- Email: [email protected]
Role of CCR2 in macrophage migration into the liver during acetaminophen-induced hepatotoxicity in the mouse
Role of CCR2 in Macrophage Migration Into the Liver During Acetaminophen-Induced Hepatotoxicity in the Mouse Donna M. Dambach,1,2 Linda M. Watson,2 Kevin R. Gray,2 Stephen K. Durham,2 and Debra L. Laskin1 The biological effects of monocyte chemoattractant protein (MCP) 1 are mediated by binding to C-C chemokine receptor (CCR) 2. In the present studies, we used CCR2 knockout (CCR2ⴚ/ⴚ) mice to examine the role of MCP-1 in acetaminophen-induced macrophage accumulation in the liver, expression of inflammatory cytokines, and hepatotoxicity. We found that hepatic expression of CCR2 and MCP-1 was increased 10-fold and 20-fold, respectively, 12 to 72 hours after administration of acetaminophen to wild-type mice. Expression of these proteins was localized in centrilobular regions of the liver. Whereas MCP-1 was expressed by both hepatocytes and macrophages, CCR2 was identified in inflammatory macrophages. F4/80 is a marker of mature macrophages expressed in large quantities by Kupffer cells. In wild-type mice, a 75% decrease in F4/80-positive macrophages was observed 24 to 48 hours after administration of acetaminophen. In contrast, expression of macrosialin (CD68), a marker of activated macrophages, increased 2-fold 24 to 72 hours after administration of acetaminophen and was associated with inflammatory cells. Although there was a decrease in the overall severity of inflammation and in the number of macrosialin-positive macrophages 72 hours after administration of acetaminophen in CCR2ⴚ/ⴚ mice, the number of F4/80-positive cells did not change. Loss of CCR2 was also found to alter acetaminophen-induced expression of tumor necrosis factor ␣, monocyte chemoattractant protein 3, and KC/gro. However, the overall outcome of acetaminopheninduced hepatic injury was not affected. In conclusion, these data indicate that MCP-1 and CCR2 contribute to the recruitment of a subset of activated macrophages into the liver during acetaminophen-induced hepatotoxicity that may be important in resolution of tissue injury. (HEPATOLOGY 2002;35:1093-1103.)
A
cetaminophen is an analgesic and antipyretic agent that induces liver injury characterized by centrilobular hepatocellular necrosis when ingested in excessive amounts.1-3 In addition to metabolism-based, direct hepatocellular damage, recent studies
Abbreviations: MCP, monocyte chemoattractant protein; CCR, C-C chemokine receptor; TNF, tumor necrosis factor; IL, interleukin; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; mRNA, messenger RNA; ALT, alanine aminotransferase. From the 1Department of Pharmacology and Toxicology, Rutgers University, Piscataway, NJ; and 2Pharmaceutical Research Institute, Bristol-Myers Squibb, Princeton, NJ. Received July 31, 2001; accepted February 16, 2002. Supported by National Institutes of Health grants GM34310, ES06897, ES04738, and ES05022. Address reprint requests to: Debra L. Laskin, Ph.D., Department of Pharmacology and Toxicology, Rutgers University, 160 Frelinghuysen Road, Piscataway, NJ 08854. E-mail: [email protected]; fax: 732-445-2534. Copyright © 2002 by the American Association for the Study of Liver Diseases. 0270-9139/02/3505-0012$35.00/0 doi:10.1053/jhep.2002.33162
have shown that inflammatory mediators released by parenchymal and nonparenchymal cells as well as infiltrating macrophages contribute to the progression of hepatotoxicity.4-6 The importance of macrophages in the pathogenesis of injury has been established by the finding that inhibition of these cells by compounds such as dextran sulfate or gadolinium chloride abrogates acetaminophen-induced hepatotoxicity.7,8 Chemotactic cytokines are known to be critical mediators of inflammatory cell trafficking into sites of injury.9,10 One of the most potent chemokines identified for monocytes and macrophages is monocyte chemoattractant protein (MCP) 1, which acts by binding to the C-C chemokine receptor (CCR) 2.11-13 MCP-1 levels have been reported to be elevated in the liver after administration of hepatotoxic doses of carbon tetrachloride, endotoxin, or alcohol to experimental animals as well as in chronic hepatitis in humans.14-16 A variety of liver cells express MCP-1, including macrophages, stellate cells, and 1093
1094
DAMBACH ET AL.
endothelial cells.13,17 Expression is induced by oxidative stress, endotoxin, and proinflammatory cytokines such as tumor necrosis factor (TNF) ␣, interleukin (IL) 1, and interferon ␥.17 Treatment of hepatocytes in vitro with acetaminophen results in the elaboration of at least one macrophage chemotactic factor; however, this factor has not been identified.18 The objectives of the present studies were to determine if levels of MCP-1 and its receptor, CCR2, are increased during acetaminophen-induced hepatotoxicity. The role of MCP-1 and CCR2 in the development and outcome of hepatotoxicity was also assessed.
Materials and Methods Animals and Treatments. Male mice (7-9 weeks old) were used for all experiments. Wild-type mice (129Sv ⫻ ICR or 129Sv/J ⫻ C57bl/6) were purchased from Jackson Laboratories (Bar Harbor, ME). CCR2 knockout mice (129Sv/ICR)11 were obtained from Dr. R. Bravo (Bristol-Myers Squibb, Princeton, NJ). MCP-1 knockout mice (129Sv/J/C57bl/6)19 were kindly provided by Dr. B. Rollins (Dana Farber Cancer Institute, Boston, MA). Animals were housed at 21°C on a 12-hour light/dark cycle in polycarbonate cages and were maintained in accordance with National Institutes of Health guidelines. Mice were fasted overnight (16-18 hours) before administration of a single intraperitoneal dose of acetaminophen (Sigma Chemical Co., St. Louis, MO) dissolved in sterile phosphate-buffered saline (PBS, pH 7.4) warmed to 45°C. Animals were administered 300 mg/kg acetaminophen unless indicated otherwise. Control mice received a similar volume of PBS. Groups of mice (n ⫽ 5-20) were killed 1 to 72 hours after treatment by carbon dioxide inhalation, and blood was collected from the abdominal vena cava. Serum was separated and stored at ⫺70°C until analysis. The liver was removed and divided into sections. These sections were immediately snap frozen in liquid nitrogen and stored at ⫺70°C for biochemical analyses, frozen in OCT cryopreservation compound (TissueTek, Torrance, CA) and stored at ⫺70°C for in situ hybridization and immunohistochemical analysis, or immersion fixed in 10% neutral buffered formalin for histologic examination. Reverse-Transcription Polymerase Chain Reaction. Total RNA was extracted from 100- to 200-mg aliquots of frozen liver using TRIzol reagent (Life Technologies, Gaithersburg, MD). After treatment with deoxyribonuclease I (Life Technologies), complementary DNA was synthesized from 1 g RNA using the Superscript First Strand Synthesis System and oligo(dT)12-18 primers (Life Technologies). Complementary DNA (25 ng) was ampli-
HEPATOLOGY, May 2002
fied using an ABI 5700 GeneAmp thermocycler programmed for the following polymerase chain reaction (PCR) conditions: one 2-minute cycle at 50°C, one 10minute cycle at 95°C, and 40 cycles at 95°C for 15 seconds, 55°C for 20 seconds, and 72°C for 1 minute. SYBR Green I fluorescence indicator dye-containing buffer (SYBR Green PCR Core Reagents Kit; ABI Biosystems, Foster City, CA) was used to detect product. Ct values (the number of cycles for the signal intensity to exceed an arbitrary threshold) in the exponential phase of amplification were determined. Target complementary DNA amplification efficiency and selectivity was determined by standard curves for each primer pair. As a control, the quantity of an endogenous “housekeeping” messenger RNA (mRNA) (hypoxanthine-guanine phosphoribosyltransferase) was measured and used to normalize the data. Pilot experiments were performed to establish that treatment of the mice with acetaminophen did not alter hypoxanthine-guanine phosphoribosyltransferase expression. A minimum of 5 samples was run for each experimental group, and all PCR samples were run in duplicate. Primer pairs used were as follows: MCP-1, AGCCAACTCTCACTGAAG and TGGAAAAGGTAGTGGATG; CCR2, TGGTAAATTCTTCAGCTTTTCC and TCCACAACCTGATAAAGCCTCC; TNF-␣, ATCTTCTCAAAATTCGAGTGACAAA and 5⬘-TGGGAGTAGACAAGGTACAACCC; IL-1, CCTCACAAGCAGAGCACAAG and AGAGGCAAGGAGGAAACACA; MCP-3, TGAAAACCCCAACTCCAAAG and CATTCCTTAGGCGTGACCAT; KC/gro, TGCGAAAAGAAGTGCAGAGA and CGAGACGAGACCAGGAGAAA; hypoxanthine-guanine phosphoribosyltransferase, GGTGGATACAGGCCAGACTTTGTTG and GATTCAACTTGCGCTCATCTTAGG. In Situ Hybridization. Livers frozen in OCT were cut into 12-m sections. These sections were fixed for 20 minutes in 4% formaldehyde followed by 2 minutes in PBS and 5 minutes in 0.1 mol/L triethanolamine. Sections were then incubated in a solution of 0.25% acetic anhydride in 0.1 mol/L triethanolamine for 10 minutes, dehydrated through a graded ethanol series, immersed in 100% chloroform for 15 minutes, and air dried. Tissue sections were hybridized with riboprobes (106 cpm) in buffer (0.36 mol/L NaCl, 20 mmol/L Tris-HCl, pH 7.4, 1 mmol/L ethylenediaminetetraacetic acid, pH 8.0, 50% formamide, 10% dextran sulfate, and 1⫻ Denhardt’s solution) for 16 to 20 hours at 60°C. The slides were then rinsed in 4⫻ saline sodium citrate and incubated with ribonuclease (20 g/mL; Life Technologies) for 30 minutes at 37°C. After washing with 0.1⫻ saline sodium citrate at 60°C, the slides were dehydrated through a graded ethanol series, air dried, and coated with NTB-2
HEPATOLOGY, Vol. 35, No. 5, 2002
emulsion (Eastman Kodak, Rochester, NY). The slides were developed and counterstained with hematoxylin. 35S-labeled riboprobes (sense and antisense) for CCR2 were generated by PCR amplification of a 320 – base pair fragment of CCR2 inserted into a TopoTA vector (Invitrogen, Carlsbad, CA). The cloned CCR2 sequence and orientation in the vector were verified by sequence analysis. MCP-1 riboprobes were generated from a sequenceverified MCP-1/JE EST (Genome Systems, Madison, WI). Riboprobes were synthesized by in vitro transcription (Riboprobe Combination Systems; Promega, Madison, WI) using 35S– uridine triphosphate (Amersham, Piscataway, NJ). Expression signals were detected by dark-phase microscopy. Cellular phenotype identification was by bright-field microscopy. Serum Transaminase and MCP-1 Protein Quantification. Serum alanine aminotransferase (ALT) was quantified using a Hitachi 704 chemistry analyzer (Roche Diagnostics, Indianapolis, IN). MCP-1 levels were measured by a commercially available enzyme-linked immunosorbent assay (Quantikine M; R&D Systems, Minneapolis, MN). Histologic Analysis. Tissue sections were scored for severity of injury and morphologic changes based on previously established methods.20 A severity score of 0 to 4 was used as follows: 0, no injury; 1, minimal injury (1%24% acinus affected); 2, mild injury (26%-50% acinus affected); 3, moderate injury (51%-75% acinus affected); and 4, severe injury (⬎75% acinus affected). The most prominent morphologic changes were scored as follows: 1, congestion; 2, fatty change or swelling; and 3, necrosis. A final injury score was obtained from the product of the severity and morphology scores. The severity of centrilobular inflammatory cell infiltration was scored separately as follows: 0, no inflammation; 1, minimal inflammation; 2, mild inflammation; 3, moderate inflammation; and 4, marked inflammation. Immunohistochemistry and Image Analysis. The number of macrophages present in the liver was determined using rat anti-mouse F4/80 and macrosialin (CD68) antibodies (Serotec, Raleigh, NC) and fluorescence microscopy. Briefly, frozen serial tissue sections were fixed in acetone at 4°C and then air dried. Sections were then blocked using a 5% normal rabbit serum/1% bovine serum albumin mixture followed by avidin D and biotin (Vector Labs, Burlingame, CA). Primary antibodies recognizing F4/80 (1:10) or macrosialin (1:50) were then applied to the sections for 1 hour. After washing in PBS, the slides were incubated with biotinylated anti-rat secondary antibody (1:100; Vector Labs) for 30 minutes at room temperature, washed 3 times in PBS, and incubated for 30 minutes with fluorescein isothiocyanate–la-
DAMBACH ET AL.
