- Email: [email protected]
Role of long noncoding RNA ZFAS1 in proliferation, apoptosis and migration of chondrocytes in osteoarthritis
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Role of long noncoding RNA ZFAS1 in proliferation, apoptosis and migration of chondrocytes in osteoarthritis Dong Ye
⁎,1
, Weihong Jian1, Jie Feng1, Xueqin Liao
Department of Orthopedics, The Third Affiliated Hospital of Nanchang University, Nanchang, Jiangxi, 330000, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Osteoarthritis Chondrocyte lncRNA ZFAS1 Wnt3a
Objective: This study aimed to investigate the role of long noncoding RNA (lncRNA) ZFAS1 in the development of osteoarthritis (OA) as well as to explore the potential molecular mechanisms. Material and methods: The expression of lncRNA ZFAS1 in OA chondrocytes was determined. After cell transfection, the effects of ZFAS1 overexpression on the viability, proliferation, apoptosis and migration of OA chondrocytes were detected. Additionally, the expression levels of Bcl-2, Bax, Caspase-3, and matrix metalloproteinases (MMP1 and MMP13) were determined. The expressions of Wnt3a signaling proteins, and the relationship between ZFAS1 and Wnt3a were detected as well. Results: The expression of ZFAS1 was down-regulated in OA chondrocytes compared with normal chondrocytes. Overexpression of ZFAS1 promoted the viability, proliferation and migration, and inhibited apoptosis and matrix synthesis of OA chondrocytes. Additionally, overexpressed ZFAS1 significantly decreased Wnt3a factors. The effects of ZFAS1 on OA chondrocytes were achieved by regulating Wnt3a signaling. Conclusions: Our study demonstrates that ZFAS1 may promote chondrocyte proliferation, and migration, and decrease apoptosis and matrix synthesis in OA possible via targeting Wnt3a signaling. ZFAS1 provides a potential therapeutic target for OA treatment.
1. Introduction Osteoarhtritis (OA) is a degenerative joint disease characterized by deterioration in the integrity of cartilage, reduced cartilage cellularity, and subchondral sclerosis, synovial inflammation [1,2]. It is a leading cause of pain, disability, and shortening of adult working life around the world [3]. Multiple factors are implicated in OA etiology, however, there is no approved treatment that can modify the disease progression [4]. Chondrocyte is the only cell type in mature cartilage, which dominates the degenerative process of cartilage [5]. An evidence has suggested that altered expression of some genes in chondrocytes are associated with the synthesis and degradation of cartilage [6,7], which may serve as novel therapeutic targets for OA. The human transcriptome comprises not only protein-coding messenger RNAs (mRNAs), but also a large number of non–protein-coding transcripts with regulatory or unknown functions [8]. Long noncoding RNAs (lncRNAs) are a class of non–protein-coding RNAs more than 200 nucleotides in length and have emerged as key regulators in human diseases [9–11]. Aberrant expression of lncRNAs in OA has recently been reported, indicating their possible contributions in OA progression
⁎
1
and potential of serving as biomarkers for OA diagnosis and treatment [12,13]. LncRNA ZFAS1 is a recently reported tumor suppressor gene, which is expressed in most tissues [14,15]. Nevertheless, the function of ZFAS1 in OA progression has not been fully investigated to our knowledge. In the present study, we intended to investigate the effect of ZFAS1 on the proliferation, migration, apoptosis, and matrix synthesis of chondrocytes in OA, as well as the potential action mechanism of ZFAS1 affecting OA. Findings in this study may help to identify novel therapeutic targets for OA. 2. Materials and methods 2.1. Tissue sampling Human OA cartilage was obtained from 15 OA patients (average age 64.40 ± 7.13 years) who underwent total knee replacement surgery. The OA patients were diagnosed according to the American College of Rheumatology criteria. They had not taken non-steroidal anti-inflammatory drugs or steroids for at least 2 weeks prior to surgery, as
Corresponding author at: Department of Orthopedics, The Third Affiliated Hospital of Nanchang University, NO.128 North Xiangshan Road, Nanchang, Jiangxi, 330000, China. E-mail address: [email protected] (D. Ye). They are first co-authors.
https://doi.org/10.1016/j.biopha.2018.04.124 Received 10 December 2017; Received in revised form 15 April 2018; Accepted 17 April 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Please cite this article as: Ye, D., Biomedicine & Pharmacotherapy (2018), https://doi.org/10.1016/j.biopha.2018.04.124
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
well as not received any intra-articular injection for at least 1 month prior to surgery. Normal cartilage samples were obtained from six patients (average age 42.67 ± 15.41 years) who had femoral neck fracture and underwent total hip replacement surgery. They had no known history of OA or rheumatic arthritis (RA). All subjects were randomly selected to avoid the selection bias. This study was approved by the institutional ethics committee of the Third Affiliated Hospital of Nanchang University (Jiangxi, Nanchang, China). All patients have signed informed consents.
Table 1 Primers used for targets amplification. Name
Forward primer (5ʹ-3ʹ)
Reverse primer (5ʹ-3ʹ)
GAPDH Wnt3a β-catenin P53 RNU6B ZFAS1
AACGTGTCAGTOGTGGACCTG CAGTGCCTCGGAGATGGTG TGATGGAGTTGGACATGGCC TGCGTGTGGAGTATTTGGATG ACG CAA ATT CGT GAA GCG ACGTGCAGACATCTACAACCT
AGT GGGTGTCGCTGTFGAAGT GGTTAGGTTCGCAGAAGTTGG CTCATACAGGACTTGGGAGG TGGTACAGTCAGAGCCAACCAG TACTTCCAACACCCGCAT
2.2. Chondrocytes culture The obtained articular cartilage was minced and digested with 0.2% collagenase II in Dulbecco’s modified Eagle’s medium (DMEM) to obtain chondrocytes. Chondrocytes were maintained in DMEM containing 10% fetal bovine serum (FBS, Gibco, USA) for 24 h at 37 °C. Next, chondrocytes were filtered through a 0.075 mm cell strainer and washed with sterile phosphate buffered saline (PBS). After 2 weeks, chondrocytes at the first passage were obtained, which were incubated in a humidified atmosphere of 5% CO2 and 95% air at 37 °C, and the medium was changed every 2 days. 2.3. Cell transfection The overexpression vectors of ZFAS1 and Wnt3a were constructed by ligating the complete open reading frame to pcDNA3.1 vector, and then transfected to chondrocytes using Lipofectamine 3000 (Invitrogen, USA). Blank vector pcDNA3.1 was transfected as a negative control. In addition, three siRNAs specifically targeting ZFAS1 (si-ZFAS1#1, #2, and #3) or control (si-control) synthesized by Ribobio (GuangDong, China) were transfected to chondrocytes to down-regulate the expression level of ZFAS1.
Fig. 1. A: Relative expression level of ZFAS1 in normal and osteoarthritis (OA) chondrocytes detected by qRT-PCR. **P < 0.01 compared to the control group.
fluorescence microscopy. 2.7. Flow cytometry
2.4. MTT assay
Apoptosis was detected using the annexin V-FITC/PI apoptosis detection kit. Cells were plated in six-well plate with a density of 3 × 105 per well and were transfected for 48 h. The floating and residual attached cells were collected, washed twice with PBS, and stained with Annexin-V-FITC and propidium iodide (PI) for 15 min at room temperature. Apoptotic cells were examined using FACS calibur flow cytometer (BD Biosciences, USA) and were analyzed by the software supplied in the instrument.
The chondrocytes were seeded into 96-well plates with a density of 6 × 103 cells per well at different time points after transfection (0, 24, 48 and 72 h).Next, 20 μl of 0.5% 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was added into each well for incubation of chondrocytes for 4 h. The supernatant was removed and 150 μl of dimethylsulfoxide was added for dissolving the formazan precipitates. Optical densities were measured at 490 nm with a MRX II absorbance reader (DYNEX Technologies, Chantilly, Virginia, USA). 2.5. BrdU incorporation assay
2.8. qRT-PCR
Cell proliferation was examined using BrdU assay (Roche, Switzerland) according to the manufacturer’s instructions. Briefly, chondrocytes were seeded into 96-well plates at a density of 5 × 103 cells in a final volume of 100 μl per well, and then treated with different concentrations of Icariin for 1 or 3 days. After 4 h of BrdU (10 μM) treatment, the cells were incubated with peroxidase-conjugated anti-BrdU antibody for 90 min, and BrdU incorporation was detected by incubating cells with tetramethyl-benzidine (TMB) as a substrate. Color development was directly proportional to the amount of DNA synthesis and thereby to the number of proliferating cells. BrdUpositive cells were counted.
