RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells

Eur J Vasc Endovasc Surg (xxxx) xxx, xxx

RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells Chengen Wang Yuan Li c,*

a,b,y,z

, Huihui Liu

c,y,z

, Min Yang

a,y,z

, Yun Bai d, Hanyun Ren c, Yinghua Zou a, Ziping Yao a, Bihui Zhang a,

a

Department of Interventional Radiology and Vascular Surgery, Peking University First Hospital, Beijing, China Department of Minimally Invasive Tumour Therapies Centre, Beijing Hospital, National Centre of Gerontology, Beijing, China c Department of Haematology, Peking University First Hospital, Beijing, China d Department of Cell Biology, School of Basic Medical Sciences, Peking University Health Science Centre, Beijing, China b

WHAT THIS PAPER ADDS Clinical studies have shown that mesenchymal stem cells (MSCs) could improve ischaemic symptoms in patients with peripheral arterial disease. The mechanism underlying their therapeutic effect is that MSCs can differentiate into endothelial cells (ECs) and form new blood vessels. However, the expression profile during endothelial differentiation has not been fully understood. Transcriptome analysis provides a comprehensive sequence resource for functional genomic studies. The Gene Ontology and Kyoto Encyclopedia of Genes and Genomes functional enrichment analyses revealed that extracellular matrix, cytokines and transforming growth factor-b pathway play an important role in the process of endothelial differentiation. Furthermore, 11 genes were found that may be involved in the differentiation of MSCs into ECs and enhance current understanding of the differentiation mechanism.

Objectives: The aim was to identify the change in gene expression between mesenchymal stem cells (MSCs) and induced endothelial cells (ECs) and to investigate the potential mechanism of endothelial differentiation based on ribonucleic acid sequencing (RNA-Seq) analysis. Methods: MSCs were isolated from bone marrow and exposed to inducing medium. The dynamic transcription profiles of MSCs were identified and ECs were induced through RNA-seq. Differentially expressed genes (DEGs) were identified. Enrichment of functions and signalling pathways analysis were performed based on Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) database. Quantitative real time polymerase chain reaction (qRT-PCR) was used to validate the genes selected from RNA-Seq. Results: In total, 2769 DEGs were identified, of which 1117 genes were upregulated and 1652 genes were downregulated. GO and KEGG pathway analyses identified significantly enriched pathways in DEGs, including extracellular matrix organisation, blood vessel morphogenesis, angiogenesis, extracellular matrix binding, growth factor binding and glycosaminoglycan binding extracellular matrixereceptor interaction pathway, cytokineereceptor interaction pathway and transforming growth factor (TGF)-b signalling pathway. All genes found to be associated with the TGF-b pathway were significantly downregulated. Eleven novel genes were also identified that most likely are involved in endothelial differentiation and were upregulated with more than 10 fold change, which were further validated by qRT-PCR. Conclusions: The GO and KEGG analysis revealed that extracellular matrix, cytokines and the TGF-b pathway play an important role in the process of endothelial differentiation. Furthermore, 11 genes were found that may be involved in the differentiation of MSCs into ECs and contribute to current understanding of the differentiation mechanism. Keywords: Gene expression, Endothelial differentiation, Stem cells, Endothelial cells Article history: Received 9 March 2019, Accepted 1 November 2019, Available online XXX Ó 2019 European Society for Vascular Surgery. Published by Elsevier B.V. All rights reserved.

INTRODUCTION y

These authors contributed equally to this work. These authors are joint first authors. * Corresponding author. Department of Haematology, Peking University First Hospital, No. 8 Xishiku Street, Beijing 100034, China. E-mail address: [email protected] (Yuan Li). 1078-5884/Ó 2019 European Society for Vascular Surgery. Published by Elsevier B.V. All rights reserved. https://doi.org/10.1016/j.ejvs.2019.11.003 z

Peripheral arterial disease (PAD) is a common circulatory problem that reduces blood supply to limbs when arteries are narrowed due to vascular stenosis or occlusion.1 If not treated properly, serious events such as chronic limb threatening ischaemia (CLTI) can occur in patients with diffuse stenosis or occlusion. Although not common, some patients require amputation and have poor quality of life.2

Please cite this article as: Wang C et al., RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells, European Journal of Vascular and Endovascular Surgery, https://doi.org/10.1016/j.ejvs.2019.11.003

