NOD2 receptors in Fusobacterium nucleatum mediated NETosis

Microbial Pathogenesis 131 (2019) 53–64

Contents lists available at ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

Role of NOD1/NOD2 receptors in Fusobacterium nucleatum mediated NETosis

T

Hanadi M. Alyamib,d, Livia S. Finotia, Hellen S. Teixeirab, Abdulelah Aljefria, Denis F. Kinanec, Manjunatha R. Benakanakerea,∗ a

Department of Periodontics, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA, USA Department of Orthodontics, School of Dental Medicine, University of Pennsylvania, Philadelphia, PA, USA c Division of Periodontology, School of Dental Medicine, University of Geneva Faculty of Medicine, Geneva, Switzerland d Dentistry Department, King Fahad Medical City, P.O. Box. 59046, Riyadh, 11525, Saudi Arabia b

A R T I C LE I N FO

A B S T R A C T

Keywords: Periodontitis Fusobacterium nucleatum Neutrophil extra cellular traps NOD like receptors PAD4

Polymorphonuclear neutrophils (PMNs) are indispensable in fighting infectious microbes by adopting various antimicrobial strategies including phagocytosis and neutrophil extracellular traps (NETs). Although the role and importance of PMNs in periodontal disease are well established, the specific molecular mechanisms involved in NET formation are yet to be characterized. In the present study, we sought to determine the role of periodontal pathogen on NET formation by utilizing Fusobacterium nucleatum. Our data demonstrates that F. nucleatum activates neutrophils and induces robust NETosis in a time-dependent manner via the upregulation of the Nucleotide oligomerization domain 1 (NOD1) and NOD2 receptors. Furthermore, CRISPR/Cas9 knockout of HL60 cells and the use of ligands/inhibitors confirmed the involvement of NOD1 and NOD2 receptors in F. nucleatum-mediated NET formation. When treated with NOD1 and NOD2 inhibitors, we observed a significant downregulation of peptidylarginine deiminase 4 (PAD4) activity. In addition, neutrophils showed a significant increase and decrease of myeloperoxidase (MPO) and neutrophil elastase (NE) when treated with NOD1/NOD2 ligands and inhibitors, respectively. Taken together, CRISPR/Cas9 knockout of NOD1/NOD2 HL-60 cells and inhibitors of NOD signaling confirmed the role of NLRs in F. nucleatum-mediated NETosis. Our data demonstrates an important pathway linking NOD1 and NOD2 to NETosis by F. nucleatum, a prominent microbe in periodontal biofilms. This is the first study to elucidate the role of NOD-like receptors in NETosis and their downstream signaling network.

1. Introduction Neutrophils are the most abundant leukocytes found in the gingiva of periodontitis patients [1–3]. In periodontal disease, neutrophils are considered double-edged-swords, having both protective and destructive roles [4–6]. In homeostasis, neutrophils play a crucial role in eliciting innate immunity and eliminating microbes [2,7]. In dysbiosis, excessive neutrophil infiltration and hyper activation can exacerbate inflammation [8,9]. Upon microbial attack, neutrophils release cellular contents such as granules, DNA, and proteins, which form an extracellular structure called “Neutrophil Extracellular Traps” (NETs), and this phenomenon is termed “NETosis” [10–12]. NETs are crucial in limiting the spread of microbes during infection. Subgingival plaque is continuously replenished by gingival crevicular fluid (GCF), and multiple bacterial species flourish in this niche

∗

[13]. Controlling such an environment requires an efficient killing mechanism that can target diverse bacterial species, cover a wider surface area, and operate in non-cellular voids similar to cysts, synovial spaces, or vacuoles. Released Neutrophil Extracellular Traps (NETs) are found to be capable of performing such a function [14,15]. Studies have shown that NETs and subgingival dispersed bacteria appear in both suppurating and non-suppurating periodontitis, and form about 78% of GCF. This suggests that subgingival bacteria are the triggers of such mechanisms, and that NETosis plays a protective role by preventing bacterial adhesion to the crevicular epithelium [15,16]. Citrullinated histones, one of the prerequisites for the initiation of NETosis, were found tremendously increased in most active crevicular neutrophils [17]. Neutrophils can be activated by innate immune receptors such as Toll-like receptors and NOD-like receptors [18]. The nucleotide-binding and oligomerization domain (NOD)-like receptor (NLR) family is one of

Corresponding author. Department of Periodontics, School of Dental Medicine, University of Pennsylvania, 240 South 40th Street, Philadelphia, 19104, PA, USA. E-mail address: [email protected] (M.R. Benakanakere).

https://doi.org/10.1016/j.micpath.2019.03.036 Received 23 January 2019; Received in revised form 25 March 2019; Accepted 27 March 2019 Available online 30 March 2019 0882-4010/ © 2019 Elsevier Ltd. All rights reserved.

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

2.3. HL-60 cells

the pathogen recognition receptor (PRR) families that senses intracellular microorganisms and triggers a series of signaling cascades to activate pro-inflammatory and antimicrobial genes, culminating in the clearance of microorganisms. NOD1 and NOD2 receptors are upregulated using γ-D-glutamylmeso-diaminopimelic acid (iEDAP) and muramyl dipeptide (MDP) respectively. iEDAP is found mainly in Gram-negative bacterial peptidoglycan (PGN), while MDP is found in nearly all bacterial PGN [19,20]. NOD1/NOD2 stimulation results in the activation of nuclear factor-κB (NF-κB) and mitogen-activated protein kinases (MAPKs), which lead to the production of various cytokines and chemokines in response to ligand stimulation [21–23]. NF-κB inhibition using (E)-3[4- methylphenylsulfonyl]-2-propenenitrile (BAY 11-7082) and 6(phenylsulfinyl) tetrazolo [1,5-b] pyridazine (Ro 106-9920), as well as Acetylsalicylic acid (ASA), resulted in marked reduction in NETosis in neutrophils [24]. In addition, NOD2 was found to be capable of initiating reactive oxygen and nitrogen species production via induction of nitric oxide synthase and NADPH oxidase [25,26]. Furthermore, NOD1 and NOD2 receptors were found to be involved in the recognition of periodontal pathogens, indicating their roles in periodontitis [27]. These findings illustrate the importance of NOD1 and NOD2 in periodontitis and their possible roles in NETosis. Myeloperoxidase (MPO) is one of the most abundant proteins in neutrophils [28,29], and neutrophils completely deficient of MPO failed to make NETs [30]. Neutrophil elastase (NE) formation occurs during the promyelocytic differentiation; it is then stored in the azurophilic granules for the life of the neutrophils until its activation [31]. NE plays a critical role in inducing NETs, and its inhibition will impede chromatin de-condensation and NET release [32]. Based on our knowledge and current literature, there are no reports on the role of NOD1 and NOD2 receptors on NE and MPO activity in human neutrophils. Peptidyl-arginine deiminase enzymes (PAD4) catalyze protein transformation into peptidyl-citrulline in a Ca2+ dependent manner [33]. PAD4 citrullination of histones is essential for chromatin de-condensation as a crucial step for NETs formation [34]. Thus, we investigated the link between the PAD4 enzyme and NOD-like receptors. In this report, we for the first time demonstrate the involvement of NOD1 and NOD2 in F. nucleatum-mediated NETosis.

The acute human promyelocytic leukemia HL-60 (ATCC® CCL240™) cell line has been used to characterize and study the expression of different antigens and functions of myeloid cells. Morphologically, undifferentiated HL- 60 cells resemble promyelocytes, but can be differentiated in vitro to resemble mature neutrophils using All-trans-retinoic acid (ATRA) and di-methylsulfoxide (DMSO) [38,39]. Therefore, HL-60 was used as a model for neutrophil NET formation. HL-60 were cultured in RPMI 1640 Gibco™ GlutaMAX™, 25 mM HEPES, supplemented with 10% fetal bovine serum (FBS; GE Healthcare Life Sciences SH30071.03HI), 1% penicillin-streptomycin Gibco™ (Life Technologies), 0.05 μg/ ml Amphotericin B (Life Technologies), 50 μM β-Mercaptoethanol. Cells were incubated in a humidified incubator (37 °C, 5% CO2) and passaged every 2-3 days. Differentiation: Cells were seeded at a concentration of 2 × 105 cells/ml in culture media. 2 days post incubation, cells were stimulated to differentiate into neutrophil-like cells by the addition of 1.25% DMSO (Sigma D26650) and 2 μM ATRA (Sigma R2625) and incubated for 3 days. Then, cells were washed with PBS and re-suspended at 1 × 106 cells/ml for use in subsequent experiments. 2.4. NOD1 and NOD2 HL-60 knock-out using CRISPR/Cas9 system HL-60 cells expressing Cas9 was a kind gift from Dr. Youhai. H. Chen at Penn Institute for Immunology, School of Medicine, the University of Pennsylvania. Cells were cultured under the same conditions as HL-60. To induce Cas9 expression 1 μg/ml of doxycycline (Sigma D9891) was added to cell media for 48 h. To investigate the role of NOD-like receptors in NET formation we used IDT Alt-R® CRISPRCas9 system to generate NOD1 and NOD2 knockout HL-60 cell lines and induce NETosis via F. nucleatum. Cell-death ELISA kit (Roche Diagnostics) immunofluorescent staining then was performed to visualize and quantify the effect of NOD receptors on the NET formation. 2.5. Guide sequence identification, transfection and cell selection The IDT Alt-R Predesigned CRISPR-Cas9 crRNAs search tool was used and the optimal sequence for NOD1 and NOD2 gene targeting was selected (Table 1). Candidate gRNAs (guide RNA) are ranked by the accuracy of on-target and off-target activity. After the selection of the optimal crRNAs (tracrRNA) sequence, complexes were prepared at a 10 μM working concentration. Transfection: 48 h before transfection, cells were activated by adding 1 μg/ml doxycycline. Then cells were centrifuged at 300 g for 5 min at room temperature, washed with PBS and re-suspended at a concentration of 1 × 106 cells/ml. Transfection by electroporation was done using Amaxa® Cell Line Nucleofector® Kit V as per manufacturer recommendation (Lonza Picturepark). The cell pellet was suspended in 100 μl of solution V, and mixed with (crRNA:tracrRNA complex) in a final concentration of 2 μM 500 μl of media with doxycycline (1 μg/ml) was added after transfection, and the whole volume was transferred to a 12-well plate. Cell sorting was performed 24-h post transfection to rule out any mixed colonies. Cell sorting: cells were washed with PBS and then suspended in 500 μl of 5% FBS Sorting Buffer. Sorting buffer was prepared by adding