Total RNAs and miRNA were isolated from cultured chondrocytes with Trizol reagent (Invitrogen, USA) and RNAiso for small RNA reagent (TAKARA, Japan), respectively. RNA samples were reversetranscribed into cDNA with the PrimeScript RT Master Mix and the SYBR PrimeScript miRNA RT-PCR Kit (TAKARA, Japan). Real-time PCR was performed with gene-specific primers (Table 1), the SYBR Premix Ex Taq II, and the SYBR PrimeScript miRNA RT-PCR Kit (TAKARA, Japan) using the ABI Step One Plus Sequence Detection System v2.1 (Applied Biosystems, USA). GAPDH and RNU6B were used as endogenous controls of mRNA and miRNA respectively. The relative levels were determined by the ΔΔCt method.
2.6. Transwell assay
2.9. Western blot
After transfection, cell migration was assessed through transwell assay with a polycarbonate membrane filter (6.5-mm diameter and 8μm pore size). Briefly, 105 cells were placed in the upper chamber of a transwell plate. Six hours later, cells remaining on the upper surface of the membrane were removed with cotton swabs and the migrated cells on the lower surface were stained with DAPI and counted by
Chondrocytes were harvested, washed with cold PBS and lysed in ice-cold protein lysis buffer (Roche, Switzerland). After centrifugation (15,000g for 15 min at 4 °C), the supernatant was collected as protein extracts. Then 20 μg protein extract was separated by 12% SDS–PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane (BioRad, USA). The blots were incubated with diluted anti-Caspase-3 2
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
Fig. 2. A: Effect of ZFAS1 suppression on the viability of normal chondrocytes detected by MTT assay; B: Effect of ZFAS1 overexpression on the viability of osteoarthritis (OA) chondrocytes detected by MTT assay; C: Relative expression level of ZFAS1 after cell transfection detected by qRT-PCR; D: Effect of ZFAS1 suppression/overexpression on proliferation of normal and OA chondrocytes detected by BrdU incorporation assay; E: Effect of ZFAS1 suppression/overexpression on proliferation of normal and OA chondrocytes detected by Transwell assay; F: Effect of ZFAS1 suppression/overexpression on apoptosis of normal and OA chondrocytes detected by flow cytometry; G: Relative expression levels of apoptosis-associated proteins after cell transfection assayed by western blot; H: Relative expression levels of matrix metalloproteinases (MMP1 and MMP13) after cell transfection assayed by western blot. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the control group. 3
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
for 48 h. The results of qRT-PCR showed that compared with control, the expression level of ZFAS1 decreased significantly after 48 h of transfection with three siRNAs (si-ZFAS1#1, #2, and #3) (all P < 0.05) (Fig. 2C). Among three siRNAs, the silencing effects of siZFAS1#2 was strongest, thus, si-ZFAS1#2 was used for subsequent experiments. The result of BrdU incorporation assay revealed that after ZFAS1 was inhibited in normal chondrocytes, the percentage of proliferative cells significantly decreased (P < 0.01). However, ZFAS1 overexpression in OA chondrocytes increased the proliferation of chondrocytes significantly (P < 0.01) (Fig. 2D). Furthermore, the result of Transwell assay showed that cell migration were weakened after ZFAS1 suppression in normal chondrocytes (P < 0.001), and were enhanced after ZFAS1 overexpression in OA chondrocytes (P < 0.05) (Fig. 2E). For apoptosis assay, the results showed that ZFAS1 suppression improved apoptosis of normal chondrocytes significantly, while ZFAS1 overexpression significantly inhibited apoptosis of OA chondrocytes (P < 0.05) (Fig. 2F). Furthermore, the expression levels of apoptosis associated proteins, Caspase3, Bcl-2 and Bax, were detected. As shown in Fig. 2G, a consistent result with findings in flow cytometry was detected that the expression levels of Bax/Bcl-2 ratio and Caspase3 were markedly increased in normal chondrocytes after ZFAS1 suppression, and obviously decreased in OA chondrocytes after ZFAS1 overexpression. Besides, MMPs played a critical role in keeping the balance between degradation and synthesis of extracellular matrix, we thus detected the expression of MMP-1 and MMP-13, which were important pathological markers of OA. The results showed that the expression levels of MMP-1 and MMP-13 were markedly up-regulated in normal chondrocytes after ZFAS1 suppression, and obviously downregulated in OA chondrocytes after ZFAS1 overexpression (Fig. 2H). These results indicated that ZFAS1 could promote proliferation and migration, and inhibited apoptosis and matrix synthesis of chondrocytes.
Fig. 3. A and B: Effects of ZFAS1 suppression/overexpression on the relative expression levels of Wnt3a, β-catenin, and p53 in normal and osteoarthritis (OA) chondrocytes detected by RT-PCR and western blot; **P < 0.01, ***P < 0.001 compared to the control group.
(1:1000), anti-Bcl-2 (1:1000), anti-Bax (1:1000), anti-matrix metalloproteinase 1 (MMP1) (1:1000), anti-MMP13 (1:1000), anti-Wnt3a (1:1000), anti-β-catenin (1:1000), anti-p35 (1:1000) or anti-GAPDH (1:2000) primary antibodies in TBST overnight at 4 °C, and then incubated with horse radish peroxidase-conjugated secondary antibody (1:5000). The antibody reactive proteins were visualized using SyngenePxi imager and then analyzed with the Syngene Image analysis software.
3.3. Effect of ZFAS1 on Wnt3a signaling A previous study has reported that Wnt3a signaling regulates cell proliferation, apoptosis and differentiation [16]. In the present study, we detected the expression levels of three Wnt3a signaling factors, Wnt3a, β-catenin, and p53. As shown in Fig. 3A, the mRNA levels of Wnt3a, β-catenin and p53 in normal chondrocytes were significantly lower than that in OA chondrocytes. In normal chondrocytes, when ZFAS1 was inhibited, the mRNA levels of Wnt3a, β-catenin and p53 increased significantly (P < 0.01). In OA chondrocytes, ZFAS1 suppression significantly decreased mRNA levels of three factors (P < 0.01). Moreover, western blot analysis displayed a consistent result (Fig. 3B). The result suggested that the effect of ZFAS1 on OA chondrocytes might be related to Wnt3a signaling.
2.10. Statistical analysis The values are presented as mean ± standard deviation (SD), and the statistically significant difference between the experimental and control groups were determined by Student’s t-test. Each experiment was repeated three times using three independent samples. P < 0.05 was considered to be statistically significant. 3. Results 3.1. Expression of ZFAS1 in OA chondrocytes
3.4. Effects of Wnt3a on proliferation, migration, apoptosis, and matrix synthesis of OA chondrocytes
The expression level of ZFAS1 in normal and OA chondrocytes was shown in Fig. 1. Compared with normal chondrocytes, ZFAS1 was down-regulated in OA chondrocytes, hinting that ZFAS1 might play a role in OA development.
