutation of rln3a gene severely affected the spermatogenesis, sperm maturation and fertility in XY male fish



Rln3a gene deficiency suppressed the expression of steroidogenic enzyme genes, and resulted in the decline of 11-KT synthesis.



hCG treatment failed to increase the 11-KT production in rln3a-/- XY fish, while, hRLN3 injection considerably improved the sperm motility.

Abstract

ro of

The essential roles of Relaxin3 (RLN3) in energy homeostasis had been well investigated, while the mechanisms of RLN3 regulating reproduction remain to be

elusive in mammals. Although two rln3 paralogues have been characterized in several

-p

teleosts, their functions still remain largely unknown. In this study, two paralogous rln3 genes, represented as rln3a and rln3b, were identified from the testis of Nile tilapia

re

(Oreochromis niloticus). Rln3a was dominantly expressed in testis, while the most

lP

abundant rln3b expression was in brain. In situ hybridization demonstrated that rln3a is abundantly expressed in the Leydig cells of the testis. To understand the role of Rln3

na

in the testicular development, homologous null-rln3a gene mutant line was constructed by CRISPR/Cas9 technology. Morphological observation demonstrated that null

ur

mutation of rln3a gene caused testicular hypertrophy and a significant increase of GSI. However, a significant decrease of spermatogenic cells at different phases, i.e.

Jo

spermatogonia, spermatocytes, spermatids and sperms was found. Silencing of rln3a gene repressed the expression of key genes in germ cell and Leydig cell. Deficiency of Rln3a led to the significant decrease of 11-KT production, which stimulated the upregulation of both FSH and LH production in the pituitary via a negative feedback manner possibly. Mutation of rln3a in XY fish led to the hypogonadism with sperm deformation, significant decrease of fertility, and sperm motility, revealing as the high

mortality of the offspring obtained by crossing the wild type female and rln3a-/- XY fish. Interestingly, recombinant human RLN3 injection significantly enhanced the sperm motility in rln3a-/- XY fish. Moreover, hCG treatment stimulated the expression of steroidogenic enzyme genes and 11-KT production, which were repressed by rln3a mutation in XY fish. Taken together, this study, for the first time by using a gene knockout model, proved that Rln3a is an indispensable mediator for androgen

ro of

production in testis via HPG axis, and plays an essential role in spermatogenesis, sperm motility and male fertility in fish.

Jo

ur

na

lP

re

-p

Key words: Nile tilapia; rln3a; knockout; spermatogenesis; fertility

Introduction Spermatogenesis is the process in which diploid undifferentiated spermatogonial stem cells differentiate into haploid spermatozoa through mitotic and meiotic divisions in the testis[1]. The developmental stages of spermatogenesis can be divided into three main phases: the spermatogonial phase, meiosis and the spermiogenesis[2]. Vast

ro of

studies have documented that the process of spermatogenesis is regulated by many factors, such as pituitary hormones, sex steroids, growth factor, and other paracrine factors[2-5].

-p

All relaxin family members belong to insulin superfamily and share a common twochain structure linked by disulfide bonds, which are essential for receptor binding[6, 7].

re

Based on sequence similarity, six RLN orthologous i.e. RLN1/2, and -3, and insulin-

lP

like peptide (INSL) -3, -4, -5, and -6 were reported from vertebrates[8]. Several reports indicated that RLN family members might be involved in male reproduction in

na

mammals. Expression of relaxin was detected in the glandular epithelium of the prostate, the glandular epithelium of the seminal vesicles, the ampulla of the vas deferens and

ur

the seminal plasma[6, 9-11]. In mammals, INSL3 is expressed in male reproductive

Jo

system and plays an important role in spermatogenesis[12]. Numerous reports have demonstrated that the relaxin family ligands RLN3 and INSL5, and their receptors played essential roles in maintenance of energy homeostasis in stress, satiety, motivation, food intake and metabolism, which suggests their physiological importance in neuroendocrine regulations[13-17]. In both rat and mouse, RLN3 expression was mainly detected in the nucleus incertus (NI)[18, 19]. Null mutation of mouse RLN3

resulted in reduced locomotion, decreased anxiety, decreased body weight, and reduced sucrose consumption[20]. Hypothalamic-pituitary-gonadal axis (HPG axis) acts in concert to regulate the production of sex steroids in the gonads via a feedback system[21]. Gonadotropinreleasing hormone (GnRH) secreted from the hypothalamus by GnRH-expressing neurons regulate the production of luteinizing hormone (LH) and follicle-stimulating

ro of

hormone (FSH) in the anterior portion of the pituitary gland, which further promote the

gonads to produce estrogen and testosterone in the gonadal somatic cells. Previous reports showed that the expression of RLN3 was also detected in the testis of human

-p

(Homo sapiens) and rhesus (Macaca mulatta)[22]. In human beings, strong expression

re

of RXFP3, putative receptor of RLN3, was detected in the post-acrosomal region of the sperms’ head and neck[23]. Incubation of RLN3 with human spermatozoa alleviated

lP

the natural decline in sperm motility[23]. Therefore, these data demonstrated that RLN3

na

might be involved in the crosstalk between energy homeostasis and HPG axis. However, the molecular mechanisms of RLN3 in male reproduction remain elusive and further

ur

investigations are required to understand its roles in HPG axis. Several reports have suggested that, owing to fish specific genome duplication, two

Jo

teleostean forms of rln3 (rln3a and rln3b) came into existence with sub-functions[2426]. Interestingly, osmoregulation in stickleback (Gasterosteus aculeatus) has been reported to be regulated only by the rln3b expression in brain, suggesting differential roles of Rln3 under salinity exposure[27]. In Japanese eels (Anguilla japonica), both rln3a and rln3b were abundantly expressed in the middle-posterior region of the brain,

while rln3b transcripts were much lower than rln3a[28]. In the adult zebrafish (Danio rerio), both rln3 genes were expressed in brain, but only rln3b transcript was found in testis[29]. Transcriptomic analysis revealed that two paralogous rln3 genes showed distinct expression profiles in the brain and testis in Nile tilapia (Oreochromis niloticus). The feature and their differential expression patterns might indicate a subfunctionalization of the two paralogues rln3 genes during evolution. Therefore,

ro of

comparative expression and functional analysis of both teleostean rln3 paralogues and their unique role in osmoregulation and reproduction are essential for understanding the

evolutionary importance of relaxin system. Similar to the situation in mammals, the

-p

roles of fish Rln3 in osmoregulation had been proved in several fish species, however,

re

none of direct evidences are available for Rln3 in fish reproduction. Tilapia (Oreochromis niloticus) is a good model for fish reproductive

lP

endocrinology studies due to the availability of mono-sex fish, and well-investigated

na

endocrinology background. By transcriptomic analysis, we found that both rln3 genes exhibit male-biased sexual dimorphism with significantly higher expression of rln3a

ur

than rln3b in the testis. Therefore, we hypothesized that Rln3a might play critical roles in testicular development and spermatogenesis. To provide further evidences of Rln3a

Jo

in male reproduction, the expression profiles and functional study by CRISPR/Cas9 technology were carried out. All together, our study emphasized, for the first time, that Rln3a might play an indispensable role during fish spermatogenesis and fertility in fish.

Materials and Methods

Animals Nile tilapias were acclimatized in recirculating freshwater tanks at 26ºC under a natural photoperiod before use. All-XX and all-XY progenies were obtained by crossing the pseudo-male (XX male) and super-male (YY) with the normal female (XX), respectively. All animal experiments were conducted in accordance with the regulations of the Guide for Care and Use of Laboratory Animals and were approved by the

Tissue distribution expression of rln3 by real-time PCR

ro of

Committee of Laboratory Animal Experimentation of Southwest University, China.