2. Materials and method 2.1. Isolation of neutrophils To facilitate the study of neutrophil response, PMN layers were obtained from the Human Immunology Core (University of Pennsylvania). Neutrophils were separated using the EasySep™ Human Neutrophil Enrichment Kit (STEMCELL Technologies, Inc) according to the manufacturer's recommendations. FACS analysis was performed to confirm the purity of neutrophils by CD11b and Lys6G antibodies. Neutrophils were then re-suspended at the desired concentrations and used immediately.

2.2. Bacterial growth conditions Fusobacterium nucleatum Strain FDC 364 was grown in Gifu Anaerobic Medium (GAM) broth (Nissui Pharmaceutical Co., Tokyo, Japan) under anaerobic conditions (85% N2, 10% CO2 and 10% H2; Coy Laboratory) at 37 °C as described previously [35]. F. nucleatum was harvested during the logarithmic growth phase for all the experiments. Porphyromonas gingivalis was grown using Gifu Anaerobic Medium (GAM) under anaerobic conditions described previously [36]. Aggregatibacter actinomycetemcomitans (A.a) was grown in Trypticase Soy Agar/Broth according to Kaplan et al. [37].

Table 1 NOD1 and NOD2 crRNA sequences. Gene

Target Sequence (Pam Is Underlined)

NOD1

5′ 5′ 5′ 5′

NOD2

54

GTGGCCCTCTTCACCTTCGA TGG 3′ CACCGGCATCCTCAATGAGC AGG 3′ GACGTACCTGGCTCCGACAT CGG 3′ CAATCCATTCGCTTTCACCG TGG 3′

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

- 2μ, and contrasted with lead citrate. Images were recorded using Hitachi H-7650 transmission electron microscope in a voltage range from 40 kV to 120 kV at Core facility (Department of Anatomy and Cell Biology, School of Dental Medicine, University of Pennsylvania).

1 mM EDTA (Invitrogen 15575), 25 mM HEPES (Thermo Fisher 15630), 5% FBS (GE Healthcare Life Sciences SH30071.03HI). The cell suspension was filtered and then sorted in a 96-well plate using BD Influx cell sorter (BD Biosciences) at the Flow Cytometry and Cell Sorting Resource Laboratory, School of Medicine, University of Pennsylvania. Colony selection: Semisolid media (ClonaCell™-TCS Medium) was prepared by adding 15 ml of liquid media. Sorted cells were diluted to a concentration of 1000 cells/ml. Diluted cells were mixed very well with 10 ml of prepared semisolid media. 16-gauge needles were used to mix cells to avoid cell loss. The mixture was then transferred into 10 mm culture plate. Colonies were collected using 10 μl pipet tips and transferred to a 96-well plate containing 200 μl of media. Both fast and slow growing colonies were collected for screening. Confirmation to validate NOD1 and NOD2 gene knock-out was done by real-time PCR (RT PCR) and western blot and compared with the control cells.

2.10. Immunocytochemistry Immunostaining was performed according to our previously published protocol [40]. Briefly, neutrophils were seeded onto poly-L-lysine coated coverslips and incubated for 30 min at 37 °C for the attachment. Cells were then challenged with F. nucleatum and PMA as mentioned above. Then, the cells were fixed with 4% formaldehyde for 10 min, permeabilized in 0.5% Triton X-100 for 2 min. Non-specific blocking was done using 10% Horse serum (HS) in PBS for 1 h at room temperature. Then, the cells were incubated with primary anti-neutrophil elastase antibody (1:100, Abcam ab21595) and anti-Histone H3 antibody (1:400 Abcam ab5103) overnight at 4 °C, washed three times with PBS, followed by Alexa Fluor® 594 or 647 conjugated secondary antibody (Thermo Fisher Scientific), and incubated for 1 h at room temperature. Finally, ProLong™ Gold Antifade Mountant with DAPI (Thermo Fisher Scientific P36935) was used to counterstain the nuclei and then the slides were mounted. Images were captured by a fluorescence microscope (Leica DMi8) with the same intensity and exposure time for both the control and the experimental group.

2.6. Induction of NETs F. nucleatum was used at multiplicity of infection (MOI) of 1:10 and 1:100 for in vitro stimulation of peripheral neutrophils NETs production. Phorbol 12-myristate 13-acetate (PMA) (Sigma P8139) was used at a concentration of 100 nM. F. nucleatum was centrifuged at 700×g for 10 min at room temperature. The supernatant was discarded, and the bacterial pellet was washed with PBS and re-suspended in RPMI media.

2.11. Cell death quantification (ELISA) 2.7. Functional assay (fluorometric quantification of NET release) To quantify the death rate after stimulation of neutrophils, the cells were challenged with F. nucleatum in the same conditions as mentioned above. After 12 h of stimulation, apoptosis was measured using Celldeath Enzyme Linked Immunosorbent Assay (ELISA) kit (Roche Diagnostics) according to the manufacturer's instructions.

Neutrophils were suspended at a concentration of 106 cells/ml in RPMI. Cells were then seeded in a 96-well microplate (BD FalconTM 353219) and allowed to rest for 20 min in a humidified incubator (37 °C, 5% CO2). SYTOX® Orange (Thermo Fisher Scientific, S34861), a cell impermeable nucleic acid stain, was added at a concentration of 0.2μM/ml. The cells were stimulated with F. nucleatum and PMA and then incubated for 1–3 h. Fluorescence was quantified at excitation/ emission wavelengths of 540/570 nm using Infinite M200 microplate reader (Tecan, Mannerdorf, Switzerland) at 1 h, 2 h and 3 h time points.

2.12. RNA isolation Cells were pelleted by centrifugation for 5 min at 300 g, the supernatant was removed, and the cell pellet was re-suspended in 1 ml TRIzol reagent per sample (Invitrogen, 15596026). The mix was transferred in 1.5 ml Eppendorf tubes, placed on a shaker, and incubated for 10 min at room temperature. 200 μl of Chloroform (C2432 Sigma) were added for each sample, vortexed for 15 s, and incubated for 3 min at room temperature. This was centrifuged at 12000 g for 15 min at 4 °C. One volume of Isopropyl alcohol (Sigma I-9516) was added to 500 μl of aqueous phase, mixed, and incubated for 10 min at room temperature. Then, the sample was centrifuged at 12000 g for 15 min at 4 °C. The cell pellet was washed by re-suspension with 1 ml of 75% alcohol and centrifugation at 7500g for 5 min at 4 °C, the supernatant was carefully removed, and the pellet was allowed to air dry for 10 min. The RNA was subsequently re-suspended in 30 μl RNase-free water (preheated to 60 °C). RNA concentration and purity were assessed using a Nanodrop spectrophotometer (Thermo Scientific). cDNA was synthesized from isolated RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA) for gene expression analysis. For qPCR arrays, samples were purified using the QIAGEN RNeasy Mini Cleanup Kit (Thermo Scientific 74104) before cDNA conversion.

