- Email: [email protected]
RNF185 modulates JWA ubiquitination and promotes gastric cancer metastasis
Accepted Manuscript RNF185 modulates JWA ubiquitination and promotes gastric cancer metastasis
Danping Qiu, Qiang Wang, Zhangding Wang, Junjie Chen, Donglin Yan, Yan Zhou, Aiping Li, Ruiwen Zhang, Shouyu Wang, Jianwei Zhou PII: DOI: Reference:
S0925-4439(18)30070-X doi:10.1016/j.bbadis.2018.02.013 BBADIS 65061
To appear in: Received date: Revised date: Accepted date:
10 October 2017 24 January 2018 19 February 2018
Please cite this article as: Danping Qiu, Qiang Wang, Zhangding Wang, Junjie Chen, Donglin Yan, Yan Zhou, Aiping Li, Ruiwen Zhang, Shouyu Wang, Jianwei Zhou , RNF185 modulates JWA ubiquitination and promotes gastric cancer metastasis. The address for the corresponding author was captured as affiliation for all authors. Please check if appropriate. Bbadis(2018), doi:10.1016/j.bbadis.2018.02.013
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT RNF185 modulates JWA ubiquitination and promotes gastric cancer metastasis Danping Qiua,b,1, Qiang Wanga,b,1, Zhangding Wanga,b,1, Junjie Chena,b, Donglin Yana,b, Yan Zhouc, Aiping Lia,b, Ruiwen Zhangd, Shouyu Wanga,b*, Jianwei Zhoua,b,* a
Department of Molecular Cell Biology and Toxicology, Key Laboratory of Modern
University, Nanjing 211166, People’s Republic of China b
PT
Toxicology of Ministry of Education, School of Public Health, Nanjing Medical
RI
Jiangsu Key Lab of Cancer Biomarkers, Prevention and Treatment, School of Public
SC
Health, Nanjing Medical University, Nanjing 211166, People’s Republic of China c
Department of Oncology, Yixing People’s Hospital, Yixing, People’s Republic of China Department of Pharmaceutical Sciences, School of Pharmacy, Texas Tech University
NU
d
Health Sciences Center, Amarillo, TX 79106, USA
These authors have contributed equally to this work
MA
1
*Correspondence to: Jianwei Zhou, e-mail: [email protected]; Shouyu Wang,
AC
CE
PT E
D
e-mail: [email protected]
1
ACCEPTED MANUSCRIPT Abstract Gastric cancer (GC) is one of the most common malignant cancers worldwide. Metastasis leads to poor prognoses in GC patients in advanced stages. Our previous studies have demonstrated that JWA functions as a tumour suppressor and that low expression of JWA in GC tissues is significantly correlated with shorter overall
PT
survival (OS) as well as with advanced clinicopathologic features in patients. However, the mechanism of dysregulation of JWA in cancers is not clear. In the
RI
present study, we found that an E3 ubiquitin ligase, RNF185, directly interacted with JWA and promoted its ubiquitination at the K158 site, resulting in subsequent
SC
degradation. Moreover, the protein level of RNF185 was negatively correlated with JWA in tumour tissues from GC patients. High RNF185 expression was significantly
NU
correlated with shorter OS. Additionally, increased RNF185 expression facilitated GC cell migration in vitro and promoted GC metastasis in vivo by downregulating JWA
MA
expression. However, this effect was reversed by replenishment of JWA. In conclusion, our findings highlight the following: (1) RNF185 promotes GC metastasis
D
by mediating JWA degradation via a ubiquitin-proteasome pathway; (2) the K158 site
PT E
of JWA is essential for its ubiquitination in GC cells. These findings suggest that RNF185 is a novel candidate prognostic marker and potential therapeutic target for GC.
AC
CE
Keyword: gastric cancer, metastasis, RNF185, JWA, ubiquitination
2
ACCEPTED MANUSCRIPT 1. Introduction Gastric cancer (GC) is the fifth most common malignant neoplasm and the third leading cause of the cancer death worldwide [1]. Metastasis is one of the leading causes of cancer-related death, including in GC [2], yet this complex process remains the least understood aspect of cancer biology [3]. Furthermore, current conventional
PT
treatments for cancer, such as surgery, radiotherapy, and chemotherapy, are thoroughly incapable of preventing GC recurrence and metastasis [4]. Therefore,
RI
identification of novel successful therapeutic targets and strategies to prevent GC metastasis is urgently needed.
SC
JWA, also known as ARL6IP5, is involved in cellular responses to that protect normal cells from DNA damage [5, 6]. Our previous studies demonstrated that
NU
decreased expressions of JWA occurs in many tumours compared with paired normal mucosa including melanomas, liver cancers and GCs. Furthermore, patients with
MA
lower expressions of JWA in the tumour tissues have worse survivals [7-9]. In a GC study, JWA was found to suppress tumour angiogenesis via Sp1-activated matrix
D
metalloproteinase-2 (MMP-2) in GC cells [10]. In HER2-positive GC cells, JWA was
PT E
found to inhibit cell migration by mediating MEK/ERK/PEA3 signalling [11]. Generally, previous studies have demonstrated that JWA is a tumour suppressor in GC. However, the cause of the reduction in JWA in GC cells has not yet been explored.
CE
The ubiquitin-proteasome pathway is responsible for the degradation of most of the protein in mammalian cells [12]. Ubiquitination is performed by a sophisticated
AC
three step enzymatic cascade, involving ubiquitin activating enzymes E1, ubiquitin conjugating enzyme E2, and ubiquitin ligase E3 [13, 14]. The human genome encodes approximately 300 members of the RING family of E3 ligases [15]. E3 ubiquitin ligases specifically target proteins for clearance, and their significance to normal cellular function is reflected in many diseases associated with their loss of function or impropriety targeting [16]. Previous studies have demonstrated that ubiquitination is closely related to cancer metastasis, including GC [17-20]. Several studies have shown that E3 ligases function as oncoproteins in cancer, including MDM2 [21] and TRAF6 [22]. Excitingly, their corresponding inhibitors Nutlin-3 [23] and 3
ACCEPTED MANUSCRIPT Epigallocatechin-3-gallate (EGCG) [24] have also been identified and applied in preclinical studies. Therefore, targeting the ubiquitin-proteasome pathways provides a new strategy for anti-cancer therapy. In the present study, we demonstrate that JWA can be degraded by E3 ubiquitin ligase RNF185 via the ubiquitin-proteasome pathway in GC cells. Moreover, RNF185
PT
targets JWA ubiquitination at the K158 site and its subsequent degradation. Furthermore, RNF185 plays an oncogenic role in promoting GC metastasis in vitro
RI
and in vivo.
SC
2. Materials and Methods 2.1 Cell lines and culture condition
NU
The AGS and NCI-N87 GC cell lines were purchased from the American Type Culture Collection (USA) and the HGC27, SGC7901, BGC823, MGC803, and GES-1
MA
cell lines were from Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). We obtained the BGC823/DDP, SGC7901/DDP lines as described
D
previously [25]. The SGC7901, HGC27, NCI-N87, BGC823/DDP, SGC7901/DDP
PT E
and GES-1 cells were cultured in RPMI-1640 medium. The MGC803 cells were cultured in DMEM medium, the AGS cells were cultured in F12K medium. All the cell lines were supplemented with 100 μg/ml streptomycin, 100 U/ml penicillin and
CE
10% foetal bovine serum (FBS). Cycloheximide (CHX) (Sigma-Aldrich, St Louis, MO, USA) and MG132 (Selleck Chemicals, USA) were used at the indicated
AC
concentrations.
2.2 Patients and specimens The retrospective GC cohort was studied, and details were provided in our previous study [9]. In brief, the cohort included 103 patients who underwent radical gastrectomy were recruited from Nantong Cancer Hospital (Nantong, Jiangsu, China), from May 1, 1990 to the June 1, 1995. The TMA of GC cohorts were constructed by the GC samples. Due to missing data, samples lost during antigen retrieval and those with no tumour cells present in the core, ultimately resulted in samples from 99 GC 4
ACCEPTED MANUSCRIPT patients who were used to evaluate the RNF185 and JWA expressions. In addition, 22 pathologically confirmed GC tissues from recent patients from the People’s Hospital (Yixing, Jiangsu, China) were obtained for western blot analysis after signed informed consent. Institutional approval was obtained from the Review Board of the respective
PT
institutions prior to this study.
2.3 Plasmids and siRNA transfection and lentiviral transduction
RI
The Flag-JWA plasmid and corresponding mutants were subcloned into a pcDNA3.1 vector (Zoonbio biotechnology, Nanjing, China) using HindIII/BamHI
SC
sites. The RNF185 cDNA were inserted into a pPM-C-HA vector (abm, Richmond, BC, Canada) using the NheI and XhoI sites. All of the plasmids were transfected into
NU
cells with Lipofectamine 3000 (Invitrogen, Grand Island, NY, USA). The siRNA sequences used for the JWA were (5'-CGAGCUAUUUCCUUAUCUC-3'), RNF185
MA
(#1: 5'-GUGGCUUCCAGAUGUCUUU-3'; #2: 5'-GCCACAGCAUUUAAUAUAA -3'; #3: 5'-CACGCCUC UUCCUAUUUGU-3'), CHIP (5'-AGGCCAAGCACGACAA
D
GUA-3'), and a nonspecific control siRNA were synthesized by Ribobio (Guangzhou,
PT E
China). The siRNA was transfected into the cells by DharmaFECT4 (Dharmacon, Chicago, IL). The lentivirus vector (GV358) containing RNF185 ORF (LV-RNF185) and the nontargeted control (LV-NC) with Flag tag were generated by Genechem
CE
(Shanghai, China), which were added to BGC823 cells. Twenty-four hours later, the
AC
infected cells were selected with 1 μg/ml Puromycin (Gibco).
2.4 Western blot assay Western blot assays were performed according to details previously reported [26]. The following antibodies were used: anti-β-actin;
anti-α-tubulin;
anti-GAPDH;
anti-HA (1:1000, Beyotime, Jiangsu, China); monoclonal anti-Flag; anti-His (1:2000, MBL, Japan); anti-JWA (1:500, AbMax, Beijing, China); monoclonal anti-Ub (1:500, Santa Cruz, Dallas, TX, USA); monoclonal anti-RNF185 and anti-CHIP (1:1000, Abcam, USA). 5
ACCEPTED MANUSCRIPT 2.5 Quantitative RT-PCR Total RNA was extracted from the cells using the Trizol reagent (Gibco BRL, Gaithersburg, MD, USA), 500 ng of RNA was used for the reverse transcription reaction with HiScript Q RT SuperMix for qPCR (Vazyme, Jiangsu, China). The complementary DNA (cDNA) was amplified with the following primers: 5′-GGAGGAGTCATTGTGGTGC-3′ (forward) and 5′-GAAGTCTCAGGGATGCG
PT
TG-3′ (reverse) for JWA; 5′- CTGTCACGCCTCTTCCTATTTGT-3′ (forward) and 5′-
RI
GCCCAGCATTAGGCAATCAG-3′ (reverse) for RNF185; 5′-CATGTGGGCCATG AGGTCCACCAC-3′ (forward) and 5′- GGGAAGCTCACTGGCATGGCCTTCC -3′
SC
(reverse) for GAPDH. Quantitative RT-PCR was carried out with SYBR Green PCR Master Mix (TaKaRa Bio, Japan) using an ABI Prism 7900 Sequence detection
NU
system (Applied Biosystems, Canada). GAPDH was used as an internal control, and
2.6 Immunofluorescence assay
MA
the results for each sample were normalized to GAPDH expression.
D
RFP-JWA and HA-RNF185 plasmids were transfected into the GC cells for 48 h,
PT E
followed by washing with PBS 3 times, and then the cells were fixed with methanol for 30 min at room temperature. Next, the fixed cells were washed in PBST (PBS supplemented with 0.5% Tween-20) and incubated with the blocking solution (0.1%
CE
Saponin and 0.2% BSA in PBS, pH 7.4) for 1 h. Then, the cells were incubated with anti-HA-mouse monoclonal antibody (1:200, Beyotime, Jiangsu, China) overnight at
AC
4°C. The cell dishes were washed with PBST, and incubated with FITC green-conjugated anti-mouse IgG secondary antibody (1:100, Beyotime, Jiangsu, China) for 1 h. After washing with PBST, the nuclei were counterstained with DAPI (Beyotime, Jiangsu, China) for 20 min. The confocal images of the cells were captured with Zeiss AIM software on a Zeiss LSM 700 confocal microscope system (Carl Zeiss Jena, Oberkochen, Germany).