1095
beled streptavidin (1:50; Vector Labs). The sections were then treated with ribonuclease (1:40 vol/vol in PBS) for 20 minutes in the dark, followed by staining with propidium iodide (1:10; BD PharMingen, San Diego, CA) for 5 minutes in the dark. Rat immunoglobulin G was used as a negative control (Vector Labs). All reactions were performed at room temperature. The number of F4/80- or macrosialin-positive cells per 20⫻ centrilobular field was determined by morphometric analysis using the ImagePro Plus software package (Media Cybernetics, Silver Spring, MD). Five centrilobular areas were counted per tissue sample. Statistical Analysis. All experiments were repeated at least 3 times. ALT and reverse-transcription PCR expression data were analyzed by ANOVA followed by Tukey’s post-hoc analysis. Histologic scores were evaluated by Kruskal-Wallis nonparametric analysis. All statistics were performed using the SYSTAT 8.0 software package (SAS, Chicago, IL). Differences were considered significant at P ⬍ .05.
Results Effects of Acetaminophen Treatment of Mice on Macrophage Subpopulations in the Liver and Chemokine Expression. To characterize the phenotype of the macrophages that accumulate in the liver during acetaminophen-induced hepatotoxicity, antibodies against F4/80, which recognizes mature monocytes/macrophages,21,22 and macrosialin (CD68), which binds to activated macrophages,23,24 were used. In liver sections from wild-type mice, F4/80-positive macrophages were clearly identified within hepatic sinusoids (Fig. 1). Administration of acetaminophen to the mice resulted in a 75% decrease in F4/80-positive cells in centrilobular areas after 24 and 48 hours (Figs. 1 and 2). By 72 hours, the number of F4/80-positive cells returned toward control. In contrast, macrosialin, which was present in control Kupffer cells at low levels, increased in a time-dependent manner, reaching a maximum (2-fold) 48 hours after administration of acetaminophen to the mice (Figs. 1 and 2). Treatment of wild-type mice with acetaminophen resulted in time-dependent increases in mRNA for MCP-1 and its receptor, CCR2, in the liver. The increase reached a maximum after 24 to 48 hours with MCP-1 and after 48 to 72 hours with CCR2 (Fig. 3). By 72 hours after exposure, MCP-1 expression returned toward control levels. In contrast, CCR2 expression remained elevated. To analyze the cellular distribution of these proteins, we used in situ hybridization. Whereas MCP-1 mRNA was not detectable in the livers of control mice (Fig. 4A), expression of this chemokine was prominent and localized in centri-
1096
DAMBACH ET AL.
HEPATOLOGY, May 2002
Fig. 1. Effects of acetaminophen on F4/80- and macrosialin-positive macrophages in the liver. Liver sections were prepared 48 hours after treatment of wild-type mice with (A, C, and E) vehicle control or (B, D, and F) acetaminophen (AA). Sections were stained with (A and B) hematoxylin-eosin, (C and D) fluorescein isothiocyanate–labeled antiF4/80 antibody, or (E and F) fluorescein isothiocyanate–labeled anti-macrosialin antibody as described in Materials and Methods. (Original magnification ⫻200.)
lobular regions of the liver 12 to 24 hours after administration of acetaminophen (Fig. 4B and C). A similar pattern of expression of the macrophage marker lysozyme was observed in the tissue (Fig. 4E). Both hepatocytes and Kupffer cells were found to express MCP-1. CCR2 mRNA expression, although weaker than MCP-1, was also localized in centrilobular areas of the liver 24 hours after administration of acetaminophen and was associated with inflammatory cell foci (Fig. 5). These data are generally consistent with our reverse-transcription PCR studies. Effects of Administration of Acetaminophen on Chemokine Expression and Hepatic Injury in CCR2ⴚ/ⴚ Mice. To determine if MCP-1 contributes to acetaminophen-induced hepatic injury and macrophage recruitment into the liver, we used transgenic mice with a targeted disruption of the gene for CCR2. As expected, CCR2⫺/⫺ mice did not express significant quantities of CCR2 mRNA even after administration of acetaminophen (Fig. 3). Moreover, deficiency in CCR2 did not alter acetaminophen-induced levels of hepatic MCP-1 mRNA when compared with wild-type mice
(Fig. 3). Administration of acetaminophen to wild-type mice was also associated with a dose- and time-related increase in serum MCP-1 that paralleled the time course of hepatic MCP-1 mRNA expression (Fig. 6). In CCR2⫺/⫺ mice, serum MCP-1 protein levels were significantly elevated 12 and 24 hours after administration of acetaminophen when compared with wild-type mice (Fig. 6). We next quantified hepatic injury induced by administration of acetaminophen to wild-type and CCR2⫺/⫺ mice by measuring serum ALT levels and by histologic evaluation. In wild-type mice, treatment with acetaminophen (200 and 300 mg/kg) caused a time- and dosedependent increase in serum ALT levels beginning within 3 hours and peaking between 12 and 24 hours. By 72 hours, ALT levels in the group receiving 300 mg/kg decreased toward control levels (Table 1). In general, the response of CCR2⫺/⫺ mice to acetaminophen was similar; however, at the higher dose, there was a trend toward increased ALT levels at 12 and 24 hours when compared with wild-type mice (Table 1). Histologic evaluation of the livers confirmed these findings. Thus, the type and
HEPATOLOGY, Vol. 35, No. 5, 2002
DAMBACH ET AL.
1097
severity of injury that developed in the CCR2⫺/⫺ and wild-type mice were similar. However, disruption of the CCR2 gene caused a significant decrease in the overall severity of inflammation 72 hours after administration of acetaminophen when compared with wild-type mice (Table 2). Treatment of CCR2⫺/⫺ mice with acetaminophen resulted in a generally similar pattern of F4/80 expression in the liver as observed in the wild-type mice. Thus, a 75% decrease in F4/80-positive cells was observed in the knockout mice (Fig. 2). In contrast, the percentage of macrosialin-positive cells accumulating in the livers of CCR2⫺/⫺ mice 72 hours after administration of acetaminophen was significantly reduced when compared with wild-type mice (Fig. 2). To confirm that MCP-1 was acting through CCR2, hepatic injury induced by acetaminophen was compared in MCP-1⫺/⫺ and wild-type mice. Analysis of serum ALT levels showed a similar trend as observed in CCR2⫺/⫺ mice (Fig. 7). No significant differences were
Fig. 3. The effects of acetaminophen treatment of mice on MCP-1 and CCR2 expression in the liver. Wild-type (■) and CCR2⫺/⫺ (䊐) mice were treated with vehicle control (CTL) or acetaminophen. Liver samples were prepared 6 to 72 hours later, and MCP-1 and CCR2 mRNA expression was quantified by reverse-transcription PCR. Each bar represents the mean ⫾ SE of samples from 5 mice. *Significantly different from vehicle-treated control mice (P ⬍ .05).
Fig. 2. Quantitation of F4/80- and macrosialin-positive macrophages in the liver after administration of acetaminophen. Serial sections of liver were prepared 24 to 72 hours after treatment of wild-type (■) and CCR2⫺/⫺ (䊐) mice with vehicle control (CTL) or acetaminophen. The number of F4/80-positive and macrosialin-positive cells per 5 20⫻ centrilobular fields was quantified by morphometric analysis. Each bar represents the mean ⫾ SE of liver sections from 3 mice. *Significantly different (P ⬍ .05) from vehicle-treated mice. **Significantly different (P ⬍ .05) from wild-type mice.
apparent in the overall severity of injury or inflammatory infiltrates (Table 3). Alterations in Acetaminophen-Induced Cytokine Expression in CCR2ⴚ/ⴚ Mice. In our next series of studies, we analyzed the role of CCR2 in acetaminopheninduced alterations in hepatic inflammatory cytokine levels. Administration of acetaminophen to wild-type mice resulted in a time-dependent induction of hepatic TNF-␣ and IL-1 expression that peaked at 24 hours for TNF-␣ and at 12 to 24 hours for IL-1 (Fig. 8). Administration of acetaminophen also induced expression of the chemokines KC/gro and MCP-3 (Fig. 8). Maximal expression was observed after 12 hours for KC/gro and after 24 hours for MCP-3. In general, although the time course of cytokine expression in CCR2⫺/⫺ and wild-type mice was similar, some differences were observed in the quantities of mRNA expressed (Fig. 8). Thus, TNF-␣ expression was significantly greater in CCR2⫺/⫺ mice when compared with wild-type mice 24 hours after administration of acetaminophen. Moreover, MCP-3 levels remained el-
1098
DAMBACH ET AL.
HEPATOLOGY, May 2002
Fig. 4. In situ localization of MCP-1 mRNA in the liver after treatment of mice with acetaminophen. Frozen liver sections from (A) vehicle control mice and from mice (B) 12 hours or (C-E) 24 hours after treatment with acetaminophen or (F) 1 hour after administration of endotoxin (750 g/kg intraperitoneally) were hybridized with 35S-labeled antisense riboprobes for (A, B, C, and F) MCP-1, (D) a sense riboprobe for MCP-1, or (E) an antisense probe for lysozyme and analyzed by dark-field microscopy. One representative liver sample from 3 mice is shown. The arrow indicates positive hybridization focus. CV, central vein. (Original magnification ⫻125.)
evated for 72 hours. In CCR2⫺/⫺ mice, increases in KC/gro expression were significantly reduced up to 12 hours after administration of acetaminophen when compared with wild-type mice.
Discussion Macrophages have been implicated in the pathogenesis of hepatotoxicity induced by a number of diverse
chemicals, including acetaminophen.5 Tissue injury is believed to be mediated by cytotoxic and proinflammatory mediators released by these cells.5,25 In the present studies, we characterized macrophage subpopulations in the liver during acetaminophen-induced hepatotoxicity and the role of the monocyte/ macrophage chemokine, MCP-1, in mediating the responses of these cells.