2.8. Scanning electron microscope (SEM) Neutrophils were seeded onto Poly-L-lysine coated 12 mm glass coverslips (Corning™ 354085) and incubated for 30 min at 37 °C to allow for cell attachment. Following the attachment, the cells were stimulated with F. nucleatum and fixed in 4% formaldehyde for 20 min, washed once with PBS for 20 min, and dehydrated by incubating through a graded solution of ethanol diluted in distilled water (20%, 30%, 40%, 50%, 60%, 70%, 90%, 100%, 100%) for 5 min each. Samples were then transferred to critical point dryer. First, samples were immersed in 100% ethanol, and then the chamber was slowly filled with liquid CO2 to replace the ethanol. When the chamber reached 100% CO2, heat was applied at 31 °C at 1072 psi to evaporate the CO2. The dried sample was then mounted on a Denton Desk II sputter coater for gold coating. Samples were then analyzed using a JOEL JSM-T330A scanning electron microscope at the Core facility (Department of Biochemistry, School of Dental Medicine, University of Pennsylvania).

2.13. Real-time PCR and custom qPCR array 2.9. Transmission electron microscopy (TEM) Neutrophils were challenged with F. nucleatum (MOI 1:10) for 8 h. Following RNA and cDNA conversion, qPCR array was performed to determine the gene expression that drives F. nucleatum-induced activation of neutrophils according to the published article [41]. Quantitative TaqMan PCR-Array was custom-designed to include innate immune, apoptosis, and GPCR signaling pathways based on previously published microarray data by Kinane et al., 2006 [42]. The fold increase was calculated as compared to the control sample according to

Neutrophils were fixed with 2.5% glutaraldehyde for 1 h at 4 °C, and then post-fixed using 1% osmium tetroxide for 1 h at 4 °C. Cells were then dehydrated by incubating in ethanol at various concentrations (50%, 70%, 85%, 95%, 100%, 100%) for 5 min, followed by propylene oxide (PO) incubation for 3 min twice. Cells were then embedded in Epoxy embedding medium (Sigma 45359) and left to polymerize. After polymerization, specimens were cut into sections, ranging from 500 nm 55

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

Fig. 1. NETosis in primary human neutrophils (A): Primary human neutrophils stimulated with A. actinomycetemcomitans (Aa), P. gingivalis (Pg) and F. nucleatum (Fn) bacteria, and immunostained with Neutrophil Elastase (Red) and DAPI (Blue) counterstain. Fn induced significantly higher NETs compared to Aa and Pg. NET release in response to PMA challenged neutrophils (B): Freshly isolated neutrophils were challenged with F. nucleatum (MOI1:10) or PMA (100 nM). NET quantification revealed significant increase in NETs when stimulated with Fn, similar to PMA. Statistical test: One-way analysis of variance (ANOVA) followed by Tukey's multiple comparison test (* = p < 0.05). Values are mean ± SD.

the ΔΔCT method (Livak and Schmittgen, 2001) [43]. Fold increase data was used to derive a heatmap with two-way hierarchical clustering using MeV v4.1 software (rows = genes, columns = samples). The color scale indicates relative expression: yellow, above mean; blue, below mean; and black, below background according to the published article [41]. Real-time PCR (RT-PCR) of NOD1, NOD2 expression from F. nucleatum, P. gingivalis, and A. actinomycetemcomitans challenged cells with and without PMA was carried out using TaqMan® Fast Advanced Master Mix (Applied Biosystems) following manufacturer instructions. The gene expression was calculated using the relative quantification normalization method (ΔΔCt) [43].

was extracted as above. For converting RNA to cDNA, we used the TaqMan® Fast Advanced Master Mix protocol. The NOD1 and NOD2 in neutrophils were determined by mRNA expression and compared with that of IL8 and PAD4 at different conditions.

2.16. PAD4 enzyme activity assay Isolated neutrophils were treated under the conditions mentioned previously. Cell pellets were collected and lysed. PAD4 enzymatic activity was monitored in 4 h interval using a fluorescence-quenching sensing strategy. PAD4 substrates TAMRA-(Gly-Arg-Gly-Ala)3 were kindly provided by Prof. David S. Lawrence (University of North Carolina). PAD4 substrate fluorescence release was observed in the presence of PAD4 and Ca2+ according to Wang et al., 2013. The sample was prepared by adding 5.2 mg/ml of protein lysate, 5 μM TAMRA(Gly-Arg-Gly-Ala)3, 5 mM DTT (Sigma 3483-12-3), 4% protease inhibitor cocktail (Sigma P8340), and 110 μM of Evans blue as quencher. Assay was initiated by adding 10 mM CaCl2 (Wang et al., 2013). Then, samples were plated in a 96-well microplate (BD FalconTM 353219). Fluorescence was quantified at excitation/emission wavelengths of 550/590 nm using the Infinite M200 microplate reader (Tecan, Mannerdorf, Switzerland) with a temperature setting of 30 °C.

2.14. Immunoblots Immunoblots were performed according to our previously published protocols Zhao et al., [41]. The membranes were incubated in Cas9 primary antibody (1:1000, Cell Signaling #14697) in blocking buffer overnight at 4 °C. Then, membranes were washed with PBST and incubated with compatible secondary antibodies at 1:2000 dilutions in blocking buffer: anti-mouse IgG, HRP-linked Antibody (1:2000, Cell Signaling #7076). Protein signal was developed using ECL plus™ Western blotting detection reagent (Amersham Biosciences) and visualized using Odyssey® Fc Imaging Systems and software (LI-COR, Lincoln, NE).

2.17. MPO and NE ELISA 2.15. PAD4 gene expression The culture supernatant of treated cells was collected by snap freezing with liquid nitrogen. One hundred microliters of culture supernatant were used in each well without dilution. MPO and NE were measured in triplicate using ELISA according to the manufacturer's standard protocol (Duoset R&D Systems, DY3174, and DY9167-05). Data was acquired using a 96-well plate reader, Infinite M200 (Tecan, Mannerdorf, Switzerland).

Isolated neutrophils were seeded in 6-well plates at a concentration of 1 × 106 cells/ ml and left to rest for 20 min before treatment. Cells were pretreated with 15 μg/ml of NOD1 inhibitor (ML130, ab142177) and NOD2 inhibitor (GSK717, MilliporeSigma) for 2 h, followed by stimulation with PMA 100 nM and their specific ligand for 4 h 1μg/ml C12-iEDAP (InvivoGen) and 10μg/ml MDP (InvivoGen) were used for NOD1 and NOD2 stimulation, respectively. DMSO in control was used as a vehicle control. After 4 h, cell pellets were collected, and total RNA 56

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

bacterial species implicated in the pathogenesis of periodontitis. We stimulated human primary neutrophils with PMA, Aggregatibacter actinomycetemcomitans strain Y4 (1:10), Porphyromonas gingivalis strain 33277 (1:10) and Fusobacterium nucleatum strain FDC 364 (1:10) for 6 h and subjected them to neutrophil elastase staining. We observed that F. nucleatum induced rapid and robust NET formation compared to P. gingivalis and A. actinomycetemcomitans (Fig. 1). For this compelling reason, we selected F. nucleatum to study NET formation in neutrophils. The ability of F. nucleatum to produce NETs was further assessed using a nucleic acid stain SYTOX® orange. Prior to NET release, it has been shown that the cell membrane becomes compromised and eventually ruptures [44]. By taking advantage of the compromised membrane integrity, NETs can be quantified using impermeable DNA dyes, such as SYTOX® orange. PMA is a well-known inducer of NETs [45]. Thus, we utilized SYTOX orange with F. nucleatum in this assay. After the cells were induced with F. nucleatum and PMA for 4 h, the fluorometric quantification revealed that F. nucleatum (MOI 1:10) were capable of inducing NETs successfully when compared to PMA as positive control. NET induction was time-dependent in a positive manner (Fig. 1B). 3.2. Neutrophils entrap F. nucleatum within the NETs To allow detailed analysis of the interaction between the bacteria and neutrophils, SEM and TEM were performed. Neutrophils were seeded as described in method section and stimulated with F. nucleatum at different time point with different concentrations. When cells were challenged with F. nucleatum (MOI 1:10), morphological changes occurred, and neutrophils started to flatten (Fig. 1A) eventually releasing NETs (Fig. 2B) as observed in other systems [46]. Generally, the NETs presented as thin strand-like structures connecting neutrophils with the bacteria entrapped within these strands (Fig. 2C). When challenged with a higher concentration of F. nucleatum (MOI 1:100), we found more cell death compared to NET release (Fig. 2D). The entrapment of F. nucleatum prompted us to use TEM to check if neutrophils internalize the bacteria. Our TEM image showed poor internalization of bacteria (Fig. 2E and F) suggesting that both NETosis and phagocytosis could cooccur at different rates. To confirm our observation under SEM, DNA fragmentation ELISA was done to detect cytoplasmic histone-associated DNA fragments (H1, H2A, H2B, H3, and H4). Data showed that F. nucleatum and positive control (DNase I - 1000 U/ml) significantly induced histone release and cell death when compared to control cells without any treatment (Fig. 2G).