2.7 Immunoprecipitation assay The cells were washed with PBS twice, then pre-cooling immunoprecipitation 6
ACCEPTED MANUSCRIPT (IP) buffer was added and incubated at 4°C for 30 min. Next, the cells were scraped down from the dish with a cell scratcher and centrifuged at 12,000 g for 15 min at 4°C. The supernatant was immediately transferred to a new centrifugal tube, and then anti-RNF185 antibody, anti-JWA antibody and appropriate control IgG (mouse, rabbit IgG, corresponding to the host species of the primary antibody) were added in 500 µg
PT
total protein and cultured at 4°C. After 1 h, cell lysate was mixed with 20 µl of resuspended volume of protein A/G Plus-Agarose (Santa Cruz, USA) at 4°C
RI
overnight. Afterwards, precooled IP buffer was used to wash the cells 4 times at 1000 g for 5 min at 4°C. The immunoprecipitate was then collected by centrifugation and
SC
analysed by SDS-PAGE.
NU
2.8 Wound-healing assays
Transfected cells were grown to confluence in a 12-well plate (Corning, USA).
MA
Next, the cells were cultured in RPMI-1640 or DMEM with 1% FBS for 12 h. The confluent monolayer was then disrupted with a cell scraper, and filmed at the
D
indicated hours via fluorescent microscopy (IX70, Olympus, Japan) with a 10×
PT E
objective. The rate of wound closure was calculated as the ratio of the average distance between the two wound edges and the total cell duration of migration. The
recorded.
CE
experiments were performed in triplicate, and three random fields of each well were
AC
2.9 Transwell migration assays Transwell migration assays were performed in 24-well plates (Corning, USA), using a 6.5-mm diameter transwell with a 8-μm pore polycarbonate membrane insert (Corning, USA). The cells, in 0.1 ml serum-free medium, were placed on the upper layer of the cell-permeable membrane, and 0.6 ml culture medium containing 10% FBS was placed in the lower chamber. After 12 h of incubation, the migrated cells were fixed with methanol and stained with Crystal Violet Staining Solution (Beyotime, Jiangsu, China) and then photographed. 7
ACCEPTED MANUSCRIPT 2.10 Ubiquitination assay Co-transfected plasmids or siRNAs were transfected into GC cells for 48 h, then the cells were treated with MG132 (10 µM) for another 6 h, and then the cells were harvested for protein samples and divided into two parts. One part was used for western blot, the remaining protein (500 ug) had anti-JWA antibody or anti-Flag
PT
antibody (1:1000, Beyotime, Jiangsu, China) added and was cultured in 4°C for 1 h, and then Protein A/G Plus-Agarose was added overnight. Afterwards, pre-cooling IP
RI
buffer was used to wash four times at 1000 g for 5 min at 4°C, and the immunoprecipitate was collected by centrifugation and then eluted and examined by
SC
western blot.
NU
2.11 Immunohistochemistry
Immunohistochemistry (IHC) was performed according to standard procedures
MA
as described previously [9]. The prepared slides were incubated with antibodies against the polyclonal rabbit anti-JWA antibody (1:200; Research Genetics Inc.) and
PT E
D
monoclonal mouse anti-RNF185 antibody (1:100; SAB, USA).
2.12 TMA construction and assessment of IHC The construction of the GC TMAs was performed with standard procedures, and
CE
the assessment of the IHC employed a semiquantitative immunoreactivity score (IRS) as reported elsewhere [9, 27]. Category A documented the intensity of
AC
immunostaining as 0-3 (0, negative; 1, weak; 2, moderate; 3, strong; Fig. S2E-H). Category B documented the percentage of immunoreactive cells as 1 (0%-25%), 2 (26%-50%), 3 (51%-75%), and 4 (76%-100%). Multiplication of category A and B resulted in an IRS ranging from 0 to 12 for each tumour. The concordance for the IRS of the RNF185 and JWA staining scores between the two pathologists was 91 (92%) in 99 tumours of the TMA cohort, and the few discrepancies were resolved by consensus using a multihead microscope. The optimum value of cutoff points of the RNF185 or JWA IRS in this study were both 4 because the predictive value of this cutoff point for death was the best in the GC cohorts as reported previously [9]. Under 8
ACCEPTED MANUSCRIPT these conditions, the samples with IRS scores 0-4 and IRS 5-12 were classified as low and high expressions of RNF185 or JWA, respectively.
2.13 In vivo metastasis assay Six-week-old BALB/c nude mice were obtained from Model Animal Research
PT
Center of Nanjing University (Nanjing, China). The study was approved by the Animal Care Committee of Nanjing Medical University. The BALB/c nude mice were
RI
randomly divided into two groups consisting of 8 mice each. RNF185 overexpressing and control BGC823 cells were suspended in PBS. The mice were injected
SC
intravenously with 2 × 106 cells in 0.1 ml of PBS through tail vein. After 40 days, the mice were killed, and the lung metastatic nodules were taken for fixation in 4%
NU
paraformaldehyde or frozen in -80°C freezer, and for further analysis. The number of metastatic foci and the area of lung metastases were examined by histological
MA
examination of the indicated lung tissue sections, which were previously employed
PT E
2.14 Statistics analysis
D
[28].
The data are expressed as the means ± S.D. Comparisons of means among multiple groups were analysed by one-way analysis of variance (ANOVA), and the
CE
Dunnett’s t-test were used to assess differences within two groups. The correlations of the expressions of JWA and RNF185 were established by Pearson’s correlation
AC
analysis. The probability of differences in OS as a function of time were ascertained by use of the Kaplan-Meier method, with a log-rank test probe for significance. P-values < 0.05 were considered to be statistically significant, and all statistical analyses were performed with SPSS 16.0.
3. Results 3.1 JWA is degraded via ubiquitin-proteasome pathway in GC cells We previously found that the JWA protein levels were significantly downregulated in GC lesions compared with adjacent noncancerous tissues [9]. To 9
ACCEPTED MANUSCRIPT elucidate the reason why the JWA protein level was reduced in tumour tissues, we first determined whether it was regulated by ubiquitination-mediated degradation. As shown in Figure 1A and B, the endogenous JWA protein level was decreased after exposure to cycloheximide (CHX), an inhibitor of protein synthesis, in two GC cell lines, BGC823 and SGC7901. Moreover, when the cells were treated with MG132, a
PT
protease inhibitor, the degradation of JWA was prevented (Fig. 1C). To confirm this, we externally transfected Flag-JWA expressing plasmid into BGC823 and SGC7901
RI
cells, and observed that the exogenous expression of JWA also could be degraded by CHX treatment (Fig. 1D and E) and demonstrated more stability in cells with MG132
NU
through the ubiquitin-proteasome pathway.
SC
treatment (Fig. 1F). These results indicated that JWA stability could be modulated
3.2 JWA interacts with RNF185 in GC cells
MA
First, JWA interacted with the predicted proteins (http://www.genecards.org/) (Fig. S1A). Among these proteins, XRCC1 was demonstrated to interact with JWA in
D
our previous study [6]. Interestingly, we found RNF185, an E3 ubiquitin ligase,
PT E
potentially interacted with JWA (Fig. S1A). Furthermore, a physical interaction between RNF185 and JWA was defined by IP in endogenous settings in BGC823 and HGC27 cells (Fig. 2A and B). Additionally, we performed immunofluorescence to
CE
examine the localization of RNF185 and JWA in cells (Fig. 2C), and we demonstrated
AC
that mostly co-localized in the cytoplasm of BGC823 cells.
3.3 RNF185 negatively regulates JWA protein levels in GC cells We then investigated whether RNF185 exerts its E3 ligase effect on JWA protein stability. We demonstrated that JWA expression was decreased in RNF185 overexpressing BGC823 or SGC7901 cells and increased in RNF185 knockdown HGC27 cells compared with the corresponding control cells (Figs. 3A and S2A). Additionally, we found that the knockdown of CHIP, another E3 ubiquitin ligase, functions as a suppressor in GC cells in our previous study [19], and yet did not affect JWA expression (Fig. S2B). In contrast, the JWA mRNA level was not affected by 10
ACCEPTED MANUSCRIPT RNA185 overexpression or knockdown (Fig. 3B). Furthermore, the RNF185 protein level was not regulated by knock down of JWA in GC cells (Fig. S2C). Next, the association of RNF185 and JWA expression was determined in the GC cells. It was shown that the JWA protein level was inversely correlated with the RNF185 protein level in the 9 gastric cell lines (R = -0.67, p < 0.05; Fig. 3C and D)
PT
and in the 22 primary tumours from the GC patients (R = -0.42, p < 0.05; Fig. 3E and F).
RI
Additionally, the association of the RNF185 mRNA levels and the OS of GC patients was assessed using a public database (http://kmplot.com/analysis/), which
SC
demonstrated that high RNF185 expression was associated with a poor OS of the GC patients. (Fig. S2D). We further constructed Kaplan-Meier survival curves to study
NU
whether the RNF185 protein level was correlated with the OS of the GC patients. Our data revealed that the patients with high RNF185 expression had poor OS (N = 99,
MA
log-rank test, p < 0.01; Fig. 3G). When combining the RNF185 and JWA together as a new variable, the patients were divided into the 3 following groups: high RNF185 and
D
low JWA; low RNF185 and high JWA; and others. This grouping revealed that the
PT E
patients with high RNF185 and low JWA had a worse outcomes in terms of survival (log-rank test, p < 0.001; Fig. 3H).
CE
3.4 RNF185 promotes JWA ubiquitination for degradation by the proteasome We therefore postulated that RNF185 may promote JWA destabilization. When
AC
the cells were treated with CHX, degradation of JWA was promoted by overexpression of RNF185 (Figs. 4A and B; S3A and B), in contrast, it was suppressed by RNF185 knockdown (Figs. 4C and D; S3C and D). It was also shown that loss of JWA expression in RNF185 overexpressing cells was partly inhibited by pretreatment with MG132 (Fig. 4E). Moreover, ubiquitinated JWA was increased due to MG132 inhibiting its degradation, and RNF185 overexpression further strengthened the ubiquitination of JWA (Fig. 4E), while RNF185 knockdown obviously weakened the ubiquitination of JWA (Fig. 4F). These 11
ACCEPTED MANUSCRIPT data indicated that RNF185 functioned as an E3 ubiquitin ligase to mediate JWA degradation by a ubiquitin-proteasome pathway.
3.5 RNF185 promotes GC cell migration via downregulating JWA expression To determine the roles of RNF185 in the migration potential of GC cells, we
PT
performed migration assays. First, expression of RNF185 was examined by western blot in BGC823 and SGC7901 cells with RNF185 overexpression (HA-RNF185) or
RI
HGC27 and MGC803 cells with RNF185 deficiency (si-RNF185 RNAs) (Figs. 5A and S4A). The transwell migration and scratch wound healing assay indicated that the
SC
cell migration was increased in the RNF185-overexpressing BGC823 or SGC7901 cells (Fig. 5B, C, D, E, and F) but was decreased in the RNF185-deficient HGC27 or
promoted the migration of GC cells.
NU
MGC803 cells (Fig. S4B, C, D, E and F). These results suggested that RNF185
MA
To further clarify the role of JWA in RNF185 regulated GC cells migration, we performed rescue assays. RNF185- and JWA-overexpressing plasmids were
D
co-transfected in BGC823 cells, and the protein levels of RNF185 and JWA were
PT E
examined by western blot (Fig. S4G). Transwell migration assays revealed that the increased migration of RNF185-overexpressing GC cells was inhibited by rescuing JWA expression (Fig. 5G and H). Additionally, these results were confirmed in the
CE
scratch wound healing assay (Fig. 5I).
AC
3.6 The K158 site of JWA is required for its ubiquitination in GC cells To explore which amino acids in the JWA protein are required for its ubiquitination
in
GC
cells,
the
potential
sites
were
predicted
(https://www.phosphosite.org/). The four potential lysines (K31, K151, K158 and K185) in the JWA protein were selected and mutated to arginine (Fig. S5A). JWA wild-type expressing plasmid (WT) and its mutants were then transfected into HGC27 cells with or without treatment of CHX. It was shown that JWA (K158R) and JWA (ALL) (all 4 sites mutated) mutants, but not the other 3 mutants, were resistant to CHX-induced degradation (Fig. 6A). Furthermore, the JWA (WT) and JWA (K158R) 12
ACCEPTED MANUSCRIPT mutant were transfected into BGC823 cells treated with CHX, the half-life curve showed that the JWA (K158R) mutant was more stable than the JWA (WT) in cells (Fig. 6B and C). Moreover, similar results were confirmed in the SGC7901 cells (Fig. 6D and E). Next, the ubiquitination of Flag-JWA was examined, we found it was attenuated for the JWA (K158R) mutant compared with that for JWA (WT) (Fig. 6F).