-p

The transcript level of rln3a and 3b in various adult tissues (including brain,

re

pituitary, testis and ovary) was checked by real-time PCR according to the methods described previously[30]. Briefly, total RNA (1.0 μg) was extracted from the four

lP

tissues (three independent samples per tissue) and reverse transcribed using Prime

na

Script RT Master Mix Perfect Real Time Kit according to the manufacturer’s instructions (Takara, Japan). All Real-time PCRs were carried out in ABI-7500 fast

ur

Real-time PCR machine (Applied Biosystems, USA) in a 20 μl reactions with a mixture of 10 μl 2×SYBR Premix ExTaq (Takara, Japan), 2 μl of diluted cDNA or PCR-grade

Jo

water as negative control, 6 μl of PCR-grade water, and 1 μl of each 10 μM primer. The PCR reactions were initiated from denaturation at 95 °C for 5 min; followed by 40 amplification cycles at 95 °C for 15 s and 60 °C for 30 s. Dissociation protocols were used to measure melting curves. The relative abundance of target genes were evaluated using the formula: R = 2-ΔΔCt by using β-actin as an endogenous control to verify the

reaction efficiency. Primer sequences used for PCR reactions are listed in table1.

In situ hybridization (ISH) The testis of XY tilapia at 150 days after hatching (dah) were fixed overnight in 4% paraformaldehyde (Sigma-Aldrich, Germany) in 1×PBS at 4°C to check the cellular localization of rln3a expression in testis by ISH. After fixation, gonads were embedded

ro of

in paraffin and cross-sections of 5 μm were cut using microtome (Leica, Germany). To

detect the cellular localization of both rln3a in 150 dah XY gonads, ISH and fluorescence multi-color ISH were performed as described previously[31, 32]. Probes

-p

of sense and antisense digoxigenin or fluorescein labeled RNA strands were transcribed

re

in vitro with a RNA labeling kit (Roche, Germany) from the linearized plasmids DNA of tilapia rln3a and cyp17a1, respectively. The images of traditional ISH were taken

lP

under Olympus BX5 light microscope (Olympus, Japan) and the images of multi-color

na

ISH were taken under Zeiss Axio Imager Z2 microscope (Zeiss, Germany) with

ur

fluorescent power supply.

Knockout of rln3a gene by CRISPR/Cas9

Jo

To elucidate the functions of tilapia rln3a during the gonadal development, the

CRISPR/Cas9 was used to knockout rln3a gene of tilapia. The guide RNA (gRNA) target site was selected from sequences corresponding to GGN18NGG on the sense strand of DNA (http://zifit.partners.org/ZiFiT/) as previously reported[33]. Briefly, fertilized eggs were randomly divided into four batches, one was used as intact control

and the other three were used for microinjection. The gRNA and Cas9 mRNA were coinjected into one-cell stage embryos of tilapia with an optimal concentration of 500 and 1000 ng/μl, respectively. Three control groups were set with the intact control, the injected fish with gRNA or Cas9 mRNA alone. The genomic DNA was extracted from pooled embryos, and DNA fragments spanning the rln3a targeting site were amplified using a pair of gene specific primers (rln3a-test-F; rln3a-test-R) adjacent to the target

ro of

site. A restriction enzyme site of Bsu36I adjacent to the protospacer adjacent motif (PAM) sequence (AGG) was selected to screen the putative mutants of F0 and F1

generations by restriction digestion. Subsequently, chimeric mutant F0 and F1 fish (XY)

-p

were grown reared to produce the homozygous F2 generation. The homozygous rln3a

re

mutant fish were screened by genomic PCR amplification with the same pair of gene

lP

specific primers and subsequent Sanger sequencing.

na

IHC

Testes of rln3a+/+ and rln3a-/- XY fish were dissected and the gonadosomatic index

ur

(GSI, the ratio between gonad weight and body weight) was calculated at 180 dah. The gonads were fixed in Bouin’s solution, dehydrated and embedded in paraffin. Then

Jo

tissue blocks were sectioned at 5 μm thickness. Paraffin sections were deparaffinized and hydrated. The sections were then treated in a blocking solution (5% BSA diluted by 1x PBS) (Sangon Biotech, China), incubated respectively with the primary antibody overnight at 4°C and rinsed with 1x PBS five times for 5 min per wash. The anti-Vasa (germ cells marker), -Proliferating Cell Nuclear Antigen (PCNA, the marker for

proliferating cells) (Cusabio, China), and -Cyp17a1 (Leydig cells marker) polyclonal antibodies with a dilution of 1:1000, were used to assess the impacts of rln3a mutation on spermatogenesis and steroidogenic properties of testes. For the negative control, the primary antibody was replaced with normal rabbit serum. Subsequently, the tissue sections were incubated with anti-rabbit immunoglobulin G (diluted at 1:1000) at room temperature for 1 h, and then rinsed with 1x PBS three times for 5 min per wash.

ro of

Immunoreactive signals were visualized using diaminobenzidine (Sigma, USA) as the

substrate. Sections were counterstained with hematoxylin. Finally, all the images for

-p

these sections were acquired with an Olympus BX5 light microscope (Olympus, Japan).

re

Analysis of steroidogenic enzyme genes by hCG treatment and rln3a gene mutation To understand the changes of steroidogenic enzyme genes in the testis of wild type

lP

and rln3a-/- under hCG treatment, real-time PCR were carried out. Briefly, rln3a+/+ and

na

rln3a-/- XY fish of 180-dah were randomly divided into four groups (rln3a+/+, rln3a-/-, rln3a+/+ hCG and rln3a-/- hCG, three fishes for each group), respectively. The hCG-

ur

induction was preformed by intraperitoneally injecting 1000 IU/kg body mass diluted by 1×PBS, which had been regularly used for ovulation induction and spermiation in

Jo

fish[30, 34, 35]. The three testes from each group were collected at 12 h after injection. And the RNA isolation, cDNA synthesis and Real-time PCR were preformed as the method described above to confirm the expression changes of steroid synthase (including StAR1, cyp11a1, cyp17a1 and cyp11b2).

Western blotting Total protein was extracted from rln3a+/+ (n=3) and rln3a-/- (n=3) XY testis at 180 dah, and diluted to a final concentration of 20 mg/ml. A western blotting was performed to detect protein expression in testes using the anti-Vasa, -eEF1A1B, -Cyp17a1, Cyp11b2 primary antibodies at a dilution ratio of 1:1000. Briefly, 100 ng of the whole gonad protein was separated by SDS-PAGE and transferred them onto PVDF

ro of

membrane (Amersham, Sweden). The membranes were then blocked with 5% low fat milk powder in TBST (20mM Tris-HCL pH7.5, 150 mM NaCl, 0.1% Tween 20) and

incubated with primary antibodies, and then with AP-labeled secondary antibody.

-p

Finally, the positive immunoreactivity was stained with NBT/BCIP substrates and

re

visualized on Fusion FX7 (Vilber Lourmat, France). Meanwhile, the expression level of GAPDH as reference protein was also checked to normalize the equal loading of

lP

protein sample. Moreover, the densitometry was quantified and normalized using

na

GAPDH as reference protein with Fusion-CAPT software. Three testes from both

ur

rln3a+/+ and rln3a-/- XY fish were used.

Germ cell counting

Jo

The cell count of spermatogenic cell at various stages including spermatogonia,

spermatocytes and spermatids, was calculated according to the methods described previously[36]. Briefly, ten sections were selected from each rln3a+/+ (n=6) and rln3a/-

(n=6) XY fish, and these sections were stained with traditional hematoxylin and eosin

(H.E.) staining. Then 5 fields of each section at 20× magnification were selected

randomly, and the images were acquired with an Olympus BX5 light microscope (Olympus, Japan) for cell counting of spermatogenic cells at different phase.

Sperm characteristics and fertility To detect the impacts of rln3a gene mutation on spermatogenesis of male fish, changes of sperm counts, sperm morphology and sperm motility were compared. Flow

ro of

cytometry was used to count the sperm number of seminal fluid collected from rln3a+/+

(n=3) and rln3a-/- (n=3) XY fish after the seminal fluid was diluted at 1:1000. The operating steps were followed as the manuscript of BD AccuriTM C6 Flow Cytometry

-p

(BD, USA), and the relative data were analyzed by Flow Jo software (BD, USA).

re

Papanicolaou staining was used to detect the morphology of sperms according to the method in previous reports[37, 38]. Briefly, the semen was diluted by 1×PBS solution

lP

before being smeared to the polylysine treated glass slides, after air-drying, the

na

specimens were stained with G6 dyes. And the images were captured under Zeiss Axio Imager Z2 microscope (Zeiss, Germany). Sperm motility, VCL (curvilinear velocity),

ur

VSL (straight line velocity) and sperm quality were examined by computer assisted sperm analysis using the Sperm Quality Analyzer according to the manufacturer’s

Jo

instructions (Zoneking Software, China). Briefly, sperms collected from rln3a+/+ (n=3) and rln3a-/- (n=3) XY at 180 dah were diluted 1:1000 with phosphate buffer saline, and one drop semen was dripped into the counting pool of the sperm counting board, and placed on the operating platform of a Leica DM500 light microscope (Leica, Germany). To check the fertility, 1200 mature eggs from a wild-type XX mother fish were divided

into six groups (each with 200 eggs), and an excessive amount of semen from rln3a+/+ (n=3) and rln3a-/- (n=3) XY fish was used for artificial insemination. Moreover, the ratio of fertilization and survival rate of offspring was calculated from 1 to 10 days after fertilization.