To further investigate the correlation between the action mechanism of ZFAS1 and Wnt3a signaling, we detected the effects of Wnt3a dysregulation on proliferation, migration, and apoptosis of OA chondrocytes. There were four groups: normal chondrocyte + blank control, normal chondrocyte + Wnt3a, OA chondrocyte + si-control, and OA chondrocyte + si-Wnt3a. The transfection effects were detected by western blot (Fig. 4A). Overexpression of Wnt3a in normal chondrocytes significantly reduced the proliferation and migration of (P < 0.05) and increased apoptosis (P < 0.01). Additionally, when Wnt3a was inhibited in OA chondrocytes, significantly increased proliferation and migration, and decreased apoptosis were detected in OA chondrocytes (P < 0.05) (Fig. 4B–D). Moreover, the expression levels of Caspase3, Bcl-2, and Bax, as shown in Fig. 4E, also exhibited consisted results (Fig. 4D). Besides, the expression of MMP-1 and MMP-13 were markedly increased after overexpression of Wnt3a in normal
3.2. Effects of ZFAS1 on proliferation, migration, apoptosis, and matrix synthesis of OA chondrocytes To investigate the effect of ZFAS1 on OA chondrocytes, ZFAS1 were overexpressed or suppressed in chondrocytes through cell transfection. As shown in Fig. 2A, the viability of normal chondrocytes was significantly repressed after 48 and 72 h of si-ZFAS1 transfection (P < 0.05). On the contrary, overexpressed ZFAS1 significantly increased the viability of OA chondrocytes after 48 and 72 h of cell transfection (Fig. 2B). The following experiment used chondrocytes that were transfected 4
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
Fig. 4. A: Protein expression level of Wnt3a in normal and osteoarthritis (OA) chondrocytes after cells were transfected with si-Wnt3a and overexpression vector of Wnt3a; B: Effect of Wnt3a suppression/overexpression on proliferation of normal and OA chondrocytes detected by BrdU incorporation assay; C: Effect of Wnt3a suppression/overexpression on proliferation of normal and OA chondrocytes detected by Transwell assay; D: Effect of Wnt3a suppression/overexpression on apoptosis of normal and OA chondrocytes detected by flow cytometry; E: Relative expression levels of apoptosis-associated proteins after cell transfection assayed by western blot; F: Relative expression levels of matrix metalloproteinases (MMP1 and MMP13) after cell transfection assayed by western blot. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the control group.
chondrocytes, and obviously decreased after Wnt3a knockdown in OA chondrocytes (Fig. 4F). These findings suggested that the effect of Wnt3a on OA chondrocytes was contrary to ZFAS1.
significantly increase the expression of the above three factors. A consistent result was revealed in the protein expression levels of these factors.
3.5. Relationships between ZFAS1 and Wnt3a signaling
4. Discussion
To verify that ZFAS1 could inhibit Wnt3a signaling on OA chondrocytes, the combined effects of suppression of ZFAS1 and Wnt3a on the expression levels of signaling factors of Wnt3a, β-catenin, and p53 in OA chondrocytes were then detected. As shown in Fig. 5A, suppression of Wnt3a significantly decreased the mRNA expression of Wnt3a, β-catenin, and p53 (P < 0.001). However, compared with Wnt3a suppression, suppression of both Wnt3a and ZFAS1 could
LncRNAs have been found to participate in complex biological and pathological processes [17,18]. In previous studies, lncRNA ZFAS1 is reported as a key player to mediate the development of human cancers, such as gastric cancer [19], colorectal cancer [20] and osteosarcoma [21]. ZFAS1 is also found to regulate cell migration and invasion of fibroblast-like synoviocytes in rheumatoid arthritis [22]. Nevertheless, the role of ZSAS1 in OA development is largely known. In the present 5
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
clustering and matrix composition changes in OA [29]. In the present study, ZFAS1 overexpression promoted chondrocyte migration, further suggesting the important role of ZFAS1 in OA. Previous studies have reported that Wnt and Wnt-associated proteins are elevated in human OA tissues [30], and the canonical Wnt–frizzled–β-catenin pathway has been implicated in the pathogenesis of OA [31]. The components of Wnt/β-catenin signaling are essential for regulating the function of chondrocyte and development of cartilage [32,33]. Fischer et al. have revealed that activation of Wnt signaling through Wnt3a could inhibit chondrogenesis of the prechondrocyte cell line ATDC540 [34]. Also, Xing et al. demonstrated that miR-1 overexpression contributed to the development of OA via targeting FZD7 of Wnt/β-catenin signaling [35]. In this study, Wnt3a associated factors, Wnt3a, β-catenin, and p53, were up-regulated in OA chondrocytes, which was consistent with the previous report. Importantly, overexpression of ZFAS1 could significantly decrease the expression levels of three factors, suggesting ZFAS1 might affect OA chondrocyte through regulating Wnt3a signaling. 5. Conclusion In conclusion, our study demonstrates that ZFAS1 may promote chondrocyte proliferation, and migration, and decrease apoptosis and matrix synthesis in OA possible via targeting Wnt3a signaling. Therefore, ZFAS1 may play a key role in OA pathogenesis, which provides a potential therapeutic target for OA treatment.
Fig. 5. A and B: Effects of Wnt3a suppression/overexpression on the relative expression levels of Wnt3a, β-catenin and p53 in normal and osteoarthritis (OA) chondrocytes detected by RT-PCR and western blot; **P < 0.01, ***P < 0.001 compared to the control group. **P < 0.01, ***P < 0.001 compared to the control group.
Conflicts of interest study, we found that the ZFAS1 was down-regulated in OA chondrocytes. Overexpression of ZFAS1 significantly increased the viability, proliferation, and migration of OA chondrocytes, and decreased their apoptosis and matrix synthesis. Further study found the effects of ZFAS1 on chondrocytes proliferation, migration, and apoptosis were achieved possible through Wnt3a signaling. Chondrocytes as the only cell type in articular cartilage maintain the dynamic equilibrium between production of the extracellular matrix and its enzymatic degradation. Key MMPs, including MMP-1 and 13 are found increased expression in OA and play crucial roles in OA development, especially the degradation of Collagen Ⅱ [23]. Agere et al. also revealed that activation of MMP-1 and MMP-13 expression was involved in collagen degradation in human rheumatoid arthritis synovial fibroblasts [24]. These data suggest that inhibition of matrix synthesis of chondrocytes may alleviate the development of OA. In addition, chondrocytes death by apoptosis is implicated in the initiation of articular cartilage degradation. As a result, maintaining proliferation and inhibiting apoptosis of chondrocytes are essential for maintaining the integrity of articular cartilage [25]. The present study revealed that ZFAS1 overexpression strongly promoted proliferation, and inhibited apoptosis and matrix synthesis of OA chondrocytes. Moreover, the expression levels of apoptosis associated proteins Bcl-2, Bax and Caspase3 were detected. The results showed that ZFAS1 overexpression significantly decreased the expression levels of Caspase-3 and Bax/Bcl-2 ratio in OA. Bcl-2 is a member of Bcl-2 protein family, which can inhibit apoptosis [26]. The expression ratio of Bax/Bcl-2 is found to increase in OA samples compared with normal cartilage controls, confirming the role of apoptosis in the pathogenesis of OA [27]. Caspase-3 belongs to caspase family, serving as an executer of programmed cell death [28]. Therefore, the decreased expression levels of Caspase-3 and Bax/Bcl-2 ratio further suggest the inhibitory effects of ZFAS1 on the apoptosis of OA chondrocytes. In addition to proliferation and apoptosis of chondrocytes, chondrocyte migration plays an important role in OA as well. A previous study has reported that chondrocyte migration starts from the articular margin, passes the superficial zone and ends in the transitional and radial zone. Dysfunction of chondrocyte migration causes chondrocytes
None Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. References [1] A. Haseeb, D. Chen, T.M. Haqqi, Delphinidin inhibits IL-1β-induced activation of NF-κB by modulating the phosphorylation of IRAK-1Ser376 in human articular chondrocytes, Rheumatology 52 (6) (2013) 998. [2] C. Xu, S. Wang, H. Cai, L. Yuan, X. Zheng, Z. Bing, C. Xia, Overexpression of microRNA-634 suppresses survival and matrix synthesis of human osteoarthritis chondrocytes by targeting PIK3R1, Sci. Rep. 6 (2016) 23117. [3] D. Pereira, M. Severo, R.A. Santos, H. Barros, J. Branco, R. Lucas, L. Costa, E. Ramos, Knee and hip radiographic osteoarthritis features: differences on pain, function and quality of life, Clin. Rheumatol. 35 (6) (2016) 1555–1564. [4] D.P. Tonge, M.J. Pearson, S.W. Jones, The hallmarks of osteoarthritis and the potential to develop personalised disease-modifying pharmacological therapeutics, Osteoarthr. Cartil. 22 (5) (2014) 609. [5] T. Aigner, B. Kurz, N. Fukui, L. Sandell, Roles of chondrocytes in the pathogenesis of osteoarthritis, Curr. Opin. Rheumatol. 14 (5) (2002) 578. [6] V.B. Kraus, J.M. Jordan, M. Doherty, A.G. Wilson, R. Moskowitz, M. Hochberg, R. Loeser, M. Hooper, J.B. Renner, M.M. Crane, The genetics of generalized osteoarthritis (GOGO) study: study design and evaluation of osteoarthritis phenotypes, Osteoarthr. Cartil. 15 (2) (2007) 120–127. [7] M. Pattrick, M. Doherty, Genetics of osteoarthritis, Curr. Rheumatol. Rep. 6 (1) (2004) 7–13. [8] J.E. Wilusz, H. Sunwoo, D.L. Spector, Long noncoding RNAs: functional surprises from the RNA world, Gene Dev. 23 (13) (2009) 1494. [9] X. Shi, M. Sun, H. Liu, Y. Yao, Y. Song, Long non-coding RNAs: a new frontier in the study of human diseases, Cancer Lett. 339 (2) (2013) 159–166. [10] R. Fatima, V.S. Akhade, D. Pal, S.M. Rao, Long noncoding RNAs in development and cancer: potential biomarkers and therapeutic targets, Mol. Cell. Ther. 3 (1) (2015) 5. [11] M. Haemmerle, T. Gutschner, Long non-coding RNAs in cancer and development: where do we go from here? Int. J. Mol. Sci. 16 (1) (2015) 1395–1405. [12] Q. Liu, X. Zhang, L. Dai, X. Hu, J. Zhu, L. Li, C. Zhou, Y. Ao, Long noncoding RNA related to cartilage injury promotes chondrocyte extracellular matrix degradation in osteoarthritis, Arthritis Rheumatol. 66 (4) (2014) 969–978. [13] M. Fu, G. Huang, Z. Zhang, J. Liu, Z. Huang, B. Yu, F. Meng, Expression profile of long noncoding RNAs in cartilage from knee osteoarthritis patients, Osteoarthr. Cartil. 23 (3) (2015) 423–432. [14] H. Hansji, E.Y. Leung, B.C. Baguley, G.J. Finlay, D. Cameronsmith, V.C. Figueiredo,
6
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
[15]
[16]
[17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
[25] C.W. Archer, H. Morrison, A.A. Pitsillides, Cellular aspects of the development of diarthrodial joints and articular cartilage, J. Anat. 184 (Pt 3) (1994) 447–456. [26] G. Kroemer, The proto-oncogene Bcl-2 and its role in regulating apoptosis, Nat. Med. 3 (6) (1997) 614–620. [27] G.I. Karaliotas, K. Mavridis, A. Scorilas, G.C. Babis, Quantitative analysis of the mRNA expression levels of BCL2 and BAX genes in human osteoarthritis and normal articular cartilage: an investigation into their differential expression, Mol. Med. Rep. 12 (3) (2015) 4514–4521. [28] P. Weinmann, P. Gaehtgens, B. Walzog, Bcl-Xl- and Bax-alpha-mediated regulation of apoptosis of human neutrophils via caspase-3, Blood 93 (9) (1999) 3106–3115. [29] T. Schubert, S. Kaufmann, A.K. Wenke, S. Grässel, A.K. Bosserhoff, Role of deleted in colon carcinoma in osteoarthritis and in chondrocyte migration, Rheumatology 48 (11) (2009) 1435. [30] K. Imai, M. Morikawa, J. D’Armiento, H. Matsumoto, K. Komiya, Y. Okada, Differential expression of WNTs and FRPs in the synovium of rheumatoid arthritis and osteoarthritis, Biochem. Biophys. Res. Commun. 345 (4) (2006) 1615–1620. [31] M. Corr, Wnt–β-catenin signaling in the pathogenesis of osteoarthritis, Nat. Clin. Pract. Rheumatol. 4 (10) (2008) 550–556. [32] Q. Wu, M. Zhu, R.N. Rosier, M.J. Zuscik, R.J. O’Keefe, D. Chen, Beta-catenin, cartilage, and osteoarthritis, Ann. N. Y. Acad. Sci. 1192 (1) (2010) 344–350. [33] Y. Tamamura, T. Otani, N. Kanatani, E. Koyama, J. Kitagaki, T. Komori, Y. Yamada, F. Costantini, S. Wakisaka, M. Pacifici, Developmental regulation of Wnt/beta-catenin signals is required for growth plate assembly, cartilage integrity, and endochondral ossification, J. Biol. Chem. 280 (19) (2005) 19185–19195. [34] L. Fischer, G. Boland, R.S. Tuan, Wnt-3A enhances bone morphogenetic protein-2mediated chondrogenesis of murine C3H10T1/2 mesenchymal cells, J. Biol. Chem. 277 (34) (2002) 30870. [35] D. Xing, B. Wang, Y. Xu, K. Tao, J. Lin, Overexpression of microRNA-1 controls the development of osteoarthritis via targeting FZD7 of Wnt/β-catenin signaling, Osteoarthr. Cartil. 24 (2016) S181–S182.
M.E. Askarianamiri, ZFAS1: a long noncoding RNA associated with ribosomes in breast cancer cells, Biol. Direct 11 (1) (2016) 62. T. Li, J. Xie, C. Shen, D. Cheng, Y. Shi, Z. Wu, X. Deng, H. Chen, B. Shen, C. Peng, Amplification of long noncoding RNA ZFAS1 promotes metastasis in hepatocellular carcinoma, Cancer Res. 75 (15) (2015) 3181–3191. Yc. SHANG, F. XIONG, Y. LI, C. ZHANG, Wnt3a signaling promotes proliferation, myogenic differentiation, and migration of rat bone marrow mesenchymal stem cells1, Acta Pharmacol. Sin. 28 (11) (2007) 1761–1774. J.S. Mattick, A new paradigm for developmental biology, J. Exp. Biol. 210 (Pt 9) (2007) 1526. H. Hansji, E.Y. Leung, B.C. Baguley, G.J. Finlay, M.E. Askarianamiri, Keeping abreast with long non-coding RNAs in mammary gland development and breast cancer, Front. Genet. 5 (2014) 379. F. Nie, Y. Xiang, M. Huang, Y. Wang, X. Min, H. Ma, Z. Wang, D. Wei, S. Ming, Long noncoding RNA ZFAS1 promotes gastric cancer cells proliferation by epigenetically repressing KLF2 and NKD2 expression, Oncotarget 8 (24) (2016). T. Nithyananda, F.V. Petra, H. Sonja, M. Jitka, K. Markus, S. Marek, S. Ondrej, Long non-coding RNA ZFAS1 interacts with CDK1 and is involved in p53-dependent cell cycle control and apoptosis in colorectal cancer, Oncotarget 7 (1) (2016) 622–637. G. Liu, W. Lu, H. Han, L. Yong, S. Lu, T. Li, C. Cai, LncRNA ZFAS1 promotes growth and metastasis by regulating BMI1 and ZEB2 in osteosarcoma, Am. J. Cancer Res. 7 (7) (2017) 1450. Y. Yang, X. Gao, N. Yang, LncRNA ZFAS1 promotes cell migration and invasion of fibroblast-like synoviocytes by suppression of miR-27a in rheumatoid arthritis, Hum. Cell (2) (2017). C. Zhang, X. Wang, J.Y. Jiang, H.Y. Huang, Expression of MMP-1, MMP-13 mRNA and immunohistochemical expression of DDR2 in osteoarthritis:its relationship with cartilage degeneration, Fudan Univ. J. Med. Sci. 34 (1) (2007) 35–38. S.A. Agere, N. Akhtar, J.M. Watson, S. Ahmed, RANTES/CCL5 induces collagen degradation by activating MMP-1 and MMP-13 expression in human rheumatoid arthritis synovial fibroblasts, Front. Immunol. 8 (2017) 1341.
