- Email: [email protected]
Role of Oxalobacter formigenes in Calcium Oxalate Stone Disease: A Study from North India
European Urology
European Urology 41 (2002) 318±322
Role of Oxalobacter formigenes in Calcium Oxalate Stone Disease: A Study from North India R. Kumara, M. Mukherjeeb, M. Bhandaria, A. Kumara, H. Sidhuc, R.D. Mittala,* a
Department of Urology, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Raebareli Road, Lucknow-226014, Uttar Pradesh, India Department of Genetics, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow-226014, Uttar Pradesh,, India c Division of Oxalate Research, Ixion Biotechnology, Alachua, FL, USA b
Accepted 8 January 2002
Abstract Objective: The present study was performed to detect the presence of an oxalate degrading bacteria Oxalobacter formigenes in the GI tract of calcium oxalate stone patients and normal individuals from North India. Furthermore, the possible relationship of this bacterium with number of stone episodes in this part of the world was also studied. The correlation of the presence or absence of O. formigenes with the urinary oxalate levels was evaluated. Methods: DNA was extracted from the stool samples of 63 calcium oxalate stone formers and 40 normal individuals. Polymerase chain reaction (PCR) was performed using genus speci®c primers for O. formigenes. The presence of which was con®rmed by Southern blotting. Urinary oxalate levels were tested in each patient. Results: As shown by PCR and Southern blotting, O. formigenes was present in 65% of normal individuals and in 30% of calcium oxalate stone formers. In patients with three or greater than three stone episodes colonies were present only in 5.6% of patients. Oxalate excretion was less in patients colonized with O. formigenes as compared to those with no colonization. Conclusion: In North Indian population the absence of O. formigenes can lead to a signi®cant increase in the risk of absorptive hyperoxaluria and resultant recurrent calcium oxalate stone episodes. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Calcium oxalate stones; Hyperoxaluria; Oxalobacter formigenes; Recurrent urolithiasis
1. Introduction Recurrence of urinary calculi is one of the biggest challenges faced by the urologists of today. Oxalate is the major component of majority of renal stones and is a powerful crystallization driving factor present in the urine, retention of which enhances cell injury and causes early stages of lithogenesis. A moderate increase in urinary oxalate levels result in calcium oxalate crystallization [1]. In North India more than 80% of urinary calculi are calcium oxalate stones alone or calcium oxalate mixed with calcium phosphate [2]. Lifetime recurrence of urolithiasis is as *
Corresponding author. Tel.: 91-522-440004-8x2116; Fax: 91-522-440017. E-mail addresses: [email protected], [email protected] (R.D. Mittal).
high as 80% [3]. Therefore, an extensive metabolic evaluation and medical management to reduce the recurrence of this disease is currently being emphasized. Oxalobacter formigenes is a recently identi®ed nonpathogenic, anaerobic bacterium colonizing the gastrointestinal tract of vertebrates including humans [4]. These bacteria have a symbiotic relationship with their host by regulating oxalic acid absorption in the intestine as well as maintaining oxalate levels in plasma and urine [5]. In normal individuals O. formigenes may colonize up to 5 108 CFU/g (wet wt.) of colon contents [6,7]. Colonization with these bacteria has the capacity to degrade 0.5±1.0 g of oxalate per day [7]. Absence of O. formigenes and low rate of oxalate degradation has been reported by Kleinshmidt et al. [8]. These bacteria were also reported to be absent in cystic ®brosis patients [9].