Fig. 5. In situ localization of CCR2 mRNA in the liver after treatment of mice with acetaminophen. 35S-labeled (A-C) antisense or (D) sense riboprobes for CCR2 were hybridized to frozen liver sections prepared from mice 24 hours after administration of (A) control or (B-D) acetaminophen. One representative liver sample from 3 mice is shown. CV, central vein. (A and B) Dark-field microscopy; original magnification ⫻125. (C) Bright-field microscopy; original magnification ⫻250.
HEPATOLOGY, Vol. 35, No. 5, 2002
Fig. 6. The effect of acetaminophen treatment of mice on serum MCP-1 levels. (Upper panel) Serum was collected 1 to 24 hours after treatment of wild-type mice with vehicle control (CTL) or with 100 mg/kg or 200 mg/kg acetaminophen. (Lower panel) Serum was collected 1 to 24 hours after treatment of wild-type (WT) or CCR2⫺/⫺ mice with vehicle control or with 300 mg/kg acetaminophen. Each bar represents the mean ⫾ SE of 6 mice. *Significantly different (P ⬍ .05) from vehicle control. **Significantly different (P ⬍ .05) from wild-type mice.
A characteristic feature of acetaminophen-induced hepatotoxicity is the accumulation of macrophages in centrilobular regions of the tissue.5 We found that treatment of mice with acetaminophen resulted in distinct changes in the subpopulations of macrophages present in these regions. These consisted initially of a population of F4/80-positive resident Kupffer cells and subsequently a population of activated CD68-positive macrophages that appeared in the liver 24 to 48 hours after treatment. Thus, while the number of resident F4/80-positive Kupffer cells in centrilobular regions of the liver lobule decreased 24 to 48 hours after treatment with acetaminophen, a marked accumulation of CD68 macrosialin-positive inflammatory macrophages was observed at this time. Whereas the number of activated macrophages remained elevated 72 hours after exposure, the number of resident Kupffer cells returned to control levels. In macrophages, the pattern of expression of membrane receptors and antigens has been shown to reflect their state of activation.26-29 F4/80 is a 160-kd membrane-associated glycoprotein present on
DAMBACH ET AL.
1099
mouse macrophages and monocytes that is generally considered to be a marker for mature macrophages.21 It is highly expressed in the liver on Kupffer cells.22 Macrophage activation is associated with down-regulation of F4/80.30,31 The decrease in F4/80 expression in the liver that we observed after administration of acetaminophen provides support for the concept that resident Kupffer cells become activated during the pathogenesis of hepatotoxicity.4,5 Macrosialin, the murine homologue of human CD68, is a heavily glycosylated transmembrane protein and a member of the lysosomal-associated membrane protein family.23,32 In contrast to F4/80, expression of macrosialin is markedly up-regulated in activated inflammatory macrophages.33,34 Macrosialin specifically binds to oxidized low-density lipoproteins and is believed to play a role in scavenging these proteins when cells are damaged by oxidative stress.24 Oxidative damage is a wellestablished component of acetaminophen-induced hepatic injury.35 We speculate that macrosialin-positive cells contribute to reducing this damage and initiating wound repair. This is supported by our observation that these cells appear in the liver at a relatively late stage after administration of acetaminophen, after injury is well established. Although the loss of CCR2 did not alter the percentage of F4/80-positive macrophages in centrilobular regions of the liver, significantly fewer macrosialin-positive macrophages were observed 72 hours after treatment of the mice with acetaminophen. This was correlated temporally with a reduction in the severity of inflammation, suggesting that this subset of macrophages is an important component of the late inflammatory infiltrate. These findings confirm earlier reports that acet-
Fig. 7. Effects of administration of acetaminophen on serum ALT levels. Serum was collected 6 to 72 hours after treatment of wild-type (■) and MCP-1⫺/⫺ (䊐) mice with vehicle control (CTL) or acetaminophen. Each bar represents the mean ⫾ SE of 5 to 20 mice. No significant differences were observed between MCP-1⫺/⫺ and wild-type mice.
1100
DAMBACH ET AL.
HEPATOLOGY, May 2002
Table 1. Effects of Acetaminophen on Serum ALT Levels in Wild-Type and CCR2ⴚ/ⴚ Mice ALT (U/L) Mean ⴞ SE
Table 3. Histologic Evaluation of Hepatic Injury and Inflammatory Cell Infiltration in Wild-Type and MCP-1ⴚ/ⴚ Mice After Administration of Acetaminophen
Acetaminophen (mg/kg)
Time (hr)
Wild-Type
CCR2ⴚ/ⴚ
Hours After AA
Scores
Wild-Type
MCP-1ⴚ/ⴚ
100
6 12 24 6 12 24 1 3 6 12 24 48 72
101.7 ⫾ 19.8 80.5 ⫾ 12.2 136.5 ⫾ 21.1 1,365.2 ⫾ 530.3 732.5 ⫾ 314.8 4,274.6 ⫾ 1,257.9 85.6 ⫾ 32.9 1,484.4 ⫾ 265.9 7,793.6 ⫾ 2,096.6 9,009.7 ⫾ 1,898.4 8,469.7 ⫾ 961.2 2,956.0 ⫾ 1,335.1 468.0 ⫾ 67.5
78.3 ⫾ 16.4 124.0 ⫾ 39.1 167.6 ⫾ 56.4 1,183.7 ⫾ 485.7 3,511.1 ⫾ 1,544.1* 5,876.9 ⫾ 1,499.7 61.8 ⫾ 12.0 4,387.8 ⫾ 523.6 10,069.8 ⫾ 1,687.5 16,619.2 ⫾ 4,396.9 12,557.1 ⫾ 1,571.9 1,676.8 ⫾ 454.3 299.8 ⫾ 51.0
Control
Injury Inflammation Injury Inflammation Injury Inflammation Injury Inflammation
0 0 8.9 ⫾ 1.5 0.7 ⫾ 0.2 9.6 ⫾ 1.8 0.8 ⫾ 0.3 11.7 ⫾ 1.5 2.0 ⫾ 0.3
0 0 8.0 ⫾ 2.6 0.6 ⫾ 0.4 11.2 ⫾ 0.8 0.6 ⫾ 0.4 15.0 ⫾ 1.6 2.2 ⫾ 0.6
200
300
NOTE. Wild-type and CCR2⫺/⫺ mice were administered acetaminophen or vehicle control. Serum was collected 6 to 72 hours later and analyzed for ALT. Pooled vehicle control values were 70.8 ⫾ 12.1 for wild-type mice and 71.7 ⫾ 11.2 for CCR2⫺/⫺ mice. Data represent the mean ⫾ SE of n ⫽ 5 to 20 mice. *Significantly different (P ⬍ .05) from wild-type mice.
aminophen-induced injury is associated with the accumulation of inflammatory macrophages in the liver.4,18 The fact that a disruption in the CCR2 gene did not alter the number of CD68-positive cells in the tissue 48 hours after exposure suggests that these cells consist of resident Kupffer cells that have become activated. Alternatively, other chemokines may mediate the infiltration of activated inflammatory macrophages into the liver at this time. MCP-1 has been reported to be up-regulated in the liver after exposure of animals to hepatotoxicants such as endotoxin, carbon tetrachloride, and alcohol.14-16 Similarly, administration of acetaminophen to mice was found Table 2. Histologic Evaluation of Hepatic Injury and Inflammatory Cell Infiltration in Wild-Type and CCR2ⴚ/ⴚ Mice After Administration of Acetaminophen Hours After AA
Scores
Wild-Type
CCR2ⴚ/ⴚ
Control
Injury Inflammation Injury Inflammation Injury Inflammation Injury Inflammation Injury Inflammation Injury Inflammation
0 0 8.4 ⫾ 1.4 0.2 ⫾ 0.1 8.2 ⫾ 1.2 0.6 ⫾ 0.2 13.2 ⫾ 1.6 2.3 ⫾ 0.2 10.8 ⫾ 1.5 2.8 ⫾ 0.3 8.6 ⫾ 1.0 3.0 ⫾ 0.0
0 0 10.5 ⫾ 1.0 0.4 ⫾ 0.1 9.9 ⫾ 1.7 1.0 ⫾ 0.2 14.8 ⫾ 1.5 2.0 ⫾ 0.2 9.6 ⫾ 0.4 2.8 ⫾ 0.2 9.0 ⫾ 1.7 2.0 ⫾ 0.0*
6 12 24 48 72
NOTE. Wild-type (ICR) and CCR2⫺/⫺ mice were treated with acetaminophen (AA) or vehicle control. Liver samples were prepared 6 to 72 hours later for histologic analysis. Data represent the mean ⫾ SE of 5 to 20 mice per group. *Significantly different (P ⬍ .05) from wild-type mice.
6 12 24
NOTE. Wild-type (C57B1/6) and MCP-1⫺/⫺ mice were treated with acetaminophen (AA) or vehicle control. Liver samples were prepared 6 to 24 hours later for histologic analysis. Data represent the mean ⫾ SE of 5 to 20 mice per group. No significant differences were observed between wild-type and MCP-1⫺/⫺ mice.
to induce the expression of MCP-1 in centrilobular regions of the liver. These effects were dose related and correlated with the time course of acetaminophen-induced injury. Interestingly, MCP-1 expression was noted in both hepatocytes and macrophages. These findings suggest that, after acetaminophen-induced injury, resident Kupffer cells and hepatocytes are responsible for the recruitment of inflammatory cells to areas of injury. In this regard, previous studies have shown that hepatocytes treated with acetaminophen release macrophage chemotactic factors.18 As observed with MCP-1, CCR2 expression was also up-regulated by toxic doses of acetaminophen in centrilobular regions of the liver lobule. CCR2 expression was temporally correlated with the period of maximal inflammatory cell infiltration (48-72 hours) into the liver and was localized in inflammatory cell foci. These data, together with the findings that macrosialin-positive cell accumulation is dependent on CCR2, suggest that it is the macrosialin-positive subset of macrophages that express CCR2. The loss of CCR2 had no effect on acetaminopheninduced MCP-1 RNA expression. However, it was associated with a sustained elevation in serum MCP-1 levels when compared with wild-type mice. Similar findings were observed in CCR2⫺/⫺ mice with pulmonary granulomatous disease.36 These findings suggest that CCR2 plays a role in the clearance of MCP-1 from the serum. This may be an important mechanism for modulating the chemokine gradient during disease processes. We also found that CCR2 is involved in regulating inflammatory mediator expression in the liver during acetaminophen-induced hepatotoxicity. Thus, TNF-␣ mRNA expression was increased in CCR2⫺/⫺ mice treated with acetaminophen when compared with wildtype mice. These findings, which are similar to those observed in mice administered MCP-1 neutralizing
HEPATOLOGY, Vol. 35, No. 5, 2002
Fig. 8. Effect of acetaminophen treatment of mice on hepatic expression of inflammatory cytokines. Wild-type (■) and CCR2⫺/⫺ (䊐) mice were treated with vehicle (CTL) or acetaminophen. Liver samples were collected 6 to 72 hours later and analyzed for the relative expression of TNF-␣, IL-1, MCP-3, and KC/gro mRNA by reverse-transcription PCR. Each bar represents the mean ⫾ SE of 5 mice. *Significantly different (P ⬍ .05) from wild-type mice.
