- Email: [email protected]
RNA editing: getting U into RNA
REVIEWS
TIBS 22 - MAY 1997
27 Felder, M-P. eta/. (1994) J. Virol. 68, 4759-4767 28 Kumar, M, and Carmichael, G. G. Proc. Natl. Acad. Sci. U. S. ,4. (,n press) 29 Wong, T. C., Ayata, M., Ueda, S. and Hirano, A. (1991) J. Vvol. 65, 2191-2199 30 Scadden, A. D. J. and Smith, C. W. J. EMBO 3. (in press) 31 Kable, M. L., Heidmann, S. and Stuart, K. D. (1997) Trends Biochem. Sci. 22, 162-166 32 Basitio, C. et al. (1962) Proc. Natl. Acad. Sci. U. S. A. 48, 613-616 33 Seeburg, P. H. (1996) J. Neurochem. 66, 1-5 34 Sommer, B., K6hler, M., Sprengel, R. and Seeburg, P. H, (1991) Cell 67, 11-19 35 Brusa, R. et al. (1995) Science 270, 1677-1680. 36 Lomeli, H. et aL (•994) Science 266, 1709-1713
37 Egebjerg, J., Kukekov, V. and Heinemann, S. F. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10270-10274 38 Higuchi, M. et al. (1993) Cell 75, 1361-1370 39 Herb, A., Higuchi, M., Sprengel, R. and Seeburg, P. H. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1875-1880 40 Rueter, S. M. et al. (1995) Science 267, 1491-1494 41 Bass, B. L. (1995) Curt. Biol. 5, 598-600 42 Lai, M. M. C. (1995) Annu. Rev. Biochem. 64, 259-286 43 Casey, J. L. and Gerin, J. L. (1995) J. Virol. 69, 7593-7600 44 Poison, A. G., Bass, B. L. and Casey, J. L. (1996) Nature 380, 454-456 45 Dabiri, G. A., Lai, F., Drakas, R. A. and
editing: getUn U into RNA '
-
Moffett L. Kable, Stefan Heidmann and Kenneth D. Stuart RNA editing in kinetoplastid protozoa remodels the sequences of mitochondrial pre-mRNAs by the precise insertion and deletion of uridylate residues. These sequence changes are directed by small trans-acting RNAs, termed guide RNAs. The basic mechanistic pathway by which edited RNA is generated has recently been elucidated using in vitro systems capable of a full round of guide-RNA-directed editing. KINETOPLASTID protozoan parasites, which are the causative agents of such tropical diseases as African sleeping sickness and Chagas disease, have largely been studied because of their pathogenicity, but their investigation has also revealed surprising basic molecular biological phenomena, includ. ing RNA editing, in kinetoplastids, the mature sequences of 12 of the 17 mitochondrial mRNAs are produced by the post-transcriptional insertion and deletion of uridylates (Us) by a process termed RNA editing (for previous reviews, se~ Refs 1-4). The editing is so extensive in most cases that it is not possible to deduce the protein coding sequence from the 'encrypted' gene sequence. RNA editing in kinetoplastids M, L Kable and K, D, Stuart are at the Seattle Biomedical Research Institute, 4 NickersonSt, Seattle, WA 98109, USA, and at the Universityof Washington, Department of Pathobiology,Seattle, WA 98195, USA; and S. Iteidmann is at the Department of Genetics, Universityof Bayreuth, 95440 Bayreuth, Germany. Email: [email protected] [email protected] [email protected]
1.62
creates the start and stop codons as well as the functional protein coding sequence for many mature mRNAs. Remarkably, the thousands of U insertions and hundreds of U deletions that occur during editing result in mRNAs with precise sequences. Most edited mRNAs encode components of the oxidative phosphorylation machinery, as is typical for mitochondrial mRNAs. Therefore, accurate RNA editing is essential for the metabolism, and hence survival, of these parasites. The discovery of RNA editing in kinetoplastids stimulated the recognition of other cases where the informational content of the mature RNAs differs from that encoded in their genes. These sequence alterations are also termed RNA editing although they involve a variety of mechanisms and include processes that modify RNA bases as well as those that (like kinetoplastid RNA editing) insert and delete nucleotides 5. The rationale for the existence of kinetoplastid RNA editing is still unexplained, but its discovery 6 provided expanded insight into the diverse means by which genetic information can be stored and expressed.
Nishikura, K. (1996) EMBO J. 15, 34-45 46 Hurst. S. R., Hough, R. F., Aruscavage P. J. and Bass, B. L. (1995) RNA 1, 1051-1060 47 Yang, J. H., Skiar, P., Axel, R. and Maniatis, T. (1995) Nature 374, 77-81 48 Melcher, ]. et al. (1995) J. Biol. Chem. 270, 8566--8570 49 Melcher, l'. et al. (1996) Nature 379, 460-464 50 O'Connell, M. A., Gerber, A. and Keller, W~ (1997) J. Biol. Chem. 272,473-478 51 Casey, J. L., Bergmann, K. F., Brown, T. L. and Gerin, J. L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7149-7153 52 Wong, £ C. et aL (1989) J. Virol. 63, 5464-5468 53 Petschek, J. P. et al. (1996) J. Mol. Biol. 259, 885-890 54 Burns, C. M. et al. Nature (in press)
sequenoe The means by which the edited RNA sequence is specified was a mystery until the discovery that the mitochondalai genome of kinetoplast{ds also encodes numerous $mall (50-70 nt) RNAs that have complementarity to edited RNA sequences ~. Blum and Simpson proposed that these guide RNAs (gRNAs) direct the sequence changes made during RNA editing. Clues about how this {nformat{on transfer might occur were gleaned from the gRNA sequences, which have three domains. The 5' region of each gRNA, the 'anchor', is complementary to its cognate pre-mRNA and presumably initially interacts with it by duplex |ormation. The central domain contains the guiding information for the U insertions and deletions to produce a -30-40 nt stretch of edited premRNA sequence. The sequence changes made during editing allow a continuous duplex to form between the pre-mRNA and this port{on of the gRNA (see Fig. 1). This RNA base-pairing includes both Watson-Crick interactions and G:U basepairing. Thus, either an A or a G in the guiding portion of a gRNA can specify insertion of a U into the complementary sequence of edited mRNA, while unpaired encoded Us in pre-mRNA are deleted. The 3' region of the gRNA has an oligo(U) tail, which is added posttranscriptionally and has an average length of -12 nt. The function of this oligo(U) tail is controversial, but it might stabilize the gRNA interaction with the pre-mRNA as discussed below. Several indirect observations initially suggested that gRNAs specify the edited sequence. These include their mitochondriai localization, complementarity to edited RNA and sufficient diversity of gRNAs to account for all the observed editing. Direct experimental evidence for
Copyright © 1997, Elsevier Science Ltd. All rights reserved. 0968-0004/97/$17.00
PII:S0968-0004(97)01041-4
REVIEWS
TIBS 22 - MAY 1997
_.
A6 pre-mRNA
5'
... A A A G A G ~ A ~ A A A G G U U A G G G G G A G G A G A G A A ~ A A A G ~ G A A A G U U G U ~ A ~ l ] U ~ A ~ U U A U A ~ A A U A A G A U ~ : ~ . ` ` ~ . ~ ; . . .
3"
i.lllllllill gA6[14]
3" ~~OUAAUAGUA'JAOOO,~CA(:;OUUUAGACUAt.,.GCM.~U~A~.,AUAC-<~ U-tail
5' . . .A A A G A G C A G G A A A G G U U A G G G G G A G G A G A G A u A G u u A u
h formation
uAu Au uGu u G u - G A A A = u u G
::::l"l'llll'llll'llll'"lll"llll'll 3'~AUUAAUAGUAUAGUGACAGUUUUAGAC
5"
Anchor
•Gu u U G u u A
"U U G G A G U U A U A G A A U A A G A U C A A A U . . .
