Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli

G Model

ARTICLE IN PRESS

IJMM-51067; No. of Pages 12

International Journal of Medical Microbiology xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

International Journal of Medical Microbiology journal homepage: www.elsevier.com/locate/ijmm

Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli Rima Tapader a , Dipro Bose b , Pallabi Basu c , Moumita Mondal d , Ayan Mondal a , Nabendu Sekhar Chatterjee d , Pujarini Dutta e , Sulagna Basu f , Rupak K. Bhadra c , Amit Pal a,∗ a

Division of Pathophysiology, National Institute of Cholera and Enteric Diseases (NICED), Kolkata-10, India Centre for Infectious Diseases & Control, School of Biosciences and Technology, VIT University, Vellore 632014, India c Infectious Diseases and Immunology Division, CSIR-Indian Institute of Chemical Biology, Kolkata-32, India d Division of Biochemistry, NICED, Kolkata-10, India e Division of Clinical Medicine, NICED, Kolkata-10, India f Division of Bacteriology, NICED, Kolkata-10, India b

a r t i c l e

i n f o

Article history: Received 25 November 2015 Received in revised form 24 May 2016 Accepted 15 June 2016 Keywords: Neonatal sepsis Neonatal septicemic Escherichia coli (NSEC) Metalloprotease YghJ Cytotoxicity Proinflammatory response

a b s t r a c t Neonatal sepsis is the invasion of microbial pathogens into blood stream and is associated with a systemic inflammatory response with production and release of a wide range of inflammatory mediators. The increased serum levels of cytokines were found to correlate with the severity and mortality in course of sepsis. There have been no reports on the role of microbial proteases in stimulation of proinflammatory response in neonatal sepsis. We have identified YghJ, a secreted metalloprotease from a neonatal septicemic Escherichia coli (NSEC) isolate. The protease was partially purified from culture supernatant by successive anion and gel filtration chromatography. MS/MS peptide sequencing of the protease showed homology with YghJ. YghJ was cloned, expressed and purified in pBAD TOPO expression vector. YghJ was found to be proteolytically active against Methoxysuccinyl Ala-Ala-Pro-Met-p-nitroanilide oligopeptide substrate, but not against casein and gelatin. YghJ showed optimal activity at pH 7–8 and at temperatures 37–40 ◦ C. YghJ showed clear changes in cellular morphologies of Int407, HT-29 and HEK293 cells. YghJ stimulated the secretion of cytokines IL-1␣, IL-1␤ and TNF-␣ in murine macrophages (RAW 264.7) and IL-8 from human intestinal epithelial cells (HT-29). YghJ also down-regulated the production of antiinflammatory cytokines such as IL-10. YghJ is present in both septicemic (78%) and fecal E. coli isolates (54%). However, expression and secretion of YghJ is significantly higher among the septicemic (89%) than the fecal isolates (33%). This is the first study to show the role of a microbial protease, YghJ in triggering proinflammatory response in NSEC. © 2016 Elsevier GmbH. All rights reserved.

1. Introduction Sepsis is the systemic signs and symptoms following an infection and isolation of an infectious agent from blood and cerebrospinal fluid. In neonatal sepsis, this occurs in the first four weeks of life, i.e. in the neonatal period (Singh et al., 1994; Paolucci et al., 2012). Neonatal sepsis continues to be a major health menace glob-

∗ Corresponding author at: Division of Pathophysiology, National Institute of Cholera and Enteric Diseases, P33, CIT Road, Scheme XM, Beliaghata, Kolkata 700010, India. E-mail address: [email protected] (A. Pal).

ally, contributing significantly to the mortality and morbidity in both term and pre-term infants, specifically among very-low-birthweight (VLBW) infants (Liu et al., 2015; Camacho-Gonzalez et al., 2013; Hornik et al., 2012). Sepsis stands as one of the major causes for neonatal deaths in developing countries (Lahariya and Paul, 2010). Escherichia coli has emerged as one of the major pathogens associated with sepsis of the newborns, specifically in case of earlyonset sepsis (Zaidi et al., 2011; Stoll et al., 2011; Lin et al., 2011). E. coli is the most common cause of sepsis in VLBW neonates and the second most common cause of sepsis in term infants (Stoll et al., 2011; Weston et al., 2011). Bacterial proteases remain one of the crucial factors that essentially contribute to the pathogenesis of the producer organisms.

http://dx.doi.org/10.1016/j.ijmm.2016.06.003 1438-4221/© 2016 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model IJMM-51067; No. of Pages 12 2

ARTICLE IN PRESS R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

Secreted extracellular proteases demand critical attention as they promote virulence of pathogenic bacteria by facilitating bacterial invasion to a specific host tissue and by exhibiting their proteolytic effects on several intra and extra-cellular targets to exacerbate the disease condition (Marokhazi et al., 2004; Massaoud et al., 2010). A number of specialized virulence factors (VFs) have been implicated in the pathogenesis of neonatal septicemic E. coli (NSEC) isolates like various adhesins (e.g. type S and type P pili), factors for iron acquisition [e.g. aerobactin (IucC), Salmochelin siderophore receptor (IroN)], factors for invasion [like factor for invasion in brain endothelium (IbeA)], factors to subvert host defence systems (e.g. capsule, lipopolysaccharide) and toxins [like cytotoxic necrotizing factor (Cnf), alpha-hemolysin (Hly)], which are generally absent in fecal isolates (Watt et al., 2003; Ron, 2010; Chapman et al., 2006; Mokady et al., 2005). However, there is scarcity of knowledge about the secreted proteases from these isolates. In our earlier study, we reported for the first time about the significantly higher prevalence of a group of secreted serine proteases, SPATEs (Serine protease autotransporters of Enterobacteriaceae) in different phylogroups of NSEC isolates (89%) compared to the fecal (7.5%) and environmental E. coli isolates (3%). The presence of SPATEs was also compared with other VFs and SPATEs was found as the most discriminatory trait for the NSEC isolates (Tapader et al., 2014). To best of our knowledge, this was the only study carried out to show the occurrence of proteases among NSEC isolates. We initiated our present study to identify and purify a secreted protease from a clinical isolate of NSEC and to investigate the role of the protease in the establishment of the disease. In our attempt, we identified YghJ from a clinical NSEC isolate. YghJ is known to harbour M60 metalloprotease domain (Nakjang et al., 2012). We further cloned, expressed, purified and characterized YghJ. Moreover, we have also determined the distribution of YghJ among neonatal septicemic and fecal E. coli isolates. A comparative analysis of the expression and secretion of YghJ between these two groups of isolates was also performed. YghJ has recently been identified to be secreted from Enterotoxigenic E. coli (ETEC) and has been shown to have mucinase activity (Luo et al., 2014). In another study, the chromosomally located yghJ gene has been documented to be secreted by 89% of the ETEC isolates, distributed over a diverse phylogenetic lineage and shown to be expressed during the course of infection of ETEC (Luo et al., 2015). Interestingly, YghJ was identified as one of the potential vaccine candidates for ExPEC isolates and has been shown to provide complete protection against septicaemia (Moriel et al., 2010). However, the exact role of YghJ in the pathogenesis of sepsis in newborns has not been explored yet. We have attempted to elucidate the role of YghJ in the pathogenesis of NSEC isolates. Sepsis is characterized by the overproduction of diverse endogenous mediators and amplified host response towards an infection. Cytokines, the low molecular weight proteins are one of such mediators synthesized by host’s immune cells during an infection process. Proinflammatory cytokines released by numerous immune cells are attributed as one of the key mediators in the pathogenesis of sepsis and are considered as one of the diagnostic marker in sepsis (Netea et al., 2003; Sikora et al., 2001; Schulte et al., 2013). Bacterial lipopolysaccharide (LPS) is the most commonly known factor responsible for stimulating the proinflammatory response (Ulevitch and Tobias 1995; Poltorak et al., 1998; Fattori et al., 1994). No other VF of NSEC isolates has been reported to play a role in stimulating the production of proinflammatory cytokines implicated in sepsis. Our study is the first to show that YghJ stimulates the production of several proinflammatory cytokines like IL-1␣, IL-1␤, IL-8 and TNF-␣ which are essentially associated in the sepsis of newborns.