DAMBACH ET AL.
1101
antibodies before endotoxin,37 suggest that MCP-1 is involved in the regulation of TNF-␣ expression during inflammatory reactions associated with liver injury. In contrast, disruption of the CCR2 gene had no significant effect on acetaminophen-induced IL-1 expression in the liver. This indicates that the mechanisms regulating proinflammatory gene expression are distinct. Eosinophils and neutrophils are components of the inflammatory infiltrate that accumulates in the liver during acetaminophen hepatotoxicity. We found that expression of MCP-3 as well as KC/gro, which mediate eosinophil and neutrophil chemotaxis, respectively, were decreased in CCR2⫺/⫺ mice when compared with wild-type controls treated with acetaminophen. Thus, it seems that chemotaxis of these inflammatory cells is also mediated, at least in part, by CCR2. Hogaboam et al.38 recently reported that mice lacking CCR2 exhibit increased sensitivity to acetaminophen when compared with wild-type mice. In contrast, we found that disruption of the CCR2 gene or the MCP-1 gene did not significantly affect the development of acetaminophen-induced hepatic necrosis. These differences may be due to variations in the extent of hepatotoxicity induced by acetaminophen in the 2 studies. Thus, relatively low levels of hepatic injury were reported in the study by Hogaboam et al. when compared with our study, which may be due to strain differences in the mice. Despite its lack of effect on necrosis, CCR2 plays a role in the recruitment of macrophages into the liver after acetaminophen-induced hepatotoxicity. This was specific for macrosialin-positive inflammatory macrophages that appeared in the liver later in the pathogenic process. These cells are likely to be involved in repair of the damaged tissue.39 This is supported by our findings that expression of matrix metalloproteinase 9 and connective tissue growth factor, mediators known to be involved in extracellular matrix remodeling and tissue repair,40,41 is up-regulated in the liver 12 to 24 hours after administration of acetaminophen to wild-type mice (manuscript submitted). The observation that CCR2-mediated chemotaxis only affects a subset of macrophages suggests that other chemokines are involved in macrophage recruitment into the liver in this model. In summary, the present studies show that MCP-1 and its receptor, CCR2, are induced in a time- and dosedependent manner and localized to areas of injury after administration of toxic doses of acetaminophen. Moreover, the temporal pattern of MCP-1 and CCR2 expression is correlated with inflammatory macrophage accumulation in the liver. The loss of CCR2 resulted in a decrease in the severity of inflammation and a decrease in the number of macrosialin-positive macrophages in the
1102
DAMBACH ET AL.
tissue with no effect on injury. This suggests that macrophages that accumulate in the tissue after administration of acetaminophen also contribute to wound repair, and this is currently being investigated. Acknowledgment: The authors thank Dr. Patrick J. Farley for his constructive comments and Dr. Carol Gardner for her assistance in the preparation of this manuscript.
References 1. Mitchell JR, Jollow DJ, Potter WZ, Gillette JR, Brodie BB. Acetaminophen-induced hepatic necrosis I: role of drug metabolism. J Pharmacol Exp Ther 1973;187:181-194. 2. Savides MC, Oehme FW, Nash SL, Leipold HW. The toxicity and biotransformation of single doses of acetaminophen in dogs and cats. Toxicol Appl Pharmacol 1984;74:26-34. 3. Thomas SHL. Paracetamol (acetaminophen) poisoning. Pharmacol Ther 1993;60:91-120. 4. Laskin DL, Pilaro AM. Potential role of activated macrophages in acetaminophen hepatotoxicity. I. Isolation and characterization of activated macrophages from the rat liver. Toxicol Appl Pharmacol 1986;86:204-215. 5. Laskin DL, Gardner CR: The role of nonparenchymal cells and inflammatory macrophages in hepatotoxicity. In: Plaa GL, Hewitt WR, eds. Toxicology of the Liver. 2nd ed. New York: Raven, 1998:297-320. 6. Gardner CR, Heck DE, Yang CS, Thomas PE, Zhang X-J, DeGeorge GL, Laskin JD, et al. Role of nitric oxide in acetaminophen-induced hepatotoxicity in the rat. HEPATOLOGY 1998;26: 748-754. 7. Laskin DL, Gardner CR, Price VF, Jollow DJ. Modulation of macrophage functioning abrogates the acute hepatotoxicity of acetaminophen. HEPATOLOGY 1995;21:1045-1050. 8. Michael SL, Pumford NR, Mayeux PR, Niesman MR, Hinson JA. Pretreatment of mice with macrophage inactivators decreases acetaminophen hepatotoxicity and the formation of reactive oxygen and nitrogen species. HEPATOLOGY 1999;30:186-195. 9. Luster AD. Chemokines: chemotactic cytokines that mediate inflammation. N Engl J Med 1998;338:436-445. 10. Rossi D, Zlotnik A. The biology of chemokines and their receptors. Annu Rev Immunol 2000;18:217-242. 11. Kurihara T, Warr G, Loy J, Bravo R. Defects in macrophage recruitment and host defense in mice lacking the ccr2 chemokine receptor. J Exp Med 1997;186:1757-1762. 12. Boring L, Gosling J, Chensue SW, Kunkel SL, Farese RV, Broxmeyer HE, Charo IF. Impaired monocyte migration and reduced type 1 (Th1) cytokine responses in c-c chemokine receptor 2 knockout mice. J Clin Invest 1997;100:2552-2561. 13. Boring L, Charo IF, Rollins BJ. MCP-1 in human disease: insights gained from animal models. In: Herbert, CA, ed. Chemokines in Disease: Biology and Clinical Research. 1st ed. Totowa, NJ: Humana, 1999:53-65. 14. Czaja MJ, Geerts A, Xu J, Schmiedeberg P, Ju Y. Monocyte chemoattractant protein 1 (MCP-1) expression occurs in toxic rat liver injury and human liver disease. J Leukoc Biol 1994;55:120126. 15. Chiao H, Foster S, Thomas R, Lipton J, Star RA. Alpha-melanocyte–stimulating factor hormone reduces endotoxin-induced liver inflammation. J Clin Invest 1996;97:2038-2044.
HEPATOLOGY, May 2002
16. Afford SC, Fisher NC, Neil DAH, Fear J, Brun P, Hubscher SG, Adams DH. Distinct patterns of chemokine expression are associated with leukocyte recruitment in alcoholic hepatitis and alcoholic cirrhosis. J Pathol 1998;186:82-89. 17. Proost P, Wuyts A, Opendakker G, Van Damme J. Monocyte chemotactic proteins 1, 2, and 3. In: Mire-Sluis A, Thorpe R, Page C, eds. Cytokines. New York: Academic, 1998:489-506. 18. Laskin DL, Pilaro AM, Ji S. Potential role of activated macrophages in acetaminophen hepatotoxicity. II. Mechanisms of macrophage accumulation and activation. Toxicol Appl Pharmacol 1986;86:216-226. 19. Lu BB, Rutledge BJ, Gu L, Fiorillo J, Lukacs N, Kunkel SL, North R, et al. Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice. J Exp Med 1998;187:601-608. 20. Rohr H, Oberholzer M, Bartsch G, Keller M. Morphometry in experimental pathology: methods, baseline data and applications. Int Rev Exp Pathol 1976;15:233-325. 21. Leenen PJM, de Bruijn MFTR, Voerman JSA, Campbell PA, van Ewijk W. Markers of mouse macrophage development detected by monoclonal antibodies. J Immunol Methods 1994;174:5-19. 22. Lee BS, Starkey PM, Gordon S. Quantitative analysis of total macrophage content in adult mouse tissues. J Exp Med 1985;161: 475-489. 23. Holness CL, da Silva RP, Fawcett J, Gordon S, Simmons DL. Macrosialin, a mouse macrophage-restricted glycoprotein, is a member of the lamp/lgp family. J Biol Chem 1993;268:9661-9666. 24. Ramprasad MP, Terpstra V, Kondratenko N, Quehernberger O, Steinberg D. Cell surface expression of mouse macrosialin and human CD68 and their role as macrophage receptors for oxidized low density lipoprotein. Proc Natl Acad Sci U S A 1996;93: 14833-14838. 25. Luster MI, Simeonova PP, Gallucci RM, Bruccoleri A, Blazka ME, Yucesoy B. Role of inflammation in chemical-induced hepatotoxicity. Toxicol Lett 2001;120:317-321. 26. Karnovsky ML, Lazdins JK. Biochemical criteria for activated macrophages. J Immunol 1978;121:809-813. 27. Hamilton TA, Weiel JE, Adams DO. Expression of the transferrin receptor in murine peritoneal macrophages is modulated in the different stages of activation. J Immunol 1984;132:2285-2290. 28. Ezekowitz RAB, Hill M, Gordon S. Interferon a/b selectively antagonises down-regulation of mannosyl-fucosyl receptors on activated macrophages by interferon-gamma. Biochem Biophys Res Commun 1986;136:737-745. 29. Da Silva RP, Gordon S. Phagocytosis stimulates alternative glycosylation of macrosialin (mouse CD68), a macrophage-specific endosomal protein. Biochem J 1999;338:687-694. 30. Austyn JM, Gordon S. F4/80, a monoclonal antibody directed specifically against the mouse macrophage. Eur J Immunol 1981; 11:805-815. 31. Ezekowitz RAB, Gordon S. Down-regulation of mannosyl receptor-mediated endocytosis and antigen F4/80 in bacillus calmetteguerin-activated mouse macrophages. J Exp Med 1982;155: 1623-1637. 32. Jiang Z, Shih DM, Xia Y, Lusis AJ, de Beer FC, de Villiers WJS, van der Westhuyzen DR, et al. Structure, organization, and chromosomal mapping of the gene encoding macrosialin, a macrophage-restricted protein. Genomics 1998;50:199-205. 33. Rabinowitz SS, Gordon S. Macrosialin, a macrophage-restricted membrane sialoprotein differentially glycosylated in response to inflammatory stimuli. J Exp Med 1991;174:827-836.
HEPATOLOGY, Vol. 35, No. 5, 2002
34. Kurushima H, Ramprasad M, Kondratenko N, Foster DM, Quehenberger O, Steinberg D. Surface expression and rapid internalization of macrosialin (mouse CD68) on elicited mouse peritoneal macrophages. Lab Invest 2000;67:104-108. 35. Cohen SD, Khairallah EA. Selective protein arylation and acetaminophen hepatotoxicity. Drug Metab Rev 1997;29:5977. 36. Warmington KS, Boring L, Ruth JH, Sonstein J, Hogaboam CM, Curtis JL, Kunkel SL, et al. Effect of c-c chemokine receptor 2 (ccr2) knockout on type-2 (schistosomal antigenelicited) pulmonary granuloma formation. Am J Pathol 1999; 154:1407-1416. 37. Zisman DA, Kunkel SL, Strieter RM, Tsai WC, Bucknell K, Wilkowski J. MCP-1 protects mice in lethal endotoxemia. J Clin Invest 1997;99:2832-2836.