"11"1111
I'llllllllll
UAAGCAAU
~
U
A
U
A
G
G
3'
5'
Figure ~. Editing of the first block of Trypanosomabrucei ATPase 6 pre-mRNA. The 3' part of the ATPase 6 pre-mRNA is shown engaged in an intermolecular anchor duplex with its cognate gl~ide RNA (gRNA), gA61141, as it is thought to form before editing commences. ~,6114] specifies the insertion of 19 Us and the deletion of four Us at 12 internudeotide positions. Inserted nucleotides are shown in lower-case red letters and the positions of Us ti~at have been deleted from the precursor RNA are indicated by green asterisks. It is notable that after editing, an uninterrupted duplex can form between the gRNA and the premRNA. The three functional regions of gA6114] are marked in blue, yellow and red for the anchor region, the informational section and for the oligo(U) tail, respectively.
sequential transesterification reactions. In this model the first reaction links the oligo(Lr) tail of the gRNA to an editing site in a pre-mRNA while simultaneously releasing .~he5' portion of the pre-mRNA. The second step rejoins the 5' and 3' pre-mRNA portions at a position that determines the number of inserted or deleted Us, as specified by the gRNA (Fig. 2, blue arrows). The function of the oligo(U) tail, in this model, is to serve as a source of inserted Us and repository for deleted Us. A third mechanistic hypothesis, which combines features of the other two models, predicts the same Three mechanisUc hypotheses Three different mechanisms have gRNA-pre-mRNA chimeric intermediates been proposed for RNA editing based on and the same role for the oligo(U) tail as features of the process that were indi- in the transesterification model. However, rectly inferred. Blum and Simpson 7 sug- it proposes that the reactions occur by gested an enzyme cascade model (Fig. 2, sequential endonucleolytic cleavages green arrows) based primarily on the and ligations (red arrows in Fig. 2) mu. presence of terminal uridylate tranderase (TUTase) and RNA ligase activities Chimera formation ~n vitro Several features that distinguish these in mitochondria 9. They proposed that the initial step is gRNA-directed cleav- models have been experimentally tested age of the pre-mRNA at the editing site, in vitro. These include the pathway by then Us are added to or deleted from the which chimeras are generated. Both 3' 3' terminus of the 5' cleavage product and 5' pre-mRNA cleavage products are during insertion or deletion, respectively, produced when chimeras are formed in and finally, the two half RNAs are joined vitro, thus supporting a cleavage-.ligation by the RNA ligase. However, an alterna- model m~4. Chimeras also form more tive mechanistic pathway for the pro- readily when the isolated 3' cleavage duction of edited RNA was suggested fragment, rather than intact pre-mRNA, after chimeric molecules, in which gRNAs is included in the in vitro reaction ~4. In are covalently linked with portions of addition, when cleavage is inhibited by their cognate pre-mRNAs, were found in a phosphorothioate stereoisomer at the cellular RNA1°,i~. The gRNAs were fre- cleavage site, chimeras are not generquently linked at editing sites, typically ated, implying that cleavage is a necessthrough an oligo(U) stretch, it was pro- ary step in chimera formation ~4.Furtherposed that these chimeras were editing more, chimera formation, like the activity intermediates and that, by analo~ to of RNA ligases, is dependent upon ATP RNA splicing, editing proceeds by two et/[3 bond hydrolysis 1446. These data are
this role for gRNAs was first provided by the in vitro demonstration that synthetic cognate gRNAs specify the deletion of the appropriate number of Us from the first editing site of synthetic substrate RNAs (modeled after ATPase 6 premRNA) when incubc.ted with mitochondrial lysate from the kinetoplastid parasite, Trypanosoma brucei 8. This work confirmed that gRNAs specify the edited sequence and established an in vitro system to begin to address the underlying mechanism.
inconsistent with a transesterification mechanism for chimera formation. Rather, they imply that chimeras form by RNA ligase-catalysed joining of gRNAwith the 3' portion of the (cleaved) pre-mRNA.
RNA ed[tangin vitro Advances in the in vitro editing system led to the development of assays to monitor the gP~iA-directed deletion 17or insertion la of Us at a single site in a synthetic pre-mP~A, and allowed detailed analysis of the reactions that lead to edited ~ A . Data from these studies support the mechanism described in Fig. 3.
The first step in the pathway of production of edited RNA appears to be gRNAdirected endonucleolytic cleavage of the pre-mRNA. The cleavage occurs immediately 5' of the anchor duplex between pre-mRNA and gRNA, leaving a 5' monophosphate on the pre-mRNA 3' cleavage product and a 3' OH on the 5' cleavage product, in the case of deletion, Us are removed from the 3' end of the 5' cleavage product as indicated by the occurrence of shortened 5' cleavage products ~7. Site-specific labeling studies suggest that the removed nucleotides are released as free UMP (S. Seiwert, pets. commun.). Similarly, in the case o! insertion, Us derived from UTP appear to be added to the 3' end of the 5' cleavage product TM.In both insertion and deletion, the appropriately processed 5' cleavage product must be ligated to the 3' cleavage product to create the edited product. U insertion (unlike U deletion), is dependent upon UTP. Indeed, msZP-labeled UTP becomes specifically incorporated into an editing site when included in an in vitro reaction TM.The oligo(U) tail of
163
REVIEWS
Tff3S 2 2 - MAY 1 9 9 7
A6 pre*mRNA
5'...
UGAU
..
Finally, in time-course studies, chimeras accumulate subsequent to edited RNA and they display the kinetics of end products nJS. Thus, there are sufficient data to conclude that chimeras are not intermediates in the production of edited RNA.
,3'
gA6114]
~
(a) Cleavage 5"...
(b) TE
uG &u G C ~ ~ . . .
• . . 3' 5' UG
(c) Ligation
~
~
,•
U-Addition
5"...
UG
;AU
!!lllll/_t
G
C
~
.
.
.
.
.
5"
~LCgeavage
: ~
UG
¢,~]
ccA~
. . ,3"
AU
a"
m
~
G c ~ ~
...3"
s"
3'. . . . .
~zLigation
5',
. •
UG
;,:AU
,~Ligation
, . .3'
5'.
, .
UG II
AU
. . .3'
I A.LLLI~J_
Figure2 Three hypothesesfor the mechanism of kinetoplas~id RNA editing. The schematic pre-~aRNAguide RNA (gRNA) pair represents ATPase 6 pre-mRNA interacting with gA6114]. The illUSo trated editing event ts the insertion of two Us at edttinffsite 2 of ATPase 6 pre-mRNA. The pre.mRNA Is outlined in gray, while the three functional regions of the gRNAare color-coded as described in Fig. 1. (a} The original proposal of a succession of enzymatic activities underlying the formation of edited product is shown in the pathway delineated by green arrows. This model has received significant support by recent in vitro experiments. Pathways (b) and (©) depict the two models proposing gRNA-pre-mRNAchimeric molecules as intermediates. Chimeras may be formed by successive enzymatic steps (red arrows) or have alternatively been suggested to be produced and resolved by transesterification (TE) reactions (blue arrows). For details see text. Notethat the U-tail of the gRNAis shortened after one cycle of insertion editing in the models involving chimeric intermediates, while the length remains unchanged in the enzymatic model ,,,~o,,,.,,UTP as the sou'ce of the inserted Us.