Immunofluorescence staining of sperm

ro of

The typical structure of the eukaryotic flagellum of sperm consists of a central pair of singlet microtubules surrounded by nine doublet microtubules. Each microtubule is

composed of the protein tubulin, and an α-tubulin antibody was used to be a marker for

-p

the differentiation of the flagellum[39]. Therefore, the immunofluorescence staining of

re

α-tubulin was carried out to detect the morphology changes of sperms from rln3a+/+ and rln3a-/- XY fish according to the previous study[39]. Briefly, the sperm specimens

lP

collected from rln3a+/+ (n=3) and rln3a-/- (n=3) XY fish were fixed in 4%

na

paraformaldehyde (Sigma-Aldrich, Germany) in 1×PBS at room temperature for 2 hours and rinsed with 1×PBS with 0.5% Triton X-100. Then they were incubated at

ur

4 °C overnight with anti-α-tubulin at a dilution of 1:1000 and subsequent the second antibody of Dylight 594 anti-rabbit IgG (ThermoFisher, USA). Images were captured

Jo

under Zeiss Axio Imager Z2 microscope (Zeiss, Germany) with fluorescent power supply.

Measurement of serum hormone level by ELISA Blood samples were collected from the caudal veins of rln3a+/+ (n=6), rln3a-/- (n=6),

rln3a+/++hCG (n=3) and rln3a-/-+hCG (n=3) XY fish, and kept at 4 °C overnight. Serum was collected after centrifugation and stored at −80 °C until use. Serum 11-KT levels were measured using EIA (enzyme-linked immunosorbentassay) Kit (Cayman, USA) according to the manufacturer’s instructions, which had been used to quantify the serum 11-KT level in many fish species[38, 40]. The 11-KT EIA kit is based on the competition between varied 11-KT and constant 11-KT tracer in each well for a limited

ro of

number of 11-KT-specific rabbit antiserum binding sites. The binding of 11-KT tracer

to the rabbit antiserum will be inversely proportional to 11-KT concentration. The interand intra-assay of concentration variation of 11-KT kit fell within the range of

-p

4.1%~19.2% at multiple points on a standard curve with 2-fold dilutions from 1.57~100

re

pg/ml. The assay has a range from 0.78-100 pg/ml with a sensitivity of ~1.3 pg/ml at minimum.

lP

In brief, a 96-well plate with two blanks, two non-specific binding wells, two

na

maximum binding wells and eight point standard curve (duplicated) were set in order to ensure accurate results. The standard curve was constructed by two-fold dilution

ur

from a 1ng/ml bulk standard into a serial standard ranging from 100 to 0.78 pg/ml. Each serum sample from the six groups was measured in two dilutions and each dilution was

Jo

assayed in duplicate. Then, load the reagents sequentially including buffer, standard, serum samples, 11-KT tracer and 11-KT antiserum to the corresponding wells according to the commercial manual. In addition, the plate was incubated at 4 °C for 18 h in dark to increase the reaction sensitivity. All plates had an additional rinse with wash buffer and the 11-KT plate had a 90 minute re-incubation with Ellman's reagent.

Absorbance was measured at a wavelength of 412 nm using a Multiskan™ GO microplate reader (ThermoFisher, USA). Plot the binding ratio of 11-KT and 11-KT tracer versus 11-KT concentration using linear (y) and log (x) and perform a 4parameter logistic fit. Basing on the binding ratio from each well, sample 11-KT concentrations (ng/ml) were determined by fit formula made from standard curve.

ro of

Rescue experiments by human recombinant RLN3 (hRLN3)

In this experiment, hRLN3 injection of rln3a-/- XY fish was carried out to check

whether hRLN3 was able to rescue the phenotype of weakened sperm mobility in rln3aXY fish. Briefly, the rln3a-/- XY fish was intraperitoneally injected twice at a time

-p

/-

re

interval of one week with a concentration of 400 pm hRLN3 (n=3) according to the previous study[13]. The other three control groups were set up as rln3a+/+ XY fish,

lP

rln3a-/- XY fish, rln3a-/- XY fish injected with physiological saline (n=3), respectively.

na

After treatment, sperms were collected from the four groups and were carried the sperm

ur

motility analysis performed as described above.

Scanning electron microscope analysis

Jo

To detect the changes of testicular morphology in the rln3a-/- XY fish, the testes

were collected from rln3a+/+ and rln3a-/- XY tilapia, respectively. And the specimens were pre-fixed using 2.5% glutaraldehyde, rinsed the specimens three times with phosphate buffer (pH 7.2), and then fixed in 1% Osmium (OsO4), after rinsed three times with phosphate buffer, the specimens were dehydrated in ascending graded

ethanol. Then the dehydrated samples were put into a drying basket and dried with critical point dryer. Then the surface of the dried samples was treated with electric conduction, and the specimens were observed under a Hitachi-SU8010 FESEM scanning electron microscope (Hitachi, Japan).

Statistical analysis

ro of

All the data for real-time PCR, cell quantification, Western blotting, EIA, GSI

were presented as the mean ± SD. And Student’s t-test was preformed to determine the

difference between two groups, One-way ANOVA followed by Tukey test for multiple

-p

comparisons were preformed using SPSS software. P<0.05 was used to determine the

re

statistically significant differences.

lP

Results

na

Identification of two paralogous rln3 genes in Nile tilapia By searching genomic and transcriptomic database, two rln3 genes, represented as

ur

rln3a and rln3b, were identified from the genome of tilapia. Phylogenetic analysis showed that duplication of rln3 gene is unique to teleosts (Fig. 1A). Furthermore,

Jo

synteny analysis demonstrated that rln3b gene, but not rln3a, is the orthologous gene of the mammalian counterpart due to the consistent gene locus distribution (NANOS3, CC2D1A, MRII, and RFX1 genes) of fish rln3b and RLN3 in other vertebrates. However, fish two paralogous rln3 genes and surrounding RFX1, KHSRP, TNPO2 gene locus were found to be close to each other on a single chromosome or a single linkage

group (Fig. 1B).

Expression profiles of rln3 in tilapia gonads To investigate the expression profile of rln3 genes in the HPG axis, real-time PCR was carried out to examine the expression pattern of both rln3a and 3b in brain, pituitary and gonads of adult tilapia (Fig. 2A). The highest expression of rln3a was detected in

ro of

the testis, and a relative lower expression of rln3a was also detected in both brain and pituitary. Rln3b gene was also abundantly expressed in the brain, pituitary and testis.

However, expression of rln3b in the brain was significantly higher than that of testis.

-p

Interestingly, the expression of rln3a was much higher than that of rln3b in the testis,

re

while no evident differences between rln3a and 3b gene expression were found in other

lP

three tissues. The lowest expression of both rln3a and 3b was found in the ovary.

na

Cellular localization of rln3a in the testis

To further characterize the cellular localization of rln3a in tilapia testis, both

ur

traditional and two-color fluorescence ISH were carried out by using a well-defined Leydig cell-specific marker (cyp17a1) to define cell type in testis at 150 dah. Results

Jo

showed that rln3a was abundantly expressed in the Leydig cells, while no positive signal was detected when a sense probe was used (Fig. 2B and C). Moreover, colocalization of rln3a and a Leydig cell marker of cyp17a1 gene were observed, indicating the specific expression of rln3a in the Leydig cell in testis (Fig. 2D-G). However, the expression of rln3b was not detected in the testis by ISH (data not shown).