DAMBACH ET AL.
1103
38. Hogaboam CM, Bone-Larson CL, Steinhauser ML, Matsukawa A, Gosling J, Boring L, Charo IF, et al. Exaggerated hepatic injury due to acetaminophen challenge in mice lacking c-c chemokine receptor 2. Am J Pathol 2000;156:1245-1252. 39. DiPietro LA. Wound healing: the role of the macrophage and other immune cells. Shock 1995;4:233-240. 40. Knittel T, Mehide M, Grundmann A, Saile B, Scharf J-G, Ramadori G. Expression of matrix metalloproteinases and their inhibitors during hepatic tissue repair in the rat. Histochem Cell Biol 2000;113:443-453. 41. Ujike K, Shinji T, Hirasaki S, Shiraha H, Nakamura M, Tsuji T, Koide N. Kinetics of expression of connective tissue growth factor gene during liver regeneration after partial hepatectomy and Dgalactosamine–induced liver injury in rats. Biochem Biophys Res Commun 2000;277:448-454.
A
cetaminophen is an analgesic and antipyretic agent that induces liver injury characterized by centrilobular hepatocellular necrosis when ingested in excessive amounts.1-3 In addition to metabolism-based, direct hepatocellular damage, recent studies
Abbreviations: MCP, monocyte chemoattractant protein; CCR, C-C chemokine receptor; TNF, tumor necrosis factor; IL, interleukin; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; mRNA, messenger RNA; ALT, alanine aminotransferase. From the 1Department of Pharmacology and Toxicology, Rutgers University, Piscataway, NJ; and 2Pharmaceutical Research Institute, Bristol-Myers Squibb, Princeton, NJ. Received July 31, 2001; accepted February 16, 2002. Supported by National Institutes of Health grants GM34310, ES06897, ES04738, and ES05022. Address reprint requests to: Debra L. Laskin, Ph.D., Department of Pharmacology and Toxicology, Rutgers University, 160 Frelinghuysen Road, Piscataway, NJ 08854. E-mail: [email protected]; fax: 732-445-2534. Copyright © 2002 by the American Association for the Study of Liver Diseases. 0270-9139/02/3505-0012$35.00/0 doi:10.1053/jhep.2002.33162
have shown that inflammatory mediators released by parenchymal and nonparenchymal cells as well as infiltrating macrophages contribute to the progression of hepatotoxicity.4-6 The importance of macrophages in the pathogenesis of injury has been established by the finding that inhibition of these cells by compounds such as dextran sulfate or gadolinium chloride abrogates acetaminophen-induced hepatotoxicity.7,8 Chemotactic cytokines are known to be critical mediators of inflammatory cell trafficking into sites of injury.9,10 One of the most potent chemokines identified for monocytes and macrophages is monocyte chemoattractant protein (MCP) 1, which acts by binding to the C-C chemokine receptor (CCR) 2.11-13 MCP-1 levels have been reported to be elevated in the liver after administration of hepatotoxic doses of carbon tetrachloride, endotoxin, or alcohol to experimental animals as well as in chronic hepatitis in humans.14-16 A variety of liver cells express MCP-1, including macrophages, stellate cells, and 1093
1094
DAMBACH ET AL.
endothelial cells.13,17 Expression is induced by oxidative stress, endotoxin, and proinflammatory cytokines such as tumor necrosis factor (TNF) ␣, interleukin (IL) 1, and interferon ␥.17 Treatment of hepatocytes in vitro with acetaminophen results in the elaboration of at least one macrophage chemotactic factor; however, this factor has not been identified.18 The objectives of the present studies were to determine if levels of MCP-1 and its receptor, CCR2, are increased during acetaminophen-induced hepatotoxicity. The role of MCP-1 and CCR2 in the development and outcome of hepatotoxicity was also assessed.
Materials and Methods Animals and Treatments. Male mice (7-9 weeks old) were used for all experiments. Wild-type mice (129Sv ⫻ ICR or 129Sv/J ⫻ C57bl/6) were purchased from Jackson Laboratories (Bar Harbor, ME). CCR2 knockout mice (129Sv/ICR)11 were obtained from Dr. R. Bravo (Bristol-Myers Squibb, Princeton, NJ). MCP-1 knockout mice (129Sv/J/C57bl/6)19 were kindly provided by Dr. B. Rollins (Dana Farber Cancer Institute, Boston, MA). Animals were housed at 21°C on a 12-hour light/dark cycle in polycarbonate cages and were maintained in accordance with National Institutes of Health guidelines. Mice were fasted overnight (16-18 hours) before administration of a single intraperitoneal dose of acetaminophen (Sigma Chemical Co., St. Louis, MO) dissolved in sterile phosphate-buffered saline (PBS, pH 7.4) warmed to 45°C. Animals were administered 300 mg/kg acetaminophen unless indicated otherwise. Control mice received a similar volume of PBS. Groups of mice (n ⫽ 5-20) were killed 1 to 72 hours after treatment by carbon dioxide inhalation, and blood was collected from the abdominal vena cava. Serum was separated and stored at ⫺70°C until analysis. The liver was removed and divided into sections. These sections were immediately snap frozen in liquid nitrogen and stored at ⫺70°C for biochemical analyses, frozen in OCT cryopreservation compound (TissueTek, Torrance, CA) and stored at ⫺70°C for in situ hybridization and immunohistochemical analysis, or immersion fixed in 10% neutral buffered formalin for histologic examination. Reverse-Transcription Polymerase Chain Reaction. Total RNA was extracted from 100- to 200-mg aliquots of frozen liver using TRIzol reagent (Life Technologies, Gaithersburg, MD). After treatment with deoxyribonuclease I (Life Technologies), complementary DNA was synthesized from 1 g RNA using the Superscript First Strand Synthesis System and oligo(dT)12-18 primers (Life Technologies). Complementary DNA (25 ng) was ampli-
HEPATOLOGY, May 2002
fied using an ABI 5700 GeneAmp thermocycler programmed for the following polymerase chain reaction (PCR) conditions: one 2-minute cycle at 50°C, one 10minute cycle at 95°C, and 40 cycles at 95°C for 15 seconds, 55°C for 20 seconds, and 72°C for 1 minute. SYBR Green I fluorescence indicator dye-containing buffer (SYBR Green PCR Core Reagents Kit; ABI Biosystems, Foster City, CA) was used to detect product. Ct values (the number of cycles for the signal intensity to exceed an arbitrary threshold) in the exponential phase of amplification were determined. Target complementary DNA amplification efficiency and selectivity was determined by standard curves for each primer pair. As a control, the quantity of an endogenous “housekeeping” messenger RNA (mRNA) (hypoxanthine-guanine phosphoribosyltransferase) was measured and used to normalize the data. Pilot experiments were performed to establish that treatment of the mice with acetaminophen did not alter hypoxanthine-guanine phosphoribosyltransferase expression. A minimum of 5 samples was run for each experimental group, and all PCR samples were run in duplicate. Primer pairs used were as follows: MCP-1, AGCCAACTCTCACTGAAG and TGGAAAAGGTAGTGGATG; CCR2, TGGTAAATTCTTCAGCTTTTCC and TCCACAACCTGATAAAGCCTCC; TNF-␣, ATCTTCTCAAAATTCGAGTGACAAA and 5⬘-TGGGAGTAGACAAGGTACAACCC; IL-1, CCTCACAAGCAGAGCACAAG and AGAGGCAAGGAGGAAACACA; MCP-3, TGAAAACCCCAACTCCAAAG and CATTCCTTAGGCGTGACCAT; KC/gro, TGCGAAAAGAAGTGCAGAGA and CGAGACGAGACCAGGAGAAA; hypoxanthine-guanine phosphoribosyltransferase, GGTGGATACAGGCCAGACTTTGTTG and GATTCAACTTGCGCTCATCTTAGG. In Situ Hybridization. Livers frozen in OCT were cut into 12-m sections. These sections were fixed for 20 minutes in 4% formaldehyde followed by 2 minutes in PBS and 5 minutes in 0.1 mol/L triethanolamine. Sections were then incubated in a solution of 0.25% acetic anhydride in 0.1 mol/L triethanolamine for 10 minutes, dehydrated through a graded ethanol series, immersed in 100% chloroform for 15 minutes, and air dried. Tissue sections were hybridized with riboprobes (106 cpm) in buffer (0.36 mol/L NaCl, 20 mmol/L Tris-HCl, pH 7.4, 1 mmol/L ethylenediaminetetraacetic acid, pH 8.0, 50% formamide, 10% dextran sulfate, and 1⫻ Denhardt’s solution) for 16 to 20 hours at 60°C. The slides were then rinsed in 4⫻ saline sodium citrate and incubated with ribonuclease (20 g/mL; Life Technologies) for 30 minutes at 37°C. After washing with 0.1⫻ saline sodium citrate at 60°C, the slides were dehydrated through a graded ethanol series, air dried, and coated with NTB-2
HEPATOLOGY, Vol. 35, No. 5, 2002
emulsion (Eastman Kodak, Rochester, NY). The slides were developed and counterstained with hematoxylin. 35S-labeled riboprobes (sense and antisense) for CCR2 were generated by PCR amplification of a 320 – base pair fragment of CCR2 inserted into a TopoTA vector (Invitrogen, Carlsbad, CA). The cloned CCR2 sequence and orientation in the vector were verified by sequence analysis. MCP-1 riboprobes were generated from a sequenceverified MCP-1/JE EST (Genome Systems, Madison, WI). Riboprobes were synthesized by in vitro transcription (Riboprobe Combination Systems; Promega, Madison, WI) using 35S– uridine triphosphate (Amersham, Piscataway, NJ). Expression signals were detected by dark-phase microscopy. Cellular phenotype identification was by bright-field microscopy. Serum Transaminase and MCP-1 Protein Quantification. Serum alanine aminotransferase (ALT) was quantified using a Hitachi 704 chemistry analyzer (Roche Diagnostics, Indianapolis, IN). MCP-1 levels were measured by a commercially available enzyme-linked immunosorbent assay (Quantikine M; R&D Systems, Minneapolis, MN). Histologic Analysis. Tissue sections were scored for severity of injury and morphologic changes based on previously established methods.20 A severity score of 0 to 4 was used as follows: 0, no injury; 1, minimal injury (1%24% acinus affected); 2, mild injury (26%-50% acinus affected); 3, moderate injury (51%-75% acinus affected); and 4, severe injury (⬎75% acinus affected). The most prominent morphologic changes were scored as follows: 1, congestion; 2, fatty change or swelling; and 3, necrosis. A final injury score was obtained from the product of the severity and morphology scores. The severity of centrilobular inflammatory cell infiltration was scored separately as follows: 0, no inflammation; 1, minimal inflammation; 2, mild inflammation; 3, moderate inflammation; and 4, marked inflammation. Immunohistochemistry and Image Analysis. The number of macrophages present in the liver was determined using rat anti-mouse F4/80 and macrosialin (CD68) antibodies (Serotec, Raleigh, NC) and fluorescence microscopy. Briefly, frozen serial tissue sections were fixed in acetone at 4°C and then air dried. Sections were then blocked using a 5% normal rabbit serum/1% bovine serum albumin mixture followed by avidin D and biotin (Vector Labs, Burlingame, CA). Primary antibodies recognizing F4/80 (1:10) or macrosialin (1:50) were then applied to the sections for 1 hour. After washing in PBS, the slides were incubated with biotinylated anti-rat secondary antibody (1:100; Vector Labs) for 30 minutes at room temperature, washed 3 times in PBS, and incubated for 30 minutes with fluorescein isothiocyanate–la-
DAMBACH ET AL.