What are chimeras ff not intemleaiates? Chimeras have features unexpected of RNA editing intermediates: the gP~NA portions are often truncated and the U tracts linking the gRNA and pre-mRNA sequences vary widely in length anaong chimeras. Also, chimeras are rare in cellular RNA (approx. one molecule per 100 cells). Nevertheless, the abundance of chimeras correlates with the developmentally controlled abundance of edited RNA in vivo, suggesting that the prcduction of chimeras and edited RNA could be linked2L Chimeras could he formed by the editing machinery if, upon cleavage of the pre-mRNA at the editing site, the 3' end of the guide RNA replaces the position normally held by the 5' premRNA cleavage product (see Fig. 3c). Support for this hypothesis comes from mutational studies, which show that the ratio of chimeras to edited RNA can be modulated by changes in the basepairing potential between the 5' portion of the pre-mRNA and the 3' portion of the guide RNAaT. A weaker interaction correlates with a greater proportion of chimeras. These data suggest that the 3' portion of the gRNA occasionally replaces the 5' cleavage product of the pre-mRNA as a substrate for [igation by the editing machinery. The activities of the editing machinery could also account for the production of chimeras with variable U tracts and truncations. Overall, the data suggest that chimeras are deadend products of aberrant editing.
How gRNAspecifiesthe edited sequence The number of Us inserted or ddeted
the gRNAis insufficient to support inser. tional editing, implying that the inserted Us are not donated by the oligo(U) tail of the gRNA. Thus, as with chimera formation, the generation of edited RNA appears to proceed by cleavage-ligation rather than by transesterification. The in vitro reactions that generate edited RNA also typically produce chimeras, However, several lines of evidence, in addition to the UTP depeudence of U insertion, suggest that they are not intermediates in the prodaction of edited RNA.For example, the cleavage of pre-mRNA during U deletion ~.diting at a position 3' to the Us to be ren:oved is inconsistent with the models that propose
chither{c inte:mediates, as these models require that the Us must remain with the 3' portion of the pre-mRNA. Similarly, the cleavage that resolves the putative chimeric intermediate during insertion editing should result in a 3' cleavage product containing the added Us at its 5' end (see Fig. 2, red arrows). However, this postulated intermediate is not observed during in vitro editing. Additional evidence that chimeras are not intermediates comes from in oitro studies of a U-incorporation activity in the kinetoplastid Leishmania tarentolae 19. This U-incorporation activity has stereochemical characteristics that rule out the involvement of chimeric intermediates 20.
by editing is controlled by base-pairing interactions between the gRNA and premRNA, as illustrated by the predictable editing specified by mutant gRNAs (Fig. 4). The number of Us added to or removed from the 3' end of the 5' cleavage products does not appear strictly templated, as molecules with varying numbers of Us at this site are produced #1 vitro, including molecules with more Us added than specified by the gRNA. The processed 5' cleavage products that would extend the duplex by the greatest number of base pairs appear to be preferentially selected for ligation. In oitro, a small fraction of edited pre-mRNAs contain a number of Us not specified by the
lVlWS
TIBS 22 - MAY 1997
{a) Deletion 5'...
~'...~
{c) Chimera formation
{b) Insertion A L.!t ~L) U G
. . .3"
~ .
, ) 0 9`
5'... e:, :, AOC @UG ~,, 3'... ~
u
~
.
.
.
...3"
• . . 3'
..~.
G
I 5'... 3 " . . . ~
5"
U C O'~
@AI~J0, , | !
GCAAm~
...3"
Loss of 5'-cleavage product
.5"
UTP
U-removaV U-addition
uMP4
~
3'..~.~
Endonuc!eogytic cleavage
t
UGAU
5'...
~.
~AU 3 ' . . . ~
I UG k3\>°~ ~ A U
5'..
5"...
A © ~"
@UG
, • . 3"
Gcz%A' ~ . . . 5 "
U-removal/ U-addition
. .. 3'
~%~"
...3'
OAu
.3'
Ligation Ligation 5'...
3'...~
A~G
. . . 3'
~...s'
5".
3'..~
UGUUAU
&~.
.~,3'
BAU
.3'
3cAA~...5'
Figure :3 Detailed model for the mechanism of kinetoplastid RNA editing. The pre-mRNAis shown in gray on the top of the pairs and the guide RNA (gRNA) below with the same color code as described in Fig. 1. (a) Deletion of three Us from editing-site 1 of ATPase 6 pre-mRNAis illustrated as specified by gA6[14]A16G (Ref. 8)(Fig. 4). (b) The insertion of two Us into editing-site 2 of ATPase 6 pre-mRNAis shown. The initial step of the reaction pathway in both deletion and insertion is cleavage of the pre-mRNAat the editing site, which is defined by the phosphodiester bond immediately upstream of the intermolecular anchor duplex between gRNA and pre-mRNA. Subsequently, Us are being added to or removed from the 3' end of the pre-mRNA5' cleavage product. The intermediates [boxed species in (a) and (b)] with the appropriate number of Us [boldly colored pair in (a) and (b)] are preferentially selected over the faded pairs for ligation with the pre-mRNA3' cleavage product. The oligo(U) tail of tile gRNA is sllown throughout base-paired with the purine-rich region upstream of the editing sites. (c) If this interaction is weakened in an aberrant side reaction, tl~e pre-mRNA5' cleavage product may be lost from the catalytic center of the editing machinery and its place may be taken by the oligo(U)-tail of the gRNA resulting in chimera formation. Differential processing of the oligo(U)-tail before ligation leads to chimeras with differing numbers of Us at the linkage site. See text for details.
gRNAns. hi vivo, these molecules could undergo a subsequent round of editing to obtain the gRNA-specified sequence. The machinery, in this sense, might have a built-in proofreading capability. Order of editing-site selection The blocks of sequence that undergo editing appear to be selected by the gRNA via anchor duplex formation, suggesting a 3' to 5' direction of processing. The specific editing sites within a block seem to be recognized because they are at mismatches adjacent to an uninterrupted RNA duplex. For example, editingsite 1 of completely unedited ATPase 6 pre-mRNA is adjacent to the anchor duplex, and is targeted for editing. The same gRNA directs in vitro editing at editingsite 2 when editing-site 1 contains edited sequence (consequently allowing the gRNA/pre-mRNA duplex to be extended
to editing-site 2). Generalization of this process suggests that this duplex is extended in a strict 3' to 5' direction. This, however, is inconsistent with data on partially edited RNAs isolated from in vivo RNA. These molecules typically contain a 'partially edited' region that bridges 3' edited and 5' unedited sequences. Perhaps short upstream duplexes form between guide RNAand premRNAthat can direct editing to occur in a manner that is not precisely 3' to 5'. More efficient in vitro systems are needed to address the issue of how multiple sites are selected for editing. Imp0rtance of interactions upstream of the editing site Interactions between the oligo(U) tail and 3' regions of gRNA with pre-mRNA sequences upstream of the editing site are important to editing. The reduction
in the level of in vitro editing by elimination of the gRNAoligo(U)taiP; supports the suggestion n that its base-pairing with purine-rich upstream regions contributes to efficient editing, in addition, substitution of a region lacking an extensive purine stretch with a purine-rich sequence allows the in vitro editing of a pre-mRNA that is otherwise unedited in vitro TM. These interactions might maintain gRNA-pre-mRNA association after cleavage. However, other interactions, perhaps mediated by proteins, are probably necessary, especially to edit the most 5' editing sites in an editing domain, which tend not to be preceded by purine-rich sequences. Uns01ved mysteries The role of the gRNA3' OH. Oxidation of the terminal hydroxyls or phosphorylation of the 3' OH on the terminal nucleotide
:!.65
REVIEWS (a)
TIBS 22 - MAY 1 9 9 7
gA6114] ...A
A6\TAG.1
UUG . . . . . .