7
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Role of long noncoding RNA ZFAS1 in proliferation, apoptosis and migration of chondrocytes in osteoarthritis Dong Ye
⁎,1
, Weihong Jian1, Jie Feng1, Xueqin Liao
Department of Orthopedics, The Third Affiliated Hospital of Nanchang University, Nanchang, Jiangxi, 330000, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Osteoarthritis Chondrocyte lncRNA ZFAS1 Wnt3a
Objective: This study aimed to investigate the role of long noncoding RNA (lncRNA) ZFAS1 in the development of osteoarthritis (OA) as well as to explore the potential molecular mechanisms. Material and methods: The expression of lncRNA ZFAS1 in OA chondrocytes was determined. After cell transfection, the effects of ZFAS1 overexpression on the viability, proliferation, apoptosis and migration of OA chondrocytes were detected. Additionally, the expression levels of Bcl-2, Bax, Caspase-3, and matrix metalloproteinases (MMP1 and MMP13) were determined. The expressions of Wnt3a signaling proteins, and the relationship between ZFAS1 and Wnt3a were detected as well. Results: The expression of ZFAS1 was down-regulated in OA chondrocytes compared with normal chondrocytes. Overexpression of ZFAS1 promoted the viability, proliferation and migration, and inhibited apoptosis and matrix synthesis of OA chondrocytes. Additionally, overexpressed ZFAS1 significantly decreased Wnt3a factors. The effects of ZFAS1 on OA chondrocytes were achieved by regulating Wnt3a signaling. Conclusions: Our study demonstrates that ZFAS1 may promote chondrocyte proliferation, and migration, and decrease apoptosis and matrix synthesis in OA possible via targeting Wnt3a signaling. ZFAS1 provides a potential therapeutic target for OA treatment.
1. Introduction Osteoarhtritis (OA) is a degenerative joint disease characterized by deterioration in the integrity of cartilage, reduced cartilage cellularity, and subchondral sclerosis, synovial inflammation [1,2]. It is a leading cause of pain, disability, and shortening of adult working life around the world [3]. Multiple factors are implicated in OA etiology, however, there is no approved treatment that can modify the disease progression [4]. Chondrocyte is the only cell type in mature cartilage, which dominates the degenerative process of cartilage [5]. An evidence has suggested that altered expression of some genes in chondrocytes are associated with the synthesis and degradation of cartilage [6,7], which may serve as novel therapeutic targets for OA. The human transcriptome comprises not only protein-coding messenger RNAs (mRNAs), but also a large number of non–protein-coding transcripts with regulatory or unknown functions [8]. Long noncoding RNAs (lncRNAs) are a class of non–protein-coding RNAs more than 200 nucleotides in length and have emerged as key regulators in human diseases [9–11]. Aberrant expression of lncRNAs in OA has recently been reported, indicating their possible contributions in OA progression
⁎
1
and potential of serving as biomarkers for OA diagnosis and treatment [12,13]. LncRNA ZFAS1 is a recently reported tumor suppressor gene, which is expressed in most tissues [14,15]. Nevertheless, the function of ZFAS1 in OA progression has not been fully investigated to our knowledge. In the present study, we intended to investigate the effect of ZFAS1 on the proliferation, migration, apoptosis, and matrix synthesis of chondrocytes in OA, as well as the potential action mechanism of ZFAS1 affecting OA. Findings in this study may help to identify novel therapeutic targets for OA. 2. Materials and methods 2.1. Tissue sampling Human OA cartilage was obtained from 15 OA patients (average age 64.40 ± 7.13 years) who underwent total knee replacement surgery. The OA patients were diagnosed according to the American College of Rheumatology criteria. They had not taken non-steroidal anti-inflammatory drugs or steroids for at least 2 weeks prior to surgery, as
Corresponding author at: Department of Orthopedics, The Third Affiliated Hospital of Nanchang University, NO.128 North Xiangshan Road, Nanchang, Jiangxi, 330000, China. E-mail address: [email protected] (D. Ye). They are first co-authors.
https://doi.org/10.1016/j.biopha.2018.04.124 Received 10 December 2017; Received in revised form 15 April 2018; Accepted 17 April 2018 0753-3322/ © 2018 Elsevier Masson SAS. All rights reserved.
Please cite this article as: Ye, D., Biomedicine & Pharmacotherapy (2018), https://doi.org/10.1016/j.biopha.2018.04.124
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
well as not received any intra-articular injection for at least 1 month prior to surgery. Normal cartilage samples were obtained from six patients (average age 42.67 ± 15.41 years) who had femoral neck fracture and underwent total hip replacement surgery. They had no known history of OA or rheumatic arthritis (RA). All subjects were randomly selected to avoid the selection bias. This study was approved by the institutional ethics committee of the Third Affiliated Hospital of Nanchang University (Jiangxi, Nanchang, China). All patients have signed informed consents.
Table 1 Primers used for targets amplification. Name
Forward primer (5ʹ-3ʹ)
Reverse primer (5ʹ-3ʹ)
GAPDH Wnt3a β-catenin P53 RNU6B ZFAS1
AACGTGTCAGTOGTGGACCTG CAGTGCCTCGGAGATGGTG TGATGGAGTTGGACATGGCC TGCGTGTGGAGTATTTGGATG ACG CAA ATT CGT GAA GCG ACGTGCAGACATCTACAACCT
AGT GGGTGTCGCTGTFGAAGT GGTTAGGTTCGCAGAAGTTGG CTCATACAGGACTTGGGAGG TGGTACAGTCAGAGCCAACCAG TACTTCCAACACCCGCAT
2.2. Chondrocytes culture The obtained articular cartilage was minced and digested with 0.2% collagenase II in Dulbecco’s modified Eagle’s medium (DMEM) to obtain chondrocytes. Chondrocytes were maintained in DMEM containing 10% fetal bovine serum (FBS, Gibco, USA) for 24 h at 37 °C. Next, chondrocytes were filtered through a 0.075 mm cell strainer and washed with sterile phosphate buffered saline (PBS). After 2 weeks, chondrocytes at the first passage were obtained, which were incubated in a humidified atmosphere of 5% CO2 and 95% air at 37 °C, and the medium was changed every 2 days. 2.3. Cell transfection The overexpression vectors of ZFAS1 and Wnt3a were constructed by ligating the complete open reading frame to pcDNA3.1 vector, and then transfected to chondrocytes using Lipofectamine 3000 (Invitrogen, USA). Blank vector pcDNA3.1 was transfected as a negative control. In addition, three siRNAs specifically targeting ZFAS1 (si-ZFAS1#1, #2, and #3) or control (si-control) synthesized by Ribobio (GuangDong, China) were transfected to chondrocytes to down-regulate the expression level of ZFAS1.
Fig. 1. A: Relative expression level of ZFAS1 in normal and osteoarthritis (OA) chondrocytes detected by qRT-PCR. **P < 0.01 compared to the control group.
fluorescence microscopy. 2.7. Flow cytometry
2.4. MTT assay
Apoptosis was detected using the annexin V-FITC/PI apoptosis detection kit. Cells were plated in six-well plate with a density of 3 × 105 per well and were transfected for 48 h. The floating and residual attached cells were collected, washed twice with PBS, and stained with Annexin-V-FITC and propidium iodide (PI) for 15 min at room temperature. Apoptotic cells were examined using FACS calibur flow cytometer (BD Biosciences, USA) and were analyzed by the software supplied in the instrument.
The chondrocytes were seeded into 96-well plates with a density of 6 × 103 cells per well at different time points after transfection (0, 24, 48 and 72 h).Next, 20 μl of 0.5% 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) was added into each well for incubation of chondrocytes for 4 h. The supernatant was removed and 150 μl of dimethylsulfoxide was added for dissolving the formazan precipitates. Optical densities were measured at 490 nm with a MRX II absorbance reader (DYNEX Technologies, Chantilly, Virginia, USA). 2.5. BrdU incorporation assay
2.8. qRT-PCR
Cell proliferation was examined using BrdU assay (Roche, Switzerland) according to the manufacturer’s instructions. Briefly, chondrocytes were seeded into 96-well plates at a density of 5 × 103 cells in a final volume of 100 μl per well, and then treated with different concentrations of Icariin for 1 or 3 days. After 4 h of BrdU (10 μM) treatment, the cells were incubated with peroxidase-conjugated anti-BrdU antibody for 90 min, and BrdU incorporation was detected by incubating cells with tetramethyl-benzidine (TMB) as a substrate. Color development was directly proportional to the amount of DNA synthesis and thereby to the number of proliferating cells. BrdUpositive cells were counted.