Mutation of rln3a gene by CRISPR/Cas9 To investigate the potential role of Rln3a in the testicular development of male tilapia, the homozygous mutant line was produced by CRISPR/Cas9 technology. Restriction digestion by Bsu36I, demonstrated that an evident uncleaved band of 588bp was detected in genome of XY fish, while no uncut band were detected in other three

ro of

control lanes (Fig. 3A). Genotyping analysis of F2 generation by genomic PCR and

Sanger sequencing revealed as a frame-shift with 2-bp deletion in homozygous rln3a gene mutation line (Fig. 3B). The comparison of the predicted amino acid sequence

-p

demonstrated that 2-bp deletion of rln3a led to the yield of a truncated protein due to a

re

premature stop codon (Fig. 3C and D).

lP

Effects of rln3a mutation on testicular structure

na

Compared with control XY fish, mutation of rln3a gene led to gonadal hypertrophy with increase of testicular fluid amount (Fig. 4A and B) and GSI (Fig. 4C).

ur

However, morphological observation indicated that mutation of rln3a led to a shrink of spermatogenic layer and development of few mature sperm in comparison of control

Jo

XY fish (Fig. 4D and E). Meanwhile, flow cytometry analysis revealed as a significant decrease of mature sperm production in the testis of rln3a-/- XY fish. Massive sperm was produced in the rln3a+/+ testis, however, fewer sperms can be found in the rln3a-/testis (Fig. 4F). Furthermore, scanning electron microscope observations also demonstrated as formation of a thinner spermatogenic layer and hardly absence of

mature sperm (Fig. 4G-L).

Effects of rln3a mutation on sperm morphology and fertility Mutation of rln3a-/- in XY fish led to the abnormality of sperm morphology. Decrease in length of sperm tail and double-tailed sperms were found in rln3a-/- XY fish (Fig. 5A, A’ and C’) when compared with that in rln3a+/+ XY fish (Fig. 5B, B’ and

ro of

C) through Papanicolaou staining and immunofluorescence of α-tubulin. The survival rate of offspring was significantly decreased to all death during the period of 3 to 6 daf

-p

(days after fertilization) (Fig. 5D).

re

Impacts of rln3a mutation on molecular changes in germ cells

To measure the molecular changes in the testis of homologous rln3a mutation XY

lP

fish, IHC, real-time PCR and Western blotting were performed. H.E. staining and IHC

na

analysis of PCNA expression revealed that number of primary spermatocyte in rln3a-/XY fish (Fig. 6B and D) were much less than that in rln3a+/+ XY fish (Fig. 6A and C).

ur

Quantification of germ cell frequency indicated that a significant decrease frequency of spermatogonia, spermatocytes and spermatids in the testes of rln3a-/- XY fish than that

Jo

of rln3a+/+ XY fish (Fig. 6E). Real-time PCR analysis demonstrated that expression of serials of germ cell related genes of vasa (germ cells), oct4 (spermatogonia), pcna, sycp3 (spermatocytes), cyclin B2 (spermatocytes) and prm (spermatids) was significantly inhibited in the testis of rln3a-/- XY fish than that of rln3a+/+ XY fish (Fig. 6F). Western blotting and densitometry analysis further exhibited that mutation of rln3a

gene led to the evident decrease of the expression of Vasa and eEF1A1B at the level of translation (Fig. 6G and H).

Effects of rln3a mutation on 11-KT production in Leydig cells The results of both IHC and Western blotting revealed that mutation of rln3a gene resulted in the repression of steroidogenic enzyme genes StAR1, Cyp17a1 and

ro of

Cyp11b2 (Fig. 7A-D). Furthermore, production of 11-KT was evidently decreased in

rln3a-/- XY fish (Fig. 7F). Furthermore, deficiency of rln3a gene led to the dramatic

decline of StAR1, cyp11a1, cyp17a1 and cyp11b2 (Fig. 7E). However, intraperitoneal

-p

injection of hCG significant enhanced the expression of steroidogenic enzyme genes

re

for 11-KT production in the testis of rln3a+/+ and rln3a-/- XY fish, while the fold changes in rln3a-/- XY fish is much lower than that of control XY fish. However, hCG injection

lP

failed to upregulate the expression of cyp11b2 gene in rln3a-/- XY fish. Consistently, a

na

dramatic decline of 11-KT level in rln3a-/- XY fish than control XY fish was found. Meanwhile, a significant increase of 11-KT production in hCG-injected control XY fish

ur

was detected, but not in hCG-injected rln3a-/- XY fish. (Fig. 7E and F). Meanwhile, the evident increase of both FSH and LH gene expression in the pituitary of rln3a-/- XY

Jo

fish than that of wild type XY fish (Fig. 7G).

Comparison of sperm characteristics between control and rln3a-/- XY fish with or without hRLN3 supplement The track analysis of motile sperms from XY fish of rln3a+/+, rln3a-/-, rln3a-/-

+vehicle and rln3a-/-+hRLN3a group indicated that mutation of rln3a strongly affects the mobility (Fig. 8A-D). Quantification of different tracking parameters showed that dramatic attenuation of progressive sperms (PR) (Fig. 8E), both progressive sperms and non-progressive sperms (PR+NP) (Fig. 8F) were dramatically attenuated, while, significant increase of the number of immotile sperms (IM) (Fig. 8G) were found in both rln3a-/- and vehicle rln3a-/- group than that of wild type XY fish. Supplement of

ro of

hRLN3 in rln3a-/- XY fish remarkably increased the ratio of PR (Fig. 8E) and PR+NP

(Fig. 8F) sperms, and decreased the ratio of IM sperms in injected rln3a-/- XY fish (Fig. 8G). In rln3a-/- and vehicle rln3a-/- groups, the time of sperm movement (Fig. 8H),

-p

average curve movement speed (VCL) (Fig. 8I), and average straight line movement

re

speed (VSL) (Fig. 8J) of sperm were significantly reduced than rln3a+/+ group, while

na

Discussions

lP

hRLN3 injection considerably improved the time and speed of sperm motility (H-J).

Relaxin3 is required for the energy homeostasis and reproduction via the binding of

ur

RFXP3 receptor in mammals[9]. In fish, two paralogous rln3 genes and four rfxp3 receptors had been identified, suggesting the essential roles of Rln3-Rfxp3 system in

Jo

fish physiological functions. The expression of rln3 genes and their receptors in different tissues at both early developmental stage and adult phase, indicates the diverse physiological roles of Rln3 in teleosts[24, 29]. However, the exact roles of Rln3 in both energy osmoregulation and reproduction in fish remain largely unknown. In the present study, the expression profiles of rln3 genes in HPG axis were investigated to understand

their possible roles in male reproduction. Furthermore, the impacts of null mutation of rln3a gene on spermatogenesis, sperm maturation, sperm motility, and fertility were extensively investigated. Subsequently, the effects of Rln3a deficiency on androgen production and pituitary gonadotropins release were also investigated. Finally, alterations of androgen production and sperm motility were also examined after rescuing by human recombinant RLN3 protein and human hCG treatment in rln3a-/-

ro of

XY fish, respectively.

In mammals, Rln3/rln3 expression was predominantly detected in neurons of the

nucleus incertus (or in analogous neurons) in mouse (Mus musculus)[19], rat (Rattus

-p

norvegicus)[18], macaque (Macaca fascicularis)[41], suggesting their physiological

re

importance in neuroendocrine regulations. Meanwhile, previous report showed that RLN3/Rln3 expression in brain and testis indicated their possible roles in

lP

spermatogenesis in human (Homo sapiens) and rhesus (Macaca mulatta)[42].

na

Furthermore, stimulation of GnRH release by RLN3 treatment of hypothalamic explants of male rats suggests its critical function in the HPG axis[43]. In teleosts, two

ur

paralogous rln3 genes had been isolated and several previous reports demonstrated that expression of rln3b in the brain was associated with osmoregulation[27]. However, the

Jo

physiological roles of Rln3 in fish reproduction need to be investigated. Our data revealed that both rln3a and 3b were expressed in the brain, pituitary, and testis of tilapia. Moreover, the expression of rln3a is much higher than that of rln3b in the testis, while the highest expression level of rln3b was found in brain. Therefore, differential expression profiles indicated that the duplicated rln3 genes might be sub-functionalized

paralogous genes, which were involved in the regulation of reproduction and osmoregulation in fish, respectively. Furthermore, abundant expression of rln3a in the Leydig cell in testis emphasized its possible roles in male reproduction. Moreover, the expression of RXFP3 isoforms was observed in the spermatocytes and spermatozoa, indicating that the Rln3a-RXFP3 system functions in spermatogenesis, sperm maturation via a paracrine manner. We speculated that fish is a good model to

ro of

characterize the distinct roles of Rln3 in HPA and HPG axis, even though conditional gene knockout technology has not been successfully established.