I
...A'
I . . . . . .
UUG .
.
.
.
.
A
I .
.
.
gA6114] • . . UGuuAUrJG . . . . . .
A6-eES1
.
II
U .... GC...
I I:I ...U--AGC
(b)
A .... UG...
I:1
•..U---AGC
A6\TAG
gA6114]A16G
:11111:1 • • • GCAAUAGC . . . . . .
.
.
.
" UG...
II
U---AC...
gA6114]+A21 UGuuuAbTJG...
:111111:1 GCAAAUAGC...
Figure 4 Guide RNA (gRNA) specifies the edited sequence. Various combinations of wild-type and mutant gRNAs with pre-mRNAs predict that different numbers of Us will be inserted or deleted. In (a), the combinations of gRNAs and pre-mRNAsused in the original report of in vitro deletion editing8 are shown• Sequences surrounding the pre-mRNAediting site are shown on the top and the complementary gRNA sequences below. Watson-Crick and G:U basepairs are indicated by vertical lines and colons, respectively. Dashed lines in the gRNAs connect bordering nucleotides. Green asterisks indicate deleted Us. In (b), the two gRNAs ~.hatspecify U insertion into editing-site 2 of A6-eES1 (Ref. 18) are shown below their cognate pre-mRNA. Inserted Us are in red.
editing, candidate editing machinery proteins have been identified from T. brucei extracts, including 25, 65 and 90 kDa gRNA-specific UVcrosslinldng proteins25.z6• The 90kDa protein specifically binds the gRNA oligo(U) tail. The gene that encodes the 25 (21) kDa protein has been cloned 27 and a monoclonal antibody to this protein immunoprecipitates editing activities (T. Alien, pets. corn[nun.). A mitochondrial helicase has also been implicated in RNA editing, as mutants in which this gene has been knocked out grow very slowly and have little edited RNA in vivo 0t. U. GOringer, pers. commun.). Two mitochondrial proteins, identified as RNA ligases, have also been suggested to be involved in RNA editing ~S. Hence, early studies to identify the editing machinery are in progress.
Conclusionsand outlo0k Now that the basic mechaof the gRNA have been variously re- nism by which Us are inserted or ported to abolish in vitro editing, but not deleted at one editing site has been elucleavage. It is uncertain if this reflects a cidated, the focus has turned to other isrole for this hydroxyl in the chemistry of sues, such as detailing the requirements editing reactions or If it causes interfer. for the reaction, analysing how multiple ence In the association of the RNAs with sites are edited and identifying compoo components of the editing machinery. nents of the editing machinery. Why this Eaiting of multiple sites. Little is known baroque process is used in the synthesis about how all of the U insertions and of kinetoplastid mitochondr|ai proteins deletions specified by a gRNAare carried remains a mystery. The mechanism out. For example, what differences exist bears little relation, as was previously in the RNA interactions with the editing suspected, to another potentially anmachinery during U deletion versus cient form of RNA processing, such as U insertion? How does the machinery RNA splicing, implying that these promove from one editing site to another? cesses arose independently. Clearly, How long do the gRNAs remain duplexed there is much left to explore about the with the pre-mRNA? Are guide RNAs editing of kinetoplastid pre.mRNAs. reused to edit multiple pre.mRNAs?
The editing machinery RNA editing, like other RNA processing reactions, appears to be catalysed by a macromolecular complex. In vitro editing activities sediment at -205 in glycerol gradients 23and are sensitive to protease (S. Seiwert, pers. commun.). Several individual activities expected to be involved in RNA editing are present in this 205 fraction, as well as lower in the gradient 24, These include RNA endonuclease, TUTase, U-specific 3'-exonuclease and RNA iigase. While no specific protein has been definitively implicated in RNA
166
Acknowledgements We thank S. Seiwert, 1". Allen and H. U. G6ringer for communicating unpublished results. We would also like to thank M. Parsons for critically reading this manuscript. Work done in the authors' lab was supported by grants AI14102 and GM42188 from the National Institute of Health.
References 1 Arts, G. J• and Benne, R. (1996) Biochim. Biophys. Acta 1307, 39-54 2 Seiwert, S. D. (1995) ParasitoL Today 11, 362-368 3 Simpson, L., Maslov, D. A. and Blum, B. (1993)
in RNA editing: the alteration of prctein codinE sequences ofRNA (Vol. 1) (Benne, R., ed.), pp. 53-86, Ellis Harwood 4 Stuart, K. (1993) in RNA editing: the alteration of protein coding sequences of RNA (Vol. 1) (8enne, R., ed.), pp. 26-52, Ellis Harwood 5 -~enne, R. ed. (1993) RNA editing: the alteration of protein coding sequences of RNA (Vol. 1), Ellis Harwood 6 Benne, R, et al. (1986) Cell 46,819-826 7 Blum, B., 8akalara, N. and Simpson, L. (1990) Cell 60, 189-198 8 Seiwert, S. D. and Stuart, E. (1994) Science 266, 114-117 9 Bakalara, N., Simpson, A. M• and Simpson, L. (1989) J. Biol. Chem. 264, 18679-18686 10 Cech, T. R. (1991) Cell 64, 667-669 11 Blum, B., Sturm, N. R., Simpson, A. M. and Simpson, L. (1991) Cell 65, 543-550 12 Harris, M. E. and Hajduk, S. L. (1992) Cell 68, 1091-1099 13 Sollner-Webb, 8. (1991) Curt. Opin. Cell Biol. 3, 1056-1061 14 Rusch& L. N., Piiler, K. J. and Sollner-Wobb, B. (1995) MoL Cell. Biol. 15, 2933-2941 15 Sabatini, R. and Hajduk, S. L. (1995) J. Biol. Chem. 270, 7233-7240 16 Arts, G. J., Sloof, P. and Benne, R. (1995) Mol. Biochem. Parasitel. 73, 211-222 17 Seiwert, S. D., Heidmann, S. and Stuart, K. (.1.996) Cell 84, 831-841 18 Kable, M. L., Soiwert, S. D., Heidmann, S. and Stuart, K. (1996) Science 273, 1189-1195 19 Frech, G. C., Bakalara, N., Simpson, L. and Simpson, A. M. (1995) EMBO J. 14, 178-187 20 Frech, G. C. and Simpson, L. (1996) Mol. Cell. Biol. 16, 4584-4589 21 Riley, G. R., Myler, P. J. and Stuart, K. (1995) Nucleic Acids Res. 23, 708-73.2 22 Blum, B. and Simpson~ L. (lgcJO) Cell 62, 391-397 23 Corell, R. A. et al. (1996) Mol. Cell. Biol. 16, 1410-3.418 24 Pollard, V. W., Harris, M. E. and Hajduk, S. L. (1992) EMBO J. 11, 4429-4438 25 Road, L. K., Goringor, H. U. and Stuart, K. (1994) Mol. Cell. Biol. 14, 2629-2639 26 Kofler, J. et al. (1994) Nucleic Acids Res. 22, 1988-3.995 27 Kbllor, J. et al. (3.997) J. Biol. Cicero. 272, 3749-3757
TiBS r e f e r e n c e |[sts Authors of TiBSarticles are asked to limit the number of references cited to provide non-specialist readers with a concise list for further reading. it is hoped that the appropriate citation of review articles and timely original articles will give the reader an immediate inroad into the topic.