2. Materials and methods 2.1. Bacterial isolates and growth conditions A total of 40 E. coli bloodstream isolates from neonates with clinical syndrome of septicemia and 30 E. coli isolates from feces of healthy neonates were used to study the genotypic and phenotypic distribution of E. coli metalloprotease YghJ. These isolates were collected as described in our earlier study (Tapader et al., 2014). NSEC isolate EB260 of phylogroup A and having SPATE gene but no subtype was selected for the present study. E. coli TOP10 cells were used for transformation of the recombinant plasmids. The isolates were stored in 20% glycerol at −80 ◦ C. All the E. coli isolates were revived in MacConkey Agar plates (BD Diagnostics, Franklin Lakes, New Jersey, USA) from frozen glycerol stocks and grown in Luria Broth (LB) (BD Diagnostics) for most of the experiments. The isolates were grown in Tryptic Soya Broth (TSB) (BD Diagnostics) to study the expression of YghJ among NSEC and fecal E. coli isolates and for detection of protease activity by azocasein assay and pNA oligopeptide substrate assay. Ampicillin (Amp) concentration used for selection of positive clones of YghJ was 100 ␮g/ml. 2.2. Partial purification and identification of YghJ E. coli metalloprotease YghJ was partially purified from culture supernatant of a NSEC isolate EB260. Briefly, the organism was grown in TSB at 37 ◦ C with vigorous shaking. After 18 h of growth, the culture supernatant was filtered using 0.22 ␮ cellulose-acetate filter (Millipore Co, Bellerica MA) and concentrated in an Amicon concentrator using ultrafiltration membrane (30 kDa cut-off) (Millipore). The concentrated cell-free culture supernatant was then subjected to DE-52 (Whatman, Kent, UK) anion-exchange chromatographic column (20 × 2.5 cm) pre-equilibrated with 25 mM Tris-HCl buffer (pH 7.4). The proteins were eluted with 25 mM Tris-HCl buffer and designated as non-binding (NB) fraction. The NB fraction was concentrated and tested for protease activity. The proteins bound to the DE-52 matrix were eluted in the presence of different concentrations of NaCl from 0.1 M to 0.3 M. The bound fractions were pooled, dialyzed against 25 mM Tris-HCl, concentrated and tested for protease activity. The proteins eluted in 0.2 N NaCl pooled fraction showed protease activity and was further subjected to gel-filtration chromatography using Sephadex G-200 (Pharmacia Chemicals, Sweden) column (30 × 1.5 cm), preequilibrated with 25 mM Tris-HCl (pH 7.4). The columns were run on a BioLogic Duo Flow Chromatoraphic system (Bio-Rad, Hercules, CA). The fraction showing protease activity was eluted in the void volume, concentrated and examined by SDS and NATIVE-PAGE. Three major bands from SDS-PAGE were identified by the method of matrix-assisted laser desorption ionization time of flight (MALDITOF) mass spectrometry (Bruker Autoflex). Briefly, the bands were excised from coomassie blue stained gel, destained in destaining buffer repeatedly until complete removal of the stain. The gel pieces were then dehydrated in 100% acetonitrile for 10 min at RT and dried under vacuum until the gel pieces became completely dry. The gel pieces were rehydrated in reduction buffer for 60 min at 56 ◦ C. Alkylation was done in alkylation buffer for 1 h at RT in the dark. The gel pieces were washed in digestion buffer and dehydrated in acetonitrile. This was repeated and the gel was dried under vacuum and incubated in trypsin solution at 37 ◦ C overnight for proper digestion. The peptides were extracted by incubating the gel pieces twice (15 min each) in extraction buffer (1:1). The gel pieces were again dehydrated twice (10 min each) with 100% acetonitrile (1:1) to remove any traces of peptides from gel. The extracted peptide sample was dried under vacuum (10–20% of original volume) to remove acetonitrile. Finally the sample was dissolved in 0.1% TFA and 50% acetonitrile and analyzed on a Bruker

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model

ARTICLE IN PRESS

IJMM-51067; No. of Pages 12

R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

Autoflex MALDI-TOF instrument at Bose Institute, Kolkata. The peptide mixture was analyzed in positive reflector mode for accurate peptide mass determination and 10–12 peptides were selected from each band for MS/MS analysis. The MS and MS/MS spectra were combined and used for database search using Mascot software. 2.3. Raising of antisera against YghJ Antisera against YghJ was raised by immunizing 3 weeks old Swiss Albino mice with homogenized gel cut of YghJ band in PBS (pH 7.2) from SDS-PAGE of Sephadex G-200 eluted Pool I fraction. Mice were injected subcutaneously with the homogenized gel cut at two different sites. After four successive injections, each at 7 days interval, the animals were sacrificed and antiserum was collected. The antiserum was stored at −70 ◦ C until use at a dilution of 1:800 unless otherwise mentioned. 2.4. Cloning and DNA sequencing Primers used for amplification of yghJ for cloning are mentioned in Table 1. PCR was done with 0.4 ␮M of each primer, 0.2 mM dNTPs (Roche, Mannheim, Germany), 1× reaction buffer and 0.6 U of Taq DNA Polymerase (Roche) in a final volume of 25 ␮l. Genomic DNA isolated from NSEC isolate EB260 using cetyl trimethyl ammonium bromide (CTAB) (Sigma Chemical Company, St. Louis, Mo.) was used as template for PCR. Amplification reactions were performed using the following conditions: initial denaturation at 95 ◦ C for 10 min, 30 cycles of denaturation at 95 ◦ C for 1 min, annealing at 62 ◦ C for 45 s, extension at 72 ◦ C for 4 min 10 s and a final extension for 10 min at 72 ◦ C. The amplified product was ligated to pBAD TOPO TA expression vector (Invitrogen, USA) according to the manufacturer’s protocol and the ligation reaction mixture was transformed into TOP10 chemically competent E. coli cells. The transformed cells were plated onto Luria agar (LA) plate containing 100 ␮g/ml Amp and incubated at 37 ◦ C overnight. Colony PCR was done using pBAD forward primer and yghJ reverse primer for the confirmation of positive clones. Amplification reactions were performed using the following conditions: initial denaturation at 95 ◦ C for 10 min, 30 cycles of denaturation at 95 ◦ C for 1 min, annealing at 62 ◦ C for 45 s, extension at 72 ◦ C for 4 min 20 s and a final extension for 10 min at 72 ◦ C. Several clones gave the desired size of PCR fragment and one of them was selected for further analysis and designated pTYghJ7. The recombinant clone pTYghJ7 was further confirmed by DNA sequencing. After confirmation of the clone pTYghJ7, the entire insert DNA of ∼4.56-kb was completely sequenced by walking procedure using several primers (Table 1). Sequencing reactions were performed using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) essentially as directed by the manufacturer and it was run on an automated DNA Sequencer (3130 Genetic Analyzer, Applied Biosystems,). Nucleotide sequences were extensively analysed using Chromas LITE version 2.1.1. The homology searches for the nucleotide sequences were done using the National Centre For Biotechnology Information (NCBI) BLASTN program version 2.2.10 (http://www.ncbi.nlm.nih.gov/blast/). The entire nucleotide sequence of the yghJ gene of the NSEC isolate EB260 was submitted to the GenBank and its accession number is KX245009.

3

and the fractions showing protease activity were further subjected to Gel–filtration chromatography (Sephadex G-200). The purified protease was run on SDS and NATIVE-PAGE. 2.6. Oligopeptide substrate assay Methoxysuccinyl (MeOSuc)-Ala-Ala-Pro-Met-p-nitroanilide (AAPM pNA) (Calbiochem) oligopeptide was used as the substrate for detection of protease activity. The substrate was prepared as 10 mM stock solution in dimethyl sulphoxide. Culture supernatant as well as the purified protease (62 pM) was incubated with 1 mM substrate in 25 mM Tris-HCl (pH 7.4) in a total volume of 200 ␮l and incubated at 37 ◦ C. Absorbance was measured at 405 nm at 30 min intervals over the course of 16–18 h and plotted kinetically. 2.7. Gelatin zymography For SDS-PAGE zymography, samples were electrophoresed under denaturing but non-reducing conditions (without boiling and reducing agent in Laemmli sample buffer) using 7.5% SDS-PAGE copolymerized with 0.1% gelatin (Sigma). The gel was incubated after electrophoresis in renaturation buffer (2.5% Triton-X-100) for 1 h at RT with gentle shaking. The gel was then developed in the development buffer containing 5 mM CaCl2, 25 mM Tris-HCl (pH 7.4) overnight at 37 ◦ C with gentle shaking. The gel was visualized after staining using Coomassie Brilliant Blue R-250 and subsequent destaining. 2.8. Azocasein assay Casein was used as the substrate in this assay to determine protease activity. The assay was done as described in our earlier study (Syngkon et al., 2010). Briefly, overnight grown bacterial culture supernatant was mixed with 1% azocaein (Sigma) and incubated at 37 ◦ C overnight and the reaction was terminated using 10% TCA (Tri Chloro Acetic Acid). After removing the precipitated protein by centrifugation (10,000 rpm for 10 min), the supernatant was mixed with 500 mM NaOH and absorbance was measured at 440 nm. TSB was used as negative control and purified Haemagglutinin Protease (HAP) from V. cholerae was used as positive control. 2.9. Inhibition of protease activity Inhibitory effects on the purified enzyme activity were assayed using inhibitors: PMSF (10 mM), EDTA (10 mM) and 1,10 phenanthroline (10 mM). 100 mM stocks of PMSF and 1,10 phenanthroline were prepared in methanol and 500 mM stock of EDTA was prepared in water. 62 pM of purified protease was pre-incubated at 37 ◦ C for 30 min with each inhibitor. The residual activity was measured using pNA oligopeptide substrate as described earlier. 2.10. Determination of optimum pH for protease activity 62 pM of purified protease was dialyzed overnight against buffer in the pH range of 4–11: 50 mM acetate buffer was used for pH 4–5, 50 mM phosphate buffer to achieve pH 6–7, 50 mM Tris-HCl for pH 8–9 and 50 mM glycine-NaOH buffer for achieving the pH of 10–11 and activity was determined with 1 mM of pNA oligopeptide substrate.