Fig. 2. Scanning electron micrographs of neutrophils stimulated with F. nucleatum: Typical morphological changes associated with NETosis observed (A). NETs are presented as strand-like structure connecting cells (B). Rapid NET formation upon F. nucleatum stimulation. Magnified image of F. nucleatum trapped by neutrophils (C). Neutrophils were stimulated with 1:100 MOI of F. nucleatum for 12 h, fixed and observed under after 16 h of stimulation. F. nucleatum at 1:100 MOI induced cell death (D) Negative (media only) and positive controls (Campthecin - 4 μg/ml) were prepared according cell death detection ELISA kit (Roche diagnostics). Transmission Electron Microscopic image of F. nucleatum challenged neutrophils. TEM showing extension of neutrophils membrane represented in red outline, granules, and F. nucleatum inside and outside of a neutrophil (blue circle) (E). Magnified TEM image of neutriophil showing poor internalization of Fn (blue arrow) (F). DNA fragmentation ELISA showed high death rate compared to negative control (media only) when challenged with F. nucleatum and positive control (DNase I treatment - 1000 U/ ml) (G). Statistical test: One-way ANOVA followed by Tukey's multiple comparison test (*p < 0.05; ns = no significant difference). Results are mean ± SD.

3.3. F. nucleatum activates citrullination of histone H3 via PAD4 activation Citrullination of histone H3 (Cit-H3) by PAD4 plays an essential role in chromatin de-condensation, and subsequently in the release of NETs. Immunohistochemistry of Cit-H3 was used to detect and visualize NET formation in neutrophils. Staining of citrullinated histone H3 in F. nucleatum-treated neutrophils indicated that F. nucleatum successfully induced chromatin de-condensation via PAD4 activation (Fig. 3).

2.18. Statistics

3.4. F. nucleatum up-regulates NOD1 and NOD2 receptors in neutrophils

Statistical analysis was done using GraphPad Prism 6.0 (San Diego, CA). The Data were analyzed with one-way ANOVA followed by Tukey's multiple comparison tests. Statistical differences were considered significant at the p < 0.05 level.

To determine the neutrophil activation process by F. nucleatum, neutrophils were challenged with F. nucleatum at an MOI 1:10 for 8 h and qPCR array was performed on a focused panel of innate immune, apoptosis, and GPCR related genes (Fig. 4A). Quantitative PCR array revealed that F. nucleatum strongly upregulated NOD1 and NOD2 expression when compared to other genes pools. More specifically, NOD1 and NOD2 expressions were 44.8 and 31.8 folds compared to control, respectively. This indicates the link between NOD1 and NOD2 pathways and F. nucleatum-mediated activation of neutrophils. To confirm NOD1 and NOD2 expression is unique to F. nucleatum stimulation, we utilized neutrophils from a different donor and compared mRNA levels of NOD1 and NOD2 in cells stimulated with P. gingivalis and A.

3. Results 3.1. F. nucleatum induced rapid and robust NETosis To better understand role of NETosis, we first sought to determine the suitable model organism. In this case, we chose three important 57

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

Fig. 3. F. nucleatum induces PAD activation and the release of de-condensed chromatin in neutrophils: Cells were challenged for 4 h with F. nucleatum (MOI 1:10) or left unstimulated and then processed for immunofluorescence. DNA was stained with DAPI (blue), and de-condensed chromatin was stained with anti-citrullinated Histone H3 antibody (Cit-H3) (pink). De-condensed chromatin was not observed without stimulation (A). F. nucleatum-challenged neutrophils demonstrated the presence of de-condensed chromatin at 1 h treatment (B), and NETs (white arrow) indicating the presence of citrullinated histone H3 at 4 h (C).

NOD1 and NOD2 knockout HL-60 cell lines showed significantly fewer NETs when challenged with F. nucleatum (MOI 1:10) for 12 h (Fig. 5D). This data demonstrates the link between NOD1/NOD2 pathways and the F. nucleatum-mediated NETosis process. Next, quantity of histoneassociated DNA fragments (H1, H2A, H2B, H3, and H4) in the cytoplasm of NOD1 knockout cells was significantly reduced, but NOD2 knockout cells showed no significant changes compared to control. This indicates that NOD1 but not NOD2 is associated with histones release (Fig. 5E and F).

actinomycetemcomitans. Stimulation of PMA in neutrophils has been shown to induce NETs [47,48]. Hence, we included PMA to test whether it interfered in NOD receptor upregulation. RT-qPCR data showed that F. nucleatum profoundly upregulated NOD-like receptors in comparison with other bacterial strains with and without PMA (Fig. 4B). The difference in fold increase in Fig. 4A and B with respect to F. nucleatum stimulation may be attributed to heterogeneity among different donors and their neutrophils. 3.5. NOD1 and NOD2 receptors are involved in F. nucleatum mediated NETosis

3.6. Activation of NOD1, but not NOD2 upregulates PAD4 expression

To confirm the role of NOD receptors in NETosis process, we generated NOD1 and NOD2 knockout HL-60 cell lines as described in the methods section (Fig. 5A). Within one week, small colonies started to appear (Fig. 5B). At day 14, small and large colonies were selected and plated in 96-well plates for four days. Furthermore, selected colonies were single sorted on 96-well plates to exclude the possibility of mixed population. RNA was extracted using RNAqueous™-Micro Kit (Thermo Fisher AM1931). RT-PCR was performed and confirmed gene knockout (Fig. 5C). Utilizing the fact that NETs mainly consist of nuclear DNA [11], the fluorescent DNA stain, SYTOX® orange, was used for fluorometric quantification of NET release. When compared to control cells,

To confirm our finding with HL-60 knockout cell lines in the role of NOD-like receptors in neutrophils NET formation, we sought to utilize pharmacological inhibition of NOD1/NOD2 before challenging with their specific ligands and using PMA as a control. Cells were pretreated with or without ML130 (NOD1 inhibitor) and GSK717 (NOD2-inhibitor) for 2 h. Following the inhibitor treatment, the stimulation of cells was carried out for 4 h with NOD1 and NOD2 specific ligands (C12-iEDAP (NOD1 ligand) and MDP (NOD2 ligand)). We analyzed NOD1, NOD2, and IL-8 mRNA expression using the real-time PCR. Our data showed that although C12-iEDAP did not upregulate NOD1 expression, the IL-8 expression, which is downstream of NOD1 activation 58

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

Fig. 4. Quantitative PCR-Array of innate immune, apoptosis and GPCR related genes: Neutrophils were challenged with F. nucleatum at MOI:10 for 8 h. The ΔΔCT log values were used to generate a heatmap based on twoway hierarchical clustering with MeV v4.1 software (rows = genes, columns=sample). The color scale indicates relative expression: yellow, above mean (> 15.0); blue, below mean (−6.0); and black, unchanged (0.0) (A). RT-qCR of NOD1 and NOD2 expression in neutrophils after challenging them with P. gingivalis (PG), A. actinomycetemcomitans (A.A), and F. nucleatum (FN) with and without PMA. F. nucleatum significantly upregulate NOD1 and NOD2 compared to other groups (B). Statistical test: One-way ANOVA followed by Tukey's multiple comparison test (*p < 0.05). Results are mean ± SD.

release of MPO and NE. This data also demonstrates that NOD1 and NOD2 affect both MPO and NE by increasing their activity, and may affect NETosis processes.

[49], was significantly upregulated, confirming the receptor's activation and function. The cells that were treated with NOD1 inhibitor ML130 prior to C12-iEDAP stimulation significantly downregulated NOD1 and IL-8 expression (Fig. 6A). Treating cells with MDP significantly upregulated NOD2 expression and NOD2 inhibitor GSK717 strongly inhibited NOD2 and IL-8 upregulation (Fig. 6B). Interestingly, despite there being no effect of PAD4 with C12-iEDAP, NOD1 inhibitor ML130 had a significant downregulation on PAD4 expression. The cells treated with MDP and GSK717 showed no significant upregulation of PAD4 expression (Fig. 6C), confirming the role of NODs in the regulation of PAD4 expression, which is upstream of nuclear de-condensation. Since we observed differential activation of NOD1 and NOD2 gene expression with the pharmacological inhibitors, we wanted to investigate PAD4 enzymatic activity (post-translational modification) using Fluorescence Quenching, a fluorescence-based PAD4 activity sensing strategy. In this experiment, we mixed cell lysate from each sample with Evans blue, a fluorescence quenching mediator, and TAMRA-(Gly-Arg-Gly-Ala)3, a PAD4 specific substrate. Substrate fluorescence release was monitored at 4 h intervals. We observed a significant increase of PAD4 enzymatic activity with C12-iEDAP treated cells. Moreover, NOD1 inhibitor ML130 significantly decreased the enzymatic activity of C12-iEDAPtreated cells (Fig. 7). In contrast to NOD1 findings, despite NOD2 activation, there was no change in either PAD4 expression or in its enzymatic activity. Thus, our data illustrates the significant role of NOD1 receptor in PAD4 expression at both transcriptional and translational levels, and that NOD1-induced chromatin decondensation occurs via the activation of PAD4.