TIBS 22 - MAY 1997
27 Felder, M-P. eta/. (1994) J. Virol. 68, 4759-4767 28 Kumar, M, and Carmichael, G. G. Proc. Natl. Acad. Sci. U. S. ,4. (,n press) 29 Wong, T. C., Ayata, M., Ueda, S. and Hirano, A. (1991) J. Vvol. 65, 2191-2199 30 Scadden, A. D. J. and Smith, C. W. J. EMBO 3. (in press) 31 Kable, M. L., Heidmann, S. and Stuart, K. D. (1997) Trends Biochem. Sci. 22, 162-166 32 Basitio, C. et al. (1962) Proc. Natl. Acad. Sci. U. S. A. 48, 613-616 33 Seeburg, P. H. (1996) J. Neurochem. 66, 1-5 34 Sommer, B., K6hler, M., Sprengel, R. and Seeburg, P. H, (1991) Cell 67, 11-19 35 Brusa, R. et al. (1995) Science 270, 1677-1680. 36 Lomeli, H. et aL (•994) Science 266, 1709-1713
37 Egebjerg, J., Kukekov, V. and Heinemann, S. F. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10270-10274 38 Higuchi, M. et al. (1993) Cell 75, 1361-1370 39 Herb, A., Higuchi, M., Sprengel, R. and Seeburg, P. H. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 1875-1880 40 Rueter, S. M. et al. (1995) Science 267, 1491-1494 41 Bass, B. L. (1995) Curt. Biol. 5, 598-600 42 Lai, M. M. C. (1995) Annu. Rev. Biochem. 64, 259-286 43 Casey, J. L. and Gerin, J. L. (1995) J. Virol. 69, 7593-7600 44 Poison, A. G., Bass, B. L. and Casey, J. L. (1996) Nature 380, 454-456 45 Dabiri, G. A., Lai, F., Drakas, R. A. and
editing: getUn U into RNA '
-
Moffett L. Kable, Stefan Heidmann and Kenneth D. Stuart RNA editing in kinetoplastid protozoa remodels the sequences of mitochondrial pre-mRNAs by the precise insertion and deletion of uridylate residues. These sequence changes are directed by small trans-acting RNAs, termed guide RNAs. The basic mechanistic pathway by which edited RNA is generated has recently been elucidated using in vitro systems capable of a full round of guide-RNA-directed editing. KINETOPLASTID protozoan parasites, which are the causative agents of such tropical diseases as African sleeping sickness and Chagas disease, have largely been studied because of their pathogenicity, but their investigation has also revealed surprising basic molecular biological phenomena, includ. ing RNA editing, in kinetoplastids, the mature sequences of 12 of the 17 mitochondrial mRNAs are produced by the post-transcriptional insertion and deletion of uridylates (Us) by a process termed RNA editing (for previous reviews, se~ Refs 1-4). The editing is so extensive in most cases that it is not possible to deduce the protein coding sequence from the 'encrypted' gene sequence. RNA editing in kinetoplastids M, L Kable and K, D, Stuart are at the Seattle Biomedical Research Institute, 4 NickersonSt, Seattle, WA 98109, USA, and at the Universityof Washington, Department of Pathobiology,Seattle, WA 98195, USA; and S. Iteidmann is at the Department of Genetics, Universityof Bayreuth, 95440 Bayreuth, Germany. Email: [email protected] [email protected] [email protected]
1.62
creates the start and stop codons as well as the functional protein coding sequence for many mature mRNAs. Remarkably, the thousands of U insertions and hundreds of U deletions that occur during editing result in mRNAs with precise sequences. Most edited mRNAs encode components of the oxidative phosphorylation machinery, as is typical for mitochondrial mRNAs. Therefore, accurate RNA editing is essential for the metabolism, and hence survival, of these parasites. The discovery of RNA editing in kinetoplastids stimulated the recognition of other cases where the informational content of the mature RNAs differs from that encoded in their genes. These sequence alterations are also termed RNA editing although they involve a variety of mechanisms and include processes that modify RNA bases as well as those that (like kinetoplastid RNA editing) insert and delete nucleotides 5. The rationale for the existence of kinetoplastid RNA editing is still unexplained, but its discovery 6 provided expanded insight into the diverse means by which genetic information can be stored and expressed.
Nishikura, K. (1996) EMBO J. 15, 34-45 46 Hurst. S. R., Hough, R. F., Aruscavage P. J. and Bass, B. L. (1995) RNA 1, 1051-1060 47 Yang, J. H., Skiar, P., Axel, R. and Maniatis, T. (1995) Nature 374, 77-81 48 Melcher, ]. et al. (1995) J. Biol. Chem. 270, 8566--8570 49 Melcher, l'. et al. (1996) Nature 379, 460-464 50 O'Connell, M. A., Gerber, A. and Keller, W~ (1997) J. Biol. Chem. 272,473-478 51 Casey, J. L., Bergmann, K. F., Brown, T. L. and Gerin, J. L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7149-7153 52 Wong, £ C. et aL (1989) J. Virol. 63, 5464-5468 53 Petschek, J. P. et al. (1996) J. Mol. Biol. 259, 885-890 54 Burns, C. M. et al. Nature (in press)
sequenoe The means by which the edited RNA sequence is specified was a mystery until the discovery that the mitochondalai genome of kinetoplast{ds also encodes numerous $mall (50-70 nt) RNAs that have complementarity to edited RNA sequences ~. Blum and Simpson proposed that these guide RNAs (gRNAs) direct the sequence changes made during RNA editing. Clues about how this {nformat{on transfer might occur were gleaned from the gRNA sequences, which have three domains. The 5' region of each gRNA, the 'anchor', is complementary to its cognate pre-mRNA and presumably initially interacts with it by duplex |ormation. The central domain contains the guiding information for the U insertions and deletions to produce a -30-40 nt stretch of edited premRNA sequence. The sequence changes made during editing allow a continuous duplex to form between the pre-mRNA and this port{on of the gRNA (see Fig. 1). This RNA base-pairing includes both Watson-Crick interactions and G:U basepairing. Thus, either an A or a G in the guiding portion of a gRNA can specify insertion of a U into the complementary sequence of edited mRNA, while unpaired encoded Us in pre-mRNA are deleted. The 3' region of the gRNA has an oligo(U) tail, which is added posttranscriptionally and has an average length of -12 nt. The function of this oligo(U) tail is controversial, but it might stabilize the gRNA interaction with the pre-mRNA as discussed below. Several indirect observations initially suggested that gRNAs specify the edited sequence. These include their mitochondriai localization, complementarity to edited RNA and sufficient diversity of gRNAs to account for all the observed editing. Direct experimental evidence for
Copyright © 1997, Elsevier Science Ltd. All rights reserved. 0968-0004/97/$17.00
PII:S0968-0004(97)01041-4
REVIEWS
TIBS 22 - MAY 1997
_.
A6 pre-mRNA
5'
... A A A G A G ~ A ~ A A A G G U U A G G G G G A G G A G A G A A ~ A A A G ~ G A A A G U U G U ~ A ~ l ] U ~ A ~ U U A U A ~ A A U A A G A U ~ : ~ . ` ` ~ . ~ ; . . .
3"
i.lllllllill gA6[14]
3" ~~OUAAUAGUA'JAOOO,~CA(:;OUUUAGACUAt.,.GCM.~U~A~.,AUAC-<~ U-tail
5' . . .A A A G A G C A G G A A A G G U U A G G G G G A G G A G A G A u A G u u A u
h formation
uAu Au uGu u G u - G A A A = u u G
::::l"l'llll'llll'llll'"lll"llll'll 3'~AUUAAUAGUAUAGUGACAGUUUUAGAC
5"
Anchor
•Gu u U G u u A
"U U G G A G U U A U A G A A U A A G A U C A A A U . . .