2.5. Expression and purification of rYghJ The recombinant clone pTYghJ7 was used for expression of the gene. After an initial standardization with different l-arabinose concentrations and incubation periods, rYghJ was finally induced with 0.02% l-arabinose for 5 h. The soluble fraction of the whole cell lysate was next subjected to Ni-NTA column chromatography

2.11. Determination of optimum temperature for protease activity To determine the optimum temperature for activity of YghJ, 62 pM of the purified protease was incubated over a wide range of temperatures: 20 ◦ C, 30 ◦ C, 37 ◦ C, 40 ◦ C, 50 ◦ C, 60 ◦ C and 70 ◦ C

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model

ARTICLE IN PRESS

IJMM-51067; No. of Pages 12

R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

4

for 45 min and the enzyme activity was determined by the pNA oligopeptide substrate at pH 7.4 as described earlier.

2.12. Cell culture and treatment Human intestinal epithelial cell line Int407 cells and human kidney epithelial cell line HEK293 cells were grown and maintained in minimum essential medium (MEM) (GIBCO, Rockville, MD) with 10% fetal bovine serum (FBS) (GIBCO), 100 U/ml Penicillin G and 100 ␮g/ml Streptomycin sulphate. Human colorectal adenocarcinoma cells, HT-29 were propagated in Dulbecco’s modified Eagle’s medium (DMEM) containing high glucose (GIBCO) with 10% FBS, and antibiotics at the mentioned doses. Mouse macrophages (RAW 264.7 cells) were maintained in RPMI 1640 medium (GIBCO) with 10% FBS. All cells were grown and maintained in presence of 5% CO2 at 37 ◦ C. For cytotoxicity assay, cells were seeded in 6-well tissue culture plates (Tarson, India). Cells with 80% confluency, were washed with PBS and starved in serum-free medium for 16 h. The cells were treated with filter sterilized purified rYghJ in a dose and timedependent manner. Wells designated as untreated controls were replenished with fresh serum-free media and incubated for the similar time periods with that of treated wells at 37 ◦ C in 5% CO2. Cells were observed under phase contrast microscope (Olympus, Japan) at magnification 40×. A dose response (31–500 nM) for induction of IL-8 with rYghJ was done on HT-29 cells. For this, HT-29 cells were seeded in 12well plates. Cells were preincubated with serum-free media for 16 h and after removing the medium, cells were incubated with different doses of purified rYghJ (31–500 nM) for 4 h and cell supernatants were collected to determine secreted level of Il-8. With this initial standardization for the dose of rYghJ, the secretion of IL-8 from HT-29 cells and the secretion of other cytokines from RAW 264.7 cells were determined in presence or absence of Polymyxin B (PMB) (Sigma Chemical Company, St. Louis, Mo.). To do this, cells were initially starved in serum-free media for 16 h and incubated with or without PMB at a concentration of 50 ␮g/ml in serumfree medium at 37 ◦ C in 5% CO2 . After 1 h of incubation, purified rYghJ was added in all the wells at a dose of 200 nM and cell supernatants were collected at different time intervals of 0, 2, 4, 6, 8, 10, 18 and 24 h for determination of the levels of different cytokines. Human skin antimicrobial peptide elafin (Gene ID 5266) which was cloned, expressed and purified in a similar manner like YghJ was used as negative control. Cells were treated similarly with recombinant elafin and incubated for the similar time periods with that of rYghJ.

2.13. Determination of different cytokine secretion by ELISA The induction of IL-8 with different doses of rYghJ (31–500 nM) was studied initially. To examine the secretion of other proinflammatory cytokines, 200 nM of rYghJ was used for all further experiments on RAW 264.7 cells. The level of IL-8 protein secreted from Int407 and HT-29 cells stimulated with rYghJ in presence or absence of PMB was measured by ELISA using Human IL-8 ELISA Kit (Invitrogen) following manufacturer’s protocol. The amount of other pro and anti-inflammatory cytokines such as IL-1␣, IL-1␤, IL6, IL-12, TNF-␣ and IL-10 secreted from rYghJ treated RAW 264.7 cells was measured by ELISA using mouse Il-1␣, IL-1␤, IL-6, IL12, TNF-␣ and IL-10 ELISA kits (R&D systems, Minneapolis, MN) following manufacturer’s instruction. For each cytokine, standard curve was plotted using the standards provided in each kit and the concentrations of the unknowns were detected from the standard curves. The levels of secreted cytokines were expressed in pg/ml of cell supernatant. Human skin antimicrobial peptide elafin (Gene ID 5266) was cloned, expressed in TOP10 E. coli and purified in a similar way like YghJ. The recombinant protein elafin which did not show any proinflammatory response (unpublished data) was used as negative control in our study. 2.14. PCR to study the distribution of YghJ among NSEC and fecal isolates yghJ was PCR amplified using 0.5 ␮M of each internal primers named YghJ 4F and YghJ 4R (Table 1) with 0.2 mM dNTPs (Roche, Mannheim, Germany), 1× reaction buffer and 0.6 U of Taq DNA Polymerase (Roche) in a final volume of 25 ␮l. Two microliters of bacterial cell lysates from overnight grown cultures of both septicemic and fecal isolates were used as templates for amplification reactions. PCR was done using the following conditions: initial denaturation at 95 ◦ C for 5 min, 35 cycles of denaturation at 95 ◦ C for 30 s, annealing at 58 ◦ C for 45 s, extension at 72 ◦ C for 1 min and a final extension for 7 min at 72 ◦ C. The amplicon size was 823 bp. 2.15. Immunoblot analysis to study the expression of YghJ among NSEC and fecal isolates Both fecal and NSEC isolates were grown in 20 ml of TSB at 37 ◦ C. After 18 h of growth, optical density was measured at 600 nm for each isolate and equal numbers of bacterial cells were taken for immunoblot analysis. Cells were pelleted down at 10,000 rpm for 10 min. To study the expression and secretion of YghJ, culture supernatants were collected for each isolate and the proteins in the culture supernatant were precipitated using 100% TCA,

Table 1 Primers used in this study. Primer

Primer sequence (5 -3 )

Use

Reference

YghJ Clon F YghJ Clon R pBAD F pBAD R YghJ 1F YghJ 1R YghJ 2F YghJ 2R YghJ 3F YghJ 3R YghJ 4F YghJ 4R YghJ 5F YghJ 6F YghJ 6R

TTGTCACTTGCGTTATTAATGAATAAG CTCGGCAGACATCTTATGCTC ATGCCATAGCATTTTTATCC GATTTAATCTGTATCAGG ACCAGAACCGGAGCCAGA TAAAACTCTGGCAGAGGA AGTTTTATCAGTATCAACC GGCATTCAGGTTCTTCTTC CCAAAGAGATCGATACC CCATATAGTTGAGCGGG AACGCGCCTGGGATAAAAACG CACCATCTACGGCAGGATAAC ATGAGCAATCTTAAGGAAG CCAACGGTAACGCAGCGGAC GTTGCCAGGACGGGCATCGCC

PCR PCR PCR, sequencing PCR, sequencing Sequencing Sequencing Sequencing Sequencing Sequencing Sequencing PCR, Sequencing PCR, Sequencing Sequencing Sequencing Sequencing

Luo et al., 2014 Luo et al., 2014 pBAD TOPO TA Expression Kit, Invitrogen pBAD TOPO TA Expression Kit, Invitrogen This study This study This study This study This study This study This study This study This study This study This study

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model IJMM-51067; No. of Pages 12

ARTICLE IN PRESS R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

mixed with Laemmli sample buffer (1:1), boiled for 10 min and run on 7.5% SDS-PAGE. The proteins after electrophoresis were transferred onto nitrocellulose membrane (Bio-Rad, USA) using Trans-Blot Apparatus (Bio-Rad, USA). The membranes were blocked with 3% BSA in Tris buffered saline-Tween 20 (TBST) for 1 h at RT. The membranes were then incubated overnight at 4 ◦ C with mouse polyclonal anti-YghJ at a dilution of 1:800 in blocking buffer. After washing, alkaline phosphatase–conjugated goat antimouse IgG (BD Diagnostics, Franklin Lakes, New Jersey, USA) was added in 1:3000 dilution in TBST for 2 h at RT. The alkaline phosphatase positive bands were detected by developing the blots in a solution containing 1 × BCIP/NBT (5-bromo-4-chloro-3-indonyl phosphate/nitro blue tetrazolium) (Bio-Rad USA). E. coli outer membrane protein A (OmpA) was used as internal loading control for whole cell lysate. To determine the expression of OmpA among both groups of isolates, cell pellet of each isolate was suspended in cell lysis buffer and sonicated. The soluble fraction was run on SDSPAGE and immunoblot analysis was performed in a similar manner as described above using anti-OmpA polyclonal antibody (raised in mice) at a dilution of 1:5000. 2.16. Statistical analysis All experiments were done in triplicate and the results obtained from ELISA, oligopeptide substrate assay were expressed as mean ± SD. Statistical comparisons between two groups were done by Student’s t-test using GraphPad Prism software, version 5.0. P value < 0.05 was set as the level of statistical significance for all tests. 3. Results 3.1. Identification of YghJ from NSEC isolate EB260 The culture supernatant of NSEC isolate EB260 was proteolytically active against the pNA oligopeptide substrate (Fig. 1A) but not against casein and gelatin (data not shown) and was selected for our present study. The cell free concentrated culture supernatant showing protease activity was loaded onto DE-52 anion-exchange chromatographic column, the unbound fraction was eluted with 25 mM Tris-HCl (pH 7.4), bound fractions were eluted with gradient of NaCl (Data not shown), dialyzed, concentrated and protease activity was tested for each eluted fraction. The 0.2 N NaCl eluted fraction showed protease activity in oligopeptide substrate assay (Fig. 1B) which and was subsequently loaded onto Gel filtration chromatography column Sephadex G-200. Two peaks were eluted from Sephadex G-200 (Fig. 1C), of which pool I showed protease activity (Fig. 1B). The pool I of Sephadex G-200 fraction showed the presence of three bands in 7.5% SDS-PAGE (Fig. 1D). In-gel trypsin digestion was performed for the three bands and the resulting peptides were analyzed in positive reflector mode for accurate mass determination. The MS spectra were then analyzed using Mascot software for identification of the proteins. Matching proteins were found in the database by their peptide masses. Homologous proteins with the highest score have been taken into account. The 167 kDa band from SDS-PAGE revealed the presence of E. coli lipoprotein YghJ containing M60 metalloprotease domain (Fig. 1E). The other two bands showed homology with 36 kDa E. coli Outer membrane protein C (OmpC) and 35 kDa E. coli outer membrane protein A (OmpA) (Fig. 1D).