1095
beled streptavidin (1:50; Vector Labs). The sections were then treated with ribonuclease (1:40 vol/vol in PBS) for 20 minutes in the dark, followed by staining with propidium iodide (1:10; BD PharMingen, San Diego, CA) for 5 minutes in the dark. Rat immunoglobulin G was used as a negative control (Vector Labs). All reactions were performed at room temperature. The number of F4/80- or macrosialin-positive cells per 20⫻ centrilobular field was determined by morphometric analysis using the ImagePro Plus software package (Media Cybernetics, Silver Spring, MD). Five centrilobular areas were counted per tissue sample. Statistical Analysis. All experiments were repeated at least 3 times. ALT and reverse-transcription PCR expression data were analyzed by ANOVA followed by Tukey’s post-hoc analysis. Histologic scores were evaluated by Kruskal-Wallis nonparametric analysis. All statistics were performed using the SYSTAT 8.0 software package (SAS, Chicago, IL). Differences were considered significant at P ⬍ .05.
Results Effects of Acetaminophen Treatment of Mice on Macrophage Subpopulations in the Liver and Chemokine Expression. To characterize the phenotype of the macrophages that accumulate in the liver during acetaminophen-induced hepatotoxicity, antibodies against F4/80, which recognizes mature monocytes/macrophages,21,22 and macrosialin (CD68), which binds to activated macrophages,23,24 were used. In liver sections from wild-type mice, F4/80-positive macrophages were clearly identified within hepatic sinusoids (Fig. 1). Administration of acetaminophen to the mice resulted in a 75% decrease in F4/80-positive cells in centrilobular areas after 24 and 48 hours (Figs. 1 and 2). By 72 hours, the number of F4/80-positive cells returned toward control. In contrast, macrosialin, which was present in control Kupffer cells at low levels, increased in a time-dependent manner, reaching a maximum (2-fold) 48 hours after administration of acetaminophen to the mice (Figs. 1 and 2). Treatment of wild-type mice with acetaminophen resulted in time-dependent increases in mRNA for MCP-1 and its receptor, CCR2, in the liver. The increase reached a maximum after 24 to 48 hours with MCP-1 and after 48 to 72 hours with CCR2 (Fig. 3). By 72 hours after exposure, MCP-1 expression returned toward control levels. In contrast, CCR2 expression remained elevated. To analyze the cellular distribution of these proteins, we used in situ hybridization. Whereas MCP-1 mRNA was not detectable in the livers of control mice (Fig. 4A), expression of this chemokine was prominent and localized in centri-
1096
DAMBACH ET AL.
HEPATOLOGY, May 2002
Fig. 1. Effects of acetaminophen on F4/80- and macrosialin-positive macrophages in the liver. Liver sections were prepared 48 hours after treatment of wild-type mice with (A, C, and E) vehicle control or (B, D, and F) acetaminophen (AA). Sections were stained with (A and B) hematoxylin-eosin, (C and D) fluorescein isothiocyanate–labeled antiF4/80 antibody, or (E and F) fluorescein isothiocyanate–labeled anti-macrosialin antibody as described in Materials and Methods. (Original magnification ⫻200.)
lobular regions of the liver 12 to 24 hours after administration of acetaminophen (Fig. 4B and C). A similar pattern of expression of the macrophage marker lysozyme was observed in the tissue (Fig. 4E). Both hepatocytes and Kupffer cells were found to express MCP-1. CCR2 mRNA expression, although weaker than MCP-1, was also localized in centrilobular areas of the liver 24 hours after administration of acetaminophen and was associated with inflammatory cell foci (Fig. 5). These data are generally consistent with our reverse-transcription PCR studies. Effects of Administration of Acetaminophen on Chemokine Expression and Hepatic Injury in CCR2ⴚ/ⴚ Mice. To determine if MCP-1 contributes to acetaminophen-induced hepatic injury and macrophage recruitment into the liver, we used transgenic mice with a targeted disruption of the gene for CCR2. As expected, CCR2⫺/⫺ mice did not express significant quantities of CCR2 mRNA even after administration of acetaminophen (Fig. 3). Moreover, deficiency in CCR2 did not alter acetaminophen-induced levels of hepatic MCP-1 mRNA when compared with wild-type mice
(Fig. 3). Administration of acetaminophen to wild-type mice was also associated with a dose- and time-related increase in serum MCP-1 that paralleled the time course of hepatic MCP-1 mRNA expression (Fig. 6). In CCR2⫺/⫺ mice, serum MCP-1 protein levels were significantly elevated 12 and 24 hours after administration of acetaminophen when compared with wild-type mice (Fig. 6). We next quantified hepatic injury induced by administration of acetaminophen to wild-type and CCR2⫺/⫺ mice by measuring serum ALT levels and by histologic evaluation. In wild-type mice, treatment with acetaminophen (200 and 300 mg/kg) caused a time- and dosedependent increase in serum ALT levels beginning within 3 hours and peaking between 12 and 24 hours. By 72 hours, ALT levels in the group receiving 300 mg/kg decreased toward control levels (Table 1). In general, the response of CCR2⫺/⫺ mice to acetaminophen was similar; however, at the higher dose, there was a trend toward increased ALT levels at 12 and 24 hours when compared with wild-type mice (Table 1). Histologic evaluation of the livers confirmed these findings. Thus, the type and
HEPATOLOGY, Vol. 35, No. 5, 2002
DAMBACH ET AL.
1097
severity of injury that developed in the CCR2⫺/⫺ and wild-type mice were similar. However, disruption of the CCR2 gene caused a significant decrease in the overall severity of inflammation 72 hours after administration of acetaminophen when compared with wild-type mice (Table 2). Treatment of CCR2⫺/⫺ mice with acetaminophen resulted in a generally similar pattern of F4/80 expression in the liver as observed in the wild-type mice. Thus, a 75% decrease in F4/80-positive cells was observed in the knockout mice (Fig. 2). In contrast, the percentage of macrosialin-positive cells accumulating in the livers of CCR2⫺/⫺ mice 72 hours after administration of acetaminophen was significantly reduced when compared with wild-type mice (Fig. 2). To confirm that MCP-1 was acting through CCR2, hepatic injury induced by acetaminophen was compared in MCP-1⫺/⫺ and wild-type mice. Analysis of serum ALT levels showed a similar trend as observed in CCR2⫺/⫺ mice (Fig. 7). No significant differences were
Fig. 3. The effects of acetaminophen treatment of mice on MCP-1 and CCR2 expression in the liver. Wild-type (■) and CCR2⫺/⫺ (䊐) mice were treated with vehicle control (CTL) or acetaminophen. Liver samples were prepared 6 to 72 hours later, and MCP-1 and CCR2 mRNA expression was quantified by reverse-transcription PCR. Each bar represents the mean ⫾ SE of samples from 5 mice. *Significantly different from vehicle-treated control mice (P ⬍ .05).
Fig. 2. Quantitation of F4/80- and macrosialin-positive macrophages in the liver after administration of acetaminophen. Serial sections of liver were prepared 24 to 72 hours after treatment of wild-type (■) and CCR2⫺/⫺ (䊐) mice with vehicle control (CTL) or acetaminophen. The number of F4/80-positive and macrosialin-positive cells per 5 20⫻ centrilobular fields was quantified by morphometric analysis. Each bar represents the mean ⫾ SE of liver sections from 3 mice. *Significantly different (P ⬍ .05) from vehicle-treated mice. **Significantly different (P ⬍ .05) from wild-type mice.
apparent in the overall severity of injury or inflammatory infiltrates (Table 3). Alterations in Acetaminophen-Induced Cytokine Expression in CCR2ⴚ/ⴚ Mice. In our next series of studies, we analyzed the role of CCR2 in acetaminopheninduced alterations in hepatic inflammatory cytokine levels. Administration of acetaminophen to wild-type mice resulted in a time-dependent induction of hepatic TNF-␣ and IL-1 expression that peaked at 24 hours for TNF-␣ and at 12 to 24 hours for IL-1 (Fig. 8). Administration of acetaminophen also induced expression of the chemokines KC/gro and MCP-3 (Fig. 8). Maximal expression was observed after 12 hours for KC/gro and after 24 hours for MCP-3. In general, although the time course of cytokine expression in CCR2⫺/⫺ and wild-type mice was similar, some differences were observed in the quantities of mRNA expressed (Fig. 8). Thus, TNF-␣ expression was significantly greater in CCR2⫺/⫺ mice when compared with wild-type mice 24 hours after administration of acetaminophen. Moreover, MCP-3 levels remained el-
1098
DAMBACH ET AL.
HEPATOLOGY, May 2002
Fig. 4. In situ localization of MCP-1 mRNA in the liver after treatment of mice with acetaminophen. Frozen liver sections from (A) vehicle control mice and from mice (B) 12 hours or (C-E) 24 hours after treatment with acetaminophen or (F) 1 hour after administration of endotoxin (750 g/kg intraperitoneally) were hybridized with 35S-labeled antisense riboprobes for (A, B, C, and F) MCP-1, (D) a sense riboprobe for MCP-1, or (E) an antisense probe for lysozyme and analyzed by dark-field microscopy. One representative liver sample from 3 mice is shown. The arrow indicates positive hybridization focus. CV, central vein. (Original magnification ⫻125.)
evated for 72 hours. In CCR2⫺/⫺ mice, increases in KC/gro expression were significantly reduced up to 12 hours after administration of acetaminophen when compared with wild-type mice.
Discussion Macrophages have been implicated in the pathogenesis of hepatotoxicity induced by a number of diverse
chemicals, including acetaminophen.5 Tissue injury is believed to be mediated by cytotoxic and proinflammatory mediators released by these cells.5,25 In the present studies, we characterized macrophage subpopulations in the liver during acetaminophen-induced hepatotoxicity and the role of the monocyte/ macrophage chemokine, MCP-1, in mediating the responses of these cells.
Fig. 5. In situ localization of CCR2 mRNA in the liver after treatment of mice with acetaminophen. 35S-labeled (A-C) antisense or (D) sense riboprobes for CCR2 were hybridized to frozen liver sections prepared from mice 24 hours after administration of (A) control or (B-D) acetaminophen. One representative liver sample from 3 mice is shown. CV, central vein. (A and B) Dark-field microscopy; original magnification ⫻125. (C) Bright-field microscopy; original magnification ⫻250.
HEPATOLOGY, Vol. 35, No. 5, 2002
Fig. 6. The effect of acetaminophen treatment of mice on serum MCP-1 levels. (Upper panel) Serum was collected 1 to 24 hours after treatment of wild-type mice with vehicle control (CTL) or with 100 mg/kg or 200 mg/kg acetaminophen. (Lower panel) Serum was collected 1 to 24 hours after treatment of wild-type (WT) or CCR2⫺/⫺ mice with vehicle control or with 300 mg/kg acetaminophen. Each bar represents the mean ⫾ SE of 6 mice. *Significantly different (P ⬍ .05) from vehicle control. **Significantly different (P ⬍ .05) from wild-type mice.