PT
A transwell migration assay showed that the cell migration was more inhibited in HGC27 cells with the overexpression of the JWA (K158R) mutant than that of its
RI
wild-type (Figs. 6G, H and S5B). Additionally, we further confirmed that RNF185 could induced the degradation of the wild-type JWA but not the JWA (K158R) mutant
SC
in BGC823 or SGC7901 cells (Fig. 6I). Moreover, a transwell migration assay also indicated that JWA K158R mutants could inhibit the increase of cell migration
NU
induced by RNF185 overexpression (Fig. 6J). These results showed that the K158 site
MA
of JWA is responsible for its stability and biological function.
3.7 RNF185 promotes GC metastasis via down-regulating JWA expression in vivo
D
To further investigate whether RNF185 overexpression promotes GC metastasis
PT E
in vivo, RNF185 stably overexpressing (LV-RNF185) BGC823 cells and corresponding controls (LV-NC) were constructed (Fig. 7A). Then, these cells were injected into the mice through the tail vein. Forty days after injection, the mice were
CE
killed to examine the tumour formation in the lungs. Extensive tumour formation was found in the RNF185 overexpression group. In contrast, the lungs from the mice
AC
injected with LV-NC cells exhibited much fewer and smaller tumour nodules compared with the LV-RNF185 group (Fig. 7B). Moreover, histological examination of the lung tissue sections revealed the number of metastatic foci and the area of lung metastases were strongly increased in LV-RNF185 mice (Fig. 7C and D). IHC indicated that the JWA expression in the LV-RNF185 group was much lower than that of the LV-NC group (Fig. 7E), which suggests that RNF185 promoted GC metastasis through downregulation of JWA expression in vivo.
4. Discussion 13
ACCEPTED MANUSCRIPT The high mortality rates of GC patients are associated with metastatic disease [29, 30]. Unravelling the factors driving this process is thus important for future therapeutic interventions. In this study, we have identified that RNF185, an E3 ubiquitin ligase, mediated JWA ubiquitination at its K158 site and subsequent degradation, which increased cell migration via negative regulation of JWA in human
PT
GC cells. We and other groups have demonstrated that JWA functions as a tumour
RI
suppressor and regulates cancer cell migration, apoptosis and angiogenesis via modulating various downstream signalling pathways, such as mitogen-activated
SC
protein kinase (MAPK) cascades [31], and integrin-linked kinase (ILK) [32] and SP1/MMP2 signalling [10]. However, the upstream molecule or signalling pathway
NU
that modulates JWA expression is not clear, although our previous data have demonstrated that the nuclear transcription factor NF1 can bind to the promoter of the
MA
JWA gene and activate its transcription, which regulates oxidative stress and induces DNA damage [5]. However, previous reports have demonstrated that NF1 mRNA
D
expression is lower in GC tissues than normal tissues [33], which indicates that the
PT E
declining transcription activity of NF1 also contributes to JWA reduction, which requires further investigation. Additionally, the phosphorylation of JWA plays an important role in mediating MAPK activation [31], which suggest that
function.
CE
post-translational modification of JWA protein is critical to execute its biological
AC
The degradation of tumour suppressors, such as p53 and PTEN, that are mediated by ubiquitin-proteasome pathways, are critical driving factors in tumour development and progression [34, 35]. In this study, we found that JWA degradation exists in GC cells, which is consistent to our previous reports that the JWA protein level is decreased in tumour tissues in GC patients [9]. Moreover, the K158 site in JWA was identified for its ubiquitination and degradation. When this site was mutated (K158R), the JWA protein was more stable in cells, and GC cell migration was substantially inhibited (Fig. 6G), which suggests that JWA ubiquitination is responsible for the loss of its expression in GC cells, which might result in GC 14
ACCEPTED MANUSCRIPT progression and poor prognosis. Interestingly, we have identified an E3 ubiquitin ligase, RNF185, that binds to JWA and promotes its ubiquitination. It has been shown that RNF185 can induce the degradation of BNIP1 and Dvl2, which modulates autophagy and osteogenesis, respectively [36, 37]. Additionally, high levels of RNF185 are associated with lymph
PT
node and distant metastasis in patients with renal cell carcinomas [38]. Moreover, RNF185 shares 91% homology with human XRNF185, which regulates cell
RI
migration through promoting paxillin degradation [39]. However, the direct evidence indicating the roles of RNF185 in cancer are lacking. Here, we demonstrated that
SC
RNF185 boosted GC cell migration by downregulating JWA expression. Moreover, the protein level of RNF185 was negatively correlated with that of JWA in both GC
NU
cell lines and primary tumour tissues. Further, the GC patients with high RNF185 and low JWA expression exhibited the worst outcomes. These findings indicate that
MA
RNF185 may be involved in the progression of gastric carcinomas and a large population study with GC is warranted. Additionally, we also found USP9x, a
D
deubiquitinase, was predictively interacted with JWA (Fig. S1). Although it had been
PT E
reported that USP9x is overexpressed in GC [40], the interaction of JWA and USP9x and the balance between JWA ubiquitination and deubiquitination deserved to be investigated.
degradation
CE
In summary, the data presented here demonstrate that RNF185 promotes JWA via
the
ubiquitin-proteasome
pathway,
which
accelerates
GC
AC
cell migration. Based on this study, we propose that RNF185 may serve as a promising therapeutic target for GC and that inhibition of RNF185 may be a novel strategy for metastatic GC patients.
Funding This work was supported in part by the National Natural Science Foundation of China (91229125, 81773383, 81521004, 81520108027, 81673219, 81370078), the 973 project of Ministry of Science and Technology, China (2014CB560705), the Science Foundation for Distinguished Young Scholars of Jiangsu Province 15
ACCEPTED MANUSCRIPT (BK20170047); and the Foundation of Priority Academic Program Development (PAPD).
Conflict of interest statement The authors declare they have no competing financial interests
AC
CE
PT E
D
MA
NU
SC
RI
PT
References [1] J. Ferlay, I. Soerjomataram, R. Dikshit, S. Eser, C. Mathers, M. Rebelo, D.M. Parkin, D. Forman, F. Bray, Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012, Int J Cancer, 136 (2015) E359-386. [2] P.S. Steeg, Targeting metastasis, Nat Rev Cancer, 16 (2016) 201-218. [3] A.W. Lambert, D.R. Pattabiraman, R.A. Weinberg, Emerging Biological Principles of Metastasis, Cell, 168 (2017) 670-691. [4] L. Niu, H.Z. Qin, H.Q. Xi, B. Wei, S.Y. Xia, L. Chen, RNF43 Inhibits Cancer Cell Proliferation and Could be a Potential Prognostic Factor for Human Gastric Carcinoma, Cell Physiol Biochem, 36 (2015) 1835-1846. [5] R. Chen, W. Qiu, Z. Liu, X. Cao, T. Zhu, A. Li, Q. Wei, J. Zhou, Identification of JWA as a novel functional gene responsive to environmental oxidative stress induced by benzo[a]pyrene and hydrogen peroxide, Free radical biology & medicine, 42 (2007) 1704-1714. [6] S. Wang, Z. Gong, R. Chen, Y. Liu, A. Li, G. Li, J. Zhou, JWA regulates XRCC1 and functions as a novel base excision repair protein in oxidative-stress-induced DNA single-strand breaks, Nucleic acids research, 37 (2009) 1936-1950. [7] J. Lu, Y. Tang, Y. Cheng, G. Zhang, A. Yip, M. Martinka, Z. Dong, J. Zhou, G. Li, ING4 regulates JWA in angiogenesis and their prognostic value in melanoma patients, British journal of cancer, 109 (2013) 2842-2852. [8] X. Wu, H. Chen, Q. Gao, J. Bai, X. Wang, J. Zhou, S. Qiu, Y. Xu, Y. Shi, X. Wang, J. Zhou, J. Fan, Downregulation of JWA promotes tumor invasion and predicts poor prognosis in human hepatocellular carcinoma, Molecular carcinogenesis, 53 (2014) 325-336. [9] S. Wang, X. Wu, Y. Chen, J. Zhang, J. Ding, Y. Zhou, S. He, Y. Tan, F. Qiang, J. Bai, J. Zeng, Z. Gong, A. Li, G. Li, O.D. Roe, J. Zhou, Prognostic and predictive role of JWA and XRCC1 expressions in gastric cancer, Clin Cancer Res, 18 (2012) 2987-2996. [10] Y. Chen, Y. Huang, Y. Huang, X. Xia, J. Zhang, Y. Zhou, Y. Tan, S. He, F. Qiang, A. Li, O.D. Re, G. Li, J. Zhou, JWA suppresses tumor angiogenesis via Sp1-activated matrix metalloproteinase-2 and its prognostic significance in human gastric cancer, Carcinogenesis, 35 (2014) 442-451. [11] J. Qian, W. Zhu, K. Wang, L. Ma, J. Xu, T. Xu, O.D. Roe, A. Li, J. Zhou, Y. Shu, JWA loss promotes cell migration and cytoskeletal rearrangement by affecting HER2 expression and identifies a high-risk subgroup of HER2-positive gastric carcinoma 16
ACCEPTED MANUSCRIPT
AC
CE
PT E
D
MA
NU
SC
RI
PT
patients, Oncotarget, 7 (2016) 36865-36884. [12] G.A. Collins, A.L. Goldberg, The Logic of the 26S Proteasome, Cell, 169 (2017) 792-806. [13] C.M. Pickart, Mechanisms underlying ubiquitination, Annu Rev Biochem, 70 (2001) 503-533. [14] B.T. Dye, B.A. Schulman, Structural mechanisms underlying posttranslational modification by ubiquitin-like proteins, Annu Rev Biophys Biomol Struct, 36 (2007) 131-150. [15] R.J. Deshaies, C.A. Joazeiro, RING domain E3 ubiquitin ligases, Annual review of biochemistry, 78 (2009) 399-434. [16] L.E. Pascal, Z. Wang, Virtual drug design: Skp1-Skp2 inhibition targets cancer stem cells, Asian journal of andrology, 15 (2013) 717-718. [17] M. He, Z. Zhou, G. Wu, Q. Chen, Y. Wan, Emerging role of DUBs in tumor metastasis and apoptosis: Therapeutic implication, Pharmacol Ther, (2017). [18] J. Xue, X. Lin, W.T. Chiu, Y.H. Chen, G. Yu, M. Liu, X.H. Feng, R. Sawaya, R.H. Medema, M.C. Hung, S. Huang, Sustained activation of SMAD3/SMAD4 by FOXM1 promotes TGF-beta-dependent cancer metastasis, J Clin Invest, 124 (2014) 564-579. [19] S. Wang, X. Wu, J. Zhang, Y. Chen, J. Xu, X. Xia, S. He, F. Qiang, A. Li, Y. Shu, O.D. Roe, G. Li, J.W. Zhou, CHIP functions as a novel suppressor of tumour angiogenesis with prognostic significance in human gastric cancer, Gut, 62 (2013) 496-508. [20] J.C. Black, J.R. Whetstine, RNF2 E3 or Not to E3: Dual Roles of RNF2 Overexpression in Melanoma, Cancer discovery, 5 (2015) 1241-1243. [21] O. Karni-Schmidt, M. Lokshin, C. Prives, The Roles of MDM2 and MDMX in Cancer, Annual review of pathology, 11 (2016) 617-644. [22] X. Zhang, C.F. Li, L. Zhang, C.Y. Wu, L. Han, G. Jin, A.H. Rezaeian, F. Han, C. Liu, C. Xu, X. Xu, C.Y. Huang, F.J. Tsai, C.H. Tsai, K. Watabe, H.K. Lin, TRAF6 Restricts p53 Mitochondrial Translocation, Apoptosis, and Tumor Suppression, Molecular cell, 64 (2016) 803-814. [23] L.T. Vassilev, B.T. Vu, B. Graves, D. Carvajal, F. Podlaski, Z. Filipovic, N. Kong, U. Kammlott, C. Lukacs, C. Klein, N. Fotouhi, E.A. Liu, In vivo activation of the p53 pathway by small-molecule antagonists of MDM2, Science, 303 (2004) 844-848. [24] J. Zhang, Z. Lei, Z. Huang, X. Zhang, Y. Zhou, Z. Luo, W. Zeng, J. Su, C. Peng, X. Chen, Epigallocatechin-3-gallate(EGCG) suppresses melanoma cell growth and metastasis by targeting TRAF6 activity, Oncotarget, 7 (2016) 79557-79571. [25] W. Xu, S. Wang, Q. Chen, Y. Zhang, P. Ni, X. Wu, J. Zhang, F. Qiang, A. Li, O.D. Roe, S. Xu, M. Wang, R. Zhang, J. Zhou, TXNL1-XRCC1 pathway regulates cisplatin-induced cell death and contributes to resistance in human gastric cancer, Cell death & disease, 5 (2014) e1055. [26] J. Zhou, J. Ye, X. Zhao, A. Li, J. Zhou, JWA is required for arsenic trioxide induced apoptosis in HeLa and MCF-7 cells via reactive oxygen species and mitochondria linked signal pathway, Toxicol Appl Pharmacol, 230 (2008) 33-40. [27] W. Weichert, A. Roske, V. Gekeler, T. Beckers, M.P. Ebert, M. Pross, M. Dietel, 17