5

screened for positive clones using pBAD forward and yghJ reverse primers. Fig. 2B represents the amplified products after screening of some of the colonies that appeared on LA Amp plate. Among several positive clones, one clone was selected called pTYghJ7 and its entire 4.56-kb insert DNA was sequenced, analysed and submitted to the GenBank with the accession number KX245009. Extensive analysis of the sequence of the yghJ gene of the NSEC isolate EB260 indicated that it is highly homologous (98%) with the reported sequences of the same gene from other E. coli strains. 3.3. Expression and purification of rYghJ The recombinant clone pTYghJ7 was initially induced with different concentrations of l-arabinose (0.2% 0.02%, 0.002%, 0.0002% and 0.00002%) for 5 h. rYghJ was expressed in the soluble fraction of total cell lysate after induction. The arabinose concentrations of 0.2% 0.02% and 0.002% could induce the secretion of rYghJ with the optimal induction with 0.02% l-arabinose (Fig. 2C). The expression of rYghJ was further confirmed by immunoblot analysis with monoclonal anti-His antibody (Fig. 2D) and polyclonal anti-YghJ antibody raised in mice (Fig. 2E). The soluble fraction of whole cell lysate of TOP10 E. coli harbouring rYghJ was dialyzed against binding buffer (20 mM sodium phosphate, 0.5 M NaCl, 10 mM imidazole) and loaded onto Ni-NTA column, pre-equilibrated with binding buffer, washed with increasing concentration (40 mM) of imidazole and finally eluted with elution buffer containing 500 mM imidazole. Proteins eluted from Ni-NTA column was positive for protease activity and was subjected to further chromatography on Sephadex G-200 (Fig. 2G). The first eluted peak from Sephadex G200 showed single band of 167 kDa rYghJ on SDS-PAGE (Fig. 2F) and on NATIVE-PAGE (Fig. 2H) and was positive for protease activity. 3.4. Effect of inhibitors on protease activity Various protease inhibitors were used to test inhibitory activity against purified rYghJ, using Ala-Ala-Pro-Met-p-nitroanilide as a substrate. The protease activity of rYghJ was completely inhibited by EDTA (97%) and 1,10 phenanthroline (94%) and remained unchanged with PMSF, indicating that YghJ is a Zn++ containing metalloprotease (Fig. 3A). 3.5. Effect of pH on protease activity The pH dependence of proteolytic activity of rYghJ using pNA oligopeptide as a substrate showed activity over a broad range of pH values (from 2.4–10), with an optimum activity at pH 7.2 and minimum activity at pH 2.4. The enzyme retained 80–90% activity at pH 8–10 (Fig. 3B). 3.6. Effect of temperature on protease activity rYghJ showed maximum activity against pNA oligopeptide substrate at temperatures 37 ◦ C and 40 ◦ C and then decreased by almost 55% at 50 ◦ C. The protease activity decreased sharply in the temperature range from 20 ◦ C–30 ◦ C and at higher temperature ranges of 60–70 ◦ C, the protease activity was almost completely abolished (Fig. 3C). 3.7. Cytotoxic effect of YghJ on human intestinal epithelial cell lines

3.2. Cloning and DNA sequencing The PCR amplified product (∼4.56-kb) of yghJ (Fig. 2A) was cloned into pBAD TOPO expression vector (Invitrogen) using TA cloning kit. The ampicillin resistant colonies on LA Amp plate were

Cytotoxicity of YghJ was determined on Int407 (Fig. 4A–C), HT-29 (Fig. 4D–F) and HEK293 (data not shown). The cells were incubated with two different concentrations of purified rYghJ (60 nM and 120 nM) for 24 h at 37 ◦ C, and observed under phase

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model IJMM-51067; No. of Pages 12 6

ARTICLE IN PRESS R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

Fig. 1. Partial purification and identification of YghJ from neonatal septicemic E. coli (NSEC) isolate. (A) AAPM-pNA oligopeptide substrate assay with culture supernatant of clinical NSEC isolate EB260 showed protease activity. TSB was used as media control. The values shown are the means with standard deviations from three experiments. (B) Proteins eluted with 0.2 N NaCl showed protease activity. (C) Chromatographic profile of proteins eluted from Sephadex G-200 column loaded with 0.2 N NaCl eluted fraction. ‘++’ indicates presence of protease activity in Pool I. (D) SDS-PAGE (7.5%) profile of proteins eluted from the first peak of Sephadex G-200 column. The marked protein bands were analysed by MS/MS peptide sequencing and were identified as 167 kDa E. coli lipoprotein YghJ having M60 metalloprotease domain, 36 kDa E. coli outer membrane protein C (OmpC) and 35 kDa E. coli outer membrane protein A (OmpA). (E) The peptides of the 167 kDa band that showed homology with E. coli lipoprotein YghJ is shown in bold red. The HExxH metalloprotease domain is shown underlined.

contrast microscopy with a magnification of 40×. Clear cell rounding and distorted morphology was observed on all the cell lines tested in a dose dependent manner (Fig. 4B, C, E, F) compared to the untreated healthy control (Fig. 4A, D). 3.8. Induction of proinflammatory cytokines by YghJ Human intestinal epithelial cells HT-29 was initially stimulated with different doses of purified rYghJ for 6 h. IL-8 was found to be stimulated at a dose dependent manner and rYghJ could induce a significant and sustained release of IL-8 in the cell supernatant at a minimum concentration of 62.5 nM (Fig. 5A). With this initial standardization of the dose for rYghJ, HT-29 cells were then treated with 200 nM of purified rYghJ and incubated for 2, 4, 6, 8, 10, 18 and 24 h both in the absence or presence of 50 ␮g/ml of PMB, a potent antibiotic that binds and neutralizes LPS. The supernatants were analyzed at times indicated for the secretion of IL-8 by ELISA (Fig. 5B). In similar manner, we investigated the induction of other proinflammatory cytokines (Il-6, IL-1␣, IL-1␤, TNF-␣, IL-12p70) and an anti-inflammatory cytokine (IL-10) secreted from RAW 264.7 (mouse macrophages). RAW 264.7 cells were incubated with rYghJ at 200 nM for indicated time points in presence or absence of PMB (50 ␮g/ml) and the amount of cytokines expressed and secreted in the cell supernatant were then quantified by ELISA. The kinetics of LPS-induced IL-8 production showed that IL-8 was optimally stimulated at 4 h of post-treatment. The secretion of IL-8 was also optimum at 4 h of post-treatment of rYghJ in presence

of PMB, and was actually 11 ± 4 fold higher compared to the control of 0 h (80.638 ± 11 versus 7 ± 2.5 pg/ml; p < 0.0001) (Fig. 5B). The secreted IL-8 concentration decreased slightly at 6 h and thereafter further decreased by 1.3 fold and 1.6 fold at 8 h and 24 h of post-induction respectively. This indicates a sustained release throughout the time course studied, suggesting that a steady state has been reached. At 24 h of time point, the amount of IL-8 secreted in presence of PMB was 49.58 ± 14 pg/ml which was almost 7 fold higher than the respective level of control at the 0 h of time point (Fig. 5B). The production of TNF-␣, the member of TNF superfamily, was strikingly higher compared to the other cytokines studied even in the presence of PMB (Fig. 5C). The level of TNF-␣ in presence of PMB decreased slightly for all time course studied, indicating that LPS is not solely responsible for the production of TNF-␣. In our study, TNF-␣ was the earliest cytokine secreted in response to YghJ from mouse macrophage. TNF-␣ exhibited rapid kinetics of stimulation on induction with YghJ (as indicated by the level in presence of PMB), being induced as early as 2 h of treatment and showed remarkable increase compared to control at 0 h of time point (244.4 ± 31 versus 60.5 ± 20.3 pg/ml; p = 0.001). The level was found to be highest at 10 h of induction being 14.6 ± 3.3 fold higher compared to control (883.52 ± 66 versus 60.5 ± 20.3 pg/ml; p < 0.0001) (Fig. 5C). Likewise the members of IL-1 superfamily, the amount of TNF-␣ in the cell supernatant decreased only slightly after the optimum secretion and thereafter remained almost consistent till 24 h of detection.