"11"1111
I'llllllllll
UAAGCAAU
~
U
A
U
A
G
G
3'
5'
Figure ~. Editing of the first block of Trypanosomabrucei ATPase 6 pre-mRNA. The 3' part of the ATPase 6 pre-mRNA is shown engaged in an intermolecular anchor duplex with its cognate gl~ide RNA (gRNA), gA61141, as it is thought to form before editing commences. ~,6114] specifies the insertion of 19 Us and the deletion of four Us at 12 internudeotide positions. Inserted nucleotides are shown in lower-case red letters and the positions of Us ti~at have been deleted from the precursor RNA are indicated by green asterisks. It is notable that after editing, an uninterrupted duplex can form between the gRNA and the premRNA. The three functional regions of gA6114] are marked in blue, yellow and red for the anchor region, the informational section and for the oligo(U) tail, respectively.
sequential transesterification reactions. In this model the first reaction links the oligo(Lr) tail of the gRNA to an editing site in a pre-mRNA while simultaneously releasing .~he5' portion of the pre-mRNA. The second step rejoins the 5' and 3' pre-mRNA portions at a position that determines the number of inserted or deleted Us, as specified by the gRNA (Fig. 2, blue arrows). The function of the oligo(U) tail, in this model, is to serve as a source of inserted Us and repository for deleted Us. A third mechanistic hypothesis, which combines features of the other two models, predicts the same Three mechanisUc hypotheses Three different mechanisms have gRNA-pre-mRNA chimeric intermediates been proposed for RNA editing based on and the same role for the oligo(U) tail as features of the process that were indi- in the transesterification model. However, rectly inferred. Blum and Simpson 7 sug- it proposes that the reactions occur by gested an enzyme cascade model (Fig. 2, sequential endonucleolytic cleavages green arrows) based primarily on the and ligations (red arrows in Fig. 2) mu. presence of terminal uridylate tranderase (TUTase) and RNA ligase activities Chimera formation ~n vitro Several features that distinguish these in mitochondria 9. They proposed that the initial step is gRNA-directed cleav- models have been experimentally tested age of the pre-mRNA at the editing site, in vitro. These include the pathway by then Us are added to or deleted from the which chimeras are generated. Both 3' 3' terminus of the 5' cleavage product and 5' pre-mRNA cleavage products are during insertion or deletion, respectively, produced when chimeras are formed in and finally, the two half RNAs are joined vitro, thus supporting a cleavage-.ligation by the RNA ligase. However, an alterna- model m~4. Chimeras also form more tive mechanistic pathway for the pro- readily when the isolated 3' cleavage duction of edited RNA was suggested fragment, rather than intact pre-mRNA, after chimeric molecules, in which gRNAs is included in the in vitro reaction ~4. In are covalently linked with portions of addition, when cleavage is inhibited by their cognate pre-mRNAs, were found in a phosphorothioate stereoisomer at the cellular RNA1°,i~. The gRNAs were fre- cleavage site, chimeras are not generquently linked at editing sites, typically ated, implying that cleavage is a necessthrough an oligo(U) stretch, it was pro- ary step in chimera formation ~4.Furtherposed that these chimeras were editing more, chimera formation, like the activity intermediates and that, by analo~ to of RNA ligases, is dependent upon ATP RNA splicing, editing proceeds by two et/[3 bond hydrolysis 1446. These data are
this role for gRNAs was first provided by the in vitro demonstration that synthetic cognate gRNAs specify the deletion of the appropriate number of Us from the first editing site of synthetic substrate RNAs (modeled after ATPase 6 premRNA) when incubc.ted with mitochondrial lysate from the kinetoplastid parasite, Trypanosoma brucei 8. This work confirmed that gRNAs specify the edited sequence and established an in vitro system to begin to address the underlying mechanism.
inconsistent with a transesterification mechanism for chimera formation. Rather, they imply that chimeras form by RNA ligase-catalysed joining of gRNAwith the 3' portion of the (cleaved) pre-mRNA.
RNA ed[tangin vitro Advances in the in vitro editing system led to the development of assays to monitor the gP~iA-directed deletion 17or insertion la of Us at a single site in a synthetic pre-mP~A, and allowed detailed analysis of the reactions that lead to edited ~ A . Data from these studies support the mechanism described in Fig. 3.
The first step in the pathway of production of edited RNA appears to be gRNAdirected endonucleolytic cleavage of the pre-mRNA. The cleavage occurs immediately 5' of the anchor duplex between pre-mRNA and gRNA, leaving a 5' monophosphate on the pre-mRNA 3' cleavage product and a 3' OH on the 5' cleavage product, in the case of deletion, Us are removed from the 3' end of the 5' cleavage product as indicated by the occurrence of shortened 5' cleavage products ~7. Site-specific labeling studies suggest that the removed nucleotides are released as free UMP (S. Seiwert, pets. commun.). Similarly, in the case o! insertion, Us derived from UTP appear to be added to the 3' end of the 5' cleavage product TM.In both insertion and deletion, the appropriately processed 5' cleavage product must be ligated to the 3' cleavage product to create the edited product. U insertion (unlike U deletion), is dependent upon UTP. Indeed, msZP-labeled UTP becomes specifically incorporated into an editing site when included in an in vitro reaction TM.The oligo(U) tail of
163
REVIEWS
Tff3S 2 2 - MAY 1 9 9 7
A6 pre*mRNA
5'...
UGAU
..
Finally, in time-course studies, chimeras accumulate subsequent to edited RNA and they display the kinetics of end products nJS. Thus, there are sufficient data to conclude that chimeras are not intermediates in the production of edited RNA.
,3'
gA6114]
~
(a) Cleavage 5"...
(b) TE
uG &u G C ~ ~ . . .
• . . 3' 5' UG
(c) Ligation
~
~
,•
U-Addition
5"...
UG
;AU
!!lllll/_t
G
C
~
.
.
.
.
.
5"
~LCgeavage
: ~
UG
¢,~]
ccA~
. . ,3"
AU
a"
m
~
G c ~ ~
...3"
s"
3'. . . . .
~zLigation
5',
. •
UG
;,:AU
,~Ligation
, . .3'
5'.
, .
UG II
AU
. . .3'
I A.LLLI~J_
Figure2 Three hypothesesfor the mechanism of kinetoplas~id RNA editing. The schematic pre-~aRNAguide RNA (gRNA) pair represents ATPase 6 pre-mRNA interacting with gA6114]. The illUSo trated editing event ts the insertion of two Us at edttinffsite 2 of ATPase 6 pre-mRNA. The pre.mRNA Is outlined in gray, while the three functional regions of the gRNAare color-coded as described in Fig. 1. (a} The original proposal of a succession of enzymatic activities underlying the formation of edited product is shown in the pathway delineated by green arrows. This model has received significant support by recent in vitro experiments. Pathways (b) and (©) depict the two models proposing gRNA-pre-mRNAchimeric molecules as intermediates. Chimeras may be formed by successive enzymatic steps (red arrows) or have alternatively been suggested to be produced and resolved by transesterification (TE) reactions (blue arrows). For details see text. Notethat the U-tail of the gRNAis shortened after one cycle of insertion editing in the models involving chimeric intermediates, while the length remains unchanged in the enzymatic model ,,,~o,,,.,,UTP as the sou'ce of the inserted Us.