0302-2838/02/$ ± see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 3 0 2 - 2 8 3 8 ( 0 2 ) 0 0 0 4 0 - 4
R. Kumar et al. / European Urology 41 (2002) 318±322
In the present study, we have evaluated the relationship between the absence of O. formigenes with calcium oxalate urolithiasis in North Indian population. We have also studied the association of this bacterium with recurrence of oxalate stones and urinary oxalate levels. 2. Materials and methods 2.1. Selection of patients Idiopathic calcium oxalate urolithiasis patients registered between 1998±2001 in the Urology Department of Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow, India constituted the study material. Complete clinical evaluation such as screening of urinary tract calculi by plain X-ray and ultrasound of abdomen (KUB) region was done by our urologists. A total of 63 patients (57 males and 6 females) ranging in age from 9 to 68 years and 40 normal, healthy volunteers (31 males and 9 females) ranging in age from 7 to 40 years participated in the study. Of the 63 patients subjected to Polymerase chain reaction (PCR) for O. formigenes and urinary oxalate levels, 31 (49%) had single stone episode, 14 (22%) had two stone episodes and 18 (28.57%) had three or more stone episodes. The patients with different stone histories were designated as A, B and C respectively. The stones from patients were analyzed by X-ray crystallography. 2.2. Collection of human stool samples Fresh stool samples were collected from each participant with consent during their routine hospital admission or visit to the Urology OPD. Approximately 20±30 mg stool was collected as fecal swab using the fecal collection and transport system with Cary Blair media (Becton Dickinson, NJ USA). Fecal samples were collected from the individuals who were not on antibiotics for atleast 4 weeks prior to sample collection. The study was approved by institutional research and ethical committee. 2.3. DNA extraction Bacterial DNA was isolated directly from fresh stool within 2± 3 h of sample collection using the procedure of Stacy-Phipps et al. [10] with slight modi®cations. Approximately 20±25 mg of stool was suspended in 0.7 ml of phosphate buffered saline and centrifuged at 4000 rpm for 1 min to remove the debris. The supernatant was centrifuged at 10,000 rpm for 10 min. The bacterial pellet was resuspended in 0.7 ml of binding lysis buffer (5.3 M guanidine thiocyanate, 10 mM DTT, 1% Tween 20, 0.3 M sodium acetate and 50 mM sodium citrate) and incubated at 65 8C for 15 min. Glass matrix, 50 ml (Bangalore Genei, India) was added to absorb DNA. The DNA was eluted from the glass beads with 10 mM TE buffer after a brief incubation at 50 8C.
319
2.5. Polymerase chain reaction (PCR) PCR ampli®cation was performed in 50 ml reaction mixtures containing 150±200 ng DNA, 200 mM dNTPs, 1 mM of each primer, PCR buffer and 1.5 U Taq polymerase (Genetix). After initial denaturation (94 8C for 5 min), PCR was carried out for 10 cycles of 94 8C for 1 min, 59 8C for 1 min and 72 8C for 1 min followed by another 30 cycles with an annealing temperature of 55 8C for 1 min in thermocycler (Perkin Elmer 2400). The ampli®ed PCR products were electrophorized in 1.2% agarose gels, visualized with UV light and documented (AlphaImagerTM 1220 Documentation and Analysis System, AlphaImager Innotech Corporation). Each set of PCR performed was controlled negatively using a reaction containing all the PCR components except for template DNA and positively using a reaction containing OxB DNA as the template. The primer pairs used were Oxf-6/Oxf-7 for O. formigenes and Bac-1/Bac-2 for bacterial DNA. 2.6. Southern blot analysis Southern blotting was performed according to Sidhu et al. with some modi®cation [11]. The size separated PCR products were transferred onto positively charged nylon membranes (Boehringer Mannheim GmBH, Indianapolis, IN) followed by drying and UV cross-linking. The Oxf-5 probe-sequence was end labeled using g[32 P] dATP and T4 polynucleotide kinase. The membranes were prehybridized for 60 min at 58 8C in hybridization solution (1% Blocking reagent, 5 X SSC, 0.1% Sarkosyl, 0.02% SDS) and subsequently hybridized for 10±12 h at 58 8C in fresh hybridization solution containing the labeled Oxf-5 probe. Blots were washed under stringent conditions and exposed to X-Omat XK-5 ®lm (Kodak) using an intensifying screen. The autoradiographs were analysed for the presence or absence of O. formigenes. 2.7. Urinary oxalate estimation Twenty four-hour urine samples were collected from patients and normal individuals in 10 ml concentrated HCl as acid preservative. Urinary oxalate was assayed by oxalate oxidase method using Sigma Diagnostics Kits.