Previous reports demonstrated that Rln3 is closely related to sperm motility and

-p

fertility in mammals[23]. Injection of RLN3 stimulated the production of LH[43], and

re

exposure to RLN3 of human spermatozoa alleviated the natural decline in sperm motility in human beings[23]. Immunocytochemistry analysis showed the presence of

lP

G-protein coupled receptor RXFP3, the cognate receptor for relaxin-3, was located in

na

the post-acrosomal region of the sperms’ head and neck[23]. However, no further evidences are found to identify the exact functions of RLN3 in reproduction by using a

ur

knockout model in vertebrates. In this study, we constructed a homologous null rln3a gene mutant line and investigated the changes of morphology and molecular changes

Jo

in testicular differentiation, sperm maturation, and fertility. For the first time, our work demonstrated that Rln3a was indispensable for the differentiation of different phase spermatogenic cells, including spermatogonia, spermatocytes, spermatids and sperms, revealing as the significant decrease of marker genes of oct4, vasa, pcna, sycp3, cyclin b2 and prm. Morphological analysis by traditional H.E. staining, scanning electrical

microscope and flow cytometry further indicated homologous rln3a gene mutation had affected both spermatogenesis and spermiogenesis, which resulted in the formation of abnormal sperm and decrease of fertility. Moreover, lower fertilization rate and high mortality rate around the day of hatching of the offspring produced by rln3a-/- XY fish, suggested the essentiality of Rln3 in the maintenance of mature sperm motility and fertility in fish. Our data further emphasized that the functions of Rln3a in

ro of

spermatogenesis and spermiogenesis might be conserved across the vertebrates.

Previous studies have demonstrated that Relaxin-RXFP system was associated with cAMP-PKA signaling pathway[44], therefore, it might interact and partially overlap

-p

with steroidogenic pathway. In this study, our data showed that mutation of rln3a led

re

to the significant decline of steroidogenic enzyme genes, including StAR1, cyp11a1, cyp17a1, and cyp11b2 genes. The significant decrease of 11-KT production in rln3a-/-

lP

XY fish suggested that Rln3a-activated signaling pathway might be an essential

na

mediator for the steroidogenic enzyme genes expression and 11-KT production in male fish. Furthermore, decrease of 11-KT level in rln3a-/- XY fish might account in part for

ur

the abnormality of spermatogenesis and sperm maturation. HPG axis was supposed to be the primary driver for reproduction and steroids production. In this rln3a-/- XY fish,

Jo

expression level for both FSH and LH were significantly enhanced than that in control group. We hypothesized that the ectopic increase of GTH might be caused by the decrease of 11-KT level in the testis via a negative feedback manner. HCG is potential peptide hormone to stimulate the expression of steroid synthase[30], and the production of testosterone in human[45]. It was documented that

hCG treatment restored spermatogenesis and improve the testosterone-associated infertility[46, 47]. A single injection of hCG induce spermatogenesis and sperm maturation in several fish species, including Japanese eel[48, 49], Spined loach (Cobitis taenia)[50], Sterlet sturgeon (Acipenser ruthenus)[51], goldfish (Carassius auratus), Eurasian perch (Perca fluviatilis)[52] and European sea bass (Dicentrarchus labrax)[53]. Therefore, hCG injection successfully stimulated the expression of

ro of

steroidogenic enzyme genes (StAR1, cyp11a1, cyp17a1 and cyp11b2) and 11-KT production in the control XY fish. However, hCG treatment failed to promote cyp11b2 gene expression and 11-KT production in rln3a-/- XY fish. Our present data indicated

-p

that Rln3a might be an essential mediator for androgen production in the testis of XY

re

fish.

Recent report demonstrated that exposure to RLN3 partially rescue the natural

lP

decline of sperm motility in human[23]. In this study, mutation of fish rln3a gene led

na

to a significant decrease of sperm motility, indicating that Rln3a is involved in maintenance of the sperm motility in fish. Interestingly, intraperitoneal injection of

ur

human recombinant RLN3 significantly improved the sperm motility, and the ability of VCL, percentage of PR and NR movement sperm reached the control level. These data

Jo

indicated that the functions in regulating the sperm motility of Rln3 might be conserved across different phyla. In summary, two paralogous rln3 genes were identified in tilapia, which displayed distinct expression profiles and functions in tilapia. Our data by using a null rln3a gene fish model highlights that Rln3a might be an essential mediator of androgen production

in Leydig cell by regulating the expression of steroidogenic enzyme genes. Subsequently, decline of 11-KT level stimulated the abnormal increase of the level of FSH and LH in the pituitary due to the negative feedback regulation. Finally, Rln3a plays a critical role in maintenance of spermatogenesis, spermiogenesis, and fish fertility via directly controlling the sperm morphology and sperm motility. (Fig. 9).

ro of

Declaration of interest The authors declare that there are no conflicts of interest that could be perceived as prejudicing the impartiality of the research reported.

-p

Funding

re

This work was supported in part by Grants for Scientific Research from the National Natural Science Foundation of China (31772825, 31572597, 31872556,

lP

31630082 and 31861123001). This work was also supported in part by National key

na

research and development program of China (2018YFD0900202).

ur

Author contribution statement

Linyan Zhou and Lanying Yang together conceived and designed the experiments;

Jo

Lanying Yang, Yanlong Li and You Wu performed most of the experiments. Shaohua Sun and Qiang Song maintained the fish stock. Jing Wei and Lina Sun conducted cell qualification, ISH and IHC experiments. Minghui Li performed real-time PCR analysis. Linyan Zhou and Lanying Yang analyzed the data, interpreted the results and drafted the manuscript; Linyan Zhou and Deshou Wang edited the manuscript. All authors read

and approved the final manuscript.

References [1] J. Bowles, D. Knight, C. Smith, D. Wilhelm, J. Richman, S. Mamiya, K. Yashiro, K. Chawengsaksophak, M.J. Wilson, J. Rossant, H. Hamada, P. Koopman, Retinoid signaling determines germ cell fate in mice, Science, 312 (2006) 596-600. [2] R.W. Schulz, L.R. de Franca, J.J. Lareyre, F. Le Gac, H. Chiarini-Garcia, R.H. Nobrega, T. Miura, Spermatogenesis in fish, General and comparative endocrinology, 165 (2010) 390-411. [3] R. Billard, A. Fostier, C. Weil, B. Breton, Endocrine Control Of Spermatogenesis In Teleost Fish, Can J Fish Aquat Sci, 39 (1982) 65-79. Developmental Biology, 38 (1994) 217-229.

ro of

[4] Y. Nagahama, Endocrine Regulation Of Gametogenesis In Fish, International Journal Of [5] H. Ueda, A. Kambegawa, Y. Nagahama, Involvement Of Gonadotropin And Steroid-Hormones In

Spermiation In the Amago Salmon, Oncorhynchus-Rhodurus, And Goldfish, Carassius-Auratus, General and comparative endocrinology, 59 (1985) 24-30.

[6] R.A.D. Bathgate, C.S. Samuel, T.C.D. Burazin, A.L. Gundlach, G.W. Tregear, Relaxin: new peptides,

-p

receptors and novel actions, Trends Endocrin Met, 14 (2003) 207-213.

[7] K.J. Rosengren, F. Lin, R.A.D. Bathgate, G.W. Tregear, N.L. Daly, J.D. Wade, D.J. Craik, Solution structure and novel insights into the determinants of the receptor specificity of human relaxin-3, Journal

re

Of Biological Chemistry, 281 (2006) 5845-5851.

[8] T.N. Wilkinson, T.P. Speed, G.W. Tregear, R.A. Bathgate, Evolution of the relaxin-like peptide family, Bmc Evol Biol, 5 (2005).

lP

[9] T.C. Burazin, R.A. Bathgate, M. Macris, S. Layfield, A.L. Gundlach, G.W. Tregear, Restricted, but abundant, expression of the novel rat gene-3 (R3) relaxin in the dorsal tegmental region of brain, Journal of neurochemistry, 82 (2002) 1553-1557.

