- Email: [email protected]
ROLE OF CYCLOOXYGENASE-2 IN THE DEVELOPMENT OF BLADDER OVERACTIVITY AFTER CEREBRAL INFARCTION IN THE RAT
0022-5347/05/1741-0365/0 THE JOURNAL OF UROLOGY® Copyright © 2005 by AMERICAN UROLOGICAL ASSOCIATION
Vol. 174, 365–369, July 2005 Printed in U.S.A.
DOI: 10.1097/01.ju.0000161601.77023.05
ROLE OF CYCLOOXYGENASE-2 IN THE DEVELOPMENT OF BLADDER OVERACTIVITY AFTER CEREBRAL INFARCTION IN THE RAT SATOSHI YOTSUYANAGI,* OSAMU YOKOYAMA, KAZUTO KOMATSU, KOICHI KODAMA, YASUHIRO NAGASAKA AND MIKIO NAMIKI From the Departments of Urology, Kanazawa University School of Medicine, Kanazawa and University of Fukui, Fukui, Japan ABSTRACT
Purpose: We investigated the role of cyclooxygenase (COX) isoforms in bladder overactivity induced by cerebral infarction (CI) in rats. Materials and Methods: CI was induced by left middle cerebral artery occlusion (MCAO) in female Sprague-Dawley rats. Bladder activity was monitored with continuous infusion cystometrography of conscious rats. Specimens were obtained from the pontine tegmental area (PTA) 1, 3, 5, 12 and 24 hours after CI or sham operation (SO). The effects of MK-801 (0.1 mg/kg intravenously), an NMDA (N-methyl-D-aspartate) glutamatergic receptor antagonist, on bladder activity, and on COX-1 and 2 mRNA expression following MCAO were examined. Real-time quantitative reverse transcriptase-polymerase chain reaction was performed to evaluate the effects of CI on gene expression in the PTA. The effects of the COX-2 inhibitor NS398 (0.01 to 10 mg/kg intravenously) on bladder activity were examined. Results: The bladder capacity of CI rats was significantly decreased 1 to 24 hours after MCAO compared with that of SO rats (p ⬍0.05 or 0.01). One and 3 hours after MCAO mean COX-2 mRNA expression ⫾ SE had increased significantly to 22.4 ⫾ 3.5 in terms of its expression relative to the outer control in a sample obtained immediately after MCAO, in contrast to that in SO rats (p ⬍0.01). The expression level returned to the control level within 12 hours after MCAO. COX-1 expression was not influenced by MCAO. Pretreatment with MK-801 inhibited the development of bladder overactivity and significantly decreased the expression of COX-2 mRNA in the PTA (p ⬍0.01). Treatment with NS398 before MCAO prevented the development of bladder overactivity in a dose dependent manner and did not influence infarct volume. Conclusions: These results indicate that the development of bladder overactivity following MCAO is accompanied by an increase in COX-2 mRNA expression in the PTA and is mediated by NMDA receptor activity. COX-2 in the brain may be a new target for the treatment of neurogenic voiding dysfunction after cerebral infarction. KEY WORDS: cerebral infarction; bladder; cyclooxygenase-2; brain; rats, Sprague-Dawley
Voiding dysfunction, such as urinary frequency or incontinence following cerebral infarction, are commonly problems in survivors of cerebrovascular disease. Although the frontal lobe is known to be largely responsible for urinary tract function and damage to the neural circuitry in the forebrain can produce bladder overactivity and urinary incontinence,1 the control of micturition by the brain is not yet understood in detail. Left middle cerebral artery (MCA) occlusion (MCAO) while under halothane or pentobarbital anesthesia2⫺5 has been reported to result in the development of bladder overactivity in rats. Bladder capacity in rats with cerebral infarction (CI) was markedly decreased, indicating bladder overactivity,2 which has been attributed to the interruption of inhibitory pathways from the forebrain to the pontine micturition center (PMC). However, observations that bladder capacity in CI rats was lower than in sham operated (SO) decerebrated rats and decerebration increased bladder capacity in CI rats indicate that CI induces a tonic facilitatory input to the brainstem/spinal pathways controlling voiding.5 We have previously reported that NMDA (N-methyl-D-aspartate) glutamatergic transmission is essential for the development of bladder overactivity following cerebral infarction.6, 7 Therefore, we hypothesized that
neuronal plastic changes, such as long-term potentiation in the hippocampus, might occur in the PMC following MCAO. Previously we have reported the mRNA expression of c-fos and zif268, known as neuronal plasticity related genes, in the pontine tegmental area (PTA) after MCAO and the fact that the expression of these genes was blocked by the NMDA antagonist MK-801 and were synchronized with changes in bladder activity.8 Cyclooxygenase (COX) is a rate limiting enzyme for prostanoid synthesis that is present in at least 2 isoforms, COX-1 and COX-2. COX-1 is expressed constitutively in many cell types, in which it produces prostanoids, which subserve normal physiological functions. COX-2 is known as an immediate early gene. Recently COX-2 was suggested to be a marker of neuronal activity and neuronal plasticity.9, 10 In the current study we investigated the expression of COX isoforms in the PTA in rats with bladder overactivity induced by MCAO. The relationship between NMDA glutamatergic receptors with the expression of these genes and the effects of NS398 on bladder overactivity following MCAO were also studied using a CI model. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the role played by NMDA receptors in the induction of this expression. LightCyclerTM technology was used for continuous real-time PCR with the aid of the fluorescent, double strand, DNA specific dye (SYBR® Green).11 This procedure is sufficiently sensitive to enable low levels of gene expression to be assayed.11
Submitted for publication October 1, 2004. Study received Institutional Animal Care and Use Committee approval. * Correspondence: Department of Urology, Kanazawa University School of Medicine, 13–1 Takara-machi, Kanazawa, Ishikawa 9208641, Japan. 365
366
CYCLOOXYGENASE-2 IN PONS RELATED TO BLADDER OVERACTIVITY MATERIALS AND METHODS
Experiments were performed using 124 female SpragueDawley rats weighing between 220 and 280 gm. Animals were housed at a constant temperature (mean ⫾ SE 23C ⫾ 2C) and humidity (50% to 60%) under a regular 12-hour light/dark schedule with lights on from 7:00 a.m. to 7 p.m. Tap water and standard rat chow were freely available. All experiments were performed in strict accordance with the guidelines of the Institutional Animal Care and Use Committee. Cystometrography (CMG) in conscious rats. Following 2% halothane inhalation the bladder was exposed via a midline incision in the abdomen. A polyethylene tube (size 4, inner and outer diameters 0.8 and 1.3 mm, respectively) was implanted into the bladder through the dome and secured with 5-zero silk suture, as described previously.8 The catheter was passed through the subcutaneous tissue and extruded through the skin at the neck. After suturing the abdominal skin the rats were placed in Ballman restraining cages (KN326 Type 3, Natsume Seisakusyo Co., Ltd., Tokyo, Japan). The CMG catheter was connected to a TE-311 pump (Terumo Co., Ltd., Tokyo, Japan) for continuous infusion of saline and to a TP-200T pressure transducer (Nihon-Kohden Co., Ltd., Tokyo, Japan) by a polyethylene T tube. Three hours after catheter implantation control cystometric recordings were obtained without anesthesia by infusing physiological saline at room temperature into the bladder at a rate of 0.04 ml per minute. Saline voided from the urethral meatus was then measured to determine voided volume. Evacuating the bladder through the CMG catheter enabled the measurement of residual volume after the micturition reflex. Bladder capacity was defined as the sum of voided and residual volumes. Rats with a large residual volume after urination were excluded from the current study. Technique for inducing cerebral infarction in rats. The rats were classified into 3 groups, including 30 with SO, 30 with CI and 18 CI rats pretreated with MK-801 at 30 minutes before MCAO (MK-CI rats). Immediately after completion of the first cystometric recording the rats were anesthetized with halothane and the left carotid bifurcation