2

With the development of medical technology, vascular bypass surgery and endovascular treatment have become important treatments for PAD, however the outcome is not satisfactory for some patients with severe disease. Recently, mesenchymal stem cell (MSC) based treatment has become the hot method for research. Although some clinical studies reported negative results,3 a few studies have shown that stem cells could improve the ankle brachial index, transcutaneous oxygen measurements and pain score in patients with CLTI.4 Thus, MSC based treatment remains a promising alternative for PAD. The mechanisms underlying their therapeutic effects is that MSCs can differentiate into endothelial cells (ECs) and form new blood vessels.5 Although the directed differentiation of MSCs towards ECs offers a therapeutic possibility for PAD, the proportion of MSCs differentiated into ECs in vivo is quite low.6 Understanding the molecular mechanism of the differentiation of MSCs to ECs will help to improve differentiation rates. Recent studies suggest that genetics may influence the differentiation of MSCs.7 The majority of these differentially expressed genes (DEGs) are master regulators of the differentiation process. However, their role in endothelial differentiation has not been extensively investigated to date. A previous study has demonstrated the successful derivation of ECs from MSCs in vitro,8 while the potential mechanism of endothelial differentiation is relatively less studied. In this study, the gene expressing profiles of MSCs were analysed and EC samples were induced using ribonucleic acid sequencing (RNA-seq) to identify the differentially expressed genes and gain more insight into the potential mechanism of endothelial differentiation.

Chengen Wang et al.

MSCs were cultured in a differentiation medium containing 50 ng/mL vascular endothelia growth factor (VEGF), 10 ng/ mL basic fibroblast growth factor (bFGF), 20 ng/mL insulin like growth factor (IGF), 5 ng/mL epidermal growth factor (EGF) (PeproTech, Rocky Hill, NJ, USA), ascorbic acid, heparin and 2% FBS. To confirm the endothelial phenotype, the induced cells were harvested and analysed for EC specific markers (CD31) by flow cytometry. Dioctadecyloxacarbocyanine perchlorate acetylated low density lipoprotein (Dil-ac-LDL) (Solarbio, Beijing, China) uptake assay was performed to verify endothelial function. To examine the angiogenesis of the differentiated ECs, the formation of vessel like structures was assessed. The cells were seeded in triplicate into the 96 well plate at a density of 2  104 cells/ well and incubated for 12 h. Tube formation assay in vitro was performed after three, seven, and 14 days of exposure to inducing medium. Ribonucleic acid preparation Total ribonucleic acid (RNA) from MSCs and induced ECs was extracted using Trizol reagent (Thermo Fisher, Waltham, MA, USA) according to the manufacturer’s instructions. RNA samples were then digested with RNase free DNase I (Invitrogen, Carlsbad, CA, USA) to eliminate residual genomic deoxyribonucleic acid (DNA), and the digestion products were purified using magnetic beads (Axygen, Union City, CA, USA). Lastly, the concentration, quality and integrity of the total RNA were determined using a Nano Drop 2000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA) and an Agilent 2100 Bioanalyser (Agilent Technologies, Santa Clara, CA, USA). The total RNA that had a standard of concentration 200 ng/mL, mass 10 mg and RNA integrity number (RIN)  8.0 was subjected to RNA-Seq.

METHODS MSC preparation The present study was approved by the ethics committee of Peking University First Hospital. Human iliac crest bone marrow aspirates were obtained from five healthy donors with informed consent. Cells were suspended in Iscove’s Modified Dulbecco’s Medium (IMDM) (Invitrogen, Carlsbad, CA, USA) and placed over 1.073 g/mL Ficoll (Haoyang, Tianjin, China) and centrifuged at 800g for 20 min at room temperature. The mononuclear cells were collected at the interface, and then suspended in IMDM supplemented with 10% foetal bovine serum (FBS) (Invitrogen, Carlsbad, CA, USA) and 100 U/mL penicillin/streptomycin (Invitrogen). The cells were seeded on six well culture plates (Corning, Acton, MA, USA) and incubated with 5% CO2 at 37  C. The medium was changed after 48 h and then every three days. The characterisation of the MSCs was identified by flow cytometry after labelling them with APC-CD29, PE-Cy7-CD44, FITC-CD90, PE-CD105 and Per CP-Cy5.5-CD31 antibodies (Biolegend, San Diego, CA, USA). Endothelial differentiation of MSCs MSCs were induced to differentiate into ECs using the modified procedures described by Wang et al.8 Briefly,

Complementary deoxyribonucleic acid library construction Messenger (m)RNA for each sample was enriched using oligo (dT) magnetic beads and then fragmented into short pieces (approximately 200 bp) in fragmentation buffer. The first strand cDNA was transcribed from the cleaved RNA fragments using random hexamer primer, and second strand complementary (c)DNA was synthesised in a reaction containing buffer, dNTPs (deoxyribonucleotide triphosphate), RNase H and DNA polymerase I. Double stranded cDNA was purified with magnetic beads and subjected to end reparation and 30 single adenylation. Integrity and size were checked on an Agilent 2100 Bioanalyser (Agilent technologies, Santa Clara, CA, USA). Lastly, the cDNA library was sequenced on a paired end flow cell using an Illumina HiseqÔ 4000 platform (Illumina, San Diego, CA, USA). Ribonucleic acid sequencing data processing and identification of differentially expressed genes cDNA libraries from MSCs and induced ECs were sequenced according to the protocols for RNA-Seq. Raw reads were pre-processed using FastQC software. PCR duplicates, reads that only contain adapter, ploy-N, and reads with low quality (score  5) were removed. Clean reads were then