ACCEPTED MANUSCRIPT
AC
CE
PT E
D
MA
NU
SC
RI
PT
C. Denkert, C. Rocken, Association of patterns of class I histone deacetylase expression with patient prognosis in gastric cancer: a retrospective analysis, The Lancet. Oncology, 9 (2008) 139-148. [28] E. Wieland, J. Rodriguez-Vita, S.S. Liebler, C. Mogler, I. Moll, S.E. Herberich, E. Espinet, E. Herpel, A. Menuchin, J. Chang-Claude, M. Hoffmeister, C. Gebhardt, H. Brenner, A. Trumpp, C.W. Siebel, M. Hecker, J. Utikal, D. Sprinzak, A. Fischer, Endothelial Notch1 Activity Facilitates Metastasis, Cancer cell, 31 (2017) 355-367. [29] C.H. Yoo, S.H. Noh, D.W. Shin, S.H. Choi, J.S. Min, Recurrence following curative resection for gastric carcinoma, The British journal of surgery, 87 (2000) 236-242. [30] D. Marrelli, F. Roviello, A. De Stefano, G. Fotia, C. Giliberto, L. Garosi, E. Pinto, Risk factors for liver metastases after curative surgical procedures for gastric cancer: a prospective study of 208 patients treated with surgical resection, Journal of the American College of Surgeons, 198 (2004) 51-58. [31] H. Chen, J. Bai, J. Ye, Z. Liu, R. Chen, W. Mao, A. Li, J. Zhou, JWA as a functional molecule to regulate cancer cells migration via MAPK cascades and F-actin cytoskeleton, Cell Signal, 19 (2007) 1315-1327. [32] J. Lu, Y. Tang, M. Farshidpour, Y. Cheng, G. Zhang, S.M. Jafarnejad, A. Yip, M. Martinka, Z. Dong, J. Zhou, J. Xu, G. Li, JWA inhibits melanoma angiogenesis by suppressing ILK signaling and is an independent prognostic biomarker for melanoma, Carcinogenesis, 34 (2013) 2778-2788. [33] D. Liu, Y. Zhang, Y. Li, K. Fan, Neurofibromatosis type-1 is a prognostic indicator in human gastric carcinoma, Oncotarget, 8 (2017) 82910-82919. [34] L.Y. Huang, X. Wang, X.F. Cui, H. Li, J. Zhao, C.C. Wu, L. Min, Z. Zhou, L. Wan, Y.P. Wang, C. Zhang, W.Q. Gao, Y. Sun, Z.G. Han, IRTKS is correlated with progression and survival time of patients with gastric cancer, Gut, (2017). [35] X. Wang, L.C. Trotman, T. Koppie, A. Alimonti, Z. Chen, Z. Gao, J. Wang, H. Erdjument-Bromage, P. Tempst, C. Cordon-Cardo, P.P. Pandolfi, X. Jiang, NEDD4-1 is a proto-oncogenic ubiquitin ligase for PTEN, Cell, 128 (2007) 129-139. [36] F. Tang, B. Wang, N. Li, Y. Wu, J. Jia, T. Suo, Q. Chen, Y.J. Liu, J. Tang, RNF185, a novel mitochondrial ubiquitin E3 ligase, regulates autophagy through interaction with BNIP1, PLoS One, 6 (2011) e24367. [37] Y. Zhou, H. Shang, C. Zhang, Y. Liu, Y. Zhao, F. Shuang, H. Zhong, J. Tang, S. Hou, The E3 ligase RNF185 negatively regulates osteogenic differentiation by targeting Dvl2 for degradation, Biochem Biophys Res Commun, 447 (2014) 431-436. [38] M. de Martino, T. Klatte, A. Haitel, M. Marberger, Serum cell-free DNA in renal cell carcinoma: a diagnostic and prognostic marker, Cancer, 118 (2012) 82-90. [39] C. Huang, Roles of E3 ubiquitin ligases in cell adhesion and migration, Cell Adh Migr, 4 (2010) 10-18. [40] X. Fu, W. Xie, X. Song, K. Wu, L. Xiao, Y. Liu, L. Zhang, Aberrant expression of deubiquitylating enzyme USP9X predicts poor prognosis in gastric cancer, Clinics and research in hepatology and gastroenterology, 41 (2017) 687-692.
Figure Legends: 18
ACCEPTED MANUSCRIPT Fig. 1. JWA is degraded via the ubiquitin-proteasome pathway in GC cells. (A) BGC823 and SGC7901 cells were exposed to cycloheximide (CHX 100 µg/ml) for 0, 1, 2 or 3 h, and then, the indicated protein levels were determined by western blot. (B) The intensities of the JWA protein bands were analysed by densitometry after normalization to the corresponding α-tubulin levels. (C) BGC823 and SGC7901 cells
PT
were treated with MG132 (10 µm) for 6 h; then, the indicated protein levels were determined by western blot, and the intensities of the JWA protein bands were
RI
analysed by densitometry. (D-F) BGC823 and SGC7901 cells transfected with JWA expressing plasmids (Flag-JWA) for 48 h, followed by exposure to CHX (100 µg/ml)
SC
for 0, 1, 2 or 3 h; then, the indicated protein levels were determined by western blot (D), and the intensities of the JWA protein bands were analysed (E). The cells were
NU
treated with MG132 (10 µm) for 6 h; then, the indicated protein levels were determined by western blot, and the intensities of the JWA protein bands were
MA
analysed by densitometry (F).
D
Fig. 2. JWA interacts with RNF185 in GC cells. (A) BGC823 cells and (B) HGC27
PT E
cells were pretreated with MG132 (10 µm) for 6 h, and the endogenous protein-protein interaction between RNF185 and JWA was assessed by IP with RNF185 or JWA antibodies followed by western blot. (C) BGC823 cells were
CE
co-transfected RFP-JWA and HA-RNF185 plasmids, and then, their localization in
AC
cells was determined by immunofluorescence assay. Scale bars: 20 μm.
Fig. 3. RNF185 negatively regulates JWA protein levels in GC cells. (A-B) BGC823 cells were transfected with the RNF185-expressing plasmid (HA-RNF185) or vector (HA-con) for 48 h, and HGC27 cells were transfected with RNF185 siRNAs (si-RNF185#1 and si-RNF185#3) or control siRNA (si-con) for 72 h, respectively. The indicated protein levels were determined by western blot, and the intensity of JWA protein bands was analysed by densitometry (A). The relative JWA mRNA level was determined by quantitative RT-PCR (means ± SD, n = 3) (B). (C) The protein levels of JWA and RNF185 in 9 human gastric cell lines, GC cells (SGC7901, 19
ACCEPTED MANUSCRIPT BGC823, HGC27, MGC803, AGS, and NCI-N87); cisplatin-resistant GC cells (BGC823/DDP and SGC7901/DDP); and human gastric mucosal epithelial cell (GES-1), were detected by western blot. (D) The correlation of the RNF185 protein level and JWA protein level was calculated. (E) The protein levels of JWA and RNF185 in cancerous tissues from 22 GC patients were detected by western blot, and
PT
(F) the correlations of the RNF185 protein levels and JWA protein level were calculated. (G-H) Kaplan-Meier curves depicting OS according to the expression
SC
cohort. P values were calculated with the log-rank test.
RI
patterns of RNF185 (G) combined with RNF185/JWA expression (H) in the GC
Fig. 4. RNF185 promotes JWA ubiquitination for degradation by the proteasome.
NU
(A) BGC823 cells were transiently transfected with the HA-RNF185 plasmid or vector for 48 h, followed by treatment with CHX (100 µg/ml) for 0, 1, 2, 3 h. The
MA
indicated protein levels were determined by western blot, and (B) the half-life curve of JWA protein was drawn. (C) HGC27 cells were transiently transfected with RNF
D
siRNAs or control siRNA for 72 h, followed by treatment with CHX (100 µg/ml) for
PT E
0, 1, 2, 3 h. The indicated protein levels were determined by western blot, and (B) the half-life curve of JWA protein was drawn. (E-F) Ubiquitination of JWA was induced by RNF185. His-ub was coexpressed in BGC823 cells with the HA-RNF185 or
CE
HA-con plasmids for 48 h (E) or in HGC27 cells with si-RNF185#1 or si-con for 72 h (F), followed by pretreatment with or without MG132 (10 µm) for 6 h. Ubiquitination
AC
of the JWA protein was immunoprecipitated using an anti-JWA antibody and further detected a ubiquitin antibody. In whole lysates, endogenous JWA and RNF185 were examined by the indicated antibodies.
Fig. 5. RNF185 promotes GC cell migration by downregulating JWA expression. The HA-RNF185 plasmid and control vector were transfected into BGC823 and SGC7901 cells for 48 h, (A) the levels of the indicated proteins were determined by western blot. (B) Transwell migration assays in BGC823 and SGC7901 cells were performed, and (C) the number of migrating cells was calculated (means ± SD, n = 3). 20
ACCEPTED MANUSCRIPT (D-E) Scratch wound healing assays in BGC823 and SGC7901 cells were performed, and (F) the percentages of wound healing were determined (means ± SD, n = 3). (G-I) HA-RNF185 and Flag-JWA were transfected into BGC823 cells for 48 h, and then, cell transwell migration (G-H) and scratch wound healing assays (I) were performed
PT
and then analysed (means ± SD, n = 3). * P < 0.05; ** P < 0.01; *** P < 0.001.
Fig. 6. The K158 site of JWA is required for its ubiquitination in GC cells. (A)
RI
HGC27 cells was transfected with Flag-JWA (WT) or mutants, followed by exposure to CHX (100 µg/ml) for 3 h. The indicated proteins were detected by western blot. (B,
SC
D) BGC823 and SGC7901 cells were transfected with Flag-JWA (WT) or Flag-JWA (K158R) for 48 h, followed by exposure to 100 µg/ml of CHX for 0, 1, 2, 3 h; the
NU
protein level of Flag-JWA was determined by western blot, and (C, E) the intensity of the JWA protein bands was analysed. (F) HGC27 cells were co-transfected with
MA
His-Ub, Flag-JWA (WT) or Flag-JWA (K158R) for 48 h, followed by pretreatment with MG132 (10 µm) for 6 h. Ubiquitinated Flag-JWA was determined by IP with
D
anti-Flag. (G) HGC27 was transfected with Flag-JWA (WT) or Flag-JWA (K158R),
PT E
and then, transwell migration assays was performed and (H) the number of migration cell per field was calculated (means ± SD, n = 3). (I) BGC823 and SGC7901 were co-transfected with HA-RNF185 and Flag-JWA (WT or K158R) for 48 h; then, the
CE
indicated protein levels were determined by western blot. (J) Transwell migration assays was performed, and the number of migration cells per field was measured
AC
(means ± SD, n = 3). * P < 0.05; ** P < 0.01; *** P < 0.001.
Fig. 7. RNF185 promotes GC metastasis by downregulating JWA expression in vivo. (A) Expression of the indicated proteins in RNF185 stably overexpressing BGC823 cells or corresponding controls were detected by western blot. (B-D) Forty days after injection of RNF185 overexpression and control BGC823 cells in nude mice through the tail vein. Representative images of the lungs (B) and H&E staining sections of the lungs (original magnification, ×50) (C), and quantification of metastatic area was calculated (D). Arrows indicate metastatic nodules. The data were 21
ACCEPTED MANUSCRIPT displayed as the means ± SD from 8 mice in each group. (E) Immunostaining of JWA and RNF185 in metastatic lesion of lungs from the indicated groups (original magnification, ×200). Metastatic lung foci are highlighted by dashed lines. * P < 0.05;
AC
CE
PT E
D
MA
NU
SC
RI
PT
** P < 0.01; *** P < 0.001.
22
ACCEPTED MANUSCRIPT Highlights: 1. RNF185 interacts with JWA and promotes its ubiquitination. 2. JWA lysine 158 is required for its ubiquitination and degradation. 3. RNF185 facilitates gastric cancer metastasis via destabilizing JWA protein.
PT
4. High RNF185 expression is correlated with shorter overall survival in gastric
AC
CE
PT E
D
MA
NU
SC
RI
cancer.