was exposed through a midline incision in the neck. After ligating the left common carotid artery the left internal carotid artery (ICA) was isolated and carefully separated from the adjacent vagus nerve. The pterygopalatine branch of the left ICA was ligated close to its origin. A 4-zero monofilament nylon thread with the tip rounded by exposure to flame was inserted into the left ICA and advanced a distance of 17 mm from the carotid bifurcation as far as the origin of the left MCA, where it occluded the blood flow and, thus, induced infarction on the left side of the brain.12 In SO animals the left carotid bifurcation was exposed through a midline incision in the neck and the ICA was isolated and carefully separated from the adjacent vagus nerve. Because no additional procedures were performed, SO rats served as controls. In MK-CI rats MCAO was performed 30 minutes after the intravenous administration of 0.1 mg/kg MK-801 from the cannulated left jugular vein. The MK-801 dose was determined in a previous study.3 After SO or MCAO and recovery from halothane anesthesia cystometric recordings were done with the rats in a restraining cage. SO and CI rats were sacrificed 1, 3, 5, 12 or 24 hours (6 each) after operation. MK-801 (0.1 mg/kg intravenously) was administered to 18 rats 30 minutes before MCA occlusion. MK-CI rats were sacrificed 1, 3 or 5 hours (6 each) after operation. Effects of intravenous administration of NS398. We investigated the effects of NS398, a selective COX-2 inhibitor, to evaluate the role of COX-2 in the development of bladder overactivity induced by MCAO. We performed MCAO 30 minutes after the intravenous administration of NS398 (0.01 to 10 mg/kg, vehicle and 80% dimethyl sulfoxide [DMSO] in 9 each). Preparation of PTA. The brain was removed and the cere-
bellum was immediately dissected. A 2 ⫻ 2 mm tissue sample of PTA was resected from below the colliculus inferior. Tissue specimens were frozen immediately in liquid nitrogen and stored at – 80C until RNA extraction. Total RNA extraction and reverse transcription. Total RNA was purified with Isogen RNA extraction reagent (Nippon Gene, Tokyo, Japan). cDNA was made by reverse transcription (RT) of 1 g of each total RNA using a Ready-To-Go T-Prime First-Strand kit (Amersham Pharmacia Biotech, Piscataway, New Jersey). Quantitative real-time PCR. Quantitative real-time PCR using the LightCyclerTM system for -actin (94C for 1 second, 60C for 1 second and 72C for 2 seconds), COX-1 (94C for 15 seconds, 62C for 30 seconds and 72C for 30 second) and COX-2 (92C for 15 seconds, 62C for 30 seconds and 74C for 30 second) was done using certain forward (F) and reverse (R) primers to detect COX-1, COX-2 and -actin. -Actin served as the internal standard. The primer pairs were COX-1-F, 5⬘- TTTGCACAACACTTCACCCACCAG -3⬘, COX-1-R, 5⬘- AAACACCTCCTGGGCCACAGCCAT -3⬘, COX2-F, 5⬘- GTGCCTGGTCTGATGATGTATGC -3⬘, COX-2-R 5⬘- CCATAAGTCCTTTCAAGGAGAATG -3⬘, -actin-F, 5⬘- TTGTAACCAACTGGGACGATATGG -3⬘ and -actin-R, 5⬘- ATCGGAACCGCTCATTGCC -3⬘. These primers were selected based on previously reported sequences.8, 13, 14 The amplified products for COX-1, COX-2 and -actin were all of the expected size (277, 724 and 546 bp, respectively), as determined by electrophoresis on 1.5% agarose gels. Evaluation of the corrected infarct volume. After evaluation of the drug effects the rat brain was stained by perfusion with 2% TTC (2,3,5-triphenyltetrazolium chloride) (Sigma Chemical Co., St. Louis, Missouri).15 We then performed thoracotomy, inserted a catheter into the ascending aorta via the left ventricle, which was used for perfusion with heparinized saline, and incised the right atrium. After 2 minutes the right atrium was clamped and 2% TTC in saline was infused during 7 minutes. After the completion of perfusion the rat brains were removed and the cerebral hemispheres were cut into 5 coronal slices, each 2 mm thick. The rostral surface of the TTC stained sections was photographed with color slide film and the area of the ischemic lesion was quantified by computer assisted image analysis using National Institutes of Health Image, version 1.61. Corrected infarct volume was then calculated according to the method of Golanov and Reis.16 Data analysis. Data are expressed as the mean ⫾ SE. Statistical comparisons were performed by the MannWhitney U test when there was no correspondence. When there was correspondence among the different time groups, the Wilcoxon signed rank test was used. Bladder capacity changes associated with different doses of treatment were compared using 2-way repeated measures ANOVA for repeated measures, followed by the Fisher protected least significant difference test for individual comparisons with p ⬍0.05 considered statistically significant. RESULTS
Effects of left MCA occlusion on CMGs. We examined the effects of MCAO or SO on bladder capacity in conscious rats. Bladder capacity before MCAO was 0.42 ⫾ 0.02 ml in CI rats and 0.42 ⫾ 0.03 ml in SO rats. The difference was not significant. Bladder capacity in CI and SO rats at 1 hour was 0.14 ⫾ 0.01 and 0.38 ⫾ 0.08 ml, at 3 hours it was 0.17 ⫾ 0.02 and 0.35 ⫾ 0.05 ml, at 5 hours it was 0.13 ⫾ 0.02 and 0.37 ⫾ 0.05 ml, at 12 hours it was 0.18 ⫾ 0.02 and 0.46 ⫾ 0.04 ml, and at 24 hours it was 0.22 ⫾ 0.04 and 0.46 ⫾ 0.03 ml, respectively. Thus, CI rats showed a significant decrease in bladder capacity until 24 hours after MCAO (Mann-Whitney U test p ⬍0.05 or ⬍0.01, fig. 1). Residual volume in CI and SO rats at 1 hour was 0.018 ⫾ 0.006 and 0.017 ⫾ 0.008 ml, at 3 hours it was 0.013 ⫾ 0.005 and 0.017 ⫾ 0.004 ml, at 5 hours
CYCLOOXYGENASE-2 IN PONS RELATED TO BLADDER OVERACTIVITY
FIG. 1. Bladder capacity following SO and MCAO in 6 rats each. CI rats showed significant decrease in bladder capacity at all time points after MCAO. Bars represent mean ⫾ SE. Single asterisk indicates p ⬍0.05. Double asterisks indicate 0.01.
it was 0.017 ⫾ 0.006 and 0.013 ⫾ 0.005 ml, at 12 hours it was 0.018 ⫾ 0.005 and 0.013 ⫾ 0.005 ml, and at 24 hours it was 0.020 ⫾ 0.008 and 0.023 ⫾ 0.008 ml, respectively. Residual volume in all rats was insignificant and, thus, micturition volume was almost equivalent to bladder capacity. Effects of left MCA occlusion on expression of COX-1 and COX-2 in the PTA. COX isoform mRNA expression was investigated by real-time quantitative RT-PCR. Values of COX-1 and COX-2 mRNA expression in the outer control obtained from samples immediately after MCAO were set at 1, after which all values obtained from real-time quantitative PCR were normalized in terms of the -actin level and measured as relative expression. PCR products were electrophoresed through 1.2% agarose gels and expected sizes were confirmed (fig. 2). The relative COX-1 expression level in CI and SO rats at 1 hour was 0.78 ⫾ 0.05 and 0.87 ⫾ 0.08, at 3 hours it was 0.81 ⫾ 0.11 and 0.68 ⫾ 0.13, at 5 hours it was 0.82 ⫾ 0.10 and 0.93 ⫾ 0.19, at 12 hours it was 0.58 ⫾ 0.07 and 0.50 ⫾ 0.08, and at 24 hours it was 0.49 ⫾ 0.08 and 0.47 ⫾ 0.06. There were no significant differences in the expression of COX-1 mRNA between SO and CI rats but the level tended to decrease in a time dependent manner in each group (fig. 3). Significant differences between CI and SO rats were found between the 1-hour group and the 12 or 24-hour group (Mann-Whitney U test p ⬍0.05, fig. 3). The relative COX-2 expression level in CI and SO rats at 1 hour was 22.40 ⫾ 3.47 and 4.01 ⫾ 0.26, at 3 hours it was 17.97 ⫾ 2.98 and 3.58 ⫾ 1.46, at 5 hours it was 8.45 ⫾ 2.83 and 3.51 ⫾ 0.62, at 12 hours it was 0.84 ⫾ 0.07 and 1.03 ⫾ 0.36, and at 24 hours it was 1.45 ⫾ 0.42 and 1.13 ⫾ 0.18, respectively. Thus, COX-2 mRNA expression level was increased markedly 1 and 3 hours after MCAO (p ⬍0.01, fig. 4). The expression level in SO rats decreased in a time dependent manner and it had returned to the outer control level 12 hours after
FIG. 2. COX-1, COX-2 and -actin expression. Lane 1, PCR products (25/50 cycles) 1 hour after MCAO. Lane 2, PCR products (25/50 cycles) 1 hour after SO. Lane 3, PCR products obtained from MK-CI rats at 1 hour. Left lane, intense band is 500 bp long.