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model IJMM-51067; No. of Pages 12

ARTICLE IN PRESS R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

7

Fig. 2. Cloning, expression and purification of YghJ. (A) yghJ (4.56 kb) was amplified from genomic DNA of NSEC isolate EB260 (lanes 1 and 2). Genomic DNA from ETEC H10407 was used as positive control (lane 3). Lane 4: negative control for PCR and MM denotes 1 Kb Plus DNA Ladder (Fermentas). (B) PCR confirmation of yghJ clone in pBAD TOPO vector. Screening for YghJ positive clone was done from E. coli colonies appeared on LA Amp plate. Lane 7 showed presence of yghJ. MM: 1 Kb Plus DNA Ladder (Fermentas). (C) SDS-PAGE profile of proteins from soluble fractions of total cell lysate after 5 h induction of TOP10 E. coli cells at 37 ◦ C with different percentages of l-arabinose [0.2% (lanes 2), 0.02% (lane 3) 0.002% (lane 4), 0.0002% (lane 5), 0.00002% (lane 6), and uninduced (lane 1). Immunoblot analysis with the soluble fraction of TOP10 E. coli cell lysate after 5 h of induction with 0.2% arabinose (lane 1), 0.02% (lane 2) and 0.002% (lane 3) using anti-His antibody (D) and anti-YghJ polyclonal antibody raised in mice (E). Lane 4 represents immunoblot of uninduced cell lysate. (F) SDS-PAGE (7.5%) profile of proteins from soluble fractions of uninduced total cell lysate (Lane 1), proteins from induced cell lysate (Lane 2), proteins eluted in the flow through after loading of sample in Ni-NTA column (Lane 3), proteins eluted with wash buffer (Lane 4), proteins eluted in two different fractions with elution buffer (lanes 5 and 6) and proteins in the first peak of Sephadex G-200 column chromatography (Lane 7) loaded with eluted fraction from Ni-NTA column. MM denotes molecular weight marker. (G) Chromatographic profile of proteins eluted from Sephadex G-200 column. ++ indicates that pool-I is positive for protease activity. (E) NATIVE-PAGE profile of proteins eluted in the pool I fraction from Sephadex G-200 column.

Fig. 3. Characterization of YghJ. (A) Effect of different protease inhibitors on proteolytic activity of rYghJ. PMSF, EDTA and 1,10 phenanthroline were used each at 10 mM concentration, incubated with 62 pM of purified rYghJ at 37 ◦ C for 1 h and protease activity was detected using pNA oligopeptide substrate. (B) Effect of pH and (C) temperature on proteolytic activity of rYghJ using pNA oligopeptide substrate.

Like TNF-␣, the levels of IL-1␣ (Fig. 5D) and IL-1␤ (Fig. 5E) did not decrease much in presence of PMB which means that in our study the production of members of IL-1 was majorly due to

rYghJ and not LPS. However, mouse macrophages released considerably smaller amounts of these two cytokines relative to TNF-␣ in response to YghJ. The gene expression and protein release of IL-

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model IJMM-51067; No. of Pages 12 8

ARTICLE IN PRESS R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

Fig. 4. Cytotoxic effect of YghJ on human intestinal epithelial cells. Monolayers of Int407 cells were treated with 60 nM of rYghJ (B) and 120 nM of rYghJ (C) which shows changes in cellular morphology as compared to the untreated control Int407 cells (A). Monolayers of HT-29 cells were treated with 60 nM (E) and 120 nM of rYghJ (F) shows alteration in morphology compared to untreated control cells (D).

1␣ (Fig. 5D) and IL-1␤ (Fig. 5E) was delayed by 1–2 h compared to TNF-␣ and was detected at 4 h of post-stimulation from where the levels exhibited a steady stimulation, followed by relatively slower decline and finally reached plateau at 24 h of detection. At 4 h, the level of secreted IL-1␣ was 71 ± 17 pg/ml compared to the control of 0 h which was 16 ± 7 pg/ml. Likewise TNF-␣, the level of IL-1␣ was found to be optimally induced at 10 h of time point, being 22 ± 4 fold higher than the corresponding level of the control at 0 h of time point (351 ± 30 vs 16 ± 7 pg/ml; p < 0.0001) and 17 ± 6 fold higher than the respective level of negative control (human recombinant elafin) at the same time point (351 ± 30 vs 21 ± 5 pg/ml; p < 0.0001) (Fig. 5D). The level of secreted IL-1␤ was also optimally induced at 10 h of time point which was 33 ± 13 fold and 15 ± 6 fold higher than the controls at 0 h of time point (333 ± 38 vs 10 ± 3 pg/ml; p = 0.0001) and negative control (recombinant elafin) at the sim-

ilar time point (333 ± 38 vs 22 ± 6 pg/ml; p < 0.0001) respectively (Fig. 5E). In contrary to IL-1 and TNF-␣, we could not find the induction of IL-6 in presence of PMB (Fig. 5F). The level of IL-6 in the culture supernatant could be detected at 4 h of rYghJ treatment in absence of PMB, after which it increased gradually and reached the optimum level at 10 h of post-stimulation. At this time point, the secretion of IL-6 was 43 ± 17.6 fold higher compared to the control of 0 h (900.7 ± 53 versus 21 ± 3 pg/ml; p < 0.0001), whereas the level in presence of PMB was similar to the negative control used in this study for all the time points. We found no stimulation of IL-12p70 from mouse macrophages either in the presence or in the absence of PMB (data not shown). To further validate the proinflammatory response of rYghJ, we elucidated the effect of rYghJ on the expression of a major anti-inflammatory cytokine implicated in neonatal

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model

ARTICLE IN PRESS

IJMM-51067; No. of Pages 12

R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

9

Fig. 5. Induction of IL-8 in HT-29 cells. Dose dependent induction of IL-8 on treatment with various concentrations of rYghJ on HT-29 cells for 4 h (A). IL-8 response with 200 nM of rYghJ on HT-29 cells for different time intervals in presence or absence of Polymyxin B (PMB). Human skin antimicrobial peptide elafin (Gene ID 5266) was cloned, expressed in TOP10 E. coli and purified in a similar way with that of YghJ. The recombinant protein elafin which did not show any proinflammatory response was used as negative control in our study (B). RAW264.7 cells were treated with 200 nM of rYghJ with and without PMB and the level of secreted TNF-␣ (C), IL-1␣ (D), IL-1␤ (E) and IL-6 (F) were measured through ELISA with recombinant human skin antimicrobial peptide elafin as negative control.

Table 2 Genotypic and phenotypic distribution of YghJ between septicemic and fecal E. coli isolates.

Genotypic distribution of YghJ by PCR Phenotypic distribution through Immunoblot

Septicemic isolates

Fecal isolates

78% 89%

54% 33%

sepsis, IL-10. Importantly, we detected no stimulation of IL-10 from mouse macrophages either in the presence or absence of PMB (data not shown). 3.9. Genotypic distribution of yghJ among different phylogroups of septicemic and fecal E. coli isolates Out of 40 septicemic isolates tested, 31 (78%) isolates were found to possess yghJ gene (Table 2). yghJ was found to be mostly prevalent among the isolates of phylogroup B2 (92%), followed by D (83%). A

significant occurrence of yghJ was also observed among the other phylogroups A (57%) and B1 (67%). Among the 28 fecal isolates tested, 15 isolates (54%) harboured yghJ gene. Hence, the prevalence of yghJ among the fecal isolates (54%) was found to be lesser than the septicemic isolates (78%) (Table 2). yghJ was most abundant among the fecal isolates of phylogroup B1 (57%). A moderate occurrence was also observed among the other groups, A (50%) and D (50%). 3.10. Phenotypic distribution of YghJ The presence (54%) of yghJ among the fecal isolates led us to investigate the expression and secretion of YghJ among both groups of isolates. Equal numbers of bacterial cells were taken for each isolate for immunoblot analysis. Immunoblots were performed with overnight grown culture supernatants after TCA precipitation, using anti-YghJ polyclonal antibody raised in mice (Fig. 6). Out of 31 septicemic isolates positive for presence of yghJ gene, 9 isolates were selected randomly for immunoblot analysis. Among

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model IJMM-51067; No. of Pages 12 10

ARTICLE IN PRESS R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

Fig. 6. Immunoblots for detection of expression and secretion of YghJ from NSEC and fecal E. coli isolates. Equal numbers of bacterial cells from both NSEC and fecal isolates after overnight growth in TSB were taken for immunoblot analysis. Proteins in overnight grown culture supernatants were precipitated using 100% TCA, and detected for presence of YghJ using anti-YghJ polyclonal antibody among septicemic E. coli isolates (A) and fecal E. coli isolates (C). The expression of OmpA, the internal loading control for whole cell lysate was also detected using anti-OmpA polyclonal antibody among the septicemic E. coli isolates (B) and fecal E. coli isolates (D). Lanes 1–9 in A & B represent different septicemic E. coli isolates and lanes 1–9 in C & D represent different fecal E. coli isolates.