Please cite this article as: Wang C et al., RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells, European Journal of Vascular and Endovascular Surgery, https://doi.org/10.1016/j.ejvs.2019.11.003

Transcriptome Analysis for ECs Differentiation

used for subsequent analyses. Transcript expression levels were estimated using fragments per kilobase per million reads (FPKM) values and quantified by RSEM software. EdgeR software was used to identify differential expressed genes.9 The package employed robust statistical models even for small numbers of replicates. Gene Ontology and Kyoto Encyclopedia of genes and genomes enrichment analysis For functional enrichment analysis, all DEGs were mapped to terms in the GO databases, and then significantly enriched GO terms were searched for among the DEGs using p < .05 as the threshold. GO term analysis was classified into three subgroups, namely biological process (BP), cellular component (CC) and molecular function (MF). All DEGs were mapped to the KEGG database, and searched for significantly enriched KEGG pathways at p < .05 level.

3

Statistical analysis The edge R package was used, which modelled the gene level read count data assuming a negative binomial distribution and employed the over dispersed Poisson model and an empirical Bayes procedure to moderate the degree of over dispersion across genes, to identify significant DEGs. DEGs were evaluated by meeting the two criteria: (i) more than twofold change in expression; (ii) adjusted p < .05. The fold change of each gene was calculated by comparing the standardised read counts of induced ECs to MSCs (fold change ¼ standardised read counts of induced ECs/standardised read counts of MSCs). Log2 scale of fold change was used for convenience. jlog2(fold change)j > 1 means at least twofold change. Raw p values were adjusted for multiple testing using Bonferroni correction. padj < .05 was considered significant. RESULTS

Validation of gene expression by quantitative real time polymerase chain reaction To validate the reliability of the DEG results, the expression levels of 11 selected transcripts were determined by qRTPCR with the housekeeping gene GAPDH as an endogenous reference. The complete list of primers for all genes and GAPDH is presented in Table 1. Total RNA was extracted for cDNA preparation as described above. Total RNA (1 mg) from MSC and induced EC samples was reverse transcribed into single stranded cDNA by Revert Aid first strand cDNA Synthesis Kit (Thermo Fisher, Waltham, MA, USA). The incorporation of the SYBR Green dye (Life, Foster City, CA, USA) into the PCR products was monitored in real time with the ABI Prism 7500 PCR system. Reactions were carried out with the following amplification conditions: initial denaturation at 50  C for two minutes, 95  C for 10 min, followed by 40 cycles of reaction at 95  C for 15 s and 60  C for 60 s. To confirm the specificity of the amplification reaction, a melting curve was performed after the last amplification cycle. To get reliable calculation of statistical significance, all PCR reactions were performed in triplicate for per differentially expressed gene. Gene expression was evaluated by the 2eDDCT method.

Culture of mesenchymal stem cells MSCs isolated from bone marrow demonstrated a fibroblast like, spindle shaped morphology and marked adhesion growth (Fig. 1A). Because of the absence of adherence property, the myeloid haematopoietic cells could be removed gradually by changing the culture medium. With continuous proliferation of the colony, the cells grew in a parallel arrangement according to the rule of “whirlpool” growth. Flow cytometry results showed that MSCs typically expressed CD29, CD44, CD90 and CD105. They were negative for typical endothelial marker such as CD31. Differentiation of mesenchymal stem cell endothelial cells Induced cells showed significant differences compared with undifferentiated MSCs. The cells gradually developed into short spindle shapes (Fig. 1B). The expression of CD31 was strongly positive by flow cytometry analysis on the 14th day, with 55.8% of cells showing a positive expression. No expression of endothelial markers was observed during the whole cell culture period in undifferentiated MSCs. After 14 days of exposure to inducing medium, induced cells could uptake Dil-Ac-LDL and form evident tube like structures on

Table 1. Primers for 11 upregulated candidate genes involved in endothelial differentiation and housekeeping gene GAPDH as an endogenous reference Gene

Forward primer

Reverse primer

HIPK2 GREM1 LEF1 ADGRA2 EFNB2 CHRNA7 LRG1 NTRK1 S100A9 MMRN2 RAPGEF3 GAPDH

TGACAGCGTGTTCTTAGGAC TCATCAACCGCTTCTGTTACG AGAGCGAATGTCGTTGCTGA AGCAATAACAAGATCACGG TATGCAGAACTGCGATTTCCAA GCTGGTCAAGAACTACAATCC TTACAGGTGAAACTCGGGGC AGAGTGGTCTCCGTTTCGTGG CAACACCTTCCACCAATACTCT CCTGAGCGTGGTGTCTACCT CAAACCTCATCCGAGACCG TGACTTCAACAGCGACACCCA

AGGAAAGTGGGAGTATGATTAGG GGCTGTAGTTCAGGGCAGTT TCGTTTTCCACCTGATGCAGA GGAGAAGATGTTTCCAGATA TGGGTATAGTACCAGTCCTTGTC GCCATCTGGGAAACGAAC CTGACCCCAAGCTAAGTGGG AGAGGCCCTGCACAGTTTTCC CAGCATGATGAACTCCTCGA CAAAGACCGTTGCTGTGCT CCTGGCAGATTCCCACAAC CACCCTGTTGCTGTAGCCAAA

Please cite this article as: Wang C et al., RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells, European Journal of Vascular and Endovascular Surgery, https://doi.org/10.1016/j.ejvs.2019.11.003

4

Chengen Wang et al.