367
FIG. 3. Changes in COX-1 mRNA expression following SO and MCAO in 6 rats each. Gene expression was determined relative to outer standard, that is cDNA from PTA obtained immediately after MCAO. Bars represent mean ⫾ SE. SO vs CI not significantly different.
FIG. 4. Changes in COX-2 mRNA expression following SO and MCAO in 6 rats each. COX-2 mRNA expression was increased significantly 1 and 3 hours after MCAO. Bars represent mean ⫾ SE. Single asterisk indicates p ⬍0.05. Double asterisks indicate p ⫽ 0.01.
MCAO. PCR products were electrophoresed on 1.2% agarose gels and expected sizes were confirmed (fig. 2). Effects of MK-801 on bladder capacity and COX-2 mRNA expression. In MK-CI rats (CI rats pretreated with 0.1 mg/kg MK-801 intravenously) no decrease in bladder capacity was observed in the 1, 3 or 5-hour group by the Wilcoxon signed rank test. No significant differences were detected between SO and MK-CI rats by the Mann-Whitney U test (fig. 5). Thus, MK-801 appeared to have prevented the development of bladder overactivity caused by MCAO. Because our previous experiment showed an increase in COX-2 mRNA expression in CI rats 1 to 5 hours after MCAO, samples obtained
FIG. 5. Influence of MK-801 pretreatment on bladder capacity after MCAO in 6 SO, 6 CI and 6 MK-CI rats. MK-CI rats showed significant suppression of bladder overactivity development at all time points after MCAO. Bars represent mean ⫾ SE. NS, not significant. Single asterisk indicates p ⬍0.05. Double asterisks indicate p ⫽ 0.01.
368
CYCLOOXYGENASE-2 IN PONS RELATED TO BLADDER OVERACTIVITY
from the 1, 3 and 5-hour groups were subjected to real-time quantitative RT-PCR assay. The relative COX-2 mRNA expression level at 1, 3 and 5 hours in MK-CI rats was 1.08 ⫾ 0.16, 1.00 ⫾ 0.12 and 1.34 ⫾ 0.12, respectively (fig. 6). Thus, MK-801 pretreatment suppressed the increase in COX-2 mRNA expression in CI rats (Mann-Whitney U test p ⬍0.01, fig. 6). Furthermore, there was a significant difference between MK-CI and SO rats 1 hour after operation (p ⬍0.05, fig. 6). Thus, 0.1 mg/kg MK-801 prevented any change in bladder capacity and suppressed the increase in COX-2 mRNA expression in the PTA in rats with CI. Effects of the COX-2 inhibitor NS398 on bladder capacity and infarct volume. We also investigated the effects of NS398, a selective COX-2 inhibitor, to evaluate the role of COX-2 in the development of bladder overactivity induced by MCAO. MCAO was performed 30 minutes after intravenous administration of NS-398. Infarct volume following pretreatment with 80% DMSO (vehicle), and 0.01, 0.1, 1.0 and 10 mg/kg NS398 was 437.4 ⫾ 31.2, 425.2 ⫾ 28.0, 474.4 ⫾ 43.3, 510.4 ⫾ 35.0 and 455.3 ⫾ 34.8 mm2, respectively (fig. 7). Infarct volume showed no significant differences between rats pretreated with 80% DMSO and those pretreated with NS-398 (fig. 7). Thus, NS-398 pretreatment had no influence on infarct volume by MCAO. NS398 pretreatment prevented the development of bladder overactivity after MCAO in a dose dependent manner. Pretreatment with more than 0.1 mg/kg NS398 significantly suppressed the development of bladder overactivity (ANOVA p ⬍0.05 or ⬍0.001, fig. 8). An NS398 dose of 10 mg/kg did not decrease bladder capacity after MCAO.
FIG. 7. Corrected infarct volume in CI rats pretreated with NS398. Bars represent 9 rats each. Values are shown as mean ⫾ SE. Vehicle treated controls vs CI rats pretreated with NS398 not significantly different (NS).
DISCUSSION
Our previous study suggested that physiological changes in the form of neuronal plasticity, such as an increase in synaptic transmission, occur in the PMC following cerebral infarction.5 The levels of mRNA expression of the neuronal plasticity related genes c-fos and zif268 were increased significantly in the PTA of CI rats. Bladder overactivity induced by MCAO was inhibited by the administration of MK-801, and peak values of c-fos and zif268 mRNA expression were significantly decreased by pretreatment with MK-801.8 These results indicated that c-fos and zif268 mRNA expression in the PTA are closely related to the bladder overactivity induced by MCAO and they are mediated by NMDA glutamatergic transmission. Therefore, it is reasonable to speculate that a neuronal plastic change occurs in the PTA at the initial stage of the long lasting, infarction induced potentiation of bladder reflexes.8 The results of the current study show that bladder capacity in CI rats was decreased significantly. The expression of
FIG. 6. Influence of MK-801 pretreatment on COX-2 mRNA expression in 6 SO, 6 CI and 6 MK-CI rats. MK-801 significantly decreased COX-2 mRNA expression 1 and 3 hours after MCAO. Bars represent mean ⫾ SE. CI rats pretreated with MK-801 vs SO rats significantly different. NS, not significant. Single asterisk indicates p ⬍0.05. Double asterisks indicate p ⫽ 0.01.
FIG. 8. Changes in bladder capacity in CI rats pretreated with NS398. Values are shown as mean ⫾ SE in 9 rats each treated with vehicle, and 0.01, 0.1, 1 and 10 mg/kg, respectively. Single asterisk indicates p ⬍0.05. Triple asterisks indicate p ⫽ 0.001.