Total RNAs and miRNA were isolated from cultured chondrocytes with Trizol reagent (Invitrogen, USA) and RNAiso for small RNA reagent (TAKARA, Japan), respectively. RNA samples were reversetranscribed into cDNA with the PrimeScript RT Master Mix and the SYBR PrimeScript miRNA RT-PCR Kit (TAKARA, Japan). Real-time PCR was performed with gene-specific primers (Table 1), the SYBR Premix Ex Taq II, and the SYBR PrimeScript miRNA RT-PCR Kit (TAKARA, Japan) using the ABI Step One Plus Sequence Detection System v2.1 (Applied Biosystems, USA). GAPDH and RNU6B were used as endogenous controls of mRNA and miRNA respectively. The relative levels were determined by the ΔΔCt method.
2.6. Transwell assay
2.9. Western blot
After transfection, cell migration was assessed through transwell assay with a polycarbonate membrane filter (6.5-mm diameter and 8μm pore size). Briefly, 105 cells were placed in the upper chamber of a transwell plate. Six hours later, cells remaining on the upper surface of the membrane were removed with cotton swabs and the migrated cells on the lower surface were stained with DAPI and counted by
Chondrocytes were harvested, washed with cold PBS and lysed in ice-cold protein lysis buffer (Roche, Switzerland). After centrifugation (15,000g for 15 min at 4 °C), the supernatant was collected as protein extracts. Then 20 μg protein extract was separated by 12% SDS–PAGE and transferred to a polyvinylidene fluoride (PVDF) membrane (BioRad, USA). The blots were incubated with diluted anti-Caspase-3 2
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
Fig. 2. A: Effect of ZFAS1 suppression on the viability of normal chondrocytes detected by MTT assay; B: Effect of ZFAS1 overexpression on the viability of osteoarthritis (OA) chondrocytes detected by MTT assay; C: Relative expression level of ZFAS1 after cell transfection detected by qRT-PCR; D: Effect of ZFAS1 suppression/overexpression on proliferation of normal and OA chondrocytes detected by BrdU incorporation assay; E: Effect of ZFAS1 suppression/overexpression on proliferation of normal and OA chondrocytes detected by Transwell assay; F: Effect of ZFAS1 suppression/overexpression on apoptosis of normal and OA chondrocytes detected by flow cytometry; G: Relative expression levels of apoptosis-associated proteins after cell transfection assayed by western blot; H: Relative expression levels of matrix metalloproteinases (MMP1 and MMP13) after cell transfection assayed by western blot. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the control group. 3
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
for 48 h. The results of qRT-PCR showed that compared with control, the expression level of ZFAS1 decreased significantly after 48 h of transfection with three siRNAs (si-ZFAS1#1, #2, and #3) (all P < 0.05) (Fig. 2C). Among three siRNAs, the silencing effects of siZFAS1#2 was strongest, thus, si-ZFAS1#2 was used for subsequent experiments. The result of BrdU incorporation assay revealed that after ZFAS1 was inhibited in normal chondrocytes, the percentage of proliferative cells significantly decreased (P < 0.01). However, ZFAS1 overexpression in OA chondrocytes increased the proliferation of chondrocytes significantly (P < 0.01) (Fig. 2D). Furthermore, the result of Transwell assay showed that cell migration were weakened after ZFAS1 suppression in normal chondrocytes (P < 0.001), and were enhanced after ZFAS1 overexpression in OA chondrocytes (P < 0.05) (Fig. 2E). For apoptosis assay, the results showed that ZFAS1 suppression improved apoptosis of normal chondrocytes significantly, while ZFAS1 overexpression significantly inhibited apoptosis of OA chondrocytes (P < 0.05) (Fig. 2F). Furthermore, the expression levels of apoptosis associated proteins, Caspase3, Bcl-2 and Bax, were detected. As shown in Fig. 2G, a consistent result with findings in flow cytometry was detected that the expression levels of Bax/Bcl-2 ratio and Caspase3 were markedly increased in normal chondrocytes after ZFAS1 suppression, and obviously decreased in OA chondrocytes after ZFAS1 overexpression. Besides, MMPs played a critical role in keeping the balance between degradation and synthesis of extracellular matrix, we thus detected the expression of MMP-1 and MMP-13, which were important pathological markers of OA. The results showed that the expression levels of MMP-1 and MMP-13 were markedly up-regulated in normal chondrocytes after ZFAS1 suppression, and obviously downregulated in OA chondrocytes after ZFAS1 overexpression (Fig. 2H). These results indicated that ZFAS1 could promote proliferation and migration, and inhibited apoptosis and matrix synthesis of chondrocytes.
Fig. 3. A and B: Effects of ZFAS1 suppression/overexpression on the relative expression levels of Wnt3a, β-catenin, and p53 in normal and osteoarthritis (OA) chondrocytes detected by RT-PCR and western blot; **P < 0.01, ***P < 0.001 compared to the control group.
(1:1000), anti-Bcl-2 (1:1000), anti-Bax (1:1000), anti-matrix metalloproteinase 1 (MMP1) (1:1000), anti-MMP13 (1:1000), anti-Wnt3a (1:1000), anti-β-catenin (1:1000), anti-p35 (1:1000) or anti-GAPDH (1:2000) primary antibodies in TBST overnight at 4 °C, and then incubated with horse radish peroxidase-conjugated secondary antibody (1:5000). The antibody reactive proteins were visualized using SyngenePxi imager and then analyzed with the Syngene Image analysis software.
3.3. Effect of ZFAS1 on Wnt3a signaling A previous study has reported that Wnt3a signaling regulates cell proliferation, apoptosis and differentiation [16]. In the present study, we detected the expression levels of three Wnt3a signaling factors, Wnt3a, β-catenin, and p53. As shown in Fig. 3A, the mRNA levels of Wnt3a, β-catenin and p53 in normal chondrocytes were significantly lower than that in OA chondrocytes. In normal chondrocytes, when ZFAS1 was inhibited, the mRNA levels of Wnt3a, β-catenin and p53 increased significantly (P < 0.01). In OA chondrocytes, ZFAS1 suppression significantly decreased mRNA levels of three factors (P < 0.01). Moreover, western blot analysis displayed a consistent result (Fig. 3B). The result suggested that the effect of ZFAS1 on OA chondrocytes might be related to Wnt3a signaling.
2.10. Statistical analysis The values are presented as mean ± standard deviation (SD), and the statistically significant difference between the experimental and control groups were determined by Student’s t-test. Each experiment was repeated three times using three independent samples. P < 0.05 was considered to be statistically significant. 3. Results 3.1. Expression of ZFAS1 in OA chondrocytes
3.4. Effects of Wnt3a on proliferation, migration, apoptosis, and matrix synthesis of OA chondrocytes
The expression level of ZFAS1 in normal and OA chondrocytes was shown in Fig. 1. Compared with normal chondrocytes, ZFAS1 was down-regulated in OA chondrocytes, hinting that ZFAS1 might play a role in OA development.