A characteristic feature of acetaminophen-induced hepatotoxicity is the accumulation of macrophages in centrilobular regions of the tissue.5 We found that treatment of mice with acetaminophen resulted in distinct changes in the subpopulations of macrophages present in these regions. These consisted initially of a population of F4/80-positive resident Kupffer cells and subsequently a population of activated CD68-positive macrophages that appeared in the liver 24 to 48 hours after treatment. Thus, while the number of resident F4/80-positive Kupffer cells in centrilobular regions of the liver lobule decreased 24 to 48 hours after treatment with acetaminophen, a marked accumulation of CD68 macrosialin-positive inflammatory macrophages was observed at this time. Whereas the number of activated macrophages remained elevated 72 hours after exposure, the number of resident Kupffer cells returned to control levels. In macrophages, the pattern of expression of membrane receptors and antigens has been shown to reflect their state of activation.26-29 F4/80 is a 160-kd membrane-associated glycoprotein present on
DAMBACH ET AL.
1099
mouse macrophages and monocytes that is generally considered to be a marker for mature macrophages.21 It is highly expressed in the liver on Kupffer cells.22 Macrophage activation is associated with down-regulation of F4/80.30,31 The decrease in F4/80 expression in the liver that we observed after administration of acetaminophen provides support for the concept that resident Kupffer cells become activated during the pathogenesis of hepatotoxicity.4,5 Macrosialin, the murine homologue of human CD68, is a heavily glycosylated transmembrane protein and a member of the lysosomal-associated membrane protein family.23,32 In contrast to F4/80, expression of macrosialin is markedly up-regulated in activated inflammatory macrophages.33,34 Macrosialin specifically binds to oxidized low-density lipoproteins and is believed to play a role in scavenging these proteins when cells are damaged by oxidative stress.24 Oxidative damage is a wellestablished component of acetaminophen-induced hepatic injury.35 We speculate that macrosialin-positive cells contribute to reducing this damage and initiating wound repair. This is supported by our observation that these cells appear in the liver at a relatively late stage after administration of acetaminophen, after injury is well established. Although the loss of CCR2 did not alter the percentage of F4/80-positive macrophages in centrilobular regions of the liver, significantly fewer macrosialin-positive macrophages were observed 72 hours after treatment of the mice with acetaminophen. This was correlated temporally with a reduction in the severity of inflammation, suggesting that this subset of macrophages is an important component of the late inflammatory infiltrate. These findings confirm earlier reports that acet-
Fig. 7. Effects of administration of acetaminophen on serum ALT levels. Serum was collected 6 to 72 hours after treatment of wild-type (■) and MCP-1⫺/⫺ (䊐) mice with vehicle control (CTL) or acetaminophen. Each bar represents the mean ⫾ SE of 5 to 20 mice. No significant differences were observed between MCP-1⫺/⫺ and wild-type mice.
1100
DAMBACH ET AL.
HEPATOLOGY, May 2002
Table 1. Effects of Acetaminophen on Serum ALT Levels in Wild-Type and CCR2ⴚ/ⴚ Mice ALT (U/L) Mean ⴞ SE
Table 3. Histologic Evaluation of Hepatic Injury and Inflammatory Cell Infiltration in Wild-Type and MCP-1ⴚ/ⴚ Mice After Administration of Acetaminophen
Acetaminophen (mg/kg)
Time (hr)
Wild-Type
CCR2ⴚ/ⴚ
Hours After AA
Scores
Wild-Type
MCP-1ⴚ/ⴚ
100
6 12 24 6 12 24 1 3 6 12 24 48 72
101.7 ⫾ 19.8 80.5 ⫾ 12.2 136.5 ⫾ 21.1 1,365.2 ⫾ 530.3 732.5 ⫾ 314.8 4,274.6 ⫾ 1,257.9 85.6 ⫾ 32.9 1,484.4 ⫾ 265.9 7,793.6 ⫾ 2,096.6 9,009.7 ⫾ 1,898.4 8,469.7 ⫾ 961.2 2,956.0 ⫾ 1,335.1 468.0 ⫾ 67.5
78.3 ⫾ 16.4 124.0 ⫾ 39.1 167.6 ⫾ 56.4 1,183.7 ⫾ 485.7 3,511.1 ⫾ 1,544.1* 5,876.9 ⫾ 1,499.7 61.8 ⫾ 12.0 4,387.8 ⫾ 523.6 10,069.8 ⫾ 1,687.5 16,619.2 ⫾ 4,396.9 12,557.1 ⫾ 1,571.9 1,676.8 ⫾ 454.3 299.8 ⫾ 51.0
Control
Injury Inflammation Injury Inflammation Injury Inflammation Injury Inflammation
0 0 8.9 ⫾ 1.5 0.7 ⫾ 0.2 9.6 ⫾ 1.8 0.8 ⫾ 0.3 11.7 ⫾ 1.5 2.0 ⫾ 0.3
0 0 8.0 ⫾ 2.6 0.6 ⫾ 0.4 11.2 ⫾ 0.8 0.6 ⫾ 0.4 15.0 ⫾ 1.6 2.2 ⫾ 0.6
200
300
NOTE. Wild-type and CCR2⫺/⫺ mice were administered acetaminophen or vehicle control. Serum was collected 6 to 72 hours later and analyzed for ALT. Pooled vehicle control values were 70.8 ⫾ 12.1 for wild-type mice and 71.7 ⫾ 11.2 for CCR2⫺/⫺ mice. Data represent the mean ⫾ SE of n ⫽ 5 to 20 mice. *Significantly different (P ⬍ .05) from wild-type mice.
aminophen-induced injury is associated with the accumulation of inflammatory macrophages in the liver.4,18 The fact that a disruption in the CCR2 gene did not alter the number of CD68-positive cells in the tissue 48 hours after exposure suggests that these cells consist of resident Kupffer cells that have become activated. Alternatively, other chemokines may mediate the infiltration of activated inflammatory macrophages into the liver at this time. MCP-1 has been reported to be up-regulated in the liver after exposure of animals to hepatotoxicants such as endotoxin, carbon tetrachloride, and alcohol.14-16 Similarly, administration of acetaminophen to mice was found Table 2. Histologic Evaluation of Hepatic Injury and Inflammatory Cell Infiltration in Wild-Type and CCR2ⴚ/ⴚ Mice After Administration of Acetaminophen Hours After AA
Scores
Wild-Type
CCR2ⴚ/ⴚ
Control
Injury Inflammation Injury Inflammation Injury Inflammation Injury Inflammation Injury Inflammation Injury Inflammation
0 0 8.4 ⫾ 1.4 0.2 ⫾ 0.1 8.2 ⫾ 1.2 0.6 ⫾ 0.2 13.2 ⫾ 1.6 2.3 ⫾ 0.2 10.8 ⫾ 1.5 2.8 ⫾ 0.3 8.6 ⫾ 1.0 3.0 ⫾ 0.0
0 0 10.5 ⫾ 1.0 0.4 ⫾ 0.1 9.9 ⫾ 1.7 1.0 ⫾ 0.2 14.8 ⫾ 1.5 2.0 ⫾ 0.2 9.6 ⫾ 0.4 2.8 ⫾ 0.2 9.0 ⫾ 1.7 2.0 ⫾ 0.0*
6 12 24 48 72
NOTE. Wild-type (ICR) and CCR2⫺/⫺ mice were treated with acetaminophen (AA) or vehicle control. Liver samples were prepared 6 to 72 hours later for histologic analysis. Data represent the mean ⫾ SE of 5 to 20 mice per group. *Significantly different (P ⬍ .05) from wild-type mice.
6 12 24
NOTE. Wild-type (C57B1/6) and MCP-1⫺/⫺ mice were treated with acetaminophen (AA) or vehicle control. Liver samples were prepared 6 to 24 hours later for histologic analysis. Data represent the mean ⫾ SE of 5 to 20 mice per group. No significant differences were observed between wild-type and MCP-1⫺/⫺ mice.
to induce the expression of MCP-1 in centrilobular regions of the liver. These effects were dose related and correlated with the time course of acetaminophen-induced injury. Interestingly, MCP-1 expression was noted in both hepatocytes and macrophages. These findings suggest that, after acetaminophen-induced injury, resident Kupffer cells and hepatocytes are responsible for the recruitment of inflammatory cells to areas of injury. In this regard, previous studies have shown that hepatocytes treated with acetaminophen release macrophage chemotactic factors.18 As observed with MCP-1, CCR2 expression was also up-regulated by toxic doses of acetaminophen in centrilobular regions of the liver lobule. CCR2 expression was temporally correlated with the period of maximal inflammatory cell infiltration (48-72 hours) into the liver and was localized in inflammatory cell foci. These data, together with the findings that macrosialin-positive cell accumulation is dependent on CCR2, suggest that it is the macrosialin-positive subset of macrophages that express CCR2. The loss of CCR2 had no effect on acetaminopheninduced MCP-1 RNA expression. However, it was associated with a sustained elevation in serum MCP-1 levels when compared with wild-type mice. Similar findings were observed in CCR2⫺/⫺ mice with pulmonary granulomatous disease.36 These findings suggest that CCR2 plays a role in the clearance of MCP-1 from the serum. This may be an important mechanism for modulating the chemokine gradient during disease processes. We also found that CCR2 is involved in regulating inflammatory mediator expression in the liver during acetaminophen-induced hepatotoxicity. Thus, TNF-␣ mRNA expression was increased in CCR2⫺/⫺ mice treated with acetaminophen when compared with wildtype mice. These findings, which are similar to those observed in mice administered MCP-1 neutralizing
HEPATOLOGY, Vol. 35, No. 5, 2002
Fig. 8. Effect of acetaminophen treatment of mice on hepatic expression of inflammatory cytokines. Wild-type (■) and CCR2⫺/⫺ (䊐) mice were treated with vehicle (CTL) or acetaminophen. Liver samples were collected 6 to 72 hours later and analyzed for the relative expression of TNF-␣, IL-1, MCP-3, and KC/gro mRNA by reverse-transcription PCR. Each bar represents the mean ⫾ SE of 5 mice. *Significantly different (P ⬍ .05) from wild-type mice.
DAMBACH ET AL.