these 9 isolates tested, 8 isolates (89%) were positive for expression and secretion of YghJ as detected by immunoblot analysis (Table 2, Fig. 6A). Interestingly, in case of fecal isolates, out of 9 isolates tested, 3 (33%) isolates were positive for the secretion of YghJ (Table 2, Fig. 6C). However, the expression of OmpA, the internal loading control used in the present study for whole cell lysate was uniform among all isolates selected from both the groups (Fig. 6B, D). 4. Discussion Extracellular or secreted proteases remain one of the essential VFs of pathogenic bacteria. These proteases sabotage host defence during infection by allowing penetration of the host tissue by pathogenic bacteria and hence are of immense importance in the progression of a disease. Neonatal sepsis continues to be a life-threatening disease condition. E. coli is one of the major pathogens in neonatal sepsis (Stoll et al., 2011). Several VFs are known to be involved in the pathogenesis of NSEC isolates. However, not much is known about the contribution of extracellular proteases in the pathogenesis of NSEC isolates. In an earlier study we reported the significantly higher prevalence of SPATEs among NSEC isolates compared to the fecal and environmental E. coli isolates. Our current study aimed at identification and purification of a novel protease from NSEC isolate and to establish its role in the virulence of E. coli isolates causing sepsis in newborns. Clinical isolates from our earlier study (which were positive for SPATE gene but no subtype could be detected in those isolates) were screened for the presence of secreted proteases by oligopeptide substrate assay. The culture supernatant of the NSEC isolate EB260 was found to be proteolytically active against pNA oligopeptide substrate and selected for our present study. Inhibition of the proteolytic activity with various inhibitors showed that the protease activity was inhibited by EDTA and 1,10 phenanthroline, indicating the presence of a Zn++-dependent metalloprotease. This protease was partially purified and identified by MS/MS peptide sequencing and revealed the presence of E. coli lipoprotein YghJ having M60 metalloprotease domain. We cloned, expressed and purified YghJ. Like the previous study by Luo et al. YghJ was found to be inactive against gelatin and casein (Luo et al., 2014) but was active against pNA oligopeptide substrate. YghJ was found to be optimally active at pH 7–8 which supports the fact that YghJ can degrade small intestinal mucins. We elucidated the optimum temperature for activity of YghJ at 37–40 ◦ C. This establishes the importance of this protease in terms of pathogenesis as human pathogens are mostly mesophiles and the virulence determinants should work optimally at this temperature. Sepsis is the systemic inflammatory response of host against an infection which involves the release of a series of endogenous mediators such as proinflammatory cytokines. Several recent studies have suggested proinflammatory cytokines as one of the important

diagnostic marker for early diagnosis of neonatal sepsis and these are critically implicated in sepsis related mortality and morbidity (Machado et al., 2014; Ng and Lam, 2010; Lam and Ng, 2008). Except bacterial LPS, no other VFs of the NSEC isolates has yet been identified for stimulating the proinflammatory response in neonatal host. We accessed the role of YghJ in triggering pro-inflammatory response in neonatal sepsis. A common limitation of the process for expressing recombinant proteins containing His-Tag in E. coli hosts is the contamination of recombinant protein with endotoxin (Salek-Ardakani et al., 2002). Endotoxin or LPS, a major component of the outer membrane of Gram-negative bacteria is known to signal through multiple receptors, resulting in the production of proinflammatory cytokines and chemokines such as TNF-␣, IL-1 and IL-6 (Ulevitch and Tobias 1995; Poltorak et al., 1998; Fattori et al., 1994). Among the components of LPS, the Lipid A moiety is mainly responsible for the immunostimulatory effects (Galanos et al., 1985; Raetz and Whitfield, 2002). LPS from recombinant proteins can be removed by the use of a natural cyclic cationic decapeptide, Polymyxin B (PMB). PMB, the Bacillus polymyxa-derived antibiotic binds with a very strong affinity to the Lipid A moiety of LPS and hence can block the LPSmediated proinflammation. Several studies have evidenced that PMB could successfully inhibit LPS-stimulated cytokines production (Cardoso et al., 2007; Van der Kleij et al., 2004). Studies have evidenced that PMB can also protect animals from the toxic effects of LPS and has been used to prevent septic shock (Ferrari et al., 2004; Gerard et al., 1993). We detected cytokine stimulation in presence of PMB to neutralize the effect of LPS in cytokine stimulation and to establish the role of rYghJ in the induction of different cytokines. The use of PMB in cultures of murine macrophages stimulated with recombinant YghJ completely abrogated the production of IL-6 in our study. IL-6 is known to be induced by LPS, IL-1 and TNF-␣ and has various effects including activation of B and T cells and modulation of haematopoiesis (Borden and Chin, 1994; Scheller and Rose-John, 2006). However, Preiser et al. showed that the injection of IL-6 did not produce a sepsis like state in contrast to TNF-␣ and IL-1 (Preiser et al., 1991). In another study, IL-6 has also been shown to promote anti-inflammatory responses despite having proinflammatory properties. Importantly, IL-6 inhibits the release of TNF-␣ and IL-1 (Schindler et al., 1990), the two major cytokines produced on stimulation with rYghJ in presence of PMB. Therefore, this might be a reason for the down regulation of IL-6 by rYghJ. In contrary to IL-6, the induction of TNF-␣, IL-1␣ and IL-1␤ have not altered significantly in presence of PMB. TNF-␣ and IL-1 are the most extensively studied cytokines in sepsis pathophysiology and according to previous studies, together with IL-1, TNF-␣ is one of the first mediators identified at inflammatory sites (Schulte et al., 2013; Schouten et al., 2008). Both these cytokines synergistically activate macrophages for the production of other downstream cytokines and induce a shock like state (Dinarello, 1997). TNF-␣ also stimulates other immune and non-immune cells like neutrophils,

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model IJMM-51067; No. of Pages 12

ARTICLE IN PRESS R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

endothelial cells and stimulates the secretion of reactive oxygen and nitrogen species along with the array of cytokines (Cohen, 2002; Machado et al., 2014). All these actually amplify the proinflammatory response in sepsis. Our results showed remarkably higher production of TNF-␣ compared to other cytokines tested. Earlier studies have evidenced that in neonates, high levels of TNF␣ is related to the severity of the disease (Pickler et al., 2010). This actually brings into focus the potentially important role of YghJ to exacerbate the disease condition in neonates. The kinetics of the induction of TNF-␣ was found to precede by 1–2 h when compared to the expression of IL-1␣, IL-1␤ and IL-8 which is in agreement with the previous clinical and experimental studies which reported TNF-␣ as an early mediator of sepsis (Schouten et al., 2008; Schulte et al., 2013; Shannon et al., 2007). These results further corroborate the role of TNF-␣ as a reliable biomarker for detection of early onset sepsis. In contrary, the secretion of the members (IL-1␣ and IL-1␤) of IL-1 superfamily was delayed by 1–2 h relative to TNF-␣. However, previous reports have indicated IL-1 as the proximal mediator of inflammation, being released in a timely manner similar to TNF-␣ (Dinarello, 1997; Schulte et al., 2013). The levels of both the cytokines IL-1␣ and IL-1␤ peaked at 10 h after treatment and subsequently both of them declined in due course of time. The short half-life of these cytokines and their interaction with soluble receptors specific to each cytokine (O’Neill, 2008) could be a reason for making the detection of the members of IL-1 difficult at later time periods. Unlike TNF-␣, IL-1␣ and IL-1␤, the induction of IL-8 was down regulated in presence of PMB but not completely abrogated like IL-6. The level of secreted IL-8 was almost 11 fold higher on treatment with rYghJ in presence of PMB compared to the control at 0 h of treatment. IL-8 is a multifunctional cytokine with chemotactic actions, and belongs to a large group of cytokines named chemokines. IL-8 is involved in acute and chronic inflammatory processes (Heinzmann et al., 2004). It has potent proangiogenic properties in vitro and in vivo (Belperio et al., 2000). The induction kinetics of IL-8 differed from that of TNF-␣, IL-1␣ and IL-1␤. rYghJ induced IL-8 stimulation was optimum at 4 h of post-stimulation compared to the other cytokines which were optimally induced at 10 h of post-treatment. The existing difference in the kinetics of various cytokines induction actually reflects the functional diversity of these mediators. Our results also showed that YghJ could not stimulate the production of IL-12 from mouse macrophages. According to previous studies, the role of IL-12 in sepsis remains controversial. It was reported that survivors from severe sepsis produce more IL-12 from LPS-stimulated peripheral blood mononuclear cells (PBMCs) than non-survivors (Stanilova et al., 2005). Similarly it has also been found that defect in IL-12 production in patients undergoing major visceral surgery increases the risk of sepsis (Weighardt et al., 2002). So, IL-12 has been suggested to be a defensive factor of the host in these studies. Keeping this in mind, we can conclude that the lack of YghJ-induced IL-12 production actually reflects the role of YghJ in promoting proinflammation in neonatal sepsis and inhibiting the production of such cytokines that may have a role in preventing inflammation. Our study demonstrates that YghJ not only promotes the induction of proinflammatory cytokines but also prevents the production of anti-inflammatory cytokines. IL-10, which is produced by different immune cells including monocytes, macrophages, T lymphocytes and B lymphocytes is known to prevent the excess proinflammatory response during sepsis (Schultz et al., 2007). IL10 not only suppresses the production of several proinflammatory cytokines, but also induces the production of IL-1 receptor antagonist protein (IRAP-1) and soluble TNFR, hence reducing circulating concentration of these cytokines. The reduced production of IL-10