To further investigate the correlation between the action mechanism of ZFAS1 and Wnt3a signaling, we detected the effects of Wnt3a dysregulation on proliferation, migration, and apoptosis of OA chondrocytes. There were four groups: normal chondrocyte + blank control, normal chondrocyte + Wnt3a, OA chondrocyte + si-control, and OA chondrocyte + si-Wnt3a. The transfection effects were detected by western blot (Fig. 4A). Overexpression of Wnt3a in normal chondrocytes significantly reduced the proliferation and migration of (P < 0.05) and increased apoptosis (P < 0.01). Additionally, when Wnt3a was inhibited in OA chondrocytes, significantly increased proliferation and migration, and decreased apoptosis were detected in OA chondrocytes (P < 0.05) (Fig. 4B–D). Moreover, the expression levels of Caspase3, Bcl-2, and Bax, as shown in Fig. 4E, also exhibited consisted results (Fig. 4D). Besides, the expression of MMP-1 and MMP-13 were markedly increased after overexpression of Wnt3a in normal
3.2. Effects of ZFAS1 on proliferation, migration, apoptosis, and matrix synthesis of OA chondrocytes To investigate the effect of ZFAS1 on OA chondrocytes, ZFAS1 were overexpressed or suppressed in chondrocytes through cell transfection. As shown in Fig. 2A, the viability of normal chondrocytes was significantly repressed after 48 and 72 h of si-ZFAS1 transfection (P < 0.05). On the contrary, overexpressed ZFAS1 significantly increased the viability of OA chondrocytes after 48 and 72 h of cell transfection (Fig. 2B). The following experiment used chondrocytes that were transfected 4
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
Fig. 4. A: Protein expression level of Wnt3a in normal and osteoarthritis (OA) chondrocytes after cells were transfected with si-Wnt3a and overexpression vector of Wnt3a; B: Effect of Wnt3a suppression/overexpression on proliferation of normal and OA chondrocytes detected by BrdU incorporation assay; C: Effect of Wnt3a suppression/overexpression on proliferation of normal and OA chondrocytes detected by Transwell assay; D: Effect of Wnt3a suppression/overexpression on apoptosis of normal and OA chondrocytes detected by flow cytometry; E: Relative expression levels of apoptosis-associated proteins after cell transfection assayed by western blot; F: Relative expression levels of matrix metalloproteinases (MMP1 and MMP13) after cell transfection assayed by western blot. *P < 0.05, **P < 0.01, ***P < 0.001 compared to the control group.
chondrocytes, and obviously decreased after Wnt3a knockdown in OA chondrocytes (Fig. 4F). These findings suggested that the effect of Wnt3a on OA chondrocytes was contrary to ZFAS1.
significantly increase the expression of the above three factors. A consistent result was revealed in the protein expression levels of these factors.
3.5. Relationships between ZFAS1 and Wnt3a signaling
4. Discussion
To verify that ZFAS1 could inhibit Wnt3a signaling on OA chondrocytes, the combined effects of suppression of ZFAS1 and Wnt3a on the expression levels of signaling factors of Wnt3a, β-catenin, and p53 in OA chondrocytes were then detected. As shown in Fig. 5A, suppression of Wnt3a significantly decreased the mRNA expression of Wnt3a, β-catenin, and p53 (P < 0.001). However, compared with Wnt3a suppression, suppression of both Wnt3a and ZFAS1 could
LncRNAs have been found to participate in complex biological and pathological processes [17,18]. In previous studies, lncRNA ZFAS1 is reported as a key player to mediate the development of human cancers, such as gastric cancer [19], colorectal cancer [20] and osteosarcoma [21]. ZFAS1 is also found to regulate cell migration and invasion of fibroblast-like synoviocytes in rheumatoid arthritis [22]. Nevertheless, the role of ZSAS1 in OA development is largely known. In the present 5
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
clustering and matrix composition changes in OA [29]. In the present study, ZFAS1 overexpression promoted chondrocyte migration, further suggesting the important role of ZFAS1 in OA. Previous studies have reported that Wnt and Wnt-associated proteins are elevated in human OA tissues [30], and the canonical Wnt–frizzled–β-catenin pathway has been implicated in the pathogenesis of OA [31]. The components of Wnt/β-catenin signaling are essential for regulating the function of chondrocyte and development of cartilage [32,33]. Fischer et al. have revealed that activation of Wnt signaling through Wnt3a could inhibit chondrogenesis of the prechondrocyte cell line ATDC540 [34]. Also, Xing et al. demonstrated that miR-1 overexpression contributed to the development of OA via targeting FZD7 of Wnt/β-catenin signaling [35]. In this study, Wnt3a associated factors, Wnt3a, β-catenin, and p53, were up-regulated in OA chondrocytes, which was consistent with the previous report. Importantly, overexpression of ZFAS1 could significantly decrease the expression levels of three factors, suggesting ZFAS1 might affect OA chondrocyte through regulating Wnt3a signaling. 5. Conclusion In conclusion, our study demonstrates that ZFAS1 may promote chondrocyte proliferation, and migration, and decrease apoptosis and matrix synthesis in OA possible via targeting Wnt3a signaling. Therefore, ZFAS1 may play a key role in OA pathogenesis, which provides a potential therapeutic target for OA treatment.
Fig. 5. A and B: Effects of Wnt3a suppression/overexpression on the relative expression levels of Wnt3a, β-catenin and p53 in normal and osteoarthritis (OA) chondrocytes detected by RT-PCR and western blot; **P < 0.01, ***P < 0.001 compared to the control group. **P < 0.01, ***P < 0.001 compared to the control group.
Conflicts of interest study, we found that the ZFAS1 was down-regulated in OA chondrocytes. Overexpression of ZFAS1 significantly increased the viability, proliferation, and migration of OA chondrocytes, and decreased their apoptosis and matrix synthesis. Further study found the effects of ZFAS1 on chondrocytes proliferation, migration, and apoptosis were achieved possible through Wnt3a signaling. Chondrocytes as the only cell type in articular cartilage maintain the dynamic equilibrium between production of the extracellular matrix and its enzymatic degradation. Key MMPs, including MMP-1 and 13 are found increased expression in OA and play crucial roles in OA development, especially the degradation of Collagen Ⅱ [23]. Agere et al. also revealed that activation of MMP-1 and MMP-13 expression was involved in collagen degradation in human rheumatoid arthritis synovial fibroblasts [24]. These data suggest that inhibition of matrix synthesis of chondrocytes may alleviate the development of OA. In addition, chondrocytes death by apoptosis is implicated in the initiation of articular cartilage degradation. As a result, maintaining proliferation and inhibiting apoptosis of chondrocytes are essential for maintaining the integrity of articular cartilage [25]. The present study revealed that ZFAS1 overexpression strongly promoted proliferation, and inhibited apoptosis and matrix synthesis of OA chondrocytes. Moreover, the expression levels of apoptosis associated proteins Bcl-2, Bax and Caspase3 were detected. The results showed that ZFAS1 overexpression significantly decreased the expression levels of Caspase-3 and Bax/Bcl-2 ratio in OA. Bcl-2 is a member of Bcl-2 protein family, which can inhibit apoptosis [26]. The expression ratio of Bax/Bcl-2 is found to increase in OA samples compared with normal cartilage controls, confirming the role of apoptosis in the pathogenesis of OA [27]. Caspase-3 belongs to caspase family, serving as an executer of programmed cell death [28]. Therefore, the decreased expression levels of Caspase-3 and Bax/Bcl-2 ratio further suggest the inhibitory effects of ZFAS1 on the apoptosis of OA chondrocytes. In addition to proliferation and apoptosis of chondrocytes, chondrocyte migration plays an important role in OA as well. A previous study has reported that chondrocyte migration starts from the articular margin, passes the superficial zone and ends in the transitional and radial zone. Dysfunction of chondrocyte migration causes chondrocytes
None Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. References [1] A. Haseeb, D. Chen, T.M. Haqqi, Delphinidin inhibits IL-1β-induced activation of NF-κB by modulating the phosphorylation of IRAK-1Ser376 in human articular chondrocytes, Rheumatology 52 (6) (2013) 998. [2] C. Xu, S. Wang, H. Cai, L. Yuan, X. Zheng, Z. Bing, C. Xia, Overexpression of microRNA-634 suppresses survival and matrix synthesis of human osteoarthritis chondrocytes by targeting PIK3R1, Sci. Rep. 6 (2016) 23117. [3] D. Pereira, M. Severo, R.A. Santos, H. Barros, J. Branco, R. Lucas, L. Costa, E. Ramos, Knee and hip radiographic osteoarthritis features: differences on pain, function and quality of life, Clin. Rheumatol. 35 (6) (2016) 1555–1564. [4] D.P. Tonge, M.J. Pearson, S.W. Jones, The hallmarks of osteoarthritis and the potential to develop personalised disease-modifying pharmacological therapeutics, Osteoarthr. Cartil. 22 (5) (2014) 609. [5] T. Aigner, B. Kurz, N. Fukui, L. Sandell, Roles of chondrocytes in the pathogenesis of osteoarthritis, Curr. Opin. Rheumatol. 14 (5) (2002) 578. [6] V.B. Kraus, J.M. Jordan, M. Doherty, A.G. Wilson, R. Moskowitz, M. Hochberg, R. Loeser, M. Hooper, J.B. Renner, M.M. Crane, The genetics of generalized osteoarthritis (GOGO) study: study design and evaluation of osteoarthritis phenotypes, Osteoarthr. Cartil. 15 (2) (2007) 120–127. [7] M. Pattrick, M. Doherty, Genetics of osteoarthritis, Curr. Rheumatol. Rep. 6 (1) (2004) 7–13. [8] J.E. Wilusz, H. Sunwoo, D.L. Spector, Long noncoding RNAs: functional surprises from the RNA world, Gene Dev. 23 (13) (2009) 1494. [9] X. Shi, M. Sun, H. Liu, Y. Yao, Y. Song, Long non-coding RNAs: a new frontier in the study of human diseases, Cancer Lett. 339 (2) (2013) 159–166. [10] R. Fatima, V.S. Akhade, D. Pal, S.M. Rao, Long noncoding RNAs in development and cancer: potential biomarkers and therapeutic targets, Mol. Cell. Ther. 3 (1) (2015) 5. [11] M. Haemmerle, T. Gutschner, Long non-coding RNAs in cancer and development: where do we go from here? Int. J. Mol. Sci. 16 (1) (2015) 1395–1405. [12] Q. Liu, X. Zhang, L. Dai, X. Hu, J. Zhu, L. Li, C. Zhou, Y. Ao, Long noncoding RNA related to cartilage injury promotes chondrocyte extracellular matrix degradation in osteoarthritis, Arthritis Rheumatol. 66 (4) (2014) 969–978. [13] M. Fu, G. Huang, Z. Zhang, J. Liu, Z. Huang, B. Yu, F. Meng, Expression profile of long noncoding RNAs in cartilage from knee osteoarthritis patients, Osteoarthr. Cartil. 23 (3) (2015) 423–432. [14] H. Hansji, E.Y. Leung, B.C. Baguley, G.J. Finlay, D. Cameronsmith, V.C. Figueiredo,