A

B

Figure 1. Morphological characteristics of mesenchymal stem cells (MSCs) and induced endothelial cells (ECs). (A) MSCs showed a typical spindle shaped morphology. (B) Induced ECs demonstrated short spindle shaped morphology. Scale bar represents 100 mm.

Matrigel. Conversely, MSCs formed aggregates and showed no capillaries. Analysis of differentially expressed genes during endothelial differentiation To reveal the molecular mechanism associated with endothelial differentiation, a DEG analysis was performed to identify gene expression changes between MSCs and induced ECs. By sequencing, a total of 25 817 171 and 26 220 410 raw reads were obtained from MSCs and induced ECs groups, respectively. After cleaning and quality control, the number of clean reads for further analysis were reduced to 25 308 078 and 25 674 845, respectively. A total of 2769 DEGs (jfold changej>2 and p < .05) were detected between the MSCs and ECs cDNA libraries, of which 1117 genes were upregulated (higher expression in ECs) and 1652 genes were downregulated (Figs. 2 and 3). This result indicated the great alterations in gene expression during differentiation from MSCs to ECs. To identify novel upregulated genes related to endothelial differentiation, the known genes that related to angiogenesis or endothelial differentiation that were previously reported were excluded. Eleven novel genes were identified that were significantly upregulated (over 10 fold) in the ECs compared with MSCs. Functional annotation and classification GO analyses were made on three different aspects namely BP, CC and MF, reflecting the dynamic alteration processes during endothelial differentiation (Fig. 4). According to the functional enrichment results, 906 BP terms, 69 CC terms and 75 MF terms were statistically significantly enriched in DEGs. The most enriched BP terms include extracellular matrix organisation, blood vessel morphogenesis and angiogenesis. Among them, the process of extracellular matrix organisation was significantly activated, with nine upregulated genes involved, including CTSG, ELANE, MMP1,

KDR, VWF, PDGFB, COL17A1, MMP10 and MYF5. In addition, NOTCH4 and DLL4 were upregulated more than 10 fold in the biological process of blood vessel morphogenesis and angiogenesis during endothelial differentiation. Extracellular matrix was the most enriched CC term. The most enriched MF terms were extracellular matrix binding, growth factor binding and glycosaminoglycan binding. Next, a KEGG pathway enrichment analysis was conducted to explore the most significantly enriched pathways for DEGs (Fig. 5). A total of 839 genes were mapped into signal pathways, and the most enriched were extracellular matrixereceptor interaction pathway, cytokineereceptor interaction pathway and TGF-b signalling pathway. All genes associated with the TGF-b pathway (ID4, NOG, THBS2, INHBA, INHBB, INHBE, BMP8B, COMP and CHRD) were significantly downregulated, indicating the inhibition of the TGF-b signalling pathway during endothelial differentiation. Validation of the sequencing results by quantitative real time polymerase chain reaction Some genes had significant differences in expression between the MSCs and induced EC groups. To confirm the reliability of the expression profiles generated using the RNA-Seq and DEGs analysis, qRT-PCR was applied to examine the expression levels of the 11 upregulated candidate genes (HIPK2, GREM1, LEF1, ADGRA2, EFNB2, CHRNA7, LRG1, NTRK1, S100A9, MMRN2 and RAPGEF3). As expected, the qRT-PCR results basically matched the RNA-seq results. The results indicate that the RNA-seq data reliably identified potential genes in endothelial differentiation. DISCUSSION In this study, significantly enriched DEG pathways were identified, including extracellular matrix organisation, blood vessel morphogenesis, angiogenesis, extracellular matrix binding, growth factor binding and glycosaminoglycan

Please cite this article as: Wang C et al., RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells, European Journal of Vascular and Endovascular Surgery, https://doi.org/10.1016/j.ejvs.2019.11.003

Transcriptome Analysis for ECs Differentiation

5

DEG (2769) 50

UP: 1117

–log10(padj)

DOWN: 1652

25

–12

–8

–4

0 4 log2(fold change)