4. Discussion Neutrophil extracellular trap (NET) formation is one of the key elements in many recently discovered innate immune functions that have garnered much appreciation due to their link to various pathogenic interactions and chronic inflammatory and infective diseases. Periodontitis is one of the most prevalent chronic diseases in humans [4,18,50–52]. F. nucleatum is considered one of the most abundant species in the oral cavity of healthy and diseased individuals [53,54]. F. nucleatum has a role in the periodontitis-related biofilm, due to its remarkable adhesive and adaptation properties [55] and has an essential role in supporting the growth of various bacterial species [55–57]. Being a ‘bridge bacterium’ in the interaction between early and late oral colonizing bacteria, it has a key role in the development of the dental plaque biofilm [57], and is linked to various forms of periodontal diseases starting from mild gingivitis to advanced periodontitis [53,58–60]. Numerous bacterial species have been reported to induce and be trapped by NETs, including noted periodontal pathogens [11,12,15,61]. Our data in this report indicates that F. nucleatum induces rapid and significantly higher NET formation compared to P. gingivalis and A. actinomycetemcomitans. Consistent with previous observations, F. nucleatum (MOI 1:10), was able to form NETs which were clearly visible by fluorescence microscopy and SEM. Thus, we chose F. nucleatum as a model organism to further investigate NET production and the mechanisms governing NET formation in vitro. We observed that using a higher concentration of F. nucleatum (MOI 1:100) not only lead to a faster and more robust neutrophil activation, but also induced more apoptosis than NETosis. F. nucleatum is one of the largest microbes in the oral cavity. The length of this spindle-shaped rod bacteria ranges from 5 to 10 μm [62]. It is possible that the large size of F. nucleatum is what drives

3.7. NOD1 and NOD2 activation modulate MPO and NE activity during NETosis MPO and NE enzyme activities in the culture supernatant were detected using ELISA. We observed a significant increase and decrease of MPO and NE activity when treated with NOD1/NOD2 ligands and inhibitors, respectively (Fig. 8A and B). This data confirms that NOD1 and NOD2 upregulation is linked to neutrophil activation via the 59

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

Fig. 5. Generation of NOD1 and NOD2 knockout by CRISPR/Cas9 system: Immunoblot from HL-60 Cas9 stable cell line treated with 1 μg of doxycycline for 48 h. Cas9 protein (160 kDa) was detected only in doxycycline treated cells (A) (M1: MagicMark XP Western Protein Starndard, M2: Rainbow marker, “-” indicates empty lane). Images represent a single cell colony formation cultured in a semisolid media (B). Colonies were selected two weeks post transfection and seeded in 96-well plate for colonies expansion and genes knockout validation. HL-60 knockout confirmation: RT-PCR of knockout cells showed a significant reduction in NOD1 and NOD2 expression compared to control cells (C). Quantification of NET release in NOD1 and NOD2 knockout HL-60 cell line: NET release was quantified using SYTOX® orange DNA stain. We observed a significant increase in the release of NET from control HL-60 (wildtype) when exposed to F. nucleatum, while both NOD1 and NOD2 knockout HL-60 didn't show significant NET release when compared to untreated group tested by SYTOX ® orange DNA stain (D). NOD1 knockout HL60 cells showed a significant reduction in cytoplasmic histone-associated DNA fragments (H1, H2A, H2B, H3 and H4) when challenged with F. nucleatum (MOI1:10) (E), while NOD2 knockout HL60 cells revealed insignificant changes in cell death rate (negative control: media only and positive control: Camptothecin 4μg/ml) (F). Statistical comparisons are shown by horizontal bars with asterisks above them (*p < 0.05) determined by one-way ANOVA and Tukey multiple comparison test. Data are expressed as mean ± SD.

bacterial stimulation, we challenged neutrophils with P. gingivalis and A. actinomycetemcomitans. We found that between all groups, F. nucleatum caused the most significant upregulation in NOD1 and NOD2. NOD1 and NOD2 receptor are the first NLRs reported as direct intracellular pattern-recognition receptors (PRRs) [19]. It has been shown that NLRs are necessary sensors of specific pathogen associated molecular patters (PAMPs). However, the mechanism by which NLRs detect the PAMPs remains poorly understood, and it is still unclear if they directly bind to PAMPs, or if it is only PAMPs that bind to adaptor proteins [66,67]. Given that NOD1 and NOD2 were significantly increased when challenged with F. nucleatum, we further analyzed the role of NOD1 and NOD2 receptors in NETosis. HL-60 cell line is a well-known model for neutrophils studies [38,39]. Using the CRISPR-Cas9 gene editing system we developed NOD1 and NOD2 knockout HL-60 cell lines as models for our experiments. When challenging NOD1 and NOD2 knockout HL-60 with F. nucleatum, the NET release was significantly reduced when compared to control cells. The quantity of histone-associated DNA fragments (H1, H2A, H2B, H3, and H4) in the cytoplasm of NOD1 knockout cells was significantly reduced, but NOD2 knockout cells showed no significant changes compared to control. This indicated that NOD1, but not NOD2, is associated with histone release. In addition, staining with NE revealed that while F. nucleatum successfully induced NET formation in HL-60 wild-type cells, NOD-1 knockout HL-60 cells formed significantly fewer NETs. This confirm that NOD1 and NOD2 receptors play a role in the NET formation, with NOD1 being more associated with histone

neutrophils to NETosis instead of phagocytosis [63]. In a recent study, Kurgan et al. tested various strains of F. nucleatum (F. nucleatum strains subspecies (ssp.) nucleatum ATCC 25586, ssp. polymorphum ATCC 10953, and ssp. vincentii ATCC 49256) and evaluated neutrophil apoptosis and phagocytosis [56]. The authors observed strain-specific differences on phagocytosis by the neutrophils. F. nucleatum ssp. polymorphum showed significantly higher phagocytosis than ssp. nucleatum [56]. It has been suggested that neutrophils, when highly primed by cytokines and exposed to opsonized microbes, will undergo apoptosis, whereas a weaker stimulus will lead to NETosis [64]. Concurrent with these observations, our TEM image shows inefficient internalization of F. nucleatum by the neutrophils. Moreover, F. nucleatum is considered to be less toxic when compared to the red complex pathogen such as P. gingivalis or T. denticola, and thus might preferably induce neutrophil NETosis. While the list of microbes and molecules capable of stimulating NET release is increasing, their induced response is not identical. Bacterialhost interaction elects different immune responses via a varied group of receptors and cytokines [65]. By using qPCR arrays, custom designed to detect innate immune, apoptosis, and GPCR signaling pathways, we sought to investigate which pathway is most likely related to F. nucleatum-induced NETosis. Interestingly, our data showed that F. nucleatum upregulated NOD1 and NOD2, and inhibition of NOD1 and NOD2 resulted in significant reduction in NET formation, suggesting the role for NODs in NETosis process. Furthermore, to determine if the upregulation of NOD1 and NOD1 receptors can occur with other types of 60

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

Fig. 6. NOD1 and NOD2 inhibitor/ligand treatment in human neutrophils: Cells were subjected to (15 μg/ml) ML130 (NOD1 inhibitor) treatment for 2 h, followed by stimulation with (1 μg/ml) C12-iEDAP (NOD1 ligand) and PMA (100 nM) for 4 h. Total RNA was isolated for real-time PCR. The NOD1 receptor mRNA expression was unchanged upon NOD1 ligand challenge but was successfully downregulated when treated with its inhibitor prior to ligand stimulation. PMA had no significant effect on NOD1 expression; however, IL-8 expression was increased and decreased significantly when treated with NOD1 ligand and inhibitor, respectively (A). When cells were subjected to GSK717 (15 μg/ml) treatment for 2 h, followed by stimulation with (10 μg/ml) MDP (NOD2-ligand) and PMA (100 nM) for 4 h, NOD2 and IL-8 mRNA expressions were significantly downregulated (B). PAD4 mRNA expression in neutrophils following NOD1 and NOD2 inhibitor/ligand treatment: Neutrophils were pretreated with or without (15 μg/ml) ML130 and GSK717 for 2 h before being challenged with (1μg/ml) of C12iEDAP and (10μg/ml) MDP for 4 h, respectively. Changes in PAD4 expression in NOD1 ligand-treated cells were not significant but there was successful downregulation upon ML130 pretreatment. NOD2 ligand/inhibitor treatments had no significant effect on PAD4 mRNA expression. Results are mean ± S.D. Statistical comparisons are determined using one-way ANOVA followed by Tukey multiple comparison test (*p < 0.05).