23
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12
Danping Qiu, Qiang Wang, Zhangding Wang, Junjie Chen, Donglin Yan, Yan Zhou, Aiping Li, Ruiwen Zhang, Shouyu Wang, Jianwei Zhou PII: DOI: Reference:
S0925-4439(18)30070-X doi:10.1016/j.bbadis.2018.02.013 BBADIS 65061
To appear in: Received date: Revised date: Accepted date:
10 October 2017 24 January 2018 19 February 2018
Please cite this article as: Danping Qiu, Qiang Wang, Zhangding Wang, Junjie Chen, Donglin Yan, Yan Zhou, Aiping Li, Ruiwen Zhang, Shouyu Wang, Jianwei Zhou , RNF185 modulates JWA ubiquitination and promotes gastric cancer metastasis. The address for the corresponding author was captured as affiliation for all authors. Please check if appropriate. Bbadis(2018), doi:10.1016/j.bbadis.2018.02.013
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
ACCEPTED MANUSCRIPT RNF185 modulates JWA ubiquitination and promotes gastric cancer metastasis Danping Qiua,b,1, Qiang Wanga,b,1, Zhangding Wanga,b,1, Junjie Chena,b, Donglin Yana,b, Yan Zhouc, Aiping Lia,b, Ruiwen Zhangd, Shouyu Wanga,b*, Jianwei Zhoua,b,* a
Department of Molecular Cell Biology and Toxicology, Key Laboratory of Modern
University, Nanjing 211166, People’s Republic of China b
PT
Toxicology of Ministry of Education, School of Public Health, Nanjing Medical
RI
Jiangsu Key Lab of Cancer Biomarkers, Prevention and Treatment, School of Public
SC
Health, Nanjing Medical University, Nanjing 211166, People’s Republic of China c
Department of Oncology, Yixing People’s Hospital, Yixing, People’s Republic of China Department of Pharmaceutical Sciences, School of Pharmacy, Texas Tech University
NU
d
Health Sciences Center, Amarillo, TX 79106, USA
These authors have contributed equally to this work
MA
1
*Correspondence to: Jianwei Zhou, e-mail: [email protected]; Shouyu Wang,
AC
CE
PT E
D
e-mail: [email protected]
1
ACCEPTED MANUSCRIPT Abstract Gastric cancer (GC) is one of the most common malignant cancers worldwide. Metastasis leads to poor prognoses in GC patients in advanced stages. Our previous studies have demonstrated that JWA functions as a tumour suppressor and that low expression of JWA in GC tissues is significantly correlated with shorter overall
PT
survival (OS) as well as with advanced clinicopathologic features in patients. However, the mechanism of dysregulation of JWA in cancers is not clear. In the
RI
present study, we found that an E3 ubiquitin ligase, RNF185, directly interacted with JWA and promoted its ubiquitination at the K158 site, resulting in subsequent
SC
degradation. Moreover, the protein level of RNF185 was negatively correlated with JWA in tumour tissues from GC patients. High RNF185 expression was significantly
NU
correlated with shorter OS. Additionally, increased RNF185 expression facilitated GC cell migration in vitro and promoted GC metastasis in vivo by downregulating JWA
MA
expression. However, this effect was reversed by replenishment of JWA. In conclusion, our findings highlight the following: (1) RNF185 promotes GC metastasis
D
by mediating JWA degradation via a ubiquitin-proteasome pathway; (2) the K158 site
PT E
of JWA is essential for its ubiquitination in GC cells. These findings suggest that RNF185 is a novel candidate prognostic marker and potential therapeutic target for GC.
AC
CE
Keyword: gastric cancer, metastasis, RNF185, JWA, ubiquitination
2
ACCEPTED MANUSCRIPT 1. Introduction Gastric cancer (GC) is the fifth most common malignant neoplasm and the third leading cause of the cancer death worldwide [1]. Metastasis is one of the leading causes of cancer-related death, including in GC [2], yet this complex process remains the least understood aspect of cancer biology [3]. Furthermore, current conventional
PT
treatments for cancer, such as surgery, radiotherapy, and chemotherapy, are thoroughly incapable of preventing GC recurrence and metastasis [4]. Therefore,
RI
identification of novel successful therapeutic targets and strategies to prevent GC metastasis is urgently needed.
SC
JWA, also known as ARL6IP5, is involved in cellular responses to that protect normal cells from DNA damage [5, 6]. Our previous studies demonstrated that
NU
decreased expressions of JWA occurs in many tumours compared with paired normal mucosa including melanomas, liver cancers and GCs. Furthermore, patients with
MA
lower expressions of JWA in the tumour tissues have worse survivals [7-9]. In a GC study, JWA was found to suppress tumour angiogenesis via Sp1-activated matrix
D
metalloproteinase-2 (MMP-2) in GC cells [10]. In HER2-positive GC cells, JWA was
PT E
found to inhibit cell migration by mediating MEK/ERK/PEA3 signalling [11]. Generally, previous studies have demonstrated that JWA is a tumour suppressor in GC. However, the cause of the reduction in JWA in GC cells has not yet been explored.
CE
The ubiquitin-proteasome pathway is responsible for the degradation of most of the protein in mammalian cells [12]. Ubiquitination is performed by a sophisticated
AC
three step enzymatic cascade, involving ubiquitin activating enzymes E1, ubiquitin conjugating enzyme E2, and ubiquitin ligase E3 [13, 14]. The human genome encodes approximately 300 members of the RING family of E3 ligases [15]. E3 ubiquitin ligases specifically target proteins for clearance, and their significance to normal cellular function is reflected in many diseases associated with their loss of function or impropriety targeting [16]. Previous studies have demonstrated that ubiquitination is closely related to cancer metastasis, including GC [17-20]. Several studies have shown that E3 ligases function as oncoproteins in cancer, including MDM2 [21] and TRAF6 [22]. Excitingly, their corresponding inhibitors Nutlin-3 [23] and 3
ACCEPTED MANUSCRIPT Epigallocatechin-3-gallate (EGCG) [24] have also been identified and applied in preclinical studies. Therefore, targeting the ubiquitin-proteasome pathways provides a new strategy for anti-cancer therapy. In the present study, we demonstrate that JWA can be degraded by E3 ubiquitin ligase RNF185 via the ubiquitin-proteasome pathway in GC cells. Moreover, RNF185
PT
targets JWA ubiquitination at the K158 site and its subsequent degradation. Furthermore, RNF185 plays an oncogenic role in promoting GC metastasis in vitro
RI
and in vivo.
SC
2. Materials and Methods 2.1 Cell lines and culture condition
NU
The AGS and NCI-N87 GC cell lines were purchased from the American Type Culture Collection (USA) and the HGC27, SGC7901, BGC823, MGC803, and GES-1
MA
cell lines were from Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). We obtained the BGC823/DDP, SGC7901/DDP lines as described
D
previously [25]. The SGC7901, HGC27, NCI-N87, BGC823/DDP, SGC7901/DDP
PT E
and GES-1 cells were cultured in RPMI-1640 medium. The MGC803 cells were cultured in DMEM medium, the AGS cells were cultured in F12K medium. All the cell lines were supplemented with 100 μg/ml streptomycin, 100 U/ml penicillin and
CE
10% foetal bovine serum (FBS). Cycloheximide (CHX) (Sigma-Aldrich, St Louis, MO, USA) and MG132 (Selleck Chemicals, USA) were used at the indicated
AC
concentrations.
2.2 Patients and specimens The retrospective GC cohort was studied, and details were provided in our previous study [9]. In brief, the cohort included 103 patients who underwent radical gastrectomy were recruited from Nantong Cancer Hospital (Nantong, Jiangsu, China), from May 1, 1990 to the June 1, 1995. The TMA of GC cohorts were constructed by the GC samples. Due to missing data, samples lost during antigen retrieval and those with no tumour cells present in the core, ultimately resulted in samples from 99 GC 4
ACCEPTED MANUSCRIPT patients who were used to evaluate the RNF185 and JWA expressions. In addition, 22 pathologically confirmed GC tissues from recent patients from the People’s Hospital (Yixing, Jiangsu, China) were obtained for western blot analysis after signed informed consent. Institutional approval was obtained from the Review Board of the respective
PT
institutions prior to this study.
2.3 Plasmids and siRNA transfection and lentiviral transduction
RI
The Flag-JWA plasmid and corresponding mutants were subcloned into a pcDNA3.1 vector (Zoonbio biotechnology, Nanjing, China) using HindIII/BamHI
SC
sites. The RNF185 cDNA were inserted into a pPM-C-HA vector (abm, Richmond, BC, Canada) using the NheI and XhoI sites. All of the plasmids were transfected into
NU
cells with Lipofectamine 3000 (Invitrogen, Grand Island, NY, USA). The siRNA sequences used for the JWA were (5'-CGAGCUAUUUCCUUAUCUC-3'), RNF185
MA
(#1: 5'-GUGGCUUCCAGAUGUCUUU-3'; #2: 5'-GCCACAGCAUUUAAUAUAA -3'; #3: 5'-CACGCCUC UUCCUAUUUGU-3'), CHIP (5'-AGGCCAAGCACGACAA
D
GUA-3'), and a nonspecific control siRNA were synthesized by Ribobio (Guangzhou,
PT E
China). The siRNA was transfected into the cells by DharmaFECT4 (Dharmacon, Chicago, IL). The lentivirus vector (GV358) containing RNF185 ORF (LV-RNF185) and the nontargeted control (LV-NC) with Flag tag were generated by Genechem
CE
(Shanghai, China), which were added to BGC823 cells. Twenty-four hours later, the
AC
infected cells were selected with 1 μg/ml Puromycin (Gibco).
2.4 Western blot assay Western blot assays were performed according to details previously reported [26]. The following antibodies were used: anti-β-actin;
anti-α-tubulin;
anti-GAPDH;
anti-HA (1:1000, Beyotime, Jiangsu, China); monoclonal anti-Flag; anti-His (1:2000, MBL, Japan); anti-JWA (1:500, AbMax, Beijing, China); monoclonal anti-Ub (1:500, Santa Cruz, Dallas, TX, USA); monoclonal anti-RNF185 and anti-CHIP (1:1000, Abcam, USA). 5
ACCEPTED MANUSCRIPT 2.5 Quantitative RT-PCR Total RNA was extracted from the cells using the Trizol reagent (Gibco BRL, Gaithersburg, MD, USA), 500 ng of RNA was used for the reverse transcription reaction with HiScript Q RT SuperMix for qPCR (Vazyme, Jiangsu, China). The complementary DNA (cDNA) was amplified with the following primers: 5′-GGAGGAGTCATTGTGGTGC-3′ (forward) and 5′-GAAGTCTCAGGGATGCG
PT
TG-3′ (reverse) for JWA; 5′- CTGTCACGCCTCTTCCTATTTGT-3′ (forward) and 5′-
RI
GCCCAGCATTAGGCAATCAG-3′ (reverse) for RNF185; 5′-CATGTGGGCCATG AGGTCCACCAC-3′ (forward) and 5′- GGGAAGCTCACTGGCATGGCCTTCC -3′
SC
(reverse) for GAPDH. Quantitative RT-PCR was carried out with SYBR Green PCR Master Mix (TaKaRa Bio, Japan) using an ABI Prism 7900 Sequence detection
NU
system (Applied Biosystems, Canada). GAPDH was used as an internal control, and
2.6 Immunofluorescence assay
MA
the results for each sample were normalized to GAPDH expression.
D
RFP-JWA and HA-RNF185 plasmids were transfected into the GC cells for 48 h,
PT E
followed by washing with PBS 3 times, and then the cells were fixed with methanol for 30 min at room temperature. Next, the fixed cells were washed in PBST (PBS supplemented with 0.5% Tween-20) and incubated with the blocking solution (0.1%
CE
Saponin and 0.2% BSA in PBS, pH 7.4) for 1 h. Then, the cells were incubated with anti-HA-mouse monoclonal antibody (1:200, Beyotime, Jiangsu, China) overnight at
AC
4°C. The cell dishes were washed with PBST, and incubated with FITC green-conjugated anti-mouse IgG secondary antibody (1:100, Beyotime, Jiangsu, China) for 1 h. After washing with PBST, the nuclei were counterstained with DAPI (Beyotime, Jiangsu, China) for 20 min. The confocal images of the cells were captured with Zeiss AIM software on a Zeiss LSM 700 confocal microscope system (Carl Zeiss Jena, Oberkochen, Germany).