[10] S. Ma, P. Bonaventure, T. Ferraro, P.J. Shen, T.C.D. Burazin, R.A.D. Bathgate, C. Liu, G.W. Tregear,

na

S.W. Sutton, A.L. Gundlach, Relaxin-3 in GABA projection neurons of nucleus incertus suggests widespread influence on forebrain circuits via G-protein-coupled receptor-135 in the rat, Neuroscience, 144 (2007) 165-190.

ur

[11] S. Ma, A.L. Gundlach, Relaxin-family peptide and receptor systems in brain: Insights from recent anatomical and functional studies, Relaxin And Related Peptides, 612 (2007) 119-137. [12] J. Kumagai, S.Y. Hsu, H. Matsumi, J.S. Roh, P. Fu, J.D. Wade, R.A. Bathgate, A.J. Hsueh,

Jo

INSL3/Leydig insulin-like peptide activates the LGR8 receptor important in testis descent, The Journal of biological chemistry, 277 (2002) 31283-31286. [13] J. Calvez, C. de Avila, G. Guevremont, E. Timofeeva, Sex-Specific Effects of Chronic Administration of Relaxin-3 on Food Intake, Body Weight and the Hypothalamic-Pituitary-Gonadal Axis in Rats, J Neuroendocrinol, 28 (2016). [14] J. Calvez, C. de Avila, E. Timofeeva, Sex-specific effects of relaxin-3 on food intake and body weight gain, Brit J Pharmacol, 174 (2017) 1049-1060. [15] C. de Avila, S. Chometton, C. Lenglos, J. Calvez, A.L. Gundlach, E. Timofeeva, Differential effects of relaxin-3 and a selective relaxin-3 receptor agonist on food and water intake and hypothalamic neuronal activity in rats, Behav Brain Res, 336 (2018) 135-144.

[16] C. Lenglos, J. Calvez, E. Timofeeva, Sex-Specific Effects of Relaxin-3 on Food Intake and Brain Expression of Corticotropin-Releasing Factor in Rats, Endocrinology, 156 (2015) 523-533. [17] C. Lenglos, A. Mitra, G. Guevremont, E. Timofeeva, Sex differences in the effects of chronic stress and food restriction on body weight gain and brain expression of CRF and relaxin-3 in rats, Genes Brain Behav, 12 (2013) 370-387. [18] M. Haidar, G. Guevremont, C. Zhang, R.A.D. Bathgate, E. Timofeeva, C.M. Smith, A.L. Gundlach, Relaxin-3 Inputs Target Hippocampal Interneurons and Deletion of Hilar Relaxin-3 Receptors in "Floxed-RXFP3" Mice Impairs Spatial Memory, Hippocampus, 27 (2017) 529-546. [19] A.J. Lawther, A. Flavell, S. Ma, S. Kent, C.A. Lowry, A.L. Gundlach, M.W. Hale, Involvement of Serotonergic and Relaxin-3 Neuropeptide Systems in the Expression of Anxiety-like Behavior, Neuroscience, 390 (2018) 88-103. [20] M. Haidar, M. Lam, B.E. Chua, C.M. Smith, A.L. Gundlach, Sensitivity to Chronic Neurochem Res, 41 (2016) 481-491.

ro of

Methamphetamine Administration and Withdrawal in Mice with Relaxin-3/RXFP3 Deficiency, [21] P.F. Corradi, R.B. Corradi, L.W. Greene, Physiology of the Hypothalamic Pituitary Gonadal Axis in the Male, The Urologic clinics of North America, 43 (2016) 151-162.

[22] C.M. Smith, A.J. Lawrence, S.W. Sutton, A.L. Gundlach, Behavioral phenotyping of mixed background (129S5:B6) relaxin-3 knockout mice, Annals of the New York Academy of Sciences, 1160

-p

(2009) 236-241.

[23] S. Heidari, A.H. Taromchi, R. Nejatbakhsh, S. Shokri, Expression and localisation of RXFP3 in human spermatozoa and impact of INSL7 on sperm functions, Andrologia, 50 (2018).

re

[24] H. Alnafea, B. Vahkal, C.K. Zelmer, S. Yegorov, J. Bogerd, S.V. Good, Japanese medaka as a model for studying the relaxin family genes involved in neuroendocrine regulation: Insights from the expression endocrinology, 487 (2019) 2-11.

lP

of fish-specific rln3 and insl5 and rxfp3/4-type receptor paralogues, Molecular and cellular [25] S.V. Good-Avila, S. Yegorov, S. Harron, J. Bogerd, P. Glen, J. Ozon, B.C. Wilson, Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, and expression analysis, Bmc Evol Biol, 9 (2009).

na

[26] J.I. Park, J. Semyonov, W. Yi, C.L. Chang, S.Y.T. Hsu, Regulation of Receptor Signaling by Relaxin A Chain Motifs derivation of pan-specific and LGR-7-specific human relaxin analogs, Journal Of Biological Chemistry, 283 (2008) 32099-32109.

ur

[27] M. Kusakabe, A. Ishikawa, J. Kitano, Relaxin-related gene expression differs between anadromous and stream-resident stickleback (Gasterosteus aculeatus) following seawater transfer, General and comparative endocrinology, 205 (2014) 197-206.

Jo

[28] G.B. Hu, M. Kusakabe, Y. Takei, Localization of diversified relaxin gene transcripts in the brain of eels, General and comparative endocrinology, 172 (2011) 430-439. [29] A. Donizetti, M. Fiengo, S. Minucci, F. Aniello, Duplicated zebrafish relaxin-3 gene shows a different expression pattern from that of the co-orthologue gene, Dev Growth Differ, 51 (2009) 715-722. [30] X.G. Yu, L.M. Wu, L. Xie, S.J. Yang, T. Charkraborty, H.J. Shi, D.S. Wang, L.Y. Zhou, Characterization of two paralogous StAR genes in a teleost, Nile tilapia (Oreochromis niloticus), Molecular and cellular endocrinology, 392 (2014) 152-162. [31] M. Nakamoto, M. Fukasawa, S. Orii, K. Shimamori, T. Maeda, A. Suzuki, M. Matsuda, T. Kobayashi, Y. Nagahama, N. Shibata, Cloning and expression of medaka cholesterol side chain cleavage cytochrome P450 during gonadal development, Dev Growth Differ, 52 (2010) 385-395.

[32] L.Y. Zhou, D.S. Wang, Y. Shibata, B. Paul-Prasanth, A. Suzuki, Y. Nagahama, Characterization, expression and transcriptional regulation of P450c17-I and -II in the medaka, Oryzias latipes, Biochemical and biophysical research communications, 362 (2007) 619-625. [33] M.H. Li, H.H. Yang, M.R. Li, Y.L. Sun, X.L. Jiang, Q.P. Xie, T.R. Wang, H.J. Shi, L.N. Sun, L.Y. Zhou, D.S. Wang, Antagonistic Roles of Dmrt1 and Foxl2 in Sex Differentiation via Estrogen Production in Tilapia as Demonstrated by TALENs, Endocrinology, 154 (2013) 4814-4825. [34] M.B. Sewer, M.R. Waterman, ACTH modulation of transcription factors responsible for steroid hydroxylase gene expression in the adrenal cortex, Microsc Res Techniq, 61 (2003) 300-307. [35] I.B. Goo, I.S. Park, H.W. Gil, J.H. Im, Stimulation of Spermiation by Human Chorionic Gonadotropin and Carp Pituitary Extract in Grass Puffer, Takifugu niphobles, Development & reproduction, 19 (2015) 253-258. [36] E.R. de Alvarenga, L.R. de Franca, Effects of Different Temperatures on Testis Structure and Function, with Emphasis on Somatic Cells, in Sexually Mature Nile Tilapias (Oreochromis niloticus),

ro of

Biol Reprod, 80 (2009) 537-544.

[37] J. Chen, D. Jiang, D. Tan, Z. Fan, Y. Wei, M. Li, D. Wang, Heterozygous mutation of eEF1A1b resulted in spermatogenesis arrest and infertility in male tilapia, Oreochromis niloticus, Sci Rep, 7 (2017) 43733.