specific inhibitor (ML130) significantly downregulated PAD4 activity while NOD2 inhibitor (GSK717) had no significant results, confirming that only NOD1 is related to histones released via PAD4 activation. These data coincide with our finding in HL-60 knockout histones quantification. The citrullination of proteins by PAD enzymes are regulated at transcriptional, translational, and activation levels [68]. We found that PAD4 activity significantly increased with NOD1 ligand stimulation. Moreover, this increase in PAD4 activity was reduced when pretreated with NOD1 inhibitor. On the other hand, NOD2 stimulation and inhibition had no significant effect on PAD4 enzymatic activity. Thus, confirming that NOD1, but not NOD2, regulated PAD4 at both transcriptional and translational levels in our experiments. It was reported that NOD1 and NOD2 receptors are essential for neutrophil recruitment but do not impair the immune response in NOD1−/− and NOD2−/− mice. Moreover, they stimulated mice neutrophils for 2 h with Litomosoides sigmodontis antigen (LsAg), or LPS, and

release. Knowing the importance of NOD1 and NOD2 receptors in NET formation, we further investigated the downstream activation of these receptors and their links to other essential NET-related proteins such as PAD4, MPO, and NE. F. nucleatum successfully induced PAD4 activation and citrullination of histones as detected by immunostaining of Cit-H3 confirming the role for NOD1 and NOD2 in NETosis. Treating neutrophils with the MDP ligand strongly upregulated NOD2 receptor transcription, while C12-iEDAP ligand was insignificant in NOD1 upregulation. Both NOD1 and NOD2 ligands significantly upregulated IL8 expression, indicating that despite the insignificant upregulation of NOD1, its receptor activity was increased. Moreover, each bacterial species has a different combination of surface antigens that result in variations in stimulation of host cells. The fact that F. nucleatum highly upregulates NOD1 in neutrophils illustrates that there might be different peptides/proteins other than C12-iEDAP that is more specific to the PGN of F. nucleatum resulting in NOD1 activation. NOD1 61

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

Fig. 7. PAD4 activity assay in human neutrophils: Fluorescence change of PAD4 substrate (TAMRA-Gly-Arg-Gly-Ala3) and Evans blue quencher pair in neutrophils lysate upon stimulation with NOD1 and NOD2 ligands, in the presence or absence of inhibitors. Fluorescence release was monitored for 4 h. Increased PAD4 activity was observed only in (1μg/ml) C12-iEDAP treated cells and was significantly reduced in the ML130 (15μg/ml) pretreated group. MDP had no significant effect on PAD4 enzyme activity, concurring with our RT-PCR data. Statistical testing was done by one-way ANOVA and Tukey multiple comparison (*p < 0.05; ns = no significant difference).

Fig. 9. Schematic diagram summarizing NET-related NOD1 and NOD2 signaling pathway: F. nucleatum mediates NETosis by the activation NOD1/NOD2 by triggering PAD4 enzyme activation, MPO, and NE release.

infection and disease. Furthermore, studying the pathways of NET formation related to both oral and systemic health helps in understanding and targeting the proteins leading to NET-related diseases. In addition to NET's role in restricting the spread of infection, there is a growing body of evidence that links NETosis to other various systemic disorders elucidating the importance of an efficient, non-invasive therapeutic modality. A drug therapy that controls the initiation of the NET pathways or the clearance of their byproducts could be exploited in treating NET-related cancer metastasis, autoimmune, chronic inflammatory, and cardiovascular diseases.

found that NE and MPO activity in NOD1−/− and NOD2−/− mice was comparable to the wild-type and they are not functionally impaired [69]. However, in our study, we found that stimulation of NOD1 and NOD2 for 4 h with their specific ligands resulted in increased activity of both NE and MPO enzymes. Furthermore, inhibition of NOD1 and NOD2 receptors led to a significant reduction in NE and MPO release. It is possible that the negative results obtained from NOD1−/− and NOD2−/− mice were a result of inadequate stimulation time (only 2 h) and that murine neutrophil activity slightly differs from that of human neutrophils. Moreover, MPO levels in mice neutrophils are only 10–20% of that of human neutrophils [70–72] suggesting the disparity. This is the first study to elucidate the role of NOD-like receptors in NETosis and its downstream targets (Summarized in Fig. 9). To our knowledge, the importance of NOD-like receptors in chromatin decondensation and PAD4 activation and their effect on MPO and NE activity have not been addressed previously. We believe that our study will set the ground for a novel approach to one of the most controversial functions of neutrophils. By understanding the processes that govern NET pathways, we can further understand their roles in periodontal

Acknowledgments AHM would like to thank the Saudi Arabian Cultural Mission and King Fahad Medical City for sponsoring her doctoral scholarship. The authors thank the School of Dental Medicine, University of Pennsylvania for financial support. Authors would like to thank Prof. David S. Lawrence at the University of North Carolina for providing reagents for PAD4 activity assays. Further, the authors would like to thank Mr. Meric Odabas-Yigit for proofreading the manuscript. Fig. 8. MPO and NE ELISA of supernatant from NOD1/ NOD2 ligands and inhibitors treated cells: MPO (A) and NE (B) release were significantly induced by (1μg/ml) C12-iEDAP and (10 μg/ml) MDP ligands. The induction of enzymes by NOD1 and NOD2 ligands was significantly downregulated by pharmacological inhibition with (5μg/ ml) ML130 and GSK717, respectively. Values represent the mean ± SD. The analysis was done using one-way ANOVA followed by Tukey multiple comparison test. Statistical comparisons are to the vehicle (DMSO) (*p < 0.05; ns = no significant difference).