What are chimeras ff not intemleaiates? Chimeras have features unexpected of RNA editing intermediates: the gP~NA portions are often truncated and the U tracts linking the gRNA and pre-mRNA sequences vary widely in length anaong chimeras. Also, chimeras are rare in cellular RNA (approx. one molecule per 100 cells). Nevertheless, the abundance of chimeras correlates with the developmentally controlled abundance of edited RNA in vivo, suggesting that the prcduction of chimeras and edited RNA could be linked2L Chimeras could he formed by the editing machinery if, upon cleavage of the pre-mRNA at the editing site, the 3' end of the guide RNA replaces the position normally held by the 5' premRNA cleavage product (see Fig. 3c). Support for this hypothesis comes from mutational studies, which show that the ratio of chimeras to edited RNA can be modulated by changes in the basepairing potential between the 5' portion of the pre-mRNA and the 3' portion of the guide RNAaT. A weaker interaction correlates with a greater proportion of chimeras. These data suggest that the 3' portion of the gRNA occasionally replaces the 5' cleavage product of the pre-mRNA as a substrate for [igation by the editing machinery. The activities of the editing machinery could also account for the production of chimeras with variable U tracts and truncations. Overall, the data suggest that chimeras are deadend products of aberrant editing.
How gRNAspecifiesthe edited sequence The number of Us inserted or ddeted
the gRNAis insufficient to support inser. tional editing, implying that the inserted Us are not donated by the oligo(U) tail of the gRNA. Thus, as with chimera formation, the generation of edited RNA appears to proceed by cleavage-ligation rather than by transesterification. The in vitro reactions that generate edited RNA also typically produce chimeras, However, several lines of evidence, in addition to the UTP depeudence of U insertion, suggest that they are not intermediates in the prodaction of edited RNA.For example, the cleavage of pre-mRNA during U deletion ~.diting at a position 3' to the Us to be ren:oved is inconsistent with the models that propose
chither{c inte:mediates, as these models require that the Us must remain with the 3' portion of the pre-mRNA. Similarly, the cleavage that resolves the putative chimeric intermediate during insertion editing should result in a 3' cleavage product containing the added Us at its 5' end (see Fig. 2, red arrows). However, this postulated intermediate is not observed during in vitro editing. Additional evidence that chimeras are not intermediates comes from in oitro studies of a U-incorporation activity in the kinetoplastid Leishmania tarentolae 19. This U-incorporation activity has stereochemical characteristics that rule out the involvement of chimeric intermediates 20.
by editing is controlled by base-pairing interactions between the gRNA and premRNA, as illustrated by the predictable editing specified by mutant gRNAs (Fig. 4). The number of Us added to or removed from the 3' end of the 5' cleavage products does not appear strictly templated, as molecules with varying numbers of Us at this site are produced #1 vitro, including molecules with more Us added than specified by the gRNA. The processed 5' cleavage products that would extend the duplex by the greatest number of base pairs appear to be preferentially selected for ligation. In oitro, a small fraction of edited pre-mRNAs contain a number of Us not specified by the
lVlWS
TIBS 22 - MAY 1997
{a) Deletion 5'...
~'...~
{c) Chimera formation
{b) Insertion A L.!t ~L) U G
. . .3"
~ .
, ) 0 9`
5'... e:, :, AOC @UG ~,, 3'... ~
u
~
.
.
.
...3"
• . . 3'
..~.
G
I 5'... 3 " . . . ~
5"
U C O'~
@AI~J0, , | !
GCAAm~
...3"
Loss of 5'-cleavage product
.5"
UTP
U-removaV U-addition
uMP4
~
3'..~.~
Endonuc!eogytic cleavage
t
UGAU
5'...
~.
~AU 3 ' . . . ~
I UG k3\>°~ ~ A U
5'..
5"...
A © ~"
@UG
, • . 3"
Gcz%A' ~ . . . 5 "
U-removal/ U-addition
. .. 3'
~%~"
...3'
OAu
.3'
Ligation Ligation 5'...
3'...~
A~G
. . . 3'
~...s'
5".
3'..~
UGUUAU
&~.
.~,3'
BAU
.3'
3cAA~...5'
Figure :3 Detailed model for the mechanism of kinetoplastid RNA editing. The pre-mRNAis shown in gray on the top of the pairs and the guide RNA (gRNA) below with the same color code as described in Fig. 1. (a) Deletion of three Us from editing-site 1 of ATPase 6 pre-mRNAis illustrated as specified by gA6[14]A16G (Ref. 8)(Fig. 4). (b) The insertion of two Us into editing-site 2 of ATPase 6 pre-mRNAis shown. The initial step of the reaction pathway in both deletion and insertion is cleavage of the pre-mRNAat the editing site, which is defined by the phosphodiester bond immediately upstream of the intermolecular anchor duplex between gRNA and pre-mRNA. Subsequently, Us are being added to or removed from the 3' end of the pre-mRNA5' cleavage product. The intermediates [boxed species in (a) and (b)] with the appropriate number of Us [boldly colored pair in (a) and (b)] are preferentially selected over the faded pairs for ligation with the pre-mRNA3' cleavage product. The oligo(U) tail of tile gRNA is sllown throughout base-paired with the purine-rich region upstream of the editing sites. (c) If this interaction is weakened in an aberrant side reaction, tl~e pre-mRNA5' cleavage product may be lost from the catalytic center of the editing machinery and its place may be taken by the oligo(U)-tail of the gRNA resulting in chimera formation. Differential processing of the oligo(U)-tail before ligation leads to chimeras with differing numbers of Us at the linkage site. See text for details.
gRNAns. hi vivo, these molecules could undergo a subsequent round of editing to obtain the gRNA-specified sequence. The machinery, in this sense, might have a built-in proofreading capability. Order of editing-site selection The blocks of sequence that undergo editing appear to be selected by the gRNA via anchor duplex formation, suggesting a 3' to 5' direction of processing. The specific editing sites within a block seem to be recognized because they are at mismatches adjacent to an uninterrupted RNA duplex. For example, editingsite 1 of completely unedited ATPase 6 pre-mRNA is adjacent to the anchor duplex, and is targeted for editing. The same gRNA directs in vitro editing at editingsite 2 when editing-site 1 contains edited sequence (consequently allowing the gRNA/pre-mRNA duplex to be extended
to editing-site 2). Generalization of this process suggests that this duplex is extended in a strict 3' to 5' direction. This, however, is inconsistent with data on partially edited RNAs isolated from in vivo RNA. These molecules typically contain a 'partially edited' region that bridges 3' edited and 5' unedited sequences. Perhaps short upstream duplexes form between guide RNAand premRNAthat can direct editing to occur in a manner that is not precisely 3' to 5'. More efficient in vitro systems are needed to address the issue of how multiple sites are selected for editing. Imp0rtance of interactions upstream of the editing site Interactions between the oligo(U) tail and 3' regions of gRNA with pre-mRNA sequences upstream of the editing site are important to editing. The reduction
in the level of in vitro editing by elimination of the gRNAoligo(U)taiP; supports the suggestion n that its base-pairing with purine-rich upstream regions contributes to efficient editing, in addition, substitution of a region lacking an extensive purine stretch with a purine-rich sequence allows the in vitro editing of a pre-mRNA that is otherwise unedited in vitro TM. These interactions might maintain gRNA-pre-mRNA association after cleavage. However, other interactions, perhaps mediated by proteins, are probably necessary, especially to edit the most 5' editing sites in an editing domain, which tend not to be preceded by purine-rich sequences. Uns01ved mysteries The role of the gRNA3' OH. Oxidation of the terminal hydroxyls or phosphorylation of the 3' OH on the terminal nucleotide
:!.65
REVIEWS (a)
TIBS 22 - MAY 1 9 9 7
gA6114] ...A
A6\TAG.1
UUG . . . . . .