[38] X. Fang, L. Wu, L. Yang, L. Song, J. Cai, F. Luo, J. Wei, L. Zhou, D. Wang, Nuclear progestin

-p

receptor (Pgr) knockouts resulted in subfertility in male tilapia (Oreochromis niloticus), The Journal of steroid biochemistry and molecular biology, 182 (2018) 62-71.

[39] F. Chauvigne, C. Zapater, J.M. Gasol, J. Cerda, Germ-line activation of the luteinizing hormone

re

receptor directly drives spermiogenesis in a nonmammalian vertebrate, Proc Natl Acad Sci U S A, 111 (2014) 1427-1432.

[40] D.N. Jiang, H.H. Yang, M.H. Li, H.J. Shi, X.B. Zhang, D.S. Wang, gsdf Is a Downstream Gene of

lP

dmrt1 That Functions in the Male Sex Determination Pathway of the Nile Tilapia, Mol Reprod Dev, 83 (2016) 497-508.

[41] S. Ma, F.E. Olucha-Bordonau, M.A. Hossain, F. Lin, C. Kuei, C.L. Liu, J.D. Wade, S.W. Sutton, A. Nunez, A.L. Gundlach, Modulation of hippocampal theta oscillations and spatial memory by relaxin-3

na

neurons of the nucleus incertus, Learn Memory, 16 (2009) 730-742. [42] J.D. Silvertown, A. Neschadim, H.N. Liu, P. Shannon, J.S. Walia, J.C. Kao, J. Robertson, A.J. Summerlee, J.A. Medin, Relaxin-3 and receptors in the human and rhesus brain and reproductive tissues,

ur

Regulatory peptides, 159 (2010) 44-53.

[43] B.M. McGowan, S.A. Stanley, J. Donovan, E.L. Thompson, M. Patterson, N.M. Semjonous, J.V. Gardiner, K.G. Murphy, M.A. Ghatei, S.R. Bloom, Relaxin-3 stimulates the hypothalamic-pituitary-

Jo

gonadal axis, Am J Physiol-Endoc M, 295 (2008) E278-E286. [44] C.W. Dessauer, B.T. Nguyen, Relaxin stimulates multiple signaling pathways: activation of cAMP, PI3K, and PKCzeta in THP-1 cells, Annals of the New York Academy of Sciences, 1041 (2005) 272279.

[45] J.N. Flanagan, M. Lehtihet, The Response to Gonadotropin-Releasing Hormone and hCG in Men with Prior Chronic Androgen Steroid Abuse and Clinical Hypogonadism, Horm Metab Res, 47 (2015) 668-673. [46] T.P. Kohn, M.R. Louis, S.M. Pickett, M.C. Lindgren, J.R. Kohn, A.W. Pastuszak, L.I. Lipshultz, Age and duration of testosterone therapy predict time to return of sperm count after human chorionic gonadotropin therapy, Fertility & Sterility, 107 (2016) 351.

[47] E.P. Wenker, J.M. Dupree, G.M. Langille, J. Kovac, R. Ramasamy, D. Lamb, J.N. Mills, L.I. Lipshultz, The Use of HCG-Based Combination Therapy for Recovery of Spermatogenesis after Testosterone Use, J Sex Med, 12 (2015) 1334-1337. [48] T. Miura, K. Yamauchi, Y. Nagahama, H. Takahashi, Induction Of Spermatogenesis In Male Japanese Eel, Anguilla-Japonica, by a Single Injection Of Human Chorionic-Gonadotropin, Zool Sci, 8 (1991) 63-73. [49] Y. Ozaki, E.L. Damsteegt, A.N. Setiawan, T. Miura, P.M. Lokman, Expressional regulation of gonadotropin receptor genes and androgen receptor genes in the eel testis, General and comparative endocrinology, 280 (2019) 123-133. [50] C.C. Mylonas, A. Fostier, S. Zanuy, Broodstock management and hormonal manipulations of fish reproduction, General and comparative endocrinology, 165 (2010) 516-534. [51] A. Rzemieniecki, J. Domagalla, J. Glogowski, A. Ciereszko, R. Trzebiatowski, J. Kouril, J. Hamackova, I. Babiak, Induced spermiation in 3-year-old sterlet, Acipenser ruthenus L., Aquac Res, 35

ro of

(2004) 144-151.

[52] D. Zarski, G. Bernath, J. Krol, B.I. Cejko, Z. Bokor, K. Palinska-Zarska, S. Milla, P. Fontaine, S. Krejszeff, Effects of hCG and salmon gonadoliberine analogue on spermiation in the Eurasian perch (Perca fluviatilis), Theriogenology, 104 (2017) 179-185.

[53] R. Schiavone, L. Zilli, S. Vilella, C. Fauvel, Human chorionic gonadotropin induces

re

sperm quality, Aquaculture, 255 (2006) 522-531.

-p

spermatogenesis and spermiation in 1-year-old European sea bass (Dicentrarchus labrax): Assessment of

lP

Figure Legends

Fig. 1 Phylogenetic and syntenic analysis of RLN3/Rln3 in vertebrates.

na

Phylogenetic tree of RLN3/Rln3 proteins of vertebrates constructed by using chicken Relaxin (Rln) as an out-group (A). Values on the tree represents bootstrap scores of 1000 trials, indicating the

ur

credibility of each branch. Branch lengths are proportional to the number of amino acid changes.

Jo

Synteny maps comparing genes flanking rln3 gene in tetrapods and teleosts constructed using the Ensembl Genome Browser (http://www.ensembl.org) and BLAST search against tilapia genome (B). Gene symbols are described according to Ensemble database. The bar lengths are not proportional to the distances between genes. Dotted lines represent the omitted genes on the chromosome/scaffold. The direction of the arrows indicates the gene orientation.

ro of -p

re

Fig. 2 Differential expression profiles of rln3 gene in tilapia.

Expression of rln3 genes in the brain, pituitary, and gonads of tilapia by real-time PCR (A). The

lP

reference gene β-actin was used to normalize the expression values. Data are expressed as the mean

na

± SD of three independent samples. Different lowercase letters, capital letters and asterisk above the error bar indicate statistical differences of rln3a and (or) 3b, tested by one-way ANOVA followed

ur

by Duncan’s post hoc test (P<0.05). The cellular localization of rln3a in adult XY gonad by ISH with specific anti-DIG-AP (alkaline phosphatase) antibody conjugate and the color substrates NBT

Jo

(nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl-phosphate). Arrow indicates the positive signal of rln3a in testis (B). The negative control in the testis staining with sense probe of rln3a (C). The colocalization of rln3a gene and Leydig cell marker gene (cyp17a1) in adult XY gonad (D-G). RNA probes were labeled with FITC and DIG, respectively. Photographs in D-G showed the same area of the XY gonad. The signals of rln3a and cyp17a1 are indicated by green (E)

and red (F) florescence in Leydig cells, respectively. The merged image panel A indicates the colocalization of rln3a and cyp17a1. Blue fluorescence stained by DAPI indicates positions of nuclear

lP

re

-p

ro of

(D, G).

na

Fig. 3 Establishment of homologous rln3a gene mutant line. Rln3a gene structure, the target site and the restriction enzyme cutting site (underline) were shown.

ur

The mutant was detected by restriction enzyme (Bsu36I) digestion and the uncleaved DNA fragment was indicated by the white arrow. The Cas9 and gRNA were added as indicated on the top panel

Jo

(A). A deletion of 2 bp (red color) in the genome of rln3a-/- fish compared with rln3a+/+ fish was detected by Sanger sequencing analysis (B). In comparison with wild type siblings, a putative truncated protein was produced in homologous rln3a-/- fish (C-D).

ro of -p re lP

Fig. 4 Rln3a is required for testicular development and spermiogenesis.

na

Anatomical examination of the testis of rln3a+/+ (A) and rln3a-/- (B) XY fish. Comparison of gonadosomatic index (GSI) of rln3a+/+ and rln3a-/- XY fish (C). Much lower sperm yield was

ur

observed in the efferent duct of rln3a-/- (E) than that of rln3a+/+ (D) XY fish by histological analysis of efferent duct. Red dashed line, seminiferous duct. Sperm count of rln3a+/+ and rln3a-/- XY fish

Jo

by Flow Cytometry (F). Scanning Electrical Microscope analysis of rln3a+/+ (G-I) and rln3a-/- (J-L) testis at 180 dah. Morphology of the transection of rln3a+/+ (G) and rln3a-/- testis (J), observation of morphology of spermatozoa of rln3a+/+ (H and I) and rln3a-/- (K and L).

ro of -p

re

Fig. 5 Impaired sperm morphology and fertility in rln3a-/- XY fish.