62

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

Appendix A. Supplementary data

40–60, https://doi.org/10.1111/j.1600-065X.2011.01047.x. [26] S. Lipinski, A. Till, C. Sina, A. Arlt, H. Grasberger, S. Schreiber, P. Rosenstiel, DUOX2-derived reactive oxygen species are effectors of NOD2-mediated antibacterial responses, J. Cell Sci. 122 (Pt 19) (2009) 3522–3530, https://doi.org/10. 1242/jcs.050690. [27] T. Okugawa, T. Kaneko, A. Yoshimura, N. Silverman, Y. Hara, NOD1 and NOD2 mediate sensing of periodontal pathogens, J. Dent. Res. 89 (2) (2010) 186–191, https://doi.org/10.1177/0022034509354843. [28] J. Schultz, R. Corlin, F. Oddi, K. Kaminker, W. Jones, Myeloperoxidase of the leucocyte of normal human blood. 3. Isolation of the peroxidase granule, Arch. Biochem. Biophys. 111 (1) (1965) 73–79. [29] J. Schultz, K. Kaminker, Myeloperoxidase of the leucocyte of normal human blood. I. Content and localization, Arch. Biochem. Biophys. 96 (1962) 465–467. [30] K.D. Metzler, T.A. Fuchs, W.M. Nauseef, D. Reumaux, J. Roesler, I. Schulze, V. Wahn, V. Papayannopoulos, A. Zychlinsky, Myeloperoxidase is required for neutrophil extracellular trap formation: implications for innate immunity, Blood 117 (3) (2011) 953–959, https://doi.org/10.1182/blood-2010-06-290171. [31] G. Doring, The role of neutrophil elastase in chronic inflammation, Am. J. Respir. Crit. Care Med. 150 (6 Pt 2) (1994) S114–S117, https://doi.org/10.1164/ajrccm/ 150.6_Pt_2.S114. [32] V. Papayannopoulos, K.D. Metzler, A. Hakkim, A. Zychlinsky, Neutrophil elastase and myeloperoxidase regulate the formation of neutrophil extracellular traps, J. Cell Biol. 191 (3) (2010) 677–691, https://doi.org/10.1083/jcb.201006052. [33] M. Leshner, S. Wang, C. Lewis, H. Zheng, X.A. Chen, L. Santy, Y. Wang, PAD4 mediated histone hypercitrullination induces heterochromatin decondensation and chromatin unfolding to form neutrophil extracellular trap-like structures, Front. Immunol. 3 (2012) 307, https://doi.org/10.3389/fimmu.2012.00307. [34] P. Li, M. Li, M.R. Lindberg, M.J. Kennett, N. Xiong, Y. Wang, PAD4 is essential for antibacterial innate immunity mediated by neutrophil extracellular traps, J. Exp. Med. 207 (9) (2010) 1853–1862, https://doi.org/10.1084/jem.20100239. [35] P.G. Stathopoulou, M.R. Benakanakere, J.C. Galicia, D.F. Kinane, Epithelial cell proinflammatory cytokine response differs across dental plaque bacterial species, J. Clin. Periodontol. 37 (1) (2010) 24–29, https://doi.org/10.1111/j.1600-051X. 2009.01505.x. [36] M.R. Benakanakere, Q. Li, M.A. Eskan, A.V. Singh, J. Zhao, J.C. Galicia, P. Stathopoulou, T.B. Knudsen, D.F. Kinane, Modulation of TLR2 protein expression by miR-105 in human oral keratinocytes, J. Biol. Chem. 284 (34) (2009) 23107–23115, https://doi.org/10.1074/jbc.M109.013862. [37] J.B. Kaplan, M.F. Meyenhofer, D.H. Fine, Biofilm growth and detachment of Actinobacillus actinomycetemcomitans, J. Bacteriol. 185 (4) (2003) 1399–1404. [38] S.J. Collins, The HL-60 promyelocytic leukemia cell line: proliferation, differentiation, and cellular oncogene expression, Blood 70 (5) (1987) 1233–1244. [39] J.F. Bohnsack, J. Chang, Activation of beta 1 integrin fibronectin receptors on HL60 cells after granulocytic differentiation, Blood 83 (2) (1994) 543–552. [40] T. Abe, M. AlSarhan, M.R. Benakanakere, T. Maekawa, D.F. Kinane, M.P. Cancro, J.M. Korostoff, G. Hajishengallis, The B cell-stimulatory cytokines BLyS and APRIL are elevated in human periodontitis and are required for B cell-dependent bone loss in experimental murine periodontitis, J. Immunol. 195 (4) (2015) 1427–1435, https://doi.org/10.4049/jimmunol.1500496. [41] J. Zhao, M.R. Benakanakere, K.B. Hosur, J.C. Galicia, M. Martin, D.F. Kinane, Mammalian target of rapamycin (mTOR) regulates TLR3 induced cytokines in human oral keratinocytes, Mol. Immunol. 48 (1–3) (2010) 294–304, https://doi. org/10.1016/j.molimm.2010.07.014. [42] D.F. Kinane, H. Shiba, P.G. Stathopoulou, H. Zhao, D.F. Lappin, A. Singh, M.A. Eskan, S. Beckers, S. Waigel, B. Alpert, T.B. Knudsen, Gingival epithelial cells heterozygous for Toll-like receptor 4 polymorphisms Asp299Gly and Thr399ile are hypo-responsive to Porphyromonas gingivalis, Genes Immun. 7 (3) (2006) 190–200, https://doi.org/10.1038/sj.gene.6364282. [43] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) method, Methods 25 (4) (2001) 402–408, https://doi.org/10.1006/meth.2001.1262. [44] T.A. Fuchs, U. Abed, C. Goosmann, R. Hurwitz, I. Schulze, V. Wahn, Y. Weinrauch, V. Brinkmann, A. Zychlinsky, Novel cell death program leads to neutrophil extracellular traps, J. Cell Biol. 176 (2) (2007) 231–241, https://doi.org/10.1083/jcb. 200606027. [45] A.K. Gupta, P. Hasler, W. Holzgreve, S. Gebhardt, S. Hahn, Induction of neutrophil extracellular DNA lattices by placental microparticles and IL-8 and their presence in preeclampsia, Hum. Immunol. 66 (11) (2005) 1146–1154, https://doi.org/10. 1016/j.humimm.2005.11.003. [46] T. Iba, N. Hashiguchi, I. Nagaoka, Y. Tabe, M. Murai, Neutrophil cell death in response to infection and its relation to coagulation, J Intensive Care 1 (1) (2013) 13, https://doi.org/10.1186/2052-0492-1-13. [47] J. Desai, S.V. Kumar, S.R. Mulay, L. Konrad, S. Romoli, C. Schauer, M. Herrmann, R. Bilyy, S. Muller, B. Popper, D. Nakazawa, M. Weidenbusch, D. Thomasova, S. Krautwald, A. Linkermann, H.J. Anders, PMA and crystal-induced neutrophil extracellular trap formation involves RIPK1-RIPK3-MLKL signaling, Eur. J. Immunol. 46 (1) (2016) 223–229, https://doi.org/10.1002/eji.201545605. [48] R.D. Gray, C.D. Lucas, A. MacKellar, F. Li, K. Hiersemenzel, C. Haslett, D.J. Davidson, A.G. Rossi, Activation of conventional protein kinase C (PKC) is critical in the generation of human neutrophil extracellular traps, J. Inflamm. 10 (1) (2013) 12, https://doi.org/10.1186/1476-9255-10-12. [49] D.I. Jeon, S.R. Park, M.Y. Ahn, S.G. Ahn, J.H. Park, J.H. Yoon, NOD1 and NOD2 stimulation triggers innate immune responses of human periodontal ligament cells, Int. J. Mol. Med. 29 (4) (2012) 699–703, https://doi.org/10.3892/ijmm.2012.878. [50] M.R. Benakanakere, L.S. Finoti, U. Tanaka, G.R. Grant, R.M. Scarel-Caminaga, D.F. Kinane, Investigation of the functional role of human Interleukin-8 gene

Supplementary data related to this article can be found at https:// doi.org/10.1016/j.micpath.2019.03.036. References [1] D.A. Scott, J. Krauss, Neutrophils in periodontal inflammation, Front Oral Biol. 15 (2012) 56–83, https://doi.org/10.1159/000329672. [2] J.C. Galicia, M.R. Benakanakere, P.G. Stathopoulou, D.F. Kinane, Neutrophils rescue gingival epithelial cells from bacterial-induced apoptosis, J. Leukoc. Biol. 86 (1) (2009) 181–186, https://doi.org/10.1189/jlb.0109003. [3] K.S. Kornman, R.C. Page, M.S. Tonetti, The host response to the microbial challenge in periodontitis: assembling the players, Periodontol. 14 (1997) 33–53 2000. [4] E. Hajishengallis, G. Hajishengallis, Neutrophil homeostasis and periodontal health in children and adults, J. Dent. Res. 93 (3) (2014) 231–237, https://doi.org/10. 1177/0022034513507956. [5] G. Hajishengallis, T. Chavakis, E. Hajishengallis, J.D. Lambris, Neutrophil homeostasis and inflammation: novel paradigms from studying periodontitis, J. Leukoc. Biol. 98 (4) (2015) 539–548, https://doi.org/10.1189/jlb.3VMR1014-468R. [6] I. Olsen, G. Hajishengallis, Major neutrophil functions subverted by Porphyromonas gingivalis, J. Oral Microbiol. 8 (2016) 30936, https://doi.org/10.3402/jom.v8. 30936. [7] N.M. Moutsopoulos, J. Konkel, M. Sarmadi, M.A. Eskan, T. Wild, N. Dutzan, L. Abusleme, C. Zenobia, K.B. Hosur, T. Abe, G. Uzel, W. Chen, T. Chavakis, S.M. Holland, G. Hajishengallis, Defective neutrophil recruitment in leukocyte adhesion deficiency type I disease causes local IL-17-driven inflammatory bone loss, Sci. Transl. Med. 6 (229) (2014), https://doi.org/10.1126/scitranslmed.3007696 229ra240. [8] A. Manda-Handzlik, U. Demkow, Neutrophils: the role of oxidative and nitrosative stress in health and disease, Adv. Exp. Med. Biol. 857 (2015) 51–60, https://doi. org/10.1007/5584_2015_117. [9] T. Narasaraju, E. Yang, R.P. Samy, H.H. Ng, W.P. Poh, A.A. Liew, M.C. Phoon, N. van Rooijen, V.T. Chow, Excessive neutrophils and neutrophil extracellular traps contribute to acute lung injury of influenza pneumonitis, Am. J. Pathol. 179 (1) (2011) 199–210, https://doi.org/10.1016/j.ajpath.2011.03.013. [10] V. Brinkmann, B. Laube, U. Abu Abed, C. Goosmann, A. Zychlinsky, Neutrophil extracellular traps: how to generate and visualize them, J Vis Exp 36 (2010), https://doi.org/10.3791/1724. [11] V. Brinkmann, U. Reichard, C. Goosmann, B. Fauler, Y. Uhlemann, D.S. Weiss, Y. Weinrauch, A. Zychlinsky, Neutrophil extracellular traps kill bacteria, Science 303 (5663) (2004) 1532–1535, https://doi.org/10.1126/science.1092385. [12] V. Brinkmann, A. Zychlinsky, Neutrophil extracellular traps: is immunity the second function of chromatin? J. Cell Biol. 198 (5) (2012) 773–783, https://doi.org/10. 1083/jcb.201203170. [13] J.M. Goodson, Gingival crevice fluid flow, Periodontol. 31 (2003) 43–54 2000. [14] W.D. Krautgartner, L. Vitkov, Visualization of neutrophil extracellular traps in TEM, Micron 39 (4) (2008) 367–372, https://doi.org/10.1016/j.micron.2007.03.007. [15] L. Vitkov, M. Klappacher, M. Hannig, W.D. Krautgartner, Extracellular neutrophil traps in periodontitis, J. Periodontal. Res. 44 (5) (2009) 664–672, https://doi.org/ 10.1111/j.1600-0765.2008.01175.x. [16] L. Vitkov, W.D. Krautgartner, M. Hannig, Bacterial internalization in periodontitis, Oral Microbiol. Immunol. 20 (5) (2005) 317–321, https://doi.org/10.1111/j.1399302X.2005.00233.x. [17] Y. Wang, M. Li, S. Stadler, S. Correll, P. Li, D. Wang, R. Hayama, L. Leonelli, H. Han, S.A. Grigoryev, C.D. Allis, S.A. Coonrod, Histone hypercitrullination mediates chromatin decondensation and neutrophil extracellular trap formation, J. Cell Biol. 184 (2) (2009) 205–213, https://doi.org/10.1083/jcb.200806072. [18] M. Benakanakere, D.F. Kinane, Innate cellular responses to the periodontal biofilm, Front Oral Biol. 15 (2012) 41–55, https://doi.org/10.1159/000329670. [19] M. Chamaillard, M. Hashimoto, Y. Horie, J. Masumoto, S. Qiu, L. Saab, Y. Ogura, A. Kawasaki, K. Fukase, S. Kusumoto, M.A. Valvano, S.J. Foster, T.W. Mak, G. Nunez, N. Inohara, An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid, Nat. Immunol. 4 (7) (2003) 702–707, https://doi.org/10.1038/ni945. [20] S.E. Girardin, I.G. Boneca, J. Viala, M. Chamaillard, A. Labigne, G. Thomas, D.J. Philpott, P.J. Sansonetti, Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection, J. Biol. Chem. 278 (11) (2003) 8869–8872, https://doi.org/10.1074/jbc.C200651200. [21] W. Strober, P.J. Murray, A. Kitani, T. Watanabe, Signalling pathways and molecular interactions of NOD1 and NOD2, Nat. Rev. Immunol. 6 (1) (2006) 9–20, https:// doi.org/10.1038/nri1747. [22] K. Geddes, J.G. Magalhaes, S.E. Girardin, Unleashing the therapeutic potential of NOD-like receptors, Nat. Rev. Drug Discov. 8 (6) (2009) 465–479, https://doi.org/ 10.1038/nrd2783. [23] R.G. Correa, S. Milutinovic, J.C. Reed, Roles of NOD1 (NLRC1) and NOD2 (NLRC2) in innate immunity and inflammatory diseases, Biosci. Rep. 32 (6) (2012) 597–608, https://doi.org/10.1042/BSR20120055. [24] M.J. Lapponi, A. Carestia, V.I. Landoni, L. Rivadeneyra, J. Etulain, S. Negrotto, R.G. Pozner, M. Schattner, Regulation of neutrophil extracellular trap formation by anti-inflammatory drugs, J. Pharmacol. Exp. Ther. 345 (3) (2013) 430–437, https://doi.org/10.1124/jpet.112.202879. [25] M.T. Sorbara, D.J. Philpott, Peptidoglycan: a critical activator of the mammalian immune system during infection and homeostasis, Immunol. Rev. 243 (1) (2011)