8

12

Figure 2. Volcano map of differentially expressed genes (DEGs) between mesenchymal stem cells (MSCs) and induced endothelial cells (ECs). The x-axis is the log2 scale of the fold change of gene expression in MSCs and induced ECs (log2(fold change)). Negative values indicate downregulation; positive values indicate upregulation. The y-axis is the minus log10 scale of the adjusted p values (elog10 (padj)), which indicate the significant level of expression difference. The red dots represent significantly upregulated genes with at least twofold change, while the green dots represent significantly downregulated genes with at least twofold change.

binding extracellular matrixereceptor interaction pathway, cytokineereceptor interaction pathway and TGF-b signalling pathway. Eleven novel genes were also determined that most likely are involved in endothelial differentiation and were upregulated with more than 10 fold change. Cell differentiation in which one type of cell converts to another cell type with different morphology and function is generally a complex process involving various regulation molecules.10 Stem cells are the type of cells that have the potential to differentiate into one or multiple cell types. The molecular basis for stem cell differentiation is the synthesis of specific proteins resulting from the selective expression of genes associated with differentiation.11 With the differential expression of genes, stem cells can demonstrate different morphological structures, phenotypic characteristics and biological functions during differentiation.12 In a previous study, MSCs were successfully induced to differentiate into ECs by a modified method.8 Differentiation of MSCs into ECs involves the interaction

of multiple genes and regulation in signal pathways. However, the expression changes of these genes involved in endothelial differentiation are not fully understood. By comparing the RNA-seq data of MSCs and induced ECs, it is hoped that the regulation mechanisms related to endothelial differentiation can be identified and may provide important insights that could be used to improve the differentiation rate of MSCs and facilitate implementation in clinical therapy. Recently, the revolution of next generation sequencing (NGS) has had a great impact on genome research.13,14 RNA-Seq is an innovative and promising method for the comprehensive transcriptome profiling using NGS technologies to generate deep sequencing data for the direct quantification of transcripts.12 In this study, integrative transcriptome analysis was leveraged to decipher the molecular mechanism underlying endothelial differentiation. By pathway analyses, enriched pathways for differentially expressed genes were discovered, including pathways that

Please cite this article as: Wang C et al., RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells, European Journal of Vascular and Endovascular Surgery, https://doi.org/10.1016/j.ejvs.2019.11.003

6

Chengen Wang et al.

3 2 1 0 –1 –2 –3

Figure 3. Heatmap of the differentially expressed genes between mesenchymal stem cells and induced endothelial cells. Red stripes in the figure represent high expression genes, while blue stripes represent low expression genes.

are related to extracellular matrix organisation, blood vessel morphogenesis, angiogenesis, extracellular matrixe receptor interaction and cytokineecytokine receptor interaction. These annotations and classifications provided a valuable resource for investigating the specific processes, functions and pathways involved in endothelial differentiation, and may contribute to the identification of novel genes involved in this process. To the authors’ knowledge, this study is the first report of mRNA transcript profiling between MSCs and induced ECs.

The extracellular matrix is a cell synthesised macromolecular substance that distributes among the cells. The extracellular matrix mainly includes collagen, proteoglycan, elastin and glycoprotein.15 A variety of extracellular matrix provides a three dimensional spatial structure for cell adhesion and growth. The extracellular matrix can affect the morphology of the cells.16 The same type of cell in a different extracellular matrix demonstrates different morphology.17 Researchers found that cells leaving the extracellular matrix in vitro were spherical in shape. In

Please cite this article as: Wang C et al., RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells, European Journal of Vascular and Endovascular Surgery, https://doi.org/10.1016/j.ejvs.2019.11.003

Transcriptome Analysis for ECs Differentiation

7

A

extracellular matrix (n= 171) proteinaceous extracellular matrix (n= 147) extracellular structure organisation (n= 152) extracellular matrix organisation (n= 152) glycosaminoglycan binding (n= 81) blood vessel morphogenesis (n= 154) heparin binding (n= 64) angiogenesis (n= 132) ossification (n= 118) muscle structure development (n= 154) sulphur compound binding (n= 78) skeletal system development (n= 137) multicellular organismal macromolecule ... (n= 54) extracellular matrix component (n= 56) collagen metabolic process (n= 52) multicellular organismal metabolic process (n= 56) circulatory system process (n= 114) blood circulation (n= 113) multicellular organismal catabolic process (n= 39) collagen catabolic process (n= 37)

B

extracellular structure organization (n= 152) extracellular matrix organization (n= 152) blood vessel morphogenesis (n= 154) angiogenesis (n= 132) ossification (n= 118) muscle structure development (n= 154) skeletal system development (n= 137) multicellular organismal macromolecule ... (n= 54) collagen metabolic process (n= 52) multicellular organismal metabolic process (n= 56) circulatory system process (n= 114) blood circulation (n= 113) multicellular organismal catabolic process (n= 39) collagen catabolic process (n= 37) leucocyte migration (n= 100) musde organ development (n= 96) endoderm formation (n= 29) regulation of vasculature development (n= 68) heart development (n= 118) regulation of ossification (n= 59)

* * * * * * * * * * * * * * * * * * * * 0

10

20 30 –log10 (padj)