Morphology observation of sperms in rln3a+/+ (A and A’) and rln3a-/- (B and B’) XY fish by

lP

Papanicolaou staining. Sperms with shorter or two tails were found in rln3a-/- XY fish (B and B’)

na

but not in rln3a+/+ XY fish (A and A’). Immunofluorescence of α-tubulin also illustrated the presence of sperms with two tails in rln3a-/- (C’) XY fish but not in rln3a+/+ (C) XY fish. Survival rates of

/-

ur

embryos obtained by artificially inseminating of wild type female with rln3a+/+ XY fish and rln3aXY fish, respectively (D). Asterisk above the error bar indicate significant differences between

Jo

groups tested by Student’s t-test. *, P<0.05; **, P<0.001. D, days after fertilization.

ro of -p re lP

Fig. 6 Indispensable roles of Rln3a for the differentiation of spermatogenic cells at different

na

phase.

H.E. staining of rln3a+/+ (A) and rln3a-/- (B) testis. IHC analysis of PCNA expression in rln3a+/+ (C)

ur

and rln3a-/- (D) testis, revealed that proliferating germ cells in rln3a-/- XY fish were much fewer than that in rln3a+/+ XY fish. Red arrow, PCNA positive cells. Statistical analysis of the frequency

Jo

of germ cells at different stages in rln3a-/- testis were decreased in comparison to those in rln3a+/+ testis (E). Significant decrease of germ cell marker genes in the testis of rln3a-/- XY fish than that of rln3a+/+ XY fish (F). Western blotting (G) and densitometry (H) analysis of Vasa and eEF1A1B expression in rln3a+/+ and rln3a-/- testis. Data are expressed as the mean ± SD. Asterisk above the error bar indicate significant differences between groups tested by Student’s t-test. *, P<0.05; **,

lP

re

-p

ro of

P<0.001.

Fig. 7 HCG failed to rescue the decline of androgen synthesis in rln3a-/- XY fish.

na

Expression of steroidogenic enzyme gene Cyp17a1 in rln3a+/+ (A) and rln3a-/- (B) testis by IHC. Western blotting (C) and densitometry (D) analysis of StAR1, Cyp17a1 and Cyp11b2 expression in

ur

rln3a+/+ and rln3a-/- testis. Changes of expression level of steroidogenic enzyme genes in the testis

Jo

of in rln3a+/+ and rln3a-/- XY fish with or without hCG injection (E). Serum 11-KT level in rln3a+/+ and rln3a-/- XY fish (F). The expression level of fshβ and lhβ in the pituitary of rln3a+/+ and rln3a-/XY fish (G). The reference gene β-actin was used to normalize the expression values. Data are expressed as the mean ± SD. Asterisk above the error bar indicate significant differences between groups tested by Student’s t-test. *, P<0.05; **, P<0.001.

ro of -p re

lP

Fig. 8 Partially restoration of the sperm motility by hRLN3 injection. The tracks of motile sperms from XY fish of rln3a+/+ (A), rln3a-/- (B), rln3a-/-+vehicle (C) and rln3a+hRLN3 (D). Quantification of different tracking parameters of PR (E), PR+NP (F), IM (G) of

na

/-

each group. The time of sperm movement (H), average curve movement speed (VCL) (I), and

ur

average straight line movement speed (VSL) (J) of the sperm from XY fish of rln3a+/+, rln3a-/-,

Jo

rln3a-/-+vehicle and rln3a-/-+hRLN3. Data are expressed as the mean ± SD. Different lowercase above the error bar indicate the significant differences in different groups tested by one-way ANOVA followed by Duncan’s post hoc test (P<0.05). hRLN3, human RLN3 recombinant protein; PR, progressive sperms; NP, non-progressive sperms; IM, immotile sperms.

ro of -p re

lP

Fig. 9 Schematic illustration of the possible mechanisms of Rln3a in fish spermatogenesis. Knockout of rln3a gene led to the down regulation of steroidogenic enzyme genes expression,

na

consequently 11-KT synthesis was reduced. Knockout rln3a gene affected the development of spermatogenic cell at different stages during spermatogenesis. Finally, decline of 11-KT level

ur

stimulated the secretion level of FSH and LH in the pituitary due to the negative feedback regulation.

Jo

NFB, negative feedback regulation.

ro of -p re

primer sequence (5'-3')

rln3a-P-F

GCCTGGGTCATCTGAAAAGTCA

rln3a-P-R

GATCTCGCTCTTGCTGCAAC

cyp17a1-P-F

CATACTCTCAGCCCAGCACCAA

cyp17a1-P-R

AGTCTCTGTGCTCCGTGCTG

rln3a-Cas9-R

rln3a-T-R M13+

TGTAAACATTTATGACAGTGGG GGCAACGACACAATATGCCT

Jo

M13-

GGACCCCTTCACTTCCCCTC

ur

rln3a-T-F

na

rln3a-Cas9-F

lP

primer name

TCAGTCTTTCGCCGAGAGTT

accession number

purpose

XM_025906951 ISH NM_001279765

XM_025906951

XM_025906951

CGCCAGGGTTTTCCCAGTCACG

CRISPR/Cas9

Sequencing clone screening

AGCGGATAACAATTTCACACAG

rln3a-Q-F

CATCCGGGCGGTCATCTT

rln3a-Q-R

GACCCCTTCACTTCCCCTCA

rln3b-Q-F

GAGGAGAAGCGCAGAAGACT

rln3b-Q-R

TGCTCGCTTGTAAGTTGAGG

cyp11a1-Q-F

GAAACACTCAGGTTGCATCCG

cyp11a1-Q-R

CATACAGCCCTAATTGGACCAGAG

StAR1-Q-F

CTGAAACTGTTGCTGCGAATGGA

StAR1 -Q-R

GGTCTCTGCGGATACCTCGTG

cyp17a1-Q-R

GTGTTGTTGTTCTCCGCACT

XM_025906951

XM_003455756 Real-rime PCR XM_003440441

XM_003445605 NM_001279765

and

cyp17a1-Q-F

GCGGACCTACGTCTCCTAAA

cyp11b2-Q-F

AAAGAAGTCCTCAGGTTGTACC

cyp11b2-Q-R

GACCAAAGTTCCAGCAGGTATG

vasa-Q-F

GGGAGCTGATCAACCAGATT

vasa-Q-R

CTGGTGTTCCACACAACACA

oct4-Q-F

CACCTCCCGACGAAATGC

oct4-Q-R

GCTCCAGCTCTTCAGTGGAA

sycp3-Q-F:

TGAAGTCAGAGAAGATGAAACTCCA

sycp3-Q-R:

ACCTTGCTGATGTCAGCTCC

cyclin B2-Q-F

GAGAACCGGCAGAAACCG

cyclin B2-Q-R

GATGGCTTGGCTGACACTTT

pcna-Q-F

GTCAACCTGAGCAGTATGTCAA

pcna-Q-R

TCTCAAAGACGAGAGCGAGC

prm-Q-F

GTCAAAGAGCCCGAAGAAAG

prm-Q-R

TCTTGGAGACTCTGCGTTTG

fshb-Q-F:

ACATCAGCCTCCCTGTGGAC

fshb-Q-R:

TGTTTGGGCCAGTCGTCAGT

lhb-Q-F:

TTATCTCCTGCAGCGGCCTT

lhb-Q-R:

CAGCTGGGACAGCCCTCTTT

β-actin-Q-F

GGCATCACACCTTCTACAACGA

β-actin-Q-R

ACGCTCTGTCAGGATCTTCA

XM_003450906

XM_019351278

XM_025908995

XM_003439369

XM_003452594

ro of

XM_003451046

XM_003446064

XM_025911206

-p

XM_025897714

re

XM_003443127

Note: Forward (F) and Reverse (R) represent Forward primer and Reverse primer, respectively.

Jo

ur

na

lP

Table 1 Primers used in the present study