COX-2 mRNA in the PTA had increased markedly 1 to 3 hours after MCAO and it returned to the outer control level at 12 hours, while that of COX-1 mRNA was not significantly different between SO and CI rats. Kinouchi et al observed that MCAO induced c-fos and COX-2 mRNA in the brain using in situ hybridization.17 However, c-fos mRNA expression induced in the whole MCA territory, adjacent cortex (cingulate cortex) and distant brain regions, such as the hippocampus and substantia nigra, did not induce COX-2 mRNA in the ischemic core (lateral striatum), but only in the penumbral area (MCA cortex).17 To our knowledge the current study represents the first demonstration that COX-2 mRNA expression in the pons of rats is induced after MCAO. COX-2, c-fos and zif 268 mRNA are often expressed in neurons together in response to various stimuli. c-fos and zif268 are transcription factors but it is uncertain whether these gene products regulate COX-2 transcription. Some reports showed that the expression of these 3 genes was required for CREB (cyclic adenosine monophosphate responsive element binding protein) activation in response to the increase in intracellular cyclic adenosine monophosphate or calcium levels.18, 19 COX-2, c-fos and zif268 expression after cerebral ischemia in the PTA were likely to develop due to CREB activation via NMDA receptors in the pons. COX-2 has been reported to have direct effects on neurotransmitter release and glutamatergic receptors.20 Prostaglandins may facilitate sensory neuropeptide release and sensitize sensory recep-
CYCLOOXYGENASE-2 IN PONS RELATED TO BLADDER OVERACTIVITY
tors.20 Therefore, COX-2 expression in the PMC may change the neuronal activity related to micturition. Recently we reported that supraspinal nitric oxide has an important role in bladder overactivity after cerebral infarction but it does not affect normal micturition in rats and the administration of 1-(2-trifluoromethylphenyl) imidazole, a neuronal nitric oxide synthase inhibitor, significantly increased bladder capacity in CI rats.21 The correlation between COX-2 and nitric oxide synthase is well known. Nagayama et al reported that the COX-2 inhibitor NS398 ameliorates ischemic brain injury in wild-type mice but not in those with deletion of the inducible NOS gene.22 Therefore, COX-2 may act along with NOS or some other genes regulated by COX-2 in the bladder overactivity following cerebral infarction. In the current study intravenous administration of a dose of more than 0.1 mg/kg of the selective COX-2 inhibitor NS398 intravenously prevented the development of bladder overactivity. NS398 pretreatment did not influence infarct volume by MCAO but it prevented the development of bladder overactivity. Infarct volume was not significantly different between rats pretreated with 80% DMSO and those pretreated with NS398. Therefore, the mechanism by which intravenous administration of NS398 inhibited the development of bladder overactivity did not involve a decrease in infarct volume. We believe that NS398 prevented the development of bladder overactivity by inhibiting pontine COX-2. However, it was reported recently that permanent MCAO did not induce COX-2 mRNAs in the ischemic core but strongly induced mRNAs in the penumbral area (medial striatum and periphery of MCA cortex) and adjacent cortex (cingulate cortex), and COX-2 mRNA was only induced in the bilateral hippocampus in brain regions distant from the ischemic area.19 It is possible that NS398 may also have an effect in these areas, including the penumbra. At 1 hour after SO COX-2 expression in SO rats had increased by about 4-fold compared with that in the outer control and it had again returned to the control level by 12 hours. Since COX-2 is expressed in response to inflammation or pain, the small increase in the level of COX-2 expression after SO was most likely due to stress. Although the current study was not performed using the deletion model of COX-2 expression in the pons, inhibition of the COX-2 enzyme was shown to prevent the development of bladder overactivity. Therefore, we believe that COX-2 is essential for the development of bladder overactivity after CI. The results of the current study suggest that the signal transduction cascade introduced by neuronal membrane depolarization or the activation of NMDA receptors and subsequent arachidonic acid cascade have important roles in the development of bladder overactivity after CI. CONCLUSIONS
To our knowledge the current study is the first to show that COX-2 expression in the brain is related to micturition disorders following CI. COX-2 was shown to be expressed concomitant with the development of bladder overactivity following CI and to be mediated by NMDA receptors in the pons. Pretreatment with the selective COX-2 inhibitor NS398 prevented the development of bladder overactivity. These results indicate that COX-2 transcription in the pontine tegmentum may be necessary for the establishment of the long-term bladder overactivity caused by CI. The arachidonic acid cascade in the brain inducing bladder overactivity may be a new target for pharmacological or gene therapy. REFERENCES
1. Griffiths, D. J., McCracken, P. N., Harrison, G. M., Gormley, E. A., Moore, K., Hooper, R. et al: Cerebral aetiology of urinary urge incontinence in elderly people. Age Aging, 23: 246, 1994 2. Yokoyama, O., Komatsu, K., Ishiura, Y., Nakamura, Y., Morikawa, K. and Namiki, M.: Change in bladder contractility associated with bladder overactivity in rats with cerebral in-
369
farction. J Urol, 157: 577, 1998 3. Yokoyama, O., Ishiura, Y., Komatsu, K., Mita, E., Nakamura, Y., Kunimi, K. et al: Effect of MK-801 on bladder overactivity in rats with cerebral infarction. J Urol, 159: 571, 1998 4. Yokoyama, O., Yoshiyama, M., Namiki, M. and de Groat, W. C.: Glutamatergic and dopaminergic contributions to rat bladder hyperactivity following cerebral artery occlusion. Am J Physiol, 276: R935, 1999 5. Yokoyama, O., Yoshiyama, M., Namiki, M. and de Groat, W. C.: Role of the forebrain in bladder overactivity following cerebral infarction in the rat. Exp Neurol, 163: 469, 2000 6. Yokoyama, O., Yoshiyama, M., Namiki, M. and de Groat, W. C.: Influence of anesthesia on bladder hyperactivity induced by middle cerebral artery occlusion in the rat. Am J Physiol, 273: R1900, 1997 7. Yokoyama, O., Mizuno, H., Komatsu, K., Akino, H., Tanase, K. and Namiki, M.: Role of glutamate receptors in the development and maintenance of bladder overactivity after cerebral infarction in the rat. J Urol, 171: 1709, 2004 8. Yotsuyanagi, S., Yokoyama, O., Komatsu, K., Kodama, K., Niikura, S. and Namiki, M.: Expression of neural plasticity related gene in the pontine tegmental area of rats with overactive bladder after cerebral infarction. J Urol, 166: 1148, 2001 9. Yamagata, K., Andreasson, K. I., Kaufmann, W. E. and Worley, P. F.: Expression of a mitogen-inducible cyclooxygenase in brain neurons: regulation by synaptic activity and glucocorticoids. Neuron, 11: 371, 1993 10. Bazan, N. G. and Allan, G.: Platelet-activating factor in the modulation of excitary amino acid neurotransmitter release and of gene expression. J Lipid Mediat Cell Signal, 14: 321, 1996 11. Wittwer, C. T., Ririe, K. M., Andrew, R. V., David, D. A., Gundry, R. A. and Balis, U. J.: The LightCycler: a microvolume multisample fluorimeter with rapid temperature control. Biotechniques, 22: 176, 1997 12. Longa, E. Z., Weinstein, P. R., Carlson, S. and Cummins, R.: Reversible middle cerebral artery occlusion without craniotomy in rats. Stroke, 20: 84, 1989 13. Wong, P. Y., Chan, H. C., Leung, P. S., Chung, Y. W., Wong, Y. L., Lee, W. M. et al: Regulation of anion secretion by cyclooxygenese and prostanoids in cultured epididymal epithelia from the rat. J Physiol, 514: 809, 1999 14. Fujita, H., Koshida, K., Keller, E. T., Takahashi, Y, Yoshimito, T., Namiki, M. et al: Cyclooxygenase-2 promotes prostate cancer progression. Prostate, 53: 232, 2002 15. Hatfield, R. H., Mendelow, A. D., Perry, R. H., Alvarez, L. M. and Modha, P.: Triphenyltetrazoline chloride (TTC) as a marker for ischemic changes in rat brain following permanent middle cerebral artery occlusion. Neuropathol Appl Neurobiol, 17: 61, 1991 16. Golanov, E. V. and Reis, D. J.: Contribution of cerebral edema to the neuronal salvage elicited by stimulation of cerebellar fastigial nucleus after occlusion of the middle cerebral artery in rat. J Cereb Blood Flow Metab, 15: 172, 1995 17. Kinouci, H., Huang, H., Arai, S., Mizoi, K. and Yoshimoto, T.: Induction of cyclooxygenase-2 messenger RNA after transient and permanent middle cerebral artery occlusion in rats: comparison with c-fos messenger RNA by using in situ hybridization. J Neurosurg, 91: 1005, 1999 18. Rudnick, D. A., Perlmutter, D. H. and Muglia, L. J.: Prostaglandins are required for CREB activation and cellular proliferation during liver regeneration. Proc Natl Acad Sci USA, 98: 8885, 2001 19. Ji, R. R. and Woolf, C. J.: Neuronal plasticity and signal transduction in nociceptive neurons: implications for the initiation and maintenance of pathological pain. Neurobiol Dis, 8: 1, 2001 20. Mietinen, S., Fusco, F. R., Yrjanheikki, J., Keinanen, R., Hirvonen, T., Roivainen, R. et al: Spreading depression and focal brain ischemia induce cyclooxygenase-2 in cortical neurons through N-methyl-D-aspartartic acid-receptors and phospholipase A2. Proc Natl Acad Sci USA, 94: 6500, 1997 21. Kodama, K., Yokoyama, O., Komatsu, K., Yotsuyanagi, S., Nikura, S. and Namiki, M.: Contribution of cerebral nitric oxide to bladder overactivity after cerebral infarction in rats. J Urol, 167: 391, 2002 22. Nagayama, M., Niwa, K., Nagayama, T., Ross, M. E. and Iadecola, C.: The cyclooxygenase-2 inhibitor NS-398 ameliorates ischemic brain injury in wild-type mice but not in mice with deletion of the inducible nitric oxide synthase gene. J Cereb Blood Flow Metab, 19: 1213, 1999
Vol. 174, 365–369, July 2005 Printed in U.S.A.