2.7 Immunoprecipitation assay The cells were washed with PBS twice, then pre-cooling immunoprecipitation 6
ACCEPTED MANUSCRIPT (IP) buffer was added and incubated at 4°C for 30 min. Next, the cells were scraped down from the dish with a cell scratcher and centrifuged at 12,000 g for 15 min at 4°C. The supernatant was immediately transferred to a new centrifugal tube, and then anti-RNF185 antibody, anti-JWA antibody and appropriate control IgG (mouse, rabbit IgG, corresponding to the host species of the primary antibody) were added in 500 µg
PT
total protein and cultured at 4°C. After 1 h, cell lysate was mixed with 20 µl of resuspended volume of protein A/G Plus-Agarose (Santa Cruz, USA) at 4°C
RI
overnight. Afterwards, precooled IP buffer was used to wash the cells 4 times at 1000 g for 5 min at 4°C. The immunoprecipitate was then collected by centrifugation and
SC
analysed by SDS-PAGE.
NU
2.8 Wound-healing assays
Transfected cells were grown to confluence in a 12-well plate (Corning, USA).
MA
Next, the cells were cultured in RPMI-1640 or DMEM with 1% FBS for 12 h. The confluent monolayer was then disrupted with a cell scraper, and filmed at the
D
indicated hours via fluorescent microscopy (IX70, Olympus, Japan) with a 10×
PT E
objective. The rate of wound closure was calculated as the ratio of the average distance between the two wound edges and the total cell duration of migration. The
recorded.
CE
experiments were performed in triplicate, and three random fields of each well were
AC
2.9 Transwell migration assays Transwell migration assays were performed in 24-well plates (Corning, USA), using a 6.5-mm diameter transwell with a 8-μm pore polycarbonate membrane insert (Corning, USA). The cells, in 0.1 ml serum-free medium, were placed on the upper layer of the cell-permeable membrane, and 0.6 ml culture medium containing 10% FBS was placed in the lower chamber. After 12 h of incubation, the migrated cells were fixed with methanol and stained with Crystal Violet Staining Solution (Beyotime, Jiangsu, China) and then photographed. 7
ACCEPTED MANUSCRIPT 2.10 Ubiquitination assay Co-transfected plasmids or siRNAs were transfected into GC cells for 48 h, then the cells were treated with MG132 (10 µM) for another 6 h, and then the cells were harvested for protein samples and divided into two parts. One part was used for western blot, the remaining protein (500 ug) had anti-JWA antibody or anti-Flag
PT
antibody (1:1000, Beyotime, Jiangsu, China) added and was cultured in 4°C for 1 h, and then Protein A/G Plus-Agarose was added overnight. Afterwards, pre-cooling IP
RI
buffer was used to wash four times at 1000 g for 5 min at 4°C, and the immunoprecipitate was collected by centrifugation and then eluted and examined by
SC
western blot.
NU
2.11 Immunohistochemistry
Immunohistochemistry (IHC) was performed according to standard procedures
MA
as described previously [9]. The prepared slides were incubated with antibodies against the polyclonal rabbit anti-JWA antibody (1:200; Research Genetics Inc.) and
PT E
D
monoclonal mouse anti-RNF185 antibody (1:100; SAB, USA).
2.12 TMA construction and assessment of IHC The construction of the GC TMAs was performed with standard procedures, and
CE
the assessment of the IHC employed a semiquantitative immunoreactivity score (IRS) as reported elsewhere [9, 27]. Category A documented the intensity of
AC
immunostaining as 0-3 (0, negative; 1, weak; 2, moderate; 3, strong; Fig. S2E-H). Category B documented the percentage of immunoreactive cells as 1 (0%-25%), 2 (26%-50%), 3 (51%-75%), and 4 (76%-100%). Multiplication of category A and B resulted in an IRS ranging from 0 to 12 for each tumour. The concordance for the IRS of the RNF185 and JWA staining scores between the two pathologists was 91 (92%) in 99 tumours of the TMA cohort, and the few discrepancies were resolved by consensus using a multihead microscope. The optimum value of cutoff points of the RNF185 or JWA IRS in this study were both 4 because the predictive value of this cutoff point for death was the best in the GC cohorts as reported previously [9]. Under 8
ACCEPTED MANUSCRIPT these conditions, the samples with IRS scores 0-4 and IRS 5-12 were classified as low and high expressions of RNF185 or JWA, respectively.
2.13 In vivo metastasis assay Six-week-old BALB/c nude mice were obtained from Model Animal Research
PT
Center of Nanjing University (Nanjing, China). The study was approved by the Animal Care Committee of Nanjing Medical University. The BALB/c nude mice were
RI
randomly divided into two groups consisting of 8 mice each. RNF185 overexpressing and control BGC823 cells were suspended in PBS. The mice were injected
SC
intravenously with 2 × 106 cells in 0.1 ml of PBS through tail vein. After 40 days, the mice were killed, and the lung metastatic nodules were taken for fixation in 4%
NU
paraformaldehyde or frozen in -80°C freezer, and for further analysis. The number of metastatic foci and the area of lung metastases were examined by histological
MA
examination of the indicated lung tissue sections, which were previously employed
PT E
2.14 Statistics analysis
D
[28].
The data are expressed as the means ± S.D. Comparisons of means among multiple groups were analysed by one-way analysis of variance (ANOVA), and the
CE
Dunnett’s t-test were used to assess differences within two groups. The correlations of the expressions of JWA and RNF185 were established by Pearson’s correlation
AC
analysis. The probability of differences in OS as a function of time were ascertained by use of the Kaplan-Meier method, with a log-rank test probe for significance. P-values < 0.05 were considered to be statistically significant, and all statistical analyses were performed with SPSS 16.0.
3. Results 3.1 JWA is degraded via ubiquitin-proteasome pathway in GC cells We previously found that the JWA protein levels were significantly downregulated in GC lesions compared with adjacent noncancerous tissues [9]. To 9
ACCEPTED MANUSCRIPT elucidate the reason why the JWA protein level was reduced in tumour tissues, we first determined whether it was regulated by ubiquitination-mediated degradation. As shown in Figure 1A and B, the endogenous JWA protein level was decreased after exposure to cycloheximide (CHX), an inhibitor of protein synthesis, in two GC cell lines, BGC823 and SGC7901. Moreover, when the cells were treated with MG132, a
PT
protease inhibitor, the degradation of JWA was prevented (Fig. 1C). To confirm this, we externally transfected Flag-JWA expressing plasmid into BGC823 and SGC7901
RI
cells, and observed that the exogenous expression of JWA also could be degraded by CHX treatment (Fig. 1D and E) and demonstrated more stability in cells with MG132
NU
through the ubiquitin-proteasome pathway.
SC
treatment (Fig. 1F). These results indicated that JWA stability could be modulated
3.2 JWA interacts with RNF185 in GC cells
MA
First, JWA interacted with the predicted proteins (http://www.genecards.org/) (Fig. S1A). Among these proteins, XRCC1 was demonstrated to interact with JWA in
D
our previous study [6]. Interestingly, we found RNF185, an E3 ubiquitin ligase,
PT E
potentially interacted with JWA (Fig. S1A). Furthermore, a physical interaction between RNF185 and JWA was defined by IP in endogenous settings in BGC823 and HGC27 cells (Fig. 2A and B). Additionally, we performed immunofluorescence to
CE
examine the localization of RNF185 and JWA in cells (Fig. 2C), and we demonstrated
AC
that mostly co-localized in the cytoplasm of BGC823 cells.
3.3 RNF185 negatively regulates JWA protein levels in GC cells We then investigated whether RNF185 exerts its E3 ligase effect on JWA protein stability. We demonstrated that JWA expression was decreased in RNF185 overexpressing BGC823 or SGC7901 cells and increased in RNF185 knockdown HGC27 cells compared with the corresponding control cells (Figs. 3A and S2A). Additionally, we found that the knockdown of CHIP, another E3 ubiquitin ligase, functions as a suppressor in GC cells in our previous study [19], and yet did not affect JWA expression (Fig. S2B). In contrast, the JWA mRNA level was not affected by 10
ACCEPTED MANUSCRIPT RNA185 overexpression or knockdown (Fig. 3B). Furthermore, the RNF185 protein level was not regulated by knock down of JWA in GC cells (Fig. S2C). Next, the association of RNF185 and JWA expression was determined in the GC cells. It was shown that the JWA protein level was inversely correlated with the RNF185 protein level in the 9 gastric cell lines (R = -0.67, p < 0.05; Fig. 3C and D)
PT
and in the 22 primary tumours from the GC patients (R = -0.42, p < 0.05; Fig. 3E and F).
RI
Additionally, the association of the RNF185 mRNA levels and the OS of GC patients was assessed using a public database (http://kmplot.com/analysis/), which
SC
demonstrated that high RNF185 expression was associated with a poor OS of the GC patients. (Fig. S2D). We further constructed Kaplan-Meier survival curves to study
NU
whether the RNF185 protein level was correlated with the OS of the GC patients. Our data revealed that the patients with high RNF185 expression had poor OS (N = 99,
MA
log-rank test, p < 0.01; Fig. 3G). When combining the RNF185 and JWA together as a new variable, the patients were divided into the 3 following groups: high RNF185 and
D
low JWA; low RNF185 and high JWA; and others. This grouping revealed that the
PT E
patients with high RNF185 and low JWA had a worse outcomes in terms of survival (log-rank test, p < 0.001; Fig. 3H).
CE
3.4 RNF185 promotes JWA ubiquitination for degradation by the proteasome We therefore postulated that RNF185 may promote JWA destabilization. When
AC
the cells were treated with CHX, degradation of JWA was promoted by overexpression of RNF185 (Figs. 4A and B; S3A and B), in contrast, it was suppressed by RNF185 knockdown (Figs. 4C and D; S3C and D). It was also shown that loss of JWA expression in RNF185 overexpressing cells was partly inhibited by pretreatment with MG132 (Fig. 4E). Moreover, ubiquitinated JWA was increased due to MG132 inhibiting its degradation, and RNF185 overexpression further strengthened the ubiquitination of JWA (Fig. 4E), while RNF185 knockdown obviously weakened the ubiquitination of JWA (Fig. 4F). These 11
ACCEPTED MANUSCRIPT data indicated that RNF185 functioned as an E3 ubiquitin ligase to mediate JWA degradation by a ubiquitin-proteasome pathway.
3.5 RNF185 promotes GC cell migration via downregulating JWA expression To determine the roles of RNF185 in the migration potential of GC cells, we
PT
performed migration assays. First, expression of RNF185 was examined by western blot in BGC823 and SGC7901 cells with RNF185 overexpression (HA-RNF185) or
RI
HGC27 and MGC803 cells with RNF185 deficiency (si-RNF185 RNAs) (Figs. 5A and S4A). The transwell migration and scratch wound healing assay indicated that the
SC
cell migration was increased in the RNF185-overexpressing BGC823 or SGC7901 cells (Fig. 5B, C, D, E, and F) but was decreased in the RNF185-deficient HGC27 or
promoted the migration of GC cells.
NU
MGC803 cells (Fig. S4B, C, D, E and F). These results suggested that RNF185
MA
To further clarify the role of JWA in RNF185 regulated GC cells migration, we performed rescue assays. RNF185- and JWA-overexpressing plasmids were
D
co-transfected in BGC823 cells, and the protein levels of RNF185 and JWA were
PT E
examined by western blot (Fig. S4G). Transwell migration assays revealed that the increased migration of RNF185-overexpressing GC cells was inhibited by rescuing JWA expression (Fig. 5G and H). Additionally, these results were confirmed in the
CE
scratch wound healing assay (Fig. 5I).
AC
3.6 The K158 site of JWA is required for its ubiquitination in GC cells To explore which amino acids in the JWA protein are required for its ubiquitination
in
GC
cells,
the
potential
sites
were
predicted
(https://www.phosphosite.org/). The four potential lysines (K31, K151, K158 and K185) in the JWA protein were selected and mutated to arginine (Fig. S5A). JWA wild-type expressing plasmid (WT) and its mutants were then transfected into HGC27 cells with or without treatment of CHX. It was shown that JWA (K158R) and JWA (ALL) (all 4 sites mutated) mutants, but not the other 3 mutants, were resistant to CHX-induced degradation (Fig. 6A). Furthermore, the JWA (WT) and JWA (K158R) 12
ACCEPTED MANUSCRIPT mutant were transfected into BGC823 cells treated with CHX, the half-life curve showed that the JWA (K158R) mutant was more stable than the JWA (WT) in cells (Fig. 6B and C). Moreover, similar results were confirmed in the SGC7901 cells (Fig. 6D and E). Next, the ubiquitination of Flag-JWA was examined, we found it was attenuated for the JWA (K158R) mutant compared with that for JWA (WT) (Fig. 6F).