* * * * * * * * * * * * * * * * * * 10

20 30 –log10 (padj)

* * * * * * * * * * * * * * 0

* *

0

* * *

40

C

extracellular matrix (n= 171) proteinaceous extracellular matrix (n= 147) extracellular matrix component (n= 56) anchored component of membrane (n= 47) basement membrane (n= 36) collagen trimer (n= 32) cell-cell junction (n= 91) vesicle lumen (n= 31) actin filament bundle (n= 24) cytoplasmic membrane-bounded vesicle lumen (n= 30) Golgi lumen (n= 28) interstitial matrix (n= 10) contractile fiber (n= 56) anchoring junction (n= 115) Z disc (n= 35) myofibril (n= 53) I band (n= 38) contractile fiber part (n= 52) postsynapse (n= 80) adherens junction (n= 112)

* * *

40

5

10 15 20 –log10 (padj)

25

D

glycosaminoglycan binding (n= 81) heparin binding (n= 64) sulfur compound binding (n= 78) extracellular matrix binding (n= 26) growth factor binding (n= 46) collagen binding (n= 29) extracellular matrix structural constituent (n= 27) cell adhesion molecule binding (n= 56) cytokine activity (n= 49) organic acid binding (n= 51) growth factor activity (n= 43) G-protein coupled receptor binding (n= 59) carboxylic acid binding (n= 50) carbohydrate binding (n= 67) insulin-like growth factor binding (n= 15) metallopeptidase activity (n= 51) metalloendopeptidase activity (n= 34) integrin binding (n= 35) cytokine receptor binding (n= 58) cytokine binding (n= 29)

30

* * * * * * * * * * * * * * * * * * * * 0

5

10 15 –log10 (padj)

20

Figure 4. Significant enriched Gene Ontology (GO) terms between mesenchymal stem cells (MSCs) and induced endothelial cells (ECs) based on their functions. (A) The top 20 GO terms in the enrichment analysis. (B) The top 20 biological process (BP) terms in the enrichment analysis. (C) The top 20 cellular component (CC) terms in the enrichment analysis. (D) The top 20 molecular function (MF) terms in the enrichment analysis. *Significant enriched GO terms can be found in induced ECs based on their functions compared with MSCs.

addition, the extracellular matrix can interact with adhesion receptors on the cell membrane to regulate cytoskeletal assembly and affect the cell morphological structure.18 Different types of cells have different cytoskeletal assembly and produce a different extracellular matrix, resulting in different morphological structures.19 In the experiment, the undifferentiated MSCs that were observed mainly had a long spindle shaped structure, and the induced ECs showed a short spindle shaped structure, suggesting a change of extracellular matrix and cytoskeleton. KEGG pathway analysis of the DEGs highlighted the extracellular matrixe receptor interaction and cytokineereceptor interaction pathway. The process of endothelial differentiation from MSCs may be triggered by the activation of cytokine and extracellular matrix receptors.20,21 Cytokines such as VEGF, bFGF, EGF and IGF in the inducing medium bind to specific cell surface receptors to activate the endothelial differentiation and promote angiogenesis. These findings indicate significant function for extracellular matrix and cytokines in endothelial differentiation and may be helpful to improve the yield of induced ECs. Cellular therapy is hopeful in terms of therapeutic angiogenesis. Promotion of collateral vessel formation seems to be a promising alternative for

treatment of CLTI. The intramuscular route can be employed to deliver induced ECs to the ischaemic lower extremities. Additionally, gene over expression vectors can be constructed in ECs to promote the synthesis of some extracellular matrix and cytokines, which could form an extracellular microenvironment conducive to angiogenesis. The TGF-b signalling pathway has multiple biological functions and can participate in the regulation of cell proliferation, differentiation, migration and apoptosis.22 It can stimulate the secretion of various cytokines, inflammatory mediators and other active substances affecting the synthesis and degradation of extracellular matrix.23 Smad protein is an important molecule in the TGF-b receptor superfamily for signal transduction and regulation.24 When the TGF-b pathway is activated, Smad protein in the cytoplasm can be phosphorylated and bind to transcription factors to regulate related signal transduction.25 Through KEGG pathway analysis, it was found that the TGF-b signalling pathway was significantly enriched in the differentiation of MSCs into ECs. However, all genes associated with the TGF-b pathway were significantly downregulated, indicating that the TGF-b signalling pathway was significantly inhibited during endothelial differentiation. TGF-b signalling

Please cite this article as: Wang C et al., RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells, European Journal of Vascular and Endovascular Surgery, https://doi.org/10.1016/j.ejvs.2019.11.003

8

Chengen Wang et al.