DOI: 10.1097/01.ju.0000161601.77023.05
ROLE OF CYCLOOXYGENASE-2 IN THE DEVELOPMENT OF BLADDER OVERACTIVITY AFTER CEREBRAL INFARCTION IN THE RAT SATOSHI YOTSUYANAGI,* OSAMU YOKOYAMA, KAZUTO KOMATSU, KOICHI KODAMA, YASUHIRO NAGASAKA AND MIKIO NAMIKI From the Departments of Urology, Kanazawa University School of Medicine, Kanazawa and University of Fukui, Fukui, Japan ABSTRACT
Purpose: We investigated the role of cyclooxygenase (COX) isoforms in bladder overactivity induced by cerebral infarction (CI) in rats. Materials and Methods: CI was induced by left middle cerebral artery occlusion (MCAO) in female Sprague-Dawley rats. Bladder activity was monitored with continuous infusion cystometrography of conscious rats. Specimens were obtained from the pontine tegmental area (PTA) 1, 3, 5, 12 and 24 hours after CI or sham operation (SO). The effects of MK-801 (0.1 mg/kg intravenously), an NMDA (N-methyl-D-aspartate) glutamatergic receptor antagonist, on bladder activity, and on COX-1 and 2 mRNA expression following MCAO were examined. Real-time quantitative reverse transcriptase-polymerase chain reaction was performed to evaluate the effects of CI on gene expression in the PTA. The effects of the COX-2 inhibitor NS398 (0.01 to 10 mg/kg intravenously) on bladder activity were examined. Results: The bladder capacity of CI rats was significantly decreased 1 to 24 hours after MCAO compared with that of SO rats (p ⬍0.05 or 0.01). One and 3 hours after MCAO mean COX-2 mRNA expression ⫾ SE had increased significantly to 22.4 ⫾ 3.5 in terms of its expression relative to the outer control in a sample obtained immediately after MCAO, in contrast to that in SO rats (p ⬍0.01). The expression level returned to the control level within 12 hours after MCAO. COX-1 expression was not influenced by MCAO. Pretreatment with MK-801 inhibited the development of bladder overactivity and significantly decreased the expression of COX-2 mRNA in the PTA (p ⬍0.01). Treatment with NS398 before MCAO prevented the development of bladder overactivity in a dose dependent manner and did not influence infarct volume. Conclusions: These results indicate that the development of bladder overactivity following MCAO is accompanied by an increase in COX-2 mRNA expression in the PTA and is mediated by NMDA receptor activity. COX-2 in the brain may be a new target for the treatment of neurogenic voiding dysfunction after cerebral infarction. KEY WORDS: cerebral infarction; bladder; cyclooxygenase-2; brain; rats, Sprague-Dawley
Voiding dysfunction, such as urinary frequency or incontinence following cerebral infarction, are commonly problems in survivors of cerebrovascular disease. Although the frontal lobe is known to be largely responsible for urinary tract function and damage to the neural circuitry in the forebrain can produce bladder overactivity and urinary incontinence,1 the control of micturition by the brain is not yet understood in detail. Left middle cerebral artery (MCA) occlusion (MCAO) while under halothane or pentobarbital anesthesia2⫺5 has been reported to result in the development of bladder overactivity in rats. Bladder capacity in rats with cerebral infarction (CI) was markedly decreased, indicating bladder overactivity,2 which has been attributed to the interruption of inhibitory pathways from the forebrain to the pontine micturition center (PMC). However, observations that bladder capacity in CI rats was lower than in sham operated (SO) decerebrated rats and decerebration increased bladder capacity in CI rats indicate that CI induces a tonic facilitatory input to the brainstem/spinal pathways controlling voiding.5 We have previously reported that NMDA (N-methyl-D-aspartate) glutamatergic transmission is essential for the development of bladder overactivity following cerebral infarction.6, 7 Therefore, we hypothesized that
neuronal plastic changes, such as long-term potentiation in the hippocampus, might occur in the PMC following MCAO. Previously we have reported the mRNA expression of c-fos and zif268, known as neuronal plasticity related genes, in the pontine tegmental area (PTA) after MCAO and the fact that the expression of these genes was blocked by the NMDA antagonist MK-801 and were synchronized with changes in bladder activity.8 Cyclooxygenase (COX) is a rate limiting enzyme for prostanoid synthesis that is present in at least 2 isoforms, COX-1 and COX-2. COX-1 is expressed constitutively in many cell types, in which it produces prostanoids, which subserve normal physiological functions. COX-2 is known as an immediate early gene. Recently COX-2 was suggested to be a marker of neuronal activity and neuronal plasticity.9, 10 In the current study we investigated the expression of COX isoforms in the PTA in rats with bladder overactivity induced by MCAO. The relationship between NMDA glutamatergic receptors with the expression of these genes and the effects of NS398 on bladder overactivity following MCAO were also studied using a CI model. We used real-time quantitative polymerase chain reaction (PCR) to evaluate the role played by NMDA receptors in the induction of this expression. LightCyclerTM technology was used for continuous real-time PCR with the aid of the fluorescent, double strand, DNA specific dye (SYBR® Green).11 This procedure is sufficiently sensitive to enable low levels of gene expression to be assayed.11
Submitted for publication October 1, 2004. Study received Institutional Animal Care and Use Committee approval. * Correspondence: Department of Urology, Kanazawa University School of Medicine, 13–1 Takara-machi, Kanazawa, Ishikawa 9208641, Japan. 365
366
CYCLOOXYGENASE-2 IN PONS RELATED TO BLADDER OVERACTIVITY MATERIALS AND METHODS
Experiments were performed using 124 female SpragueDawley rats weighing between 220 and 280 gm. Animals were housed at a constant temperature (mean ⫾ SE 23C ⫾ 2C) and humidity (50% to 60%) under a regular 12-hour light/dark schedule with lights on from 7:00 a.m. to 7 p.m. Tap water and standard rat chow were freely available. All experiments were performed in strict accordance with the guidelines of the Institutional Animal Care and Use Committee. Cystometrography (CMG) in conscious rats. Following 2% halothane inhalation the bladder was exposed via a midline incision in the abdomen. A polyethylene tube (size 4, inner and outer diameters 0.8 and 1.3 mm, respectively) was implanted into the bladder through the dome and secured with 5-zero silk suture, as described previously.8 The catheter was passed through the subcutaneous tissue and extruded through the skin at the neck. After suturing the abdominal skin the rats were placed in Ballman restraining cages (KN326 Type 3, Natsume Seisakusyo Co., Ltd., Tokyo, Japan). The CMG catheter was connected to a TE-311 pump (Terumo Co., Ltd., Tokyo, Japan) for continuous infusion of saline and to a TP-200T pressure transducer (Nihon-Kohden Co., Ltd., Tokyo, Japan) by a polyethylene T tube. Three hours after catheter implantation control cystometric recordings were obtained without anesthesia by infusing physiological saline at room temperature into the bladder at a rate of 0.04 ml per minute. Saline voided from the urethral meatus was then measured to determine voided volume. Evacuating the bladder through the CMG catheter enabled the measurement of residual volume after the micturition reflex. Bladder capacity was defined as the sum of voided and residual volumes. Rats with a large residual volume after urination were excluded from the current study. Technique for inducing cerebral infarction in rats. The rats were classified into 3 groups, including 30 with SO, 30 with CI and 18 CI rats pretreated with MK-801 at 30 minutes before MCAO (MK-CI rats). Immediately after completion of the first cystometric recording the rats were anesthetized with halothane and the left carotid bifurcation was exposed through a midline incision in the neck. After ligating the left common carotid artery the left internal carotid artery (ICA) was isolated and carefully separated from the adjacent vagus nerve. The pterygopalatine branch of the left ICA was ligated close to its origin. A 4-zero monofilament nylon thread with the tip rounded by exposure to flame was inserted into the left ICA and advanced a distance of 17 mm from the carotid bifurcation as far as the origin of the left MCA, where it occluded the blood flow and, thus, induced infarction on the left side of the brain.12 In SO animals the left carotid bifurcation was exposed through a midline incision in the neck and the ICA was isolated and carefully separated from the adjacent vagus nerve. Because no additional procedures were performed, SO rats served as controls. In MK-CI rats MCAO was performed 30 minutes after the intravenous administration of 0.1 mg/kg MK-801 from the cannulated left jugular vein. The MK-801 dose was determined in a previous study.3 After SO or MCAO and recovery from halothane anesthesia cystometric recordings were done with the rats in a restraining cage. SO and CI rats were sacrificed 1, 3, 5, 12 or 24 hours (6 each) after operation. MK-801 (0.1 mg/kg intravenously) was administered to 18 rats 30 minutes before MCA occlusion. MK-CI rats were sacrificed 1, 3 or 5 hours (6 each) after operation. Effects of intravenous administration of NS398. We investigated the effects of NS398, a selective COX-2 inhibitor, to evaluate the role of COX-2 in the development of bladder overactivity induced by MCAO. We performed MCAO 30 minutes after the intravenous administration of NS398 (0.01 to 10 mg/kg, vehicle and 80% dimethyl sulfoxide [DMSO] in 9 each). Preparation of PTA. The brain was removed and the cere-
bellum was immediately dissected. A 2 ⫻ 2 mm tissue sample of PTA was resected from below the colliculus inferior. Tissue specimens were frozen immediately in liquid nitrogen and stored at – 80C until RNA extraction. Total RNA extraction and reverse transcription. Total RNA was purified with Isogen RNA extraction reagent (Nippon Gene, Tokyo, Japan). cDNA was made by reverse transcription (RT) of 1 g of each total RNA using a Ready-To-Go T-Prime First-Strand kit (Amersham Pharmacia Biotech, Piscataway, New Jersey). Quantitative real-time PCR. Quantitative real-time PCR using the LightCyclerTM system for -actin (94C for 1 second, 60C for 1 second and 72C for 2 seconds), COX-1 (94C for 15 seconds, 62C for 30 seconds and 72C for 30 second) and COX-2 (92C for 15 seconds, 62C for 30 seconds and 74C for 30 second) was done using certain forward (F) and reverse (R) primers to detect COX-1, COX-2 and -actin. -Actin served as the internal standard. The primer pairs were COX-1-F, 5⬘- TTTGCACAACACTTCACCCACCAG -3⬘, COX-1-R, 5⬘- AAACACCTCCTGGGCCACAGCCAT -3⬘, COX2-F, 5⬘- GTGCCTGGTCTGATGATGTATGC -3⬘, COX-2-R 5⬘- CCATAAGTCCTTTCAAGGAGAATG -3⬘, -actin-F, 5⬘- TTGTAACCAACTGGGACGATATGG -3⬘ and -actin-R, 5⬘- ATCGGAACCGCTCATTGCC -3⬘. These primers were selected based on previously reported sequences.8, 13, 14 The amplified products for COX-1, COX-2 and -actin were all of the expected size (277, 724 and 546 bp, respectively), as determined by electrophoresis on 1.5% agarose gels. Evaluation of the corrected infarct volume. After evaluation of the drug effects the rat brain was stained by perfusion with 2% TTC (2,3,5-triphenyltetrazolium chloride) (Sigma Chemical Co., St. Louis, Missouri).15 We then performed thoracotomy, inserted a catheter into the ascending aorta via the left ventricle, which was used for perfusion with heparinized saline, and incised the right atrium. After 2 minutes the right atrium was clamped and 2% TTC in saline was infused during 7 minutes. After the completion of perfusion the rat brains were removed and the cerebral hemispheres were cut into 5 coronal slices, each 2 mm thick. The rostral surface of the TTC stained sections was photographed with color slide film and the area of the ischemic lesion was quantified by computer assisted image analysis using National Institutes of Health Image, version 1.61. Corrected infarct volume was then calculated according to the method of Golanov and Reis.16 Data analysis. Data are expressed as the mean ⫾ SE. Statistical comparisons were performed by the MannWhitney U test when there was no correspondence. When there was correspondence among the different time groups, the Wilcoxon signed rank test was used. Bladder capacity changes associated with different doses of treatment were compared using 2-way repeated measures ANOVA for repeated measures, followed by the Fisher protected least significant difference test for individual comparisons with p ⬍0.05 considered statistically significant. RESULTS
Effects of left MCA occlusion on CMGs. We examined the effects of MCAO or SO on bladder capacity in conscious rats. Bladder capacity before MCAO was 0.42 ⫾ 0.02 ml in CI rats and 0.42 ⫾ 0.03 ml in SO rats. The difference was not significant. Bladder capacity in CI and SO rats at 1 hour was 0.14 ⫾ 0.01 and 0.38 ⫾ 0.08 ml, at 3 hours it was 0.17 ⫾ 0.02 and 0.35 ⫾ 0.05 ml, at 5 hours it was 0.13 ⫾ 0.02 and 0.37 ⫾ 0.05 ml, at 12 hours it was 0.18 ⫾ 0.02 and 0.46 ⫾ 0.04 ml, and at 24 hours it was 0.22 ⫾ 0.04 and 0.46 ⫾ 0.03 ml, respectively. Thus, CI rats showed a significant decrease in bladder capacity until 24 hours after MCAO (Mann-Whitney U test p ⬍0.05 or ⬍0.01, fig. 1). Residual volume in CI and SO rats at 1 hour was 0.018 ⫾ 0.006 and 0.017 ⫾ 0.008 ml, at 3 hours it was 0.013 ⫾ 0.005 and 0.017 ⫾ 0.004 ml, at 5 hours
CYCLOOXYGENASE-2 IN PONS RELATED TO BLADDER OVERACTIVITY
FIG. 1. Bladder capacity following SO and MCAO in 6 rats each. CI rats showed significant decrease in bladder capacity at all time points after MCAO. Bars represent mean ⫾ SE. Single asterisk indicates p ⬍0.05. Double asterisks indicate 0.01.
it was 0.017 ⫾ 0.006 and 0.013 ⫾ 0.005 ml, at 12 hours it was 0.018 ⫾ 0.005 and 0.013 ⫾ 0.005 ml, and at 24 hours it was 0.020 ⫾ 0.008 and 0.023 ⫾ 0.008 ml, respectively. Residual volume in all rats was insignificant and, thus, micturition volume was almost equivalent to bladder capacity. Effects of left MCA occlusion on expression of COX-1 and COX-2 in the PTA. COX isoform mRNA expression was investigated by real-time quantitative RT-PCR. Values of COX-1 and COX-2 mRNA expression in the outer control obtained from samples immediately after MCAO were set at 1, after which all values obtained from real-time quantitative PCR were normalized in terms of the -actin level and measured as relative expression. PCR products were electrophoresed through 1.2% agarose gels and expected sizes were confirmed (fig. 2). The relative COX-1 expression level in CI and SO rats at 1 hour was 0.78 ⫾ 0.05 and 0.87 ⫾ 0.08, at 3 hours it was 0.81 ⫾ 0.11 and 0.68 ⫾ 0.13, at 5 hours it was 0.82 ⫾ 0.10 and 0.93 ⫾ 0.19, at 12 hours it was 0.58 ⫾ 0.07 and 0.50 ⫾ 0.08, and at 24 hours it was 0.49 ⫾ 0.08 and 0.47 ⫾ 0.06. There were no significant differences in the expression of COX-1 mRNA between SO and CI rats but the level tended to decrease in a time dependent manner in each group (fig. 3). Significant differences between CI and SO rats were found between the 1-hour group and the 12 or 24-hour group (Mann-Whitney U test p ⬍0.05, fig. 3). The relative COX-2 expression level in CI and SO rats at 1 hour was 22.40 ⫾ 3.47 and 4.01 ⫾ 0.26, at 3 hours it was 17.97 ⫾ 2.98 and 3.58 ⫾ 1.46, at 5 hours it was 8.45 ⫾ 2.83 and 3.51 ⫾ 0.62, at 12 hours it was 0.84 ⫾ 0.07 and 1.03 ⫾ 0.36, and at 24 hours it was 1.45 ⫾ 0.42 and 1.13 ⫾ 0.18, respectively. Thus, COX-2 mRNA expression level was increased markedly 1 and 3 hours after MCAO (p ⬍0.01, fig. 4). The expression level in SO rats decreased in a time dependent manner and it had returned to the outer control level 12 hours after
FIG. 2. COX-1, COX-2 and -actin expression. Lane 1, PCR products (25/50 cycles) 1 hour after MCAO. Lane 2, PCR products (25/50 cycles) 1 hour after SO. Lane 3, PCR products obtained from MK-CI rats at 1 hour. Left lane, intense band is 500 bp long.