63

Microbial Pathogenesis 131 (2019) 53–64

H.M. Alyami, et al.

[51]

[52]

[53]

[54] [55]

[56]

[57]

[58]

[59]

[60]

[61]

2011.1. [62] A.I. Bolstad, H.B. Jensen, V. Bakken, Taxonomy, biology, and periodontal aspects of Fusobacterium nucleatum, Clin. Microbiol. Rev. 9 (1) (1996) 55–71. [63] C.F. Urban, U. Reichard, V. Brinkmann, A. Zychlinsky, Neutrophil extracellular traps capture and kill Candida albicans yeast and hyphal forms, Cell Microbiol. 8 (4) (2006) 668–676, https://doi.org/10.1111/j.1462-5822.2005.00659.x. [64] T.N. Mayadas, X. Cullere, C.A. Lowell, The multifaceted functions of neutrophils, Annu. Rev. Pathol. 9 (2014) 181–218, https://doi.org/10.1146/annurev-pathol020712-164023. [65] R. Medzhitov, C.A. Janeway Jr., Decoding the patterns of self and nonself by the innate immune system, Science 296 (5566) (2002) 298–300, https://doi.org/10. 1126/science.1068883. [66] J.H. Fritz, R.L. Ferrero, D.J. Philpott, S.E. Girardin, Nod-like proteins in immunity, inflammation and disease, Nat. Immunol. 7 (12) (2006) 1250–1257, https://doi. org/10.1038/ni1412. [67] J.H. Fritz, L. Le Bourhis, G. Sellge, J.G. Magalhaes, H. Fsihi, T.A. Kufer, C. Collins, J. Viala, R.L. Ferrero, S.E. Girardin, D.J. Philpott, Nod1-mediated innate immune recognition of peptidoglycan contributes to the onset of adaptive immunity, Immunity 26 (4) (2007) 445–459, https://doi.org/10.1016/j.immuni.2007.03.009. [68] S.B. Rodriguez, B.L. Stitt, D.E. Ash, Expression of peptidylarginine deiminase from Porphyromonas gingivalis in Escherichia coli: enzyme purification and characterization, Arch. Biochem. Biophys. 488 (1) (2009) 14–22, https://doi.org/10.1016/j. abb.2009.06.010. [69] J. Ajendra, S. Specht, S. Ziewer, A. Schiefer, K. Pfarr, M. Parcina, T.A. Kufer, A. Hoerauf, M.P. Hubner, NOD2 dependent neutrophil recruitment is required for early protective immune responses against infectious Litomosoides sigmodontis L3 larvae, Sci. Rep. 6 (2016) 39648, https://doi.org/10.1038/srep39648. [70] T. Kalupov, M. Brillard-Bourdet, S. Dade, H. Serrano, J. Wartelle, N. Guyot, L. Juliano, T. Moreau, A. Belaaouaj, F. Gauthier, Structural characterization of mouse neutrophil serine proteases and identification of their substrate specificities: relevance to mouse models of human inflammatory diseases, J. Biol. Chem. 284 (49) (2009) 34084–34091, https://doi.org/10.1074/jbc.M109.042903. [71] N. Noguchi, K. Nakano, Y. Aratani, H. Koyama, T. Kodama, E. Niki, Role of myeloperoxidase in the neutrophil-induced oxidation of low density lipoprotein as studied by myeloperoxidase-knockout mouse, J. Biochem. 127 (6) (2000) 971–976. [72] P.G. Rausch, T.G. Moore, Granule enzymes of polymorphonuclear neutrophils: a phylogenetic comparison, Blood 46 (6) (1975) 913–919.

haplotypes by CRISPR/Cas9 mediated genome editing, Sci. Rep. 6 (2016) 31180, https://doi.org/10.1038/srep31180. G. Hajishengallis, Periodontitis: from microbial immune subversion to systemic inflammation, Nat. Rev. Immunol. 15 (1) (2015) 30–44, https://doi.org/10.1038/ nri3785. P.E. Petersen, H. Ogawa, The global burden of periodontal disease: towards integration with chronic disease prevention and control, Periodontol. 60 (1) (2012) 15–39, https://doi.org/10.1111/j.1600-0757.2011.00425.x 2000. B. Guggenheim, R. Gmur, J.C. Galicia, P.G. Stathopoulou, M.R. Benakanakere, A. Meier, T. Thurnheer, D.F. Kinane, In vitro modeling of host-parasite interactions: the 'subgingival' biofilm challenge of primary human epithelial cells, BMC Microbiol. 9 (2009) 280, https://doi.org/10.1186/1471-2180-9-280. B. Signat, C. Roques, P. Poulet, D. Duffaut, Fusobacterium nucleatum in periodontal health and disease, Curr. Issues Mol. Biol. 13 (2) (2011) 25–36. P.I. Diaz, P.S. Zilm, A.H. Rogers, Fusobacterium nucleatum supports the growth of Porphyromonas gingivalis in oxygenated and carbon-dioxide-depleted environments, Microbiology 148 (Pt 2) (2002) 467–472, https://doi.org/10.1099/ 00221287-148-2-467. S. Kurgan, S. Kansal, D. Nguyen, D. Stephens, Y. Koroneos, H. Hasturk, T.E. Van Dyke, A. Kantarci, Strain-specific impact of Fusobacterium nucleatum on neutrophil function, J. Periodontol. 88 (4) (2017) 380–389, https://doi.org/10.1902/jop. 2016.160212. R.T. Mendes, D. Nguyen, D. Stephens, F. Pamuk, D. Fernandes, T.E. Van Dyke, A. Kantarci, Endothelial cell response to Fusobacterium nucleatum, Infect. Immun. 84 (7) (2016) 2141–2148, https://doi.org/10.1128/IAI.01305-15. V. Zijnge, M.B. van Leeuwen, J.E. Degener, F. Abbas, T. Thurnheer, R. Gmur, H.J. Harmsen, Oral biofilm architecture on natural teeth, PLoS One 5 (2) (2010) e9321, , https://doi.org/10.1371/journal.pone.0009321. J.O. Kistler, V. Booth, D.J. Bradshaw, W.G. Wade, Bacterial community development in experimental gingivitis, PLoS One 8 (8) (2013) e71227, , https://doi.org/ 10.1371/journal.pone.0071227. P.E. Kolenbrander, R.J. Palmer Jr., A.H. Rickard, N.S. Jakubovics, N.I. Chalmers, P.I. Diaz, Bacterial interactions and successions during plaque development, Periodontol. 42 (2006) 47–79, https://doi.org/10.1111/j.1600-0757.2006.00187.x 2000. Q. Remijsen, T.W. Kuijpers, E. Wirawan, S. Lippens, P. Vandenabeele, T. Vanden Berghe, Dying for a cause: NETosis, mechanisms behind an antimicrobial cell death modality, Cell Death Differ. 18 (4) (2011) 581–588, https://doi.org/10.1038/cdd.

64