I
...A'
I . . . . . .
UUG .
.
.
.
.
A
I .
.
.
gA6114] • . . UGuuAUrJG . . . . . .
A6-eES1
.
II
U .... GC...
I I:I ...U--AGC
(b)
A .... UG...
I:1
•..U---AGC
A6\TAG
gA6114]A16G
:11111:1 • • • GCAAUAGC . . . . . .
.
.
.
" UG...
II
U---AC...
gA6114]+A21 UGuuuAbTJG...
:111111:1 GCAAAUAGC...
Figure 4 Guide RNA (gRNA) specifies the edited sequence. Various combinations of wild-type and mutant gRNAs with pre-mRNAs predict that different numbers of Us will be inserted or deleted. In (a), the combinations of gRNAs and pre-mRNAsused in the original report of in vitro deletion editing8 are shown• Sequences surrounding the pre-mRNAediting site are shown on the top and the complementary gRNA sequences below. Watson-Crick and G:U basepairs are indicated by vertical lines and colons, respectively. Dashed lines in the gRNAs connect bordering nucleotides. Green asterisks indicate deleted Us. In (b), the two gRNAs ~.hatspecify U insertion into editing-site 2 of A6-eES1 (Ref. 18) are shown below their cognate pre-mRNA. Inserted Us are in red.
editing, candidate editing machinery proteins have been identified from T. brucei extracts, including 25, 65 and 90 kDa gRNA-specific UVcrosslinldng proteins25.z6• The 90kDa protein specifically binds the gRNA oligo(U) tail. The gene that encodes the 25 (21) kDa protein has been cloned 27 and a monoclonal antibody to this protein immunoprecipitates editing activities (T. Alien, pets. corn[nun.). A mitochondrial helicase has also been implicated in RNA editing, as mutants in which this gene has been knocked out grow very slowly and have little edited RNA in vivo 0t. U. GOringer, pers. commun.). Two mitochondrial proteins, identified as RNA ligases, have also been suggested to be involved in RNA editing ~S. Hence, early studies to identify the editing machinery are in progress.
Conclusionsand outlo0k Now that the basic mechaof the gRNA have been variously re- nism by which Us are inserted or ported to abolish in vitro editing, but not deleted at one editing site has been elucleavage. It is uncertain if this reflects a cidated, the focus has turned to other isrole for this hydroxyl in the chemistry of sues, such as detailing the requirements editing reactions or If it causes interfer. for the reaction, analysing how multiple ence In the association of the RNAs with sites are edited and identifying compoo components of the editing machinery. nents of the editing machinery. Why this Eaiting of multiple sites. Little is known baroque process is used in the synthesis about how all of the U insertions and of kinetoplastid mitochondr|ai proteins deletions specified by a gRNAare carried remains a mystery. The mechanism out. For example, what differences exist bears little relation, as was previously in the RNA interactions with the editing suspected, to another potentially anmachinery during U deletion versus cient form of RNA processing, such as U insertion? How does the machinery RNA splicing, implying that these promove from one editing site to another? cesses arose independently. Clearly, How long do the gRNAs remain duplexed there is much left to explore about the with the pre-mRNA? Are guide RNAs editing of kinetoplastid pre.mRNAs. reused to edit multiple pre.mRNAs?
The editing machinery RNA editing, like other RNA processing reactions, appears to be catalysed by a macromolecular complex. In vitro editing activities sediment at -205 in glycerol gradients 23and are sensitive to protease (S. Seiwert, pers. commun.). Several individual activities expected to be involved in RNA editing are present in this 205 fraction, as well as lower in the gradient 24, These include RNA endonuclease, TUTase, U-specific 3'-exonuclease and RNA iigase. While no specific protein has been definitively implicated in RNA
166
Acknowledgements We thank S. Seiwert, 1". Allen and H. U. G6ringer for communicating unpublished results. We would also like to thank M. Parsons for critically reading this manuscript. Work done in the authors' lab was supported by grants AI14102 and GM42188 from the National Institute of Health.
References 1 Arts, G. J• and Benne, R. (1996) Biochim. Biophys. Acta 1307, 39-54 2 Seiwert, S. D. (1995) ParasitoL Today 11, 362-368 3 Simpson, L., Maslov, D. A. and Blum, B. (1993)
in RNA editing: the alteration of prctein codinE sequences ofRNA (Vol. 1) (Benne, R., ed.), pp. 53-86, Ellis Harwood 4 Stuart, K. (1993) in RNA editing: the alteration of protein coding sequences of RNA (Vol. 1) (8enne, R., ed.), pp. 26-52, Ellis Harwood 5 -~enne, R. ed. (1993) RNA editing: the alteration of protein coding sequences of RNA (Vol. 1), Ellis Harwood 6 Benne, R, et al. (1986) Cell 46,819-826 7 Blum, B., 8akalara, N. and Simpson, L. (1990) Cell 60, 189-198 8 Seiwert, S. D. and Stuart, E. (1994) Science 266, 114-117 9 Bakalara, N., Simpson, A. M• and Simpson, L. (1989) J. Biol. Chem. 264, 18679-18686 10 Cech, T. R. (1991) Cell 64, 667-669 11 Blum, B., Sturm, N. R., Simpson, A. M. and Simpson, L. (1991) Cell 65, 543-550 12 Harris, M. E. and Hajduk, S. L. (1992) Cell 68, 1091-1099 13 Sollner-Webb, 8. (1991) Curt. Opin. Cell Biol. 3, 1056-1061 14 Rusch& L. N., Piiler, K. J. and Sollner-Wobb, B. (1995) MoL Cell. Biol. 15, 2933-2941 15 Sabatini, R. and Hajduk, S. L. (1995) J. Biol. Chem. 270, 7233-7240 16 Arts, G. J., Sloof, P. and Benne, R. (1995) Mol. Biochem. Parasitel. 73, 211-222 17 Seiwert, S. D., Heidmann, S. and Stuart, K. (.1.996) Cell 84, 831-841 18 Kable, M. L., Soiwert, S. D., Heidmann, S. and Stuart, K. (1996) Science 273, 1189-1195 19 Frech, G. C., Bakalara, N., Simpson, L. and Simpson, A. M. (1995) EMBO J. 14, 178-187 20 Frech, G. C. and Simpson, L. (1996) Mol. Cell. Biol. 16, 4584-4589 21 Riley, G. R., Myler, P. J. and Stuart, K. (1995) Nucleic Acids Res. 23, 708-73.2 22 Blum, B. and Simpson~ L. (lgcJO) Cell 62, 391-397 23 Corell, R. A. et al. (1996) Mol. Cell. Biol. 16, 1410-3.418 24 Pollard, V. W., Harris, M. E. and Hajduk, S. L. (1992) EMBO J. 11, 4429-4438 25 Road, L. K., Goringor, H. U. and Stuart, K. (1994) Mol. Cell. Biol. 14, 2629-2639 26 Kofler, J. et al. (1994) Nucleic Acids Res. 22, 1988-3.995 27 Kbllor, J. et al. (3.997) J. Biol. Cicero. 272, 3749-3757
TiBS r e f e r e n c e |[sts Authors of TiBSarticles are asked to limit the number of references cited to provide non-specialist readers with a concise list for further reading. it is hoped that the appropriate citation of review articles and timely original articles will give the reader an immediate inroad into the topic.