367
FIG. 3. Changes in COX-1 mRNA expression following SO and MCAO in 6 rats each. Gene expression was determined relative to outer standard, that is cDNA from PTA obtained immediately after MCAO. Bars represent mean ⫾ SE. SO vs CI not significantly different.
FIG. 4. Changes in COX-2 mRNA expression following SO and MCAO in 6 rats each. COX-2 mRNA expression was increased significantly 1 and 3 hours after MCAO. Bars represent mean ⫾ SE. Single asterisk indicates p ⬍0.05. Double asterisks indicate p ⫽ 0.01.
MCAO. PCR products were electrophoresed on 1.2% agarose gels and expected sizes were confirmed (fig. 2). Effects of MK-801 on bladder capacity and COX-2 mRNA expression. In MK-CI rats (CI rats pretreated with 0.1 mg/kg MK-801 intravenously) no decrease in bladder capacity was observed in the 1, 3 or 5-hour group by the Wilcoxon signed rank test. No significant differences were detected between SO and MK-CI rats by the Mann-Whitney U test (fig. 5). Thus, MK-801 appeared to have prevented the development of bladder overactivity caused by MCAO. Because our previous experiment showed an increase in COX-2 mRNA expression in CI rats 1 to 5 hours after MCAO, samples obtained
FIG. 5. Influence of MK-801 pretreatment on bladder capacity after MCAO in 6 SO, 6 CI and 6 MK-CI rats. MK-CI rats showed significant suppression of bladder overactivity development at all time points after MCAO. Bars represent mean ⫾ SE. NS, not significant. Single asterisk indicates p ⬍0.05. Double asterisks indicate p ⫽ 0.01.
368
CYCLOOXYGENASE-2 IN PONS RELATED TO BLADDER OVERACTIVITY
from the 1, 3 and 5-hour groups were subjected to real-time quantitative RT-PCR assay. The relative COX-2 mRNA expression level at 1, 3 and 5 hours in MK-CI rats was 1.08 ⫾ 0.16, 1.00 ⫾ 0.12 and 1.34 ⫾ 0.12, respectively (fig. 6). Thus, MK-801 pretreatment suppressed the increase in COX-2 mRNA expression in CI rats (Mann-Whitney U test p ⬍0.01, fig. 6). Furthermore, there was a significant difference between MK-CI and SO rats 1 hour after operation (p ⬍0.05, fig. 6). Thus, 0.1 mg/kg MK-801 prevented any change in bladder capacity and suppressed the increase in COX-2 mRNA expression in the PTA in rats with CI. Effects of the COX-2 inhibitor NS398 on bladder capacity and infarct volume. We also investigated the effects of NS398, a selective COX-2 inhibitor, to evaluate the role of COX-2 in the development of bladder overactivity induced by MCAO. MCAO was performed 30 minutes after intravenous administration of NS-398. Infarct volume following pretreatment with 80% DMSO (vehicle), and 0.01, 0.1, 1.0 and 10 mg/kg NS398 was 437.4 ⫾ 31.2, 425.2 ⫾ 28.0, 474.4 ⫾ 43.3, 510.4 ⫾ 35.0 and 455.3 ⫾ 34.8 mm2, respectively (fig. 7). Infarct volume showed no significant differences between rats pretreated with 80% DMSO and those pretreated with NS-398 (fig. 7). Thus, NS-398 pretreatment had no influence on infarct volume by MCAO. NS398 pretreatment prevented the development of bladder overactivity after MCAO in a dose dependent manner. Pretreatment with more than 0.1 mg/kg NS398 significantly suppressed the development of bladder overactivity (ANOVA p ⬍0.05 or ⬍0.001, fig. 8). An NS398 dose of 10 mg/kg did not decrease bladder capacity after MCAO.
FIG. 7. Corrected infarct volume in CI rats pretreated with NS398. Bars represent 9 rats each. Values are shown as mean ⫾ SE. Vehicle treated controls vs CI rats pretreated with NS398 not significantly different (NS).
DISCUSSION
Our previous study suggested that physiological changes in the form of neuronal plasticity, such as an increase in synaptic transmission, occur in the PMC following cerebral infarction.5 The levels of mRNA expression of the neuronal plasticity related genes c-fos and zif268 were increased significantly in the PTA of CI rats. Bladder overactivity induced by MCAO was inhibited by the administration of MK-801, and peak values of c-fos and zif268 mRNA expression were significantly decreased by pretreatment with MK-801.8 These results indicated that c-fos and zif268 mRNA expression in the PTA are closely related to the bladder overactivity induced by MCAO and they are mediated by NMDA glutamatergic transmission. Therefore, it is reasonable to speculate that a neuronal plastic change occurs in the PTA at the initial stage of the long lasting, infarction induced potentiation of bladder reflexes.8 The results of the current study show that bladder capacity in CI rats was decreased significantly. The expression of
FIG. 6. Influence of MK-801 pretreatment on COX-2 mRNA expression in 6 SO, 6 CI and 6 MK-CI rats. MK-801 significantly decreased COX-2 mRNA expression 1 and 3 hours after MCAO. Bars represent mean ⫾ SE. CI rats pretreated with MK-801 vs SO rats significantly different. NS, not significant. Single asterisk indicates p ⬍0.05. Double asterisks indicate p ⫽ 0.01.
FIG. 8. Changes in bladder capacity in CI rats pretreated with NS398. Values are shown as mean ⫾ SE in 9 rats each treated with vehicle, and 0.01, 0.1, 1 and 10 mg/kg, respectively. Single asterisk indicates p ⬍0.05. Triple asterisks indicate p ⫽ 0.001.