PT
A transwell migration assay showed that the cell migration was more inhibited in HGC27 cells with the overexpression of the JWA (K158R) mutant than that of its
RI
wild-type (Figs. 6G, H and S5B). Additionally, we further confirmed that RNF185 could induced the degradation of the wild-type JWA but not the JWA (K158R) mutant
SC
in BGC823 or SGC7901 cells (Fig. 6I). Moreover, a transwell migration assay also indicated that JWA K158R mutants could inhibit the increase of cell migration
NU
induced by RNF185 overexpression (Fig. 6J). These results showed that the K158 site
MA
of JWA is responsible for its stability and biological function.
3.7 RNF185 promotes GC metastasis via down-regulating JWA expression in vivo
D
To further investigate whether RNF185 overexpression promotes GC metastasis
PT E
in vivo, RNF185 stably overexpressing (LV-RNF185) BGC823 cells and corresponding controls (LV-NC) were constructed (Fig. 7A). Then, these cells were injected into the mice through the tail vein. Forty days after injection, the mice were
CE
killed to examine the tumour formation in the lungs. Extensive tumour formation was found in the RNF185 overexpression group. In contrast, the lungs from the mice
AC
injected with LV-NC cells exhibited much fewer and smaller tumour nodules compared with the LV-RNF185 group (Fig. 7B). Moreover, histological examination of the lung tissue sections revealed the number of metastatic foci and the area of lung metastases were strongly increased in LV-RNF185 mice (Fig. 7C and D). IHC indicated that the JWA expression in the LV-RNF185 group was much lower than that of the LV-NC group (Fig. 7E), which suggests that RNF185 promoted GC metastasis through downregulation of JWA expression in vivo.
4. Discussion 13
ACCEPTED MANUSCRIPT The high mortality rates of GC patients are associated with metastatic disease [29, 30]. Unravelling the factors driving this process is thus important for future therapeutic interventions. In this study, we have identified that RNF185, an E3 ubiquitin ligase, mediated JWA ubiquitination at its K158 site and subsequent degradation, which increased cell migration via negative regulation of JWA in human
PT
GC cells. We and other groups have demonstrated that JWA functions as a tumour
RI
suppressor and regulates cancer cell migration, apoptosis and angiogenesis via modulating various downstream signalling pathways, such as mitogen-activated
SC
protein kinase (MAPK) cascades [31], and integrin-linked kinase (ILK) [32] and SP1/MMP2 signalling [10]. However, the upstream molecule or signalling pathway
NU
that modulates JWA expression is not clear, although our previous data have demonstrated that the nuclear transcription factor NF1 can bind to the promoter of the
MA
JWA gene and activate its transcription, which regulates oxidative stress and induces DNA damage [5]. However, previous reports have demonstrated that NF1 mRNA
D
expression is lower in GC tissues than normal tissues [33], which indicates that the
PT E
declining transcription activity of NF1 also contributes to JWA reduction, which requires further investigation. Additionally, the phosphorylation of JWA plays an important role in mediating MAPK activation [31], which suggest that
function.
CE
post-translational modification of JWA protein is critical to execute its biological
AC
The degradation of tumour suppressors, such as p53 and PTEN, that are mediated by ubiquitin-proteasome pathways, are critical driving factors in tumour development and progression [34, 35]. In this study, we found that JWA degradation exists in GC cells, which is consistent to our previous reports that the JWA protein level is decreased in tumour tissues in GC patients [9]. Moreover, the K158 site in JWA was identified for its ubiquitination and degradation. When this site was mutated (K158R), the JWA protein was more stable in cells, and GC cell migration was substantially inhibited (Fig. 6G), which suggests that JWA ubiquitination is responsible for the loss of its expression in GC cells, which might result in GC 14
ACCEPTED MANUSCRIPT progression and poor prognosis. Interestingly, we have identified an E3 ubiquitin ligase, RNF185, that binds to JWA and promotes its ubiquitination. It has been shown that RNF185 can induce the degradation of BNIP1 and Dvl2, which modulates autophagy and osteogenesis, respectively [36, 37]. Additionally, high levels of RNF185 are associated with lymph
PT
node and distant metastasis in patients with renal cell carcinomas [38]. Moreover, RNF185 shares 91% homology with human XRNF185, which regulates cell
RI
migration through promoting paxillin degradation [39]. However, the direct evidence indicating the roles of RNF185 in cancer are lacking. Here, we demonstrated that
SC
RNF185 boosted GC cell migration by downregulating JWA expression. Moreover, the protein level of RNF185 was negatively correlated with that of JWA in both GC
NU
cell lines and primary tumour tissues. Further, the GC patients with high RNF185 and low JWA expression exhibited the worst outcomes. These findings indicate that
MA
RNF185 may be involved in the progression of gastric carcinomas and a large population study with GC is warranted. Additionally, we also found USP9x, a
D
deubiquitinase, was predictively interacted with JWA (Fig. S1). Although it had been
PT E
reported that USP9x is overexpressed in GC [40], the interaction of JWA and USP9x and the balance between JWA ubiquitination and deubiquitination deserved to be investigated.
degradation
CE
In summary, the data presented here demonstrate that RNF185 promotes JWA via
the
ubiquitin-proteasome
pathway,
which
accelerates
GC
AC
cell migration. Based on this study, we propose that RNF185 may serve as a promising therapeutic target for GC and that inhibition of RNF185 may be a novel strategy for metastatic GC patients.
Funding This work was supported in part by the National Natural Science Foundation of China (91229125, 81773383, 81521004, 81520108027, 81673219, 81370078), the 973 project of Ministry of Science and Technology, China (2014CB560705), the Science Foundation for Distinguished Young Scholars of Jiangsu Province 15
ACCEPTED MANUSCRIPT (BK20170047); and the Foundation of Priority Academic Program Development (PAPD).
Conflict of interest statement The authors declare they have no competing financial interests
AC
CE
PT E
D
MA
NU
SC
RI
PT
References [1] J. Ferlay, I. Soerjomataram, R. Dikshit, S. Eser, C. Mathers, M. Rebelo, D.M. Parkin, D. Forman, F. Bray, Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012, Int J Cancer, 136 (2015) E359-386. [2] P.S. Steeg, Targeting metastasis, Nat Rev Cancer, 16 (2016) 201-218. [3] A.W. Lambert, D.R. Pattabiraman, R.A. Weinberg, Emerging Biological Principles of Metastasis, Cell, 168 (2017) 670-691. [4] L. Niu, H.Z. Qin, H.Q. Xi, B. Wei, S.Y. Xia, L. Chen, RNF43 Inhibits Cancer Cell Proliferation and Could be a Potential Prognostic Factor for Human Gastric Carcinoma, Cell Physiol Biochem, 36 (2015) 1835-1846. [5] R. Chen, W. Qiu, Z. Liu, X. Cao, T. Zhu, A. Li, Q. Wei, J. Zhou, Identification of JWA as a novel functional gene responsive to environmental oxidative stress induced by benzo[a]pyrene and hydrogen peroxide, Free radical biology & medicine, 42 (2007) 1704-1714. [6] S. Wang, Z. Gong, R. Chen, Y. Liu, A. Li, G. Li, J. Zhou, JWA regulates XRCC1 and functions as a novel base excision repair protein in oxidative-stress-induced DNA single-strand breaks, Nucleic acids research, 37 (2009) 1936-1950. [7] J. Lu, Y. Tang, Y. Cheng, G. Zhang, A. Yip, M. Martinka, Z. Dong, J. Zhou, G. Li, ING4 regulates JWA in angiogenesis and their prognostic value in melanoma patients, British journal of cancer, 109 (2013) 2842-2852. [8] X. Wu, H. Chen, Q. Gao, J. Bai, X. Wang, J. Zhou, S. Qiu, Y. Xu, Y. Shi, X. Wang, J. Zhou, J. Fan, Downregulation of JWA promotes tumor invasion and predicts poor prognosis in human hepatocellular carcinoma, Molecular carcinogenesis, 53 (2014) 325-336. [9] S. Wang, X. Wu, Y. Chen, J. Zhang, J. Ding, Y. Zhou, S. He, Y. Tan, F. Qiang, J. Bai, J. Zeng, Z. Gong, A. Li, G. Li, O.D. Roe, J. Zhou, Prognostic and predictive role of JWA and XRCC1 expressions in gastric cancer, Clin Cancer Res, 18 (2012) 2987-2996. [10] Y. Chen, Y. Huang, Y. Huang, X. Xia, J. Zhang, Y. Zhou, Y. Tan, S. He, F. Qiang, A. Li, O.D. Re, G. Li, J. Zhou, JWA suppresses tumor angiogenesis via Sp1-activated matrix metalloproteinase-2 and its prognostic significance in human gastric cancer, Carcinogenesis, 35 (2014) 442-451. [11] J. Qian, W. Zhu, K. Wang, L. Ma, J. Xu, T. Xu, O.D. Roe, A. Li, J. Zhou, Y. Shu, JWA loss promotes cell migration and cytoskeletal rearrangement by affecting HER2 expression and identifies a high-risk subgroup of HER2-positive gastric carcinoma 16
ACCEPTED MANUSCRIPT
AC
CE
PT E
D
MA
NU
SC
RI
PT
patients, Oncotarget, 7 (2016) 36865-36884. [12] G.A. Collins, A.L. Goldberg, The Logic of the 26S Proteasome, Cell, 169 (2017) 792-806. [13] C.M. Pickart, Mechanisms underlying ubiquitination, Annu Rev Biochem, 70 (2001) 503-533. [14] B.T. Dye, B.A. Schulman, Structural mechanisms underlying posttranslational modification by ubiquitin-like proteins, Annu Rev Biophys Biomol Struct, 36 (2007) 131-150. [15] R.J. Deshaies, C.A. Joazeiro, RING domain E3 ubiquitin ligases, Annual review of biochemistry, 78 (2009) 399-434. [16] L.E. Pascal, Z. Wang, Virtual drug design: Skp1-Skp2 inhibition targets cancer stem cells, Asian journal of andrology, 15 (2013) 717-718. [17] M. He, Z. Zhou, G. Wu, Q. Chen, Y. Wan, Emerging role of DUBs in tumor metastasis and apoptosis: Therapeutic implication, Pharmacol Ther, (2017). [18] J. Xue, X. Lin, W.T. Chiu, Y.H. Chen, G. Yu, M. Liu, X.H. Feng, R. Sawaya, R.H. Medema, M.C. Hung, S. Huang, Sustained activation of SMAD3/SMAD4 by FOXM1 promotes TGF-beta-dependent cancer metastasis, J Clin Invest, 124 (2014) 564-579. [19] S. Wang, X. Wu, J. Zhang, Y. Chen, J. Xu, X. Xia, S. He, F. Qiang, A. Li, Y. Shu, O.D. Roe, G. Li, J.W. Zhou, CHIP functions as a novel suppressor of tumour angiogenesis with prognostic significance in human gastric cancer, Gut, 62 (2013) 496-508. [20] J.C. Black, J.R. Whetstine, RNF2 E3 or Not to E3: Dual Roles of RNF2 Overexpression in Melanoma, Cancer discovery, 5 (2015) 1241-1243. [21] O. Karni-Schmidt, M. Lokshin, C. Prives, The Roles of MDM2 and MDMX in Cancer, Annual review of pathology, 11 (2016) 617-644. [22] X. Zhang, C.F. Li, L. Zhang, C.Y. Wu, L. Han, G. Jin, A.H. Rezaeian, F. Han, C. Liu, C. Xu, X. Xu, C.Y. Huang, F.J. Tsai, C.H. Tsai, K. Watabe, H.K. Lin, TRAF6 Restricts p53 Mitochondrial Translocation, Apoptosis, and Tumor Suppression, Molecular cell, 64 (2016) 803-814. [23] L.T. Vassilev, B.T. Vu, B. Graves, D. Carvajal, F. Podlaski, Z. Filipovic, N. Kong, U. Kammlott, C. Lukacs, C. Klein, N. Fotouhi, E.A. Liu, In vivo activation of the p53 pathway by small-molecule antagonists of MDM2, Science, 303 (2004) 844-848. [24] J. Zhang, Z. Lei, Z. Huang, X. Zhang, Y. Zhou, Z. Luo, W. Zeng, J. Su, C. Peng, X. Chen, Epigallocatechin-3-gallate(EGCG) suppresses melanoma cell growth and metastasis by targeting TRAF6 activity, Oncotarget, 7 (2016) 79557-79571. [25] W. Xu, S. Wang, Q. Chen, Y. Zhang, P. Ni, X. Wu, J. Zhang, F. Qiang, A. Li, O.D. Roe, S. Xu, M. Wang, R. Zhang, J. Zhou, TXNL1-XRCC1 pathway regulates cisplatin-induced cell death and contributes to resistance in human gastric cancer, Cell death & disease, 5 (2014) e1055. [26] J. Zhou, J. Ye, X. Zhao, A. Li, J. Zhou, JWA is required for arsenic trioxide induced apoptosis in HeLa and MCF-7 cells via reactive oxygen species and mitochondria linked signal pathway, Toxicol Appl Pharmacol, 230 (2008) 33-40. [27] W. Weichert, A. Roske, V. Gekeler, T. Beckers, M.P. Ebert, M. Pross, M. Dietel, 17