6
Biomedicine & Pharmacotherapy xxx (xxxx) xxx–xxx
D. Ye et al.
[15]
[16]
[17] [18]
[19]
[20]
[21]
[22]
[23]
[24]
[25] C.W. Archer, H. Morrison, A.A. Pitsillides, Cellular aspects of the development of diarthrodial joints and articular cartilage, J. Anat. 184 (Pt 3) (1994) 447–456. [26] G. Kroemer, The proto-oncogene Bcl-2 and its role in regulating apoptosis, Nat. Med. 3 (6) (1997) 614–620. [27] G.I. Karaliotas, K. Mavridis, A. Scorilas, G.C. Babis, Quantitative analysis of the mRNA expression levels of BCL2 and BAX genes in human osteoarthritis and normal articular cartilage: an investigation into their differential expression, Mol. Med. Rep. 12 (3) (2015) 4514–4521. [28] P. Weinmann, P. Gaehtgens, B. Walzog, Bcl-Xl- and Bax-alpha-mediated regulation of apoptosis of human neutrophils via caspase-3, Blood 93 (9) (1999) 3106–3115. [29] T. Schubert, S. Kaufmann, A.K. Wenke, S. Grässel, A.K. Bosserhoff, Role of deleted in colon carcinoma in osteoarthritis and in chondrocyte migration, Rheumatology 48 (11) (2009) 1435. [30] K. Imai, M. Morikawa, J. D’Armiento, H. Matsumoto, K. Komiya, Y. Okada, Differential expression of WNTs and FRPs in the synovium of rheumatoid arthritis and osteoarthritis, Biochem. Biophys. Res. Commun. 345 (4) (2006) 1615–1620. [31] M. Corr, Wnt–β-catenin signaling in the pathogenesis of osteoarthritis, Nat. Clin. Pract. Rheumatol. 4 (10) (2008) 550–556. [32] Q. Wu, M. Zhu, R.N. Rosier, M.J. Zuscik, R.J. O’Keefe, D. Chen, Beta-catenin, cartilage, and osteoarthritis, Ann. N. Y. Acad. Sci. 1192 (1) (2010) 344–350. [33] Y. Tamamura, T. Otani, N. Kanatani, E. Koyama, J. Kitagaki, T. Komori, Y. Yamada, F. Costantini, S. Wakisaka, M. Pacifici, Developmental regulation of Wnt/beta-catenin signals is required for growth plate assembly, cartilage integrity, and endochondral ossification, J. Biol. Chem. 280 (19) (2005) 19185–19195. [34] L. Fischer, G. Boland, R.S. Tuan, Wnt-3A enhances bone morphogenetic protein-2mediated chondrogenesis of murine C3H10T1/2 mesenchymal cells, J. Biol. Chem. 277 (34) (2002) 30870. [35] D. Xing, B. Wang, Y. Xu, K. Tao, J. Lin, Overexpression of microRNA-1 controls the development of osteoarthritis via targeting FZD7 of Wnt/β-catenin signaling, Osteoarthr. Cartil. 24 (2016) S181–S182.
M.E. Askarianamiri, ZFAS1: a long noncoding RNA associated with ribosomes in breast cancer cells, Biol. Direct 11 (1) (2016) 62. T. Li, J. Xie, C. Shen, D. Cheng, Y. Shi, Z. Wu, X. Deng, H. Chen, B. Shen, C. Peng, Amplification of long noncoding RNA ZFAS1 promotes metastasis in hepatocellular carcinoma, Cancer Res. 75 (15) (2015) 3181–3191. Yc. SHANG, F. XIONG, Y. LI, C. ZHANG, Wnt3a signaling promotes proliferation, myogenic differentiation, and migration of rat bone marrow mesenchymal stem cells1, Acta Pharmacol. Sin. 28 (11) (2007) 1761–1774. J.S. Mattick, A new paradigm for developmental biology, J. Exp. Biol. 210 (Pt 9) (2007) 1526. H. Hansji, E.Y. Leung, B.C. Baguley, G.J. Finlay, M.E. Askarianamiri, Keeping abreast with long non-coding RNAs in mammary gland development and breast cancer, Front. Genet. 5 (2014) 379. F. Nie, Y. Xiang, M. Huang, Y. Wang, X. Min, H. Ma, Z. Wang, D. Wei, S. Ming, Long noncoding RNA ZFAS1 promotes gastric cancer cells proliferation by epigenetically repressing KLF2 and NKD2 expression, Oncotarget 8 (24) (2016). T. Nithyananda, F.V. Petra, H. Sonja, M. Jitka, K. Markus, S. Marek, S. Ondrej, Long non-coding RNA ZFAS1 interacts with CDK1 and is involved in p53-dependent cell cycle control and apoptosis in colorectal cancer, Oncotarget 7 (1) (2016) 622–637. G. Liu, W. Lu, H. Han, L. Yong, S. Lu, T. Li, C. Cai, LncRNA ZFAS1 promotes growth and metastasis by regulating BMI1 and ZEB2 in osteosarcoma, Am. J. Cancer Res. 7 (7) (2017) 1450. Y. Yang, X. Gao, N. Yang, LncRNA ZFAS1 promotes cell migration and invasion of fibroblast-like synoviocytes by suppression of miR-27a in rheumatoid arthritis, Hum. Cell (2) (2017). C. Zhang, X. Wang, J.Y. Jiang, H.Y. Huang, Expression of MMP-1, MMP-13 mRNA and immunohistochemical expression of DDR2 in osteoarthritis:its relationship with cartilage degeneration, Fudan Univ. J. Med. Sci. 34 (1) (2007) 35–38. S.A. Agere, N. Akhtar, J.M. Watson, S. Ahmed, RANTES/CCL5 induces collagen degradation by activating MMP-1 and MMP-13 expression in human rheumatoid arthritis synovial fibroblasts, Front. Immunol. 8 (2017) 1341.
7