COX-2 mRNA in the PTA had increased markedly 1 to 3 hours after MCAO and it returned to the outer control level at 12 hours, while that of COX-1 mRNA was not significantly different between SO and CI rats. Kinouchi et al observed that MCAO induced c-fos and COX-2 mRNA in the brain using in situ hybridization.17 However, c-fos mRNA expression induced in the whole MCA territory, adjacent cortex (cingulate cortex) and distant brain regions, such as the hippocampus and substantia nigra, did not induce COX-2 mRNA in the ischemic core (lateral striatum), but only in the penumbral area (MCA cortex).17 To our knowledge the current study represents the first demonstration that COX-2 mRNA expression in the pons of rats is induced after MCAO. COX-2, c-fos and zif 268 mRNA are often expressed in neurons together in response to various stimuli. c-fos and zif268 are transcription factors but it is uncertain whether these gene products regulate COX-2 transcription. Some reports showed that the expression of these 3 genes was required for CREB (cyclic adenosine monophosphate responsive element binding protein) activation in response to the increase in intracellular cyclic adenosine monophosphate or calcium levels.18, 19 COX-2, c-fos and zif268 expression after cerebral ischemia in the PTA were likely to develop due to CREB activation via NMDA receptors in the pons. COX-2 has been reported to have direct effects on neurotransmitter release and glutamatergic receptors.20 Prostaglandins may facilitate sensory neuropeptide release and sensitize sensory recep-
CYCLOOXYGENASE-2 IN PONS RELATED TO BLADDER OVERACTIVITY
tors.20 Therefore, COX-2 expression in the PMC may change the neuronal activity related to micturition. Recently we reported that supraspinal nitric oxide has an important role in bladder overactivity after cerebral infarction but it does not affect normal micturition in rats and the administration of 1-(2-trifluoromethylphenyl) imidazole, a neuronal nitric oxide synthase inhibitor, significantly increased bladder capacity in CI rats.21 The correlation between COX-2 and nitric oxide synthase is well known. Nagayama et al reported that the COX-2 inhibitor NS398 ameliorates ischemic brain injury in wild-type mice but not in those with deletion of the inducible NOS gene.22 Therefore, COX-2 may act along with NOS or some other genes regulated by COX-2 in the bladder overactivity following cerebral infarction. In the current study intravenous administration of a dose of more than 0.1 mg/kg of the selective COX-2 inhibitor NS398 intravenously prevented the development of bladder overactivity. NS398 pretreatment did not influence infarct volume by MCAO but it prevented the development of bladder overactivity. Infarct volume was not significantly different between rats pretreated with 80% DMSO and those pretreated with NS398. Therefore, the mechanism by which intravenous administration of NS398 inhibited the development of bladder overactivity did not involve a decrease in infarct volume. We believe that NS398 prevented the development of bladder overactivity by inhibiting pontine COX-2. However, it was reported recently that permanent MCAO did not induce COX-2 mRNAs in the ischemic core but strongly induced mRNAs in the penumbral area (medial striatum and periphery of MCA cortex) and adjacent cortex (cingulate cortex), and COX-2 mRNA was only induced in the bilateral hippocampus in brain regions distant from the ischemic area.19 It is possible that NS398 may also have an effect in these areas, including the penumbra. At 1 hour after SO COX-2 expression in SO rats had increased by about 4-fold compared with that in the outer control and it had again returned to the control level by 12 hours. Since COX-2 is expressed in response to inflammation or pain, the small increase in the level of COX-2 expression after SO was most likely due to stress. Although the current study was not performed using the deletion model of COX-2 expression in the pons, inhibition of the COX-2 enzyme was shown to prevent the development of bladder overactivity. Therefore, we believe that COX-2 is essential for the development of bladder overactivity after CI. The results of the current study suggest that the signal transduction cascade introduced by neuronal membrane depolarization or the activation of NMDA receptors and subsequent arachidonic acid cascade have important roles in the development of bladder overactivity after CI. CONCLUSIONS
To our knowledge the current study is the first to show that COX-2 expression in the brain is related to micturition disorders following CI. COX-2 was shown to be expressed concomitant with the development of bladder overactivity following CI and to be mediated by NMDA receptors in the pons. Pretreatment with the selective COX-2 inhibitor NS398 prevented the development of bladder overactivity. These results indicate that COX-2 transcription in the pontine tegmentum may be necessary for the establishment of the long-term bladder overactivity caused by CI. The arachidonic acid cascade in the brain inducing bladder overactivity may be a new target for pharmacological or gene therapy. REFERENCES
1. Griffiths, D. J., McCracken, P. N., Harrison, G. M., Gormley, E. A., Moore, K., Hooper, R. et al: Cerebral aetiology of urinary urge incontinence in elderly people. Age Aging, 23: 246, 1994 2. Yokoyama, O., Komatsu, K., Ishiura, Y., Nakamura, Y., Morikawa, K. and Namiki, M.: Change in bladder contractility associated with bladder overactivity in rats with cerebral in-
369
farction. J Urol, 157: 577, 1998 3. Yokoyama, O., Ishiura, Y., Komatsu, K., Mita, E., Nakamura, Y., Kunimi, K. et al: Effect of MK-801 on bladder overactivity in rats with cerebral infarction. J Urol, 159: 571, 1998 4. Yokoyama, O., Yoshiyama, M., Namiki, M. and de Groat, W. C.: Glutamatergic and dopaminergic contributions to rat bladder hyperactivity following cerebral artery occlusion. Am J Physiol, 276: R935, 1999 5. Yokoyama, O., Yoshiyama, M., Namiki, M. and de Groat, W. C.: Role of the forebrain in bladder overactivity following cerebral infarction in the rat. Exp Neurol, 163: 469, 2000 6. Yokoyama, O., Yoshiyama, M., Namiki, M. and de Groat, W. C.: Influence of anesthesia on bladder hyperactivity induced by middle cerebral artery occlusion in the rat. Am J Physiol, 273: R1900, 1997 7. Yokoyama, O., Mizuno, H., Komatsu, K., Akino, H., Tanase, K. and Namiki, M.: Role of glutamate receptors in the development and maintenance of bladder overactivity after cerebral infarction in the rat. J Urol, 171: 1709, 2004 8. Yotsuyanagi, S., Yokoyama, O., Komatsu, K., Kodama, K., Niikura, S. and Namiki, M.: Expression of neural plasticity related gene in the pontine tegmental area of rats with overactive bladder after cerebral infarction. J Urol, 166: 1148, 2001 9. Yamagata, K., Andreasson, K. I., Kaufmann, W. E. and Worley, P. F.: Expression of a mitogen-inducible cyclooxygenase in brain neurons: regulation by synaptic activity and glucocorticoids. Neuron, 11: 371, 1993 10. Bazan, N. G. and Allan, G.: Platelet-activating factor in the modulation of excitary amino acid neurotransmitter release and of gene expression. J Lipid Mediat Cell Signal, 14: 321, 1996 11. Wittwer, C. T., Ririe, K. M., Andrew, R. V., David, D. A., Gundry, R. A. and Balis, U. J.: The LightCycler: a microvolume multisample fluorimeter with rapid temperature control. Biotechniques, 22: 176, 1997 12. Longa, E. Z., Weinstein, P. R., Carlson, S. and Cummins, R.: Reversible middle cerebral artery occlusion without craniotomy in rats. Stroke, 20: 84, 1989 13. Wong, P. Y., Chan, H. C., Leung, P. S., Chung, Y. W., Wong, Y. L., Lee, W. M. et al: Regulation of anion secretion by cyclooxygenese and prostanoids in cultured epididymal epithelia from the rat. J Physiol, 514: 809, 1999 14. Fujita, H., Koshida, K., Keller, E. T., Takahashi, Y, Yoshimito, T., Namiki, M. et al: Cyclooxygenase-2 promotes prostate cancer progression. Prostate, 53: 232, 2002 15. Hatfield, R. H., Mendelow, A. D., Perry, R. H., Alvarez, L. M. and Modha, P.: Triphenyltetrazoline chloride (TTC) as a marker for ischemic changes in rat brain following permanent middle cerebral artery occlusion. Neuropathol Appl Neurobiol, 17: 61, 1991 16. Golanov, E. V. and Reis, D. J.: Contribution of cerebral edema to the neuronal salvage elicited by stimulation of cerebellar fastigial nucleus after occlusion of the middle cerebral artery in rat. J Cereb Blood Flow Metab, 15: 172, 1995 17. Kinouci, H., Huang, H., Arai, S., Mizoi, K. and Yoshimoto, T.: Induction of cyclooxygenase-2 messenger RNA after transient and permanent middle cerebral artery occlusion in rats: comparison with c-fos messenger RNA by using in situ hybridization. J Neurosurg, 91: 1005, 1999 18. Rudnick, D. A., Perlmutter, D. H. and Muglia, L. J.: Prostaglandins are required for CREB activation and cellular proliferation during liver regeneration. Proc Natl Acad Sci USA, 98: 8885, 2001 19. Ji, R. R. and Woolf, C. J.: Neuronal plasticity and signal transduction in nociceptive neurons: implications for the initiation and maintenance of pathological pain. Neurobiol Dis, 8: 1, 2001 20. Mietinen, S., Fusco, F. R., Yrjanheikki, J., Keinanen, R., Hirvonen, T., Roivainen, R. et al: Spreading depression and focal brain ischemia induce cyclooxygenase-2 in cortical neurons through N-methyl-D-aspartartic acid-receptors and phospholipase A2. Proc Natl Acad Sci USA, 94: 6500, 1997 21. Kodama, K., Yokoyama, O., Komatsu, K., Yotsuyanagi, S., Nikura, S. and Namiki, M.: Contribution of cerebral nitric oxide to bladder overactivity after cerebral infarction in rats. J Urol, 167: 391, 2002 22. Nagayama, M., Niwa, K., Nagayama, T., Ross, M. E. and Iadecola, C.: The cyclooxygenase-2 inhibitor NS-398 ameliorates ischemic brain injury in wild-type mice but not in mice with deletion of the inducible nitric oxide synthase gene. J Cereb Blood Flow Metab, 19: 1213, 1999