11

in our study reinforced the role of YghJ in promoting proinflammation in neonatal sepsis. We also determined the distribution of YghJ among the isolates of septicemic and fecal E. coli. Our results showed that YghJ is widely distributed among both groups of isolates, although the prevalence is less among the fecal isolates compared to the septicemic isolates (78% vs 54%). This is similar with the previous results obtained by Moriel et al. where YghJ was found to be widely distributed among a diverse pathotypes of E. coli including ExPEC and commensal isolates. The occurrence of yghJ gene among the fecal E.coli isolates directed us to determine the expression and secretion of YghJ in both groups of isolates. Our data revealed that the expression and secretion of YghJ is significantly higher among the septicemic isolates compared to the fecal E. coli isolates (89% vs 33%). This is in contrary to the previous study of Moriel et al. which showed that YghJ was expressed in the commensal isolates tested but failed to be secreted from these isolates (Moriel et al., 2010). In our study, we performed the detection of YghJ on immunoblot from culture supernatant of the isolates, confirming the expression and secretion of YghJ from the commensal isolates. However, the prevalence of YghJ among the fecal E. coli isolates was less as compared to the NSEC isolates. It is important to note that in their earlier study, Luo et al. has shown that E. coli commensal isolates HS and Nissle 1917 secrete comparatively little YghJ compared to clinical ETEC isolates (Luo et al., 2014). In summary, we identified YghJ from a clinical NSEC isolate and showed that though YghJ is present among fecal isolates, the expression and secretion is significantly lower among the fecal isolates than the NSEC isolates. Furthermore, we report for the first time that YghJ exhibits cytotoxicity to murine macrophages and human intestinal epithelial cell lines and can stimulate the production of proinflammatory cytokines and also down-regulates the production of anti-inflammatory cytokines, indicating YghJ as one of the essential factors contributing to the pathogenesis of sepsis. Acknowledgements This work was supported by intramural funding (Indian Council of Medical Research) (ICMR). RT was supported by a fellowship from University Grants Commission (UGC), India. We would like to thank Dr. Santa Sabuj Das, Scientist E, Division of Clinical Medicine for his valuable suggestions and Ms. Somdatta Chatterjee, Division of Bacteriology, NICED for technical assistance. References Belperio, J.A., Keane, M.P., Arenberg, D.A., Addison, C.L., Ehlert, J.E., Burdick, M.D., Strieter, R.M., 2000. CXC chemokines in angiogenesis. J. Leukoc. Biol. 68, 1–8. Borden, E.C., Chin, P., 1994. Interleukin-6: a cytokine with potential diagnostic and therapeutic roles. J. Lab. Clin. Med. 123, 824–829. Camacho-Gonzalez, A., Spearman, P.W., Stoll, B.J., 2013. Neonatal infectious diseases: evaluation of neonatal sepsis. Pediatr. Clin. North. Am. 60, 367–389. Cardoso, L.S., Araujo, M.I., Goes, A.M., Pacifico, L.G., Oliveira, R.R., Oliveira, S.C., 2007. Polymyxin B as inhibitor of LPS contamination of Schistosoma mansoni recombinant proteins in human cytokine analysis. Microb. Cell Fact. 6, 1, http://dx.doi.org/10.1186/1475-2859-6-1. Chapman, T.A., Wu, X.Y., Barchia, I., Bettelheim, K., Driesen, S., Trott, D.J., Wilson, M.R., Chin, J., 2006. Comparison of virulence gene profiles of Escherichia coli strains isolated from healthy and diarrheic swine. Appl. Environ. Microbiol. 72, 4782–4795. Cohen, J., 2002. The immunopathogenesis of sepsis. Nature 420, 885–891. Dinarello, C.A., 1997. Proinflammatory and anti-inflammatory cytokines as mediators in the pathogenesis of septic shock. Chest 112, 321S–329S. Fattori, E., Cappelletti, M., Costa, P., Sellitto, C., Cantoni, L., Carelli, M., Faggioni, R., Fantuzzi, G., Ghezzi, P., Poli, V., 1994. Defective inflammatory response in interleukin 6-deficient mice. J. Exp. Med. 180, 1243–1250. Ferrari, D., Pizzirani, C., Adinolfi, E., Forchap, S., Sitta, B., Turchet, L., Falzoni, S., Minelli, M., Baricordi, R., Di Virgillo, F., 2004. The antibiotic polymyxin B modulates P2X7 receptor function. J. Immunol. 173, 4652–4660. Galanos, C., Luderitz, O., Rietschel, E.T., Westphal, O., Brade, H., Brade, L., Freudenberg, M., Schade, U., Imoto, M., Yoshimura, H., Kusumoto, H., Shiba, T.,

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003

G Model IJMM-51067; No. of Pages 12 12

ARTICLE IN PRESS R. Tapader et al. / International Journal of Medical Microbiology xxx (2016) xxx–xxx

1985. Synthetic and natural Escherichia coli free lipid A express identical endotoxic activities. Eur. J. Biochem. 148, 1–5. Gerard, C., Bruyns, C., Marchant, A., Abramowicz, D., Vandenabeele, P., Delvaux, A., Fiers, W., Goldman, M., Velu, T., 1993. Interleukin 10 reduces the release of tumor necrosis factor and prevents lethality in experimental endotoxemia. J. Exp. Med. 177, 547–550. Heinzmann, A., Ahlert, I., Kurz, T., Berner, R., Deichmann, K.A., 2004. Association study suggests opposite effects of polymorphisms within IL-8 on bronchial asthma and respiratory syncytical virus bronchiolitis. J. Allergy Clin. Immunol. 114, 671–676. Hornik, C.P., Fort, P., Clark, R.H., Watt, K., Benjamin Jr., D.K., Smith, P.B., Manzoni, P., Jacqz-Aigrain, E., Kaguelidou, F., Cohen-Wolkowiez, M., 2012. Early and late onset sepsis in very-low-birth-weight infants from a large group of neonatal intensive care units. Early Hum. Dev. 88, S69–74. Lahariya, C., Paul, V.K., 2010. Burden, differentials, and causes of child deaths in India. Indian J. Pediatr. 77, 1312–1321. Lam, H.S., Ng, P.C., 2008. Biochemical markers of neonatal sepsis. Pathology (Phila.) 40, 141–148. Lin, C.Y., Hsu, C.H., Huang, F.Y., Chang, J.H., Hung, H.Y., Kao, H.A., Peng, C.C., Jim, W.T., Chi, H., Chiu, N.C., Chang, T.Y., Chen, C.Y., Chen, C.P., 2011. The changing face of early-onset neonatal sepsis after the implementation of a maternal group B Streptococcus screening and intrapartum prophylaxis policy—a study in one medical center. Pediatr. Neonatol. 52, 78–84. Liu, L., Oza, S., Hogan, D., Perin, J., Rudan, I., Lawn, J.E., Cousens, S., Mathers, C., Black, R.E., 2015. Global, regional, and national causes of child mortality in 2000–13, with projections to inform post-2015 priorities: an updated systematic analysis. Lancet 385, 430–440. Luo, Q., Kumar, P., Vickers, T.J., Sheikh, A., Lewis, W.G., Rasko, D.A., Sistrunk, J., Fleckenstein, J.M., 2014. Enterotoxigenic Escherichia coli secretes a highly conserved mucin-degrading metalloprotease to effectively engage intestinal epithelial cells. Infect. Immun. 82, 509–521. Luo, Q., Qadri, F., Kansal, R., Rasko, D.A., Sheikh, A., Fleckenstein, J.M., 2015. Conservation and immunogenicity of novel antigens in diverse isolates of enterotoxigenic Escherichia coli. Plos Negl. Trop. Dis. 9 (1), e0003446, http://dx. doi.org/10.1371/journal.pntd.0003446. Machado, J.R., Soave, D.F., Silva, M.V., Menezes, L.B., Etchebehere, R.M., Monteiro, M.L.G.R., Reis, M.A., Corrˆe, R.R.M., Celes, M.R.N., 2014. Neonatal sepsis and inflammatory mediators. Mediators Inflamm. 2014 (Article ID 269681, 10 pages). Marokhazi, J., Lengyel, K., Pekar, S., Felfoldi, G., Patthy, A., Graf, L., Fodor, A., Venekei, I., 2004. Comparison of proteolytic activities produced by entomopathogenic Phootorhabdus bacteria: strain- and phase-dependent heterogeneity in composition and activity of four enzymes. Appl. Environ. Microbiol. 70, 7311–7320. Massaoud, M.K., Marokhazi, J., Fodor, A., Venekei, I., 2010. Proteolytic enzyme production by strains of the insect pathogen Xenorhabdus and characterization of an early-log-phase-secreted protease as a potential virulence factor. Appl. Environ. Microbiol. 76, 6901–6909. Mokady, D., Gophna, U., Ron, E.Z., 2005. Virulence factors of septicemic Escherichia coli strains. Int. J. Med. Microbiol. 295, 455–462. Moriel, D.G., Bertoldi, I., Spagnuolo, A., Marchi, S., Rosini, R., Nesta, B., Pastorello, I., Corea, V.A.M., Torricelli, G., Cartocci, E., Savino, S., Scarselli, M., Dobrindt, U., Hacker, J., Tettelin, H., Tallon, L.J., Sullivan, S., Wieler, L.H., Ewers, C., Pickard, D., Dougan, G., Fontana, M.R., Rappuoli, R., Pizza, M., Serino, L., 2010. Identification of protective and broadly conserved vaccine antigens from the genome of extraintestinal pathogenic Escherichia coli. Proc. Natl. Acad. Sci. 107, 9072–9077. Nakjang, S., Ndeh, D.A., Wipat, A., Bolam, D.N., Hirt, R.P., 2012. A novel extracellular metallopeptidase domain shared by animal host-associated mutualistic and pathogenic microbes. PLoS One 7, e30287. Netea, M.G., van der Meer, J.W., van Deuren, M., Kullberg, B.J., 2003. Proinflammatory cytokines and sepsis syndrome: not enough, or too much of a good thing? Trends Immunol. 24, 254–258. Ng, P.C., Lam, H.S., 2010. Biomarkers for late-onset neonatal sepsis: cytokines and beyond. Clin. Perinatol. 37, 599–610. O’Neill, L.A.J., 2008. The interleukin-1 receptor/Toll-like receptor superfamily: 10 years of progress. Immunol. Rev. 226, 10–18. Paolucci, M., Landini, M.P., Sambri, V., 2012. How can the microbiologist help in diagnosing neonatal sepsis? Int. J. Pediatr. 2012 (Article ID 120139, 14 pages.). Pickler, R., Brown, L., McGrath, J., Lyon, D., Rattican, D., Cheng, C.Y., Howland, L., Jallo, N., 2010. Integrated review of cytokines in maternal, cord, and newborn blood: part II—associations with early infection and increased risk of neurologic damage in preterm infants. Biol. Res. Nurs. 11, 377–386. Poltorak, A., He, X., Smirnova, I., Liu, M.Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B., Beutler, B., 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282, 2085–2088.