*

ECM-receptor interaction (n= 38) Cytokine-cytokine receptor interaction (n= 66) Focal adhesion (n= 61) TGF-beta signalling pathway (n= 30) Dilated cardiomypathy (n= 28) Amoebiasis (n= 34) Hypertrophic cardiomyopathy (HCM) (n= 26) Cell adhesion molecules (CAMs) (n= 39) Malaria (n= 19) Arrhythmogenic right ventricular ... (n= 23) Axon guidance (n= 36) DNA replication (n= 15) Vascular smooth muscle contraction (n= 30) Haematopoietic cell lineage (n= 24) Arginine and proline metabolism (n= 17) Complement and coagulation cascades (n= 18) Pathways in cancer (n= 69) Neuroactive ligand-receptor interaction (n= 43) Ribosome biogenesis in eukaryotes (n= 21) Nitrogen metobolism (n= 8)

* * * * * * * * * * * * * * *

0

1

2

3 4 –log10(padj)

5

6

7

Figure 5. The top 20 enriched Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway terms of differentially expressed genes (DEGs). *Significantly enriched KEGG pathway terms can be found in induced endothelial cells (ECs) compared with mesenchymal stem cells (MSCs). DNA, deoxyribonucleic acid; ECM ¼ extracellular matrix; TGF ¼ transforming growth factor.

pathway blockage may provide a novel and effective method to promote induced ECs. ECs play a significant role in neovascularisation, and thus provide an auxiliary treatment for PAD. Such a hypothesis can be validated by experiments in the future. TGF-b specific inhibitors such as Galunisertib (LY2157299) and LY 3200882 can be added to the inducing medium to examine whether more ECs can be derived from MSCs. In addition, administration of the TGF-b inhibitors in the clinical process of cell therapy with induced ECs for PAD can be explored further if promising results are yielded for induced ECs. In this study, after 14 days of exposure to inducing medium, 55.8% of cells showed positive expression of CD31, suggesting the proportion of ECs is about 55.8%. Pure ECs were not sorted from these cells for several reasons: (i) there was no evidence to show that the CD31 negative cells in the inducing medium did change in gene expression; (ii) an unbiased gene expression during differentiation was desired; (iii) to avoid other uncertainties introduced in the sorting process, such as uncertain stimuli which may cause gene expression change, which may affect the experimental results. Furthermore, RNA-Seq is not free of biases, differences in fragment size, transcript length and differences in GC content can affect the results.26 To confirm the results of RNA-Seq in this study, 11 novel genes for endothelial differentiation with more than 10 fold change were validated by qRT-PCR. It provided a great target list for investigating the molecular mechanism underlying endothelial differentiation expressed genes in the future. Initial strides have been taken in better understanding the potential molecular mechanism of endothelial differentiation based on RNA-Seq analysis. Eleven novel genes were identified as potential targets of endothelial

differentiation and angiogenesis. Extracellular matrix and cytokineereceptor pathways were significantly enriched in the DEGs, highlighting their function involved in the endothelial differentiation. A significant inhibition of the TGF-b signalling pathway was observed. These findings indicate that the activator of the selected genes and the inhibitor of the TGF-b signalling pathway could be used to promote induced ECs in vitro. In the context of PAD treatment, the findings hold the promise of a cell based therapeutic strategy. Future studies will focus on the validation of these hypotheses using cellular and animal models for pre-clinical trials. CONCLUSION Using RNA-Seq, significant DEGs related to endothelial differentiation were identified. The GO and KEGG functional enrichment analyses of the DEGs revealed that the extracellular matrix, cytokines and the TGF-b pathway play an important role in the process of endothelial differentiation. The TGF-b pathway was significantly inhibited. Furthermore, 11 novel genes were found that may be involved in the differentiation of MSCs into ECs. These findings enhance current understanding of the differentiation mechanism, and provide a target list and hypothesis to guide future studies. CONFLICT OF INTEREST None. FUNDING This work was supported financially by the National Natural Science Foundation of China (No.81970410); Clinical

Please cite this article as: Wang C et al., RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells, European Journal of Vascular and Endovascular Surgery, https://doi.org/10.1016/j.ejvs.2019.11.003