2.4. Oligonucleotides The genus speci®c oligonucleotides for O. formigenes and Bac primers used for PCR were purchased from GIBCO-BRL, Bethesda, MD, USA. The oligonucleotide sequences used are as follows: Oxf-6 Oxf-7 Bac-1 Bac-2 Oxf-5
AATGTAGAGTTGACTGA TTGATGCTGTTGATACG AACTGGAGGAAGGTGGGGAT AGGAGGTGATCCAACCGCA GACAATGTAGAGTTGACTGATGGCTTTCATG
Fig. 1. Detection of O. formigenes using a genus-specific primer (Oxf-6/ Oxf-7). Lanes 1±5, PCR products of normal individuals showing presence of the bacteria. Lane 6, 100 bp DNA ladder. Lanes 7±9, PCR products of calcium oxalate stone formers showing absence of the bacteria. Lane 10, negative control. Lane 11, positive control.
320
R. Kumar et al. / European Urology 41 (2002) 318±322
Fig. 4. PCR amplification of bacterial DNA in all stool samples used for the detection of O. formigenes using universal bacterial primers Bac-1/Bac-2. Lanes 1±13, show presence of bacterial DNA. Lane M, 100 bp DNA ladder.
Fig. 2. (a) PCR amplification of DNA from stool samples of calcium oxalate stone patients using Oxf-6/Oxf-7 primers. Lane M, 100 bp DNA ladder. Lanes 1±4, absence of O. formigenes. Lanes 5 and 6, presence of O. formigenes. Lane 7, negative control. Lane 8, positive control. (b) Southern blot analysis of the above PCR products using genus-specific oligonucleotide g32 P-labelled probe Oxf-5.
3. Results The 63 patients analyzed in the present study were calcium oxalate stone formers. This was con®rmed by our X-ray crystallographic studies (not reported). In the present study, 63 idiopathic calcium oxalate urolithiasis patients and 40 normal individuals residing
Fig. 3. Bar diagram showing percentage colonization of O. formigenes in different groups of stone formers. Control, no stone episode; A, one stone episode; B, two stone episodes; C, three or greater than three stone episodes.
in North India were tested for the presence of O. formigenes (Fig. 1). Out of 63 patients, 17 (30%) tested positive for O. formigenes (Fig. 2a and b). Out of 31 patients with one stone episode 11 (35.4%) and ®ve out of 14 (35.7%) with two stone episodes tested positive for O. formigenes (Fig. 3). In the last group of patients with three or more stone episodes, only one out of 18 tested positive (5.6%) (Fig. 3). None of others showed any ampli®cation with Oxf primers. This indicated that there were no colonies of O. formigenes in these patients.
Fig. 5. Bar diagram showing the urinary oxalate levels in different groups of stone formers. Control, no stone episode; A, one stone episode; B, two stone episodes; C, three or greater than three stone episodes.
R. Kumar et al. / European Urology 41 (2002) 318±322
Amongst the 40 healthy volunteers who served as controls, 26 were positive for O. formigenes (65%). Southern blots performed for all individuals con®rmed the presence of the bacteria (Fig. 2b). The present data indicates an inverse relationship between colonization of O. formigenes and the number of recurrent calcium oxalate stone episodes (Fig. 3). To determine the suitability of our DNA preparations for O. formigenes detection, a set of universal primers (Bac-1/Bac-2) were used for PCR ampli®cation. DNA from all stool samples tested for O. formigenes showed ampli®cation of a 370 bp product with Bac-1/Bac-2 primers (Fig. 4), thereby ruling out false negativity. The oxalate concentrations measured in 24 h urine of all urolithiasis patients showed that 60% of them were hyperoxalurics. It was observed that the urinary oxalate levels were higher in the non-colonized patients as compared to those colonized with O. formigenes in all groups of stone formers (Fig. 5). The increase in oxalate levels in stone formers when compared to normal individuals was statistically highly signi®cant (P < 0:001). However, the increase in oxalate levels in non-colonized patients when compared to colonized patients was not signi®cant (P > 0:05). 