1101
antibodies before endotoxin,37 suggest that MCP-1 is involved in the regulation of TNF-␣ expression during inflammatory reactions associated with liver injury. In contrast, disruption of the CCR2 gene had no significant effect on acetaminophen-induced IL-1 expression in the liver. This indicates that the mechanisms regulating proinflammatory gene expression are distinct. Eosinophils and neutrophils are components of the inflammatory infiltrate that accumulates in the liver during acetaminophen hepatotoxicity. We found that expression of MCP-3 as well as KC/gro, which mediate eosinophil and neutrophil chemotaxis, respectively, were decreased in CCR2⫺/⫺ mice when compared with wild-type controls treated with acetaminophen. Thus, it seems that chemotaxis of these inflammatory cells is also mediated, at least in part, by CCR2. Hogaboam et al.38 recently reported that mice lacking CCR2 exhibit increased sensitivity to acetaminophen when compared with wild-type mice. In contrast, we found that disruption of the CCR2 gene or the MCP-1 gene did not significantly affect the development of acetaminophen-induced hepatic necrosis. These differences may be due to variations in the extent of hepatotoxicity induced by acetaminophen in the 2 studies. Thus, relatively low levels of hepatic injury were reported in the study by Hogaboam et al. when compared with our study, which may be due to strain differences in the mice. Despite its lack of effect on necrosis, CCR2 plays a role in the recruitment of macrophages into the liver after acetaminophen-induced hepatotoxicity. This was specific for macrosialin-positive inflammatory macrophages that appeared in the liver later in the pathogenic process. These cells are likely to be involved in repair of the damaged tissue.39 This is supported by our findings that expression of matrix metalloproteinase 9 and connective tissue growth factor, mediators known to be involved in extracellular matrix remodeling and tissue repair,40,41 is up-regulated in the liver 12 to 24 hours after administration of acetaminophen to wild-type mice (manuscript submitted). The observation that CCR2-mediated chemotaxis only affects a subset of macrophages suggests that other chemokines are involved in macrophage recruitment into the liver in this model. In summary, the present studies show that MCP-1 and its receptor, CCR2, are induced in a time- and dosedependent manner and localized to areas of injury after administration of toxic doses of acetaminophen. Moreover, the temporal pattern of MCP-1 and CCR2 expression is correlated with inflammatory macrophage accumulation in the liver. The loss of CCR2 resulted in a decrease in the severity of inflammation and a decrease in the number of macrosialin-positive macrophages in the
1102
DAMBACH ET AL.
tissue with no effect on injury. This suggests that macrophages that accumulate in the tissue after administration of acetaminophen also contribute to wound repair, and this is currently being investigated. Acknowledgment: The authors thank Dr. Patrick J. Farley for his constructive comments and Dr. Carol Gardner for her assistance in the preparation of this manuscript.
References 1. Mitchell JR, Jollow DJ, Potter WZ, Gillette JR, Brodie BB. Acetaminophen-induced hepatic necrosis I: role of drug metabolism. J Pharmacol Exp Ther 1973;187:181-194. 2. Savides MC, Oehme FW, Nash SL, Leipold HW. The toxicity and biotransformation of single doses of acetaminophen in dogs and cats. Toxicol Appl Pharmacol 1984;74:26-34. 3. Thomas SHL. Paracetamol (acetaminophen) poisoning. Pharmacol Ther 1993;60:91-120. 4. Laskin DL, Pilaro AM. Potential role of activated macrophages in acetaminophen hepatotoxicity. I. Isolation and characterization of activated macrophages from the rat liver. Toxicol Appl Pharmacol 1986;86:204-215. 5. Laskin DL, Gardner CR: The role of nonparenchymal cells and inflammatory macrophages in hepatotoxicity. In: Plaa GL, Hewitt WR, eds. Toxicology of the Liver. 2nd ed. New York: Raven, 1998:297-320. 6. Gardner CR, Heck DE, Yang CS, Thomas PE, Zhang X-J, DeGeorge GL, Laskin JD, et al. Role of nitric oxide in acetaminophen-induced hepatotoxicity in the rat. HEPATOLOGY 1998;26: 748-754. 7. Laskin DL, Gardner CR, Price VF, Jollow DJ. Modulation of macrophage functioning abrogates the acute hepatotoxicity of acetaminophen. HEPATOLOGY 1995;21:1045-1050. 8. Michael SL, Pumford NR, Mayeux PR, Niesman MR, Hinson JA. Pretreatment of mice with macrophage inactivators decreases acetaminophen hepatotoxicity and the formation of reactive oxygen and nitrogen species. HEPATOLOGY 1999;30:186-195. 9. Luster AD. Chemokines: chemotactic cytokines that mediate inflammation. N Engl J Med 1998;338:436-445. 10. Rossi D, Zlotnik A. The biology of chemokines and their receptors. Annu Rev Immunol 2000;18:217-242. 11. Kurihara T, Warr G, Loy J, Bravo R. Defects in macrophage recruitment and host defense in mice lacking the ccr2 chemokine receptor. J Exp Med 1997;186:1757-1762. 12. Boring L, Gosling J, Chensue SW, Kunkel SL, Farese RV, Broxmeyer HE, Charo IF. Impaired monocyte migration and reduced type 1 (Th1) cytokine responses in c-c chemokine receptor 2 knockout mice. J Clin Invest 1997;100:2552-2561. 13. Boring L, Charo IF, Rollins BJ. MCP-1 in human disease: insights gained from animal models. In: Herbert, CA, ed. Chemokines in Disease: Biology and Clinical Research. 1st ed. Totowa, NJ: Humana, 1999:53-65. 14. Czaja MJ, Geerts A, Xu J, Schmiedeberg P, Ju Y. Monocyte chemoattractant protein 1 (MCP-1) expression occurs in toxic rat liver injury and human liver disease. J Leukoc Biol 1994;55:120126. 15. Chiao H, Foster S, Thomas R, Lipton J, Star RA. Alpha-melanocyte–stimulating factor hormone reduces endotoxin-induced liver inflammation. J Clin Invest 1996;97:2038-2044.
HEPATOLOGY, May 2002
16. Afford SC, Fisher NC, Neil DAH, Fear J, Brun P, Hubscher SG, Adams DH. Distinct patterns of chemokine expression are associated with leukocyte recruitment in alcoholic hepatitis and alcoholic cirrhosis. J Pathol 1998;186:82-89. 17. Proost P, Wuyts A, Opendakker G, Van Damme J. Monocyte chemotactic proteins 1, 2, and 3. In: Mire-Sluis A, Thorpe R, Page C, eds. Cytokines. New York: Academic, 1998:489-506. 18. Laskin DL, Pilaro AM, Ji S. Potential role of activated macrophages in acetaminophen hepatotoxicity. II. Mechanisms of macrophage accumulation and activation. Toxicol Appl Pharmacol 1986;86:216-226. 19. Lu BB, Rutledge BJ, Gu L, Fiorillo J, Lukacs N, Kunkel SL, North R, et al. Abnormalities in monocyte recruitment and cytokine expression in monocyte chemoattractant protein 1-deficient mice. J Exp Med 1998;187:601-608. 20. Rohr H, Oberholzer M, Bartsch G, Keller M. Morphometry in experimental pathology: methods, baseline data and applications. Int Rev Exp Pathol 1976;15:233-325. 21. Leenen PJM, de Bruijn MFTR, Voerman JSA, Campbell PA, van Ewijk W. Markers of mouse macrophage development detected by monoclonal antibodies. J Immunol Methods 1994;174:5-19. 22. Lee BS, Starkey PM, Gordon S. Quantitative analysis of total macrophage content in adult mouse tissues. J Exp Med 1985;161: 475-489. 23. Holness CL, da Silva RP, Fawcett J, Gordon S, Simmons DL. Macrosialin, a mouse macrophage-restricted glycoprotein, is a member of the lamp/lgp family. J Biol Chem 1993;268:9661-9666. 24. Ramprasad MP, Terpstra V, Kondratenko N, Quehernberger O, Steinberg D. Cell surface expression of mouse macrosialin and human CD68 and their role as macrophage receptors for oxidized low density lipoprotein. Proc Natl Acad Sci U S A 1996;93: 14833-14838. 25. Luster MI, Simeonova PP, Gallucci RM, Bruccoleri A, Blazka ME, Yucesoy B. Role of inflammation in chemical-induced hepatotoxicity. Toxicol Lett 2001;120:317-321. 26. Karnovsky ML, Lazdins JK. Biochemical criteria for activated macrophages. J Immunol 1978;121:809-813. 27. Hamilton TA, Weiel JE, Adams DO. Expression of the transferrin receptor in murine peritoneal macrophages is modulated in the different stages of activation. J Immunol 1984;132:2285-2290. 28. Ezekowitz RAB, Hill M, Gordon S. Interferon a/b selectively antagonises down-regulation of mannosyl-fucosyl receptors on activated macrophages by interferon-gamma. Biochem Biophys Res Commun 1986;136:737-745. 29. Da Silva RP, Gordon S. Phagocytosis stimulates alternative glycosylation of macrosialin (mouse CD68), a macrophage-specific endosomal protein. Biochem J 1999;338:687-694. 30. Austyn JM, Gordon S. F4/80, a monoclonal antibody directed specifically against the mouse macrophage. Eur J Immunol 1981; 11:805-815. 31. Ezekowitz RAB, Gordon S. Down-regulation of mannosyl receptor-mediated endocytosis and antigen F4/80 in bacillus calmetteguerin-activated mouse macrophages. J Exp Med 1982;155: 1623-1637. 32. Jiang Z, Shih DM, Xia Y, Lusis AJ, de Beer FC, de Villiers WJS, van der Westhuyzen DR, et al. Structure, organization, and chromosomal mapping of the gene encoding macrosialin, a macrophage-restricted protein. Genomics 1998;50:199-205. 33. Rabinowitz SS, Gordon S. Macrosialin, a macrophage-restricted membrane sialoprotein differentially glycosylated in response to inflammatory stimuli. J Exp Med 1991;174:827-836.
HEPATOLOGY, Vol. 35, No. 5, 2002
34. Kurushima H, Ramprasad M, Kondratenko N, Foster DM, Quehenberger O, Steinberg D. Surface expression and rapid internalization of macrosialin (mouse CD68) on elicited mouse peritoneal macrophages. Lab Invest 2000;67:104-108. 35. Cohen SD, Khairallah EA. Selective protein arylation and acetaminophen hepatotoxicity. Drug Metab Rev 1997;29:5977. 36. Warmington KS, Boring L, Ruth JH, Sonstein J, Hogaboam CM, Curtis JL, Kunkel SL, et al. Effect of c-c chemokine receptor 2 (ccr2) knockout on type-2 (schistosomal antigenelicited) pulmonary granuloma formation. Am J Pathol 1999; 154:1407-1416. 37. Zisman DA, Kunkel SL, Strieter RM, Tsai WC, Bucknell K, Wilkowski J. MCP-1 protects mice in lethal endotoxemia. J Clin Invest 1997;99:2832-2836.
DAMBACH ET AL.
1103
38. Hogaboam CM, Bone-Larson CL, Steinhauser ML, Matsukawa A, Gosling J, Boring L, Charo IF, et al. Exaggerated hepatic injury due to acetaminophen challenge in mice lacking c-c chemokine receptor 2. Am J Pathol 2000;156:1245-1252. 39. DiPietro LA. Wound healing: the role of the macrophage and other immune cells. Shock 1995;4:233-240. 40. Knittel T, Mehide M, Grundmann A, Saile B, Scharf J-G, Ramadori G. Expression of matrix metalloproteinases and their inhibitors during hepatic tissue repair in the rat. Histochem Cell Biol 2000;113:443-453. 41. Ujike K, Shinji T, Hirasaki S, Shiraha H, Nakamura M, Tsuji T, Koide N. Kinetics of expression of connective tissue growth factor gene during liver regeneration after partial hepatectomy and Dgalactosamine–induced liver injury in rats. Biochem Biophys Res Commun 2000;277:448-454.