Transcriptome Analysis for ECs Differentiation

Medicine Plus X- Young Scholars Project of Peking University; The Fundamental Research Funds for the Central Universities and Interdisciplinary Clinical Research Project of Peking University First Hospital. REFERENCES 1 Stoner MC, Calligaro KD, Chaer RA, Dietzek AM, Farber A, Guzman RJ, et al. Reporting standards of the Society for Vascular Surgery for endovascular treatment of chronic lower extremity peripheral artery disease. J Vasc Surg 2016;64:e1e21. 2 Samura M, Hosoyama T, Takeuchi Y, Ueno K, Morikage N, Hamano K. Therapeutic strategies for cell-based neovascularization in critical limb ischemia. J Transl Med 2017;15:49. 3 Benoit E, O’Donnell TJ, Iafrati MD, Asher E, Bandyk DF, Hallett JW, et al. The role of amputation as an outcome measure in cellular therapy for critical limb ischemia: implications for clinical trial design. J Transl Med 2011;9:165. 4 Das AK, Bin AB, Dhillon SS, Vijanari A, Anoop CH, Gupta PK. Intra-arterial allogeneic mesenchymal stem cells for critical limb ischemia are safe and efficacious: report of a phase I study. World J Surg 2013;37:915e22. 5 Li M, Yu J, Li Y, Li D, Yan D, Ruan Q. CXCR4þ progenitors derived from bone mesenchymal stem cells differentiate into endothelial cells capable of vascular repair after arterial injury. Cell Reprogram 2010;12:405e15. 6 Ning H, Liu G, Lin G, Yang R, Lue TF, Lin CS. Fibroblast growth factor 2 promotes endothelial differentiation of adipose tissuederived stem cells. J Sex Med 2009;6:967e79. 7 Kilian KA, Bugarija B, Lahn BT, Mrksich M. Geometric cues for directing the differentiation of mesenchymal stem cells. Proc Natl Acad Sci U S A 2010;107:4872e7. 8 Wang C, Li Y, Yang M, Zou Y, Liu H, Liang Z, et al. Efficient differentiation of bone marrow mesenchymal stem cells into endothelial cells in vitro. Eur J Vasc Endovasc Surg 2018;55:257e65. 9 Robinson MD, McCarthy DJ, EdgeR Smyth GK. A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010;26:139e40. 10 Steward AJ, Kelly DJ. Mechanical regulation of mesenchymal stem cell differentiation. J Anat 2015;227:717e31. 11 Dado D, Sagi M, Levenberg S, Zemel A. Mechanical control of stem cell differentiation. Regen Med 2012;7:101e16. 12 Kyttala A, Moraghebi R, Valensisi C, Kettunen J, Andrus C, Pasumarthy KK, et al. Genetic variability overrides the impact of parental cell type and determines iPSC differentiation potential. Stem Cell Rep 2016;6:200e12.

9 13 Park ST, Kim J. Trends in Next-Generation sequencing and a new era for whole genome sequencing. Int Neurourol J 2016;20:S76e 83. 14 Kolodziejczyk AA, Kim JK, Svensson V, Marioni JC, Teichmann SA. The technology and biology of single-cell RNA sequencing. Mol Cell 2015;58:610e20. 15 Yue B. Biology of the extracellular matrix: an overview. J Glaucoma 2014;23:S20e3. 16 Rozario T, DeSimone DW. The extracellular matrix in development and morphogenesis: a dynamic view. Dev Biol 2010;341: 126e40. 17 Hakkinen KM, Harunaga JS, Doyle AD, Yamada KM. Direct comparisons of the morphology, migration, cell adhesions, and actin cytoskeleton of fibroblasts in four different threedimensional extracellular matrices. Tissue Eng A 2011;17: 713e24. 18 Koch D, Rosoff WJ, Jiang J, Geller HM, Urbach JS. Strength in the periphery: growth cone biomechanics and substrate rigidity response in peripheral and central nervous system neurons. Biophys J 2012;102:452e60. 19 Bonnans C, Chou J, Werb Z. Remodelling the extracellular matrix in development and disease. Nat Rev Mol Cell Biol 2014;15:786e 801. 20 Halper J, Kjaer M. Basic components of connective tissues and extracellular matrix: elastin, fibrillin, fibulins, fibrinogen, fibronectin, laminin, tenascins and thrombospondins. Adv Exp Med Biol 2014;802:31e47. 21 Wang CH, Wang TM, Young TH, Lai YK, Yen ML. The critical role of ECM proteins within the human MSC niche in endothelial differentiation. Biomaterials 2013;34:4223e34. 22 Imamura T, Hikita A, Inoue Y. The roles of TGF-beta signaling in carcinogenesis and breast cancer metastasis. Breast Cancer-Tokyo 2012;19:118e24. 23 Wang Y, Liu J, Chen J, Feng T, Guo Q. MiR-29 mediates TGFbeta 1-induced extracellular matrix synthesis through activation of Wnt/beta -catenin pathway in human pulmonary fibroblasts. Technol Health Care 2015;23:S119e25. 24 Moustakas A, Souchelnytskyi S, Heldin CH. Smad regulation in TGF-beta signal transduction. J Cell Sci 2001;114:4359e69. 25 Kamato D, Burch ML, Piva TJ, Rezaei HB, Rostam MA, Xu S, et al. Transforming growth factor-beta signalling: role and consequences of Smad linker region phosphorylation. Cell Signal 2013;25:2017e24. 26 Roberts A, Trapnell C, Donaghey J, Rinn JL, Pachter L. Improving RNA-Seq expression estimates by correcting for fragment bias. Genome Biol 2011;12:R22.

Please cite this article as: Wang C et al., RNA-Seq Based Transcriptome Analysis of Endothelial Differentiation of Bone Marrow Mesenchymal Stem Cells, European Journal of Vascular and Endovascular Surgery, https://doi.org/10.1016/j.ejvs.2019.11.003