Preiser, J.C., Schmartz, D., Van der Linden, P., Content, J., Vanden Bussche, P., Buurman, W., Sebald, W., Dupont, E., Pinsky, M.R., Vincent, J.L., 1991. Interleukin-6 administration has no acute hemodynamic or hematologic effect in the dog. Cytokine 3, 1–4. Raetz, C.R., Whitfield, C., 2002. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 71, 635–700. Ron, E.Z., 2010. Distribution and evolution of virulence factors in septicemic Escherichia coli. Int. J. Med. Microbiol. 300, 367–370. Salek-Ardakani, S., Stuart, A.D., Arrand, J.E., Lyons, S., Arrand, J.R., Mackett, M., 2002. High level expression and purification of the Epstein-Barr virus encoded cytokine viral interleukin 10: efficient removal of endotoxin. Cytokine 17, 1–13. Scheller, J., Rose-John, S., 2006. Interleukin-6 and its receptor: from bench to bedside. Med. Microbiol. Immun. 195, 173–183. Schindler, R., Mancilla, J., Endres, S., Ghorbani, R., Clark, S.C., Dinarello, C.A., 1990. Correlations and interactions in the production of interleukin-6 (IL-6), IL-1, and tumor necrosis factor (TNF) in human blood mononuclear cells: IL-6 suppresses IL-1 and TNF. Blood 75, 40–47. Schouten, M., Wiersinga, W.J., Levi, M., Van Der Poll, T., 2008. Inflammation, endothelium, and coagulation in sepsis. J. Leukoc. Biol. 83, 536–545. Schulte, W., Bernhagen, J., Bucala, R., 2013. Cytokines in sepsis: potent immunoregulators and potential therapeutic targets—an updated view. Mediators Inflamm. 2013 (Article ID 165974, 16 pages.). Schultz, C., Strunk, T., Temming, P., Matzke, N., Hartel, C., 2007. Reduced IL-10 production and -receptor expression in neonatal T lymphocytes. Acta Paediatr. 96, 1122–1125. Shannon, E., Noveck, R., Sandoval, F., Kamath, B., Kearney, M., 2007. Thalidomide suppressed interleukin-6 but not tumor necrosis factor-alpha in volunteers with experimental endotoxemia. Transl. Res. 150, 275–280. Sikora, J.P., Chlebna Sokol, D., Krzyzanska-Oberbek, A., 2001. Proinflammatory cytokines (IL-6, IL-8), cytokine inhibitors (IL-6sR, sTNFRII) and anti-inflammatory cytokines (IL-10, IL-13) in the pathogenesis of sepsis in newborns and infants. Arch. Immunol. Ther. Exp. 49, 399–404. Singh, M., Narang, A., Bhakoo, O.N., 1994. Predictive perinatal score in the diagnosis of neonatal sepsis. J. Trop. Pediatr. 40, 365–368. Stanilova, S.A., Karakolev, Z.T., Dimov, G.S., Dobreva, J.G., Miteva, L.D., Slavov, E.S., Stefanov, C.S., Stanilov, N.S., 2005. High interleukin 12 and low interleukin 10 production after in vitro stimulation detected in sepsis survivors. Intensive Care Med. 31, 401–407. Stoll, B.J., Hansen, N.I., Sánchez, P.J., Faix, R.G., Poindexter, B.B., Meurs, K.P., Bizzarro, M.J., Goldberg, R.N., Frantz, I.D., Hale, E.C., Shankaran, S., Kennedy, K., Carlo, W.A., Watterberg, K.L., Bell, E.F., Walsh, M.C., Schibler, K., Laptook, A.R., Shane, A.L., Schrag, S.J., Das, A., Higgins, R.D., 2011. Early onset neonatal sepsis: the burden of group B Streptococcal and E. coli disease continues. Pediatrics 127, 817–826. Syngkon, A., Elluri, S., Koley, H., Rompikuntal, P.K., Saha, D.R., Chakrabarti, M.K., Bhadra, R.K., Wai, S.N., Pal, A., 2010. Studies on a novel serine protease of a hapAprtV Vibrio cholerae O1 strain and its role in hemorrhagic response in the rabbit ileal loop model. PLoS One 5, 1–11. Tapader, R., Chatterjee, S., Singh, A.K., Dayma, P., Haldar, S., Pal, A., Basu, S., 2014. The high prevalence of serine protease autotransporters of Enterobacteriaceae (SPATEs) in Escherichia coli causing neonatal septicemia. Eur. J. Clin. Microbiol. Infect. Dis. 33, 2015–2024. Ulevitch, R.J., Tobias, P.S., 1995. Receptor-dependent mechanisms of cell stimulation by bacterial endotoxin. Annu. Rev. Immunol. 13, 437–457. Van der Kleij, D., Van den Biggelaar, A.H., Kruize, Y.C., Retra, K., Fillie, Y., Schmitz, M., Kremsner, P.G., Tielens, A.G., Yazdanbakhsh, M., 2004. Responses to Toll-like receptor ligands in children living in areas where schistosome infections are endemic. J. Infect. Dis. 189, 1044–1051. Watt, S., Lanotte, P., Mereqhetti, L., Moulin, S.M., Picard, B., Quentin, R., 2003. Escherichia coli strains from pregnant women and neonates: intraspecies genetic distribution and prevalence of virulence factors. J. Clin. Microbiol. 41, 1929–1935. Weighardt, H., Heidecke, C., Westerholt, A., Emmanuilidis, K., Maier, S., Veit, M., Gerauer, K., Matevossian, E., Ulm, K., Siewert, J.R., Holzmann, B., 2002. Impaired monocyte IL-12 production before surgery as a predictive factor for the lethal outcome of postoperative sepsis. Ann. Surg. 235, 560–567. Weston, E.J., Pondo, T., Lewis, M.M., Martell-Cleary, P., Morin, C., Jewell, B., Daily, P., Apostol, M., Petit, S., Farley, M., Lynfield, R., Reingold, A., Hansen, N.I., Stoll, B.J., Shane, A.L., Zell, E., Schrag, S.J., 2011. The burden of invasive early-onset neonatal sepsis in the United States, 2005–2008. Pediatr. Infect. Dis. J. 30, 937–941. Zaidi, A.K., Thaver, D., Ali, S.A., Khan, T.A., 2011. Pathogens associated with sepsis in newborns and young infants in developing countries. Pediatr. Infect. Dis. J. 28, S10–S18.

Please cite this article in press as: Tapader, R., et al., Role in proinflammatory response of YghJ, a secreted metalloprotease from neonatal septicemic Escherichia coli. Int. J. Med. Microbiol. (2016), http://dx.doi.org/10.1016/j.ijmm.2016.06.003