4. Discussion Urolithiasis is a common urinary tract problem in North India where approximately 80% patients have calcium oxalate stones [2]. Hyperoxaluria, the major risk factor in these patients can be due to a high absorption of oxalate from the GI tract [12]. Oxalate has been shown to be absorbed all along the GI tract resulting in 10±50% contribution of dietary oxalate to the urinary pool [13]. Hesse et al. [14] have demonstrated a signi®cant increase in the intestinal absorption of oxalate in recurrent calcium oxalate stone formers using a 13 C-oxalate absorption test. They also showed a signi®cant correlation between intestinal oxalate absorption and oxalate excretion in 24 h urine among the stone formers. The intestinal anaerobic bacteria O. formigenes was reported to utilize oxalate as an exclusive energy source. Its role in regulating oxalic acid absorption in humans has attracted increasing attention in recent years [5]. The major breakthrough however, has been possible due to introduction of DNA-based methods for the detection of O. formigenes in the faeces, because of dif®culties in culturing anaerobic bacteria by standard microbiological methods [15]. Using speci®c primers of oxc gene, Sidhu et al. [15,16] developed a PCR
321
method, which can now be used to detect the presence of O. formigenes by routine laboratory protocols. In the present study, 65% of healthy individuals were observed to be colonized with these bacteria whereas in the ®rst and second time stone formers the colonization was in the range of 31±36%. In patients with three or greater than three episodes of stone formation, the colonization was only 5.6%. In our study, the stone formers showed a signi®cantly low percentage of O. formigenes colonization (P < 0:01) when compared to normal individuals. So, it is presumed that the absence of O. formigenes might have led to the formation of stones. Amongst the stone formers, noncolonized patients had higher levels of urinary oxalate in all the groups as compared to the colonized although the difference was not signi®cant. The absence of O. formigenes from the gut might have increased the urinary oxalate levels in the stone formers. In our population the absence of O. formigenes from the GI tract could be due to extensive consumption of antibiotics that are generously prescribed in common infections prevailing in the region. Antibiotics and other high dose drugs are mainly responsible for decolonization [17]. It is not known whether O. formigenes can reestablish itself naturally or what the ideal conditions might be that would allow recolonization in humans. In addition, certain environmental and genetic factors could also contribute to the absence of the bacteria. Therefore, ®rst time stone formers particularly those lacking O. formigenes may be advised low oxalate foods and judicious use of antibiotics. Introduction of oxalate degradation either through colonization with O. formigenes or through enzyme replacement therapy should have a distinct effect on lowering absorption of oxalate, ®ndings that could have an effective application in preventing urolithiasis. Also in humans, these bacteria are not present at birth but slowly colonize early in life [15]. Many epidemiological studies [15±17] including ours suggest a direct correlation between the number of recurrent stone formers and lack of O. formigenes colonization. Acknowledgements This work was supported by a grant by Uttar Pradesh Council of Science and Technology. Critical discussion and constructive suggestions through out the studies by Dr. B. Mittal, Additional Professor, Genetics is greatly acknowledged. One of the authors (MM) acknowledges the Council of Scienti®c and Industrial Research for providing research fellowship.
322
R. Kumar et al. / European Urology 41 (2002) 318±322
References [1] Leiske JC, Deganello S. Nucleation, adhesion and internalization of calcium containing urinary crystals by renal cells. J Am Soc Nephrol 1999;10:S422±9. [2] Ahalawat R, Goel MC, Elhence A. Upper urinary tract stone analysis using X-ray diffraction: results from a tertiary referral centre in Northern India. Natl Med J India 1996;9(1):10±2. [3] Pernminger G.M. Medical management of urinary calculus disease. Ptl, Pathogenesis and evaluation AUA update series 1995;14. [4] Allison MJ, Dawson KA, Mayberry WR, Foss JG. Oxalobacter formigenes gen. nov. sp nov: oxalate degrading bacteria that inhabit the gastrointestinal tract. Arch Microbiol 1985;141:1±7. [5] Doane LA, Liebman M, Caldwell DR. Microbial oxalate degradation: effects on oxalate and calcium balance in humans. Nutr Res 1989;9: 957±64. [6] Allison MJ, Cook HM, Milne DB, Gallaher S, Clayman RV. Oxalate degradation by gastrointestinal bacteria from humans. J Nutr 1986;116:455±60. [7] Allison MJ, Daniel SL, Cornick NA. Oxalate degrading bacteria. In: Khan S, editor. Calcium oxalate in biological systems. Boca Raton, FL, CRC Press, 1996, p. 131±67. [8] Kleinshmidt K, Mahmann A, Hautmann R. In: Ryall R, Marshall VR, Rofe AM