ACCEPTED MANUSCRIPT
AC
CE
PT E
D
MA
NU
SC
RI
PT
C. Denkert, C. Rocken, Association of patterns of class I histone deacetylase expression with patient prognosis in gastric cancer: a retrospective analysis, The Lancet. Oncology, 9 (2008) 139-148. [28] E. Wieland, J. Rodriguez-Vita, S.S. Liebler, C. Mogler, I. Moll, S.E. Herberich, E. Espinet, E. Herpel, A. Menuchin, J. Chang-Claude, M. Hoffmeister, C. Gebhardt, H. Brenner, A. Trumpp, C.W. Siebel, M. Hecker, J. Utikal, D. Sprinzak, A. Fischer, Endothelial Notch1 Activity Facilitates Metastasis, Cancer cell, 31 (2017) 355-367. [29] C.H. Yoo, S.H. Noh, D.W. Shin, S.H. Choi, J.S. Min, Recurrence following curative resection for gastric carcinoma, The British journal of surgery, 87 (2000) 236-242. [30] D. Marrelli, F. Roviello, A. De Stefano, G. Fotia, C. Giliberto, L. Garosi, E. Pinto, Risk factors for liver metastases after curative surgical procedures for gastric cancer: a prospective study of 208 patients treated with surgical resection, Journal of the American College of Surgeons, 198 (2004) 51-58. [31] H. Chen, J. Bai, J. Ye, Z. Liu, R. Chen, W. Mao, A. Li, J. Zhou, JWA as a functional molecule to regulate cancer cells migration via MAPK cascades and F-actin cytoskeleton, Cell Signal, 19 (2007) 1315-1327. [32] J. Lu, Y. Tang, M. Farshidpour, Y. Cheng, G. Zhang, S.M. Jafarnejad, A. Yip, M. Martinka, Z. Dong, J. Zhou, J. Xu, G. Li, JWA inhibits melanoma angiogenesis by suppressing ILK signaling and is an independent prognostic biomarker for melanoma, Carcinogenesis, 34 (2013) 2778-2788. [33] D. Liu, Y. Zhang, Y. Li, K. Fan, Neurofibromatosis type-1 is a prognostic indicator in human gastric carcinoma, Oncotarget, 8 (2017) 82910-82919. [34] L.Y. Huang, X. Wang, X.F. Cui, H. Li, J. Zhao, C.C. Wu, L. Min, Z. Zhou, L. Wan, Y.P. Wang, C. Zhang, W.Q. Gao, Y. Sun, Z.G. Han, IRTKS is correlated with progression and survival time of patients with gastric cancer, Gut, (2017). [35] X. Wang, L.C. Trotman, T. Koppie, A. Alimonti, Z. Chen, Z. Gao, J. Wang, H. Erdjument-Bromage, P. Tempst, C. Cordon-Cardo, P.P. Pandolfi, X. Jiang, NEDD4-1 is a proto-oncogenic ubiquitin ligase for PTEN, Cell, 128 (2007) 129-139. [36] F. Tang, B. Wang, N. Li, Y. Wu, J. Jia, T. Suo, Q. Chen, Y.J. Liu, J. Tang, RNF185, a novel mitochondrial ubiquitin E3 ligase, regulates autophagy through interaction with BNIP1, PLoS One, 6 (2011) e24367. [37] Y. Zhou, H. Shang, C. Zhang, Y. Liu, Y. Zhao, F. Shuang, H. Zhong, J. Tang, S. Hou, The E3 ligase RNF185 negatively regulates osteogenic differentiation by targeting Dvl2 for degradation, Biochem Biophys Res Commun, 447 (2014) 431-436. [38] M. de Martino, T. Klatte, A. Haitel, M. Marberger, Serum cell-free DNA in renal cell carcinoma: a diagnostic and prognostic marker, Cancer, 118 (2012) 82-90. [39] C. Huang, Roles of E3 ubiquitin ligases in cell adhesion and migration, Cell Adh Migr, 4 (2010) 10-18. [40] X. Fu, W. Xie, X. Song, K. Wu, L. Xiao, Y. Liu, L. Zhang, Aberrant expression of deubiquitylating enzyme USP9X predicts poor prognosis in gastric cancer, Clinics and research in hepatology and gastroenterology, 41 (2017) 687-692.
Figure Legends: 18
ACCEPTED MANUSCRIPT Fig. 1. JWA is degraded via the ubiquitin-proteasome pathway in GC cells. (A) BGC823 and SGC7901 cells were exposed to cycloheximide (CHX 100 µg/ml) for 0, 1, 2 or 3 h, and then, the indicated protein levels were determined by western blot. (B) The intensities of the JWA protein bands were analysed by densitometry after normalization to the corresponding α-tubulin levels. (C) BGC823 and SGC7901 cells
PT
were treated with MG132 (10 µm) for 6 h; then, the indicated protein levels were determined by western blot, and the intensities of the JWA protein bands were
RI
analysed by densitometry. (D-F) BGC823 and SGC7901 cells transfected with JWA expressing plasmids (Flag-JWA) for 48 h, followed by exposure to CHX (100 µg/ml)
SC
for 0, 1, 2 or 3 h; then, the indicated protein levels were determined by western blot (D), and the intensities of the JWA protein bands were analysed (E). The cells were
NU
treated with MG132 (10 µm) for 6 h; then, the indicated protein levels were determined by western blot, and the intensities of the JWA protein bands were
MA
analysed by densitometry (F).
D
Fig. 2. JWA interacts with RNF185 in GC cells. (A) BGC823 cells and (B) HGC27
PT E
cells were pretreated with MG132 (10 µm) for 6 h, and the endogenous protein-protein interaction between RNF185 and JWA was assessed by IP with RNF185 or JWA antibodies followed by western blot. (C) BGC823 cells were
CE
co-transfected RFP-JWA and HA-RNF185 plasmids, and then, their localization in
AC
cells was determined by immunofluorescence assay. Scale bars: 20 μm.
Fig. 3. RNF185 negatively regulates JWA protein levels in GC cells. (A-B) BGC823 cells were transfected with the RNF185-expressing plasmid (HA-RNF185) or vector (HA-con) for 48 h, and HGC27 cells were transfected with RNF185 siRNAs (si-RNF185#1 and si-RNF185#3) or control siRNA (si-con) for 72 h, respectively. The indicated protein levels were determined by western blot, and the intensity of JWA protein bands was analysed by densitometry (A). The relative JWA mRNA level was determined by quantitative RT-PCR (means ± SD, n = 3) (B). (C) The protein levels of JWA and RNF185 in 9 human gastric cell lines, GC cells (SGC7901, 19
ACCEPTED MANUSCRIPT BGC823, HGC27, MGC803, AGS, and NCI-N87); cisplatin-resistant GC cells (BGC823/DDP and SGC7901/DDP); and human gastric mucosal epithelial cell (GES-1), were detected by western blot. (D) The correlation of the RNF185 protein level and JWA protein level was calculated. (E) The protein levels of JWA and RNF185 in cancerous tissues from 22 GC patients were detected by western blot, and
PT
(F) the correlations of the RNF185 protein levels and JWA protein level were calculated. (G-H) Kaplan-Meier curves depicting OS according to the expression
SC
cohort. P values were calculated with the log-rank test.
RI
patterns of RNF185 (G) combined with RNF185/JWA expression (H) in the GC
Fig. 4. RNF185 promotes JWA ubiquitination for degradation by the proteasome.
NU
(A) BGC823 cells were transiently transfected with the HA-RNF185 plasmid or vector for 48 h, followed by treatment with CHX (100 µg/ml) for 0, 1, 2, 3 h. The
MA
indicated protein levels were determined by western blot, and (B) the half-life curve of JWA protein was drawn. (C) HGC27 cells were transiently transfected with RNF
D
siRNAs or control siRNA for 72 h, followed by treatment with CHX (100 µg/ml) for
PT E
0, 1, 2, 3 h. The indicated protein levels were determined by western blot, and (B) the half-life curve of JWA protein was drawn. (E-F) Ubiquitination of JWA was induced by RNF185. His-ub was coexpressed in BGC823 cells with the HA-RNF185 or
CE
HA-con plasmids for 48 h (E) or in HGC27 cells with si-RNF185#1 or si-con for 72 h (F), followed by pretreatment with or without MG132 (10 µm) for 6 h. Ubiquitination
AC
of the JWA protein was immunoprecipitated using an anti-JWA antibody and further detected a ubiquitin antibody. In whole lysates, endogenous JWA and RNF185 were examined by the indicated antibodies.
Fig. 5. RNF185 promotes GC cell migration by downregulating JWA expression. The HA-RNF185 plasmid and control vector were transfected into BGC823 and SGC7901 cells for 48 h, (A) the levels of the indicated proteins were determined by western blot. (B) Transwell migration assays in BGC823 and SGC7901 cells were performed, and (C) the number of migrating cells was calculated (means ± SD, n = 3). 20
ACCEPTED MANUSCRIPT (D-E) Scratch wound healing assays in BGC823 and SGC7901 cells were performed, and (F) the percentages of wound healing were determined (means ± SD, n = 3). (G-I) HA-RNF185 and Flag-JWA were transfected into BGC823 cells for 48 h, and then, cell transwell migration (G-H) and scratch wound healing assays (I) were performed
PT
and then analysed (means ± SD, n = 3). * P < 0.05; ** P < 0.01; *** P < 0.001.
Fig. 6. The K158 site of JWA is required for its ubiquitination in GC cells. (A)
RI
HGC27 cells was transfected with Flag-JWA (WT) or mutants, followed by exposure to CHX (100 µg/ml) for 3 h. The indicated proteins were detected by western blot. (B,
SC
D) BGC823 and SGC7901 cells were transfected with Flag-JWA (WT) or Flag-JWA (K158R) for 48 h, followed by exposure to 100 µg/ml of CHX for 0, 1, 2, 3 h; the
NU
protein level of Flag-JWA was determined by western blot, and (C, E) the intensity of the JWA protein bands was analysed. (F) HGC27 cells were co-transfected with
MA
His-Ub, Flag-JWA (WT) or Flag-JWA (K158R) for 48 h, followed by pretreatment with MG132 (10 µm) for 6 h. Ubiquitinated Flag-JWA was determined by IP with
D
anti-Flag. (G) HGC27 was transfected with Flag-JWA (WT) or Flag-JWA (K158R),
PT E
and then, transwell migration assays was performed and (H) the number of migration cell per field was calculated (means ± SD, n = 3). (I) BGC823 and SGC7901 were co-transfected with HA-RNF185 and Flag-JWA (WT or K158R) for 48 h; then, the
CE
indicated protein levels were determined by western blot. (J) Transwell migration assays was performed, and the number of migration cells per field was measured
AC
(means ± SD, n = 3). * P < 0.05; ** P < 0.01; *** P < 0.001.
Fig. 7. RNF185 promotes GC metastasis by downregulating JWA expression in vivo. (A) Expression of the indicated proteins in RNF185 stably overexpressing BGC823 cells or corresponding controls were detected by western blot. (B-D) Forty days after injection of RNF185 overexpression and control BGC823 cells in nude mice through the tail vein. Representative images of the lungs (B) and H&E staining sections of the lungs (original magnification, ×50) (C), and quantification of metastatic area was calculated (D). Arrows indicate metastatic nodules. The data were 21
ACCEPTED MANUSCRIPT displayed as the means ± SD from 8 mice in each group. (E) Immunostaining of JWA and RNF185 in metastatic lesion of lungs from the indicated groups (original magnification, ×200). Metastatic lung foci are highlighted by dashed lines. * P < 0.05;
AC
CE
PT E
D
MA
NU
SC
RI
PT
** P < 0.01; *** P < 0.001.
22
ACCEPTED MANUSCRIPT Highlights: 1. RNF185 interacts with JWA and promotes its ubiquitination. 2. JWA lysine 158 is required for its ubiquitination and degradation. 3. RNF185 facilitates gastric cancer metastasis via destabilizing JWA protein.
PT
4. High RNF185 expression is correlated with shorter overall survival in gastric
AC
CE
PT E
D
MA
NU
SC
RI
cancer.
23
Figure 1
Figure 2
Figure 3
Figure 4
Figure 5
Figure 6
Figure 7
Figure 8
Figure 9
Figure 10
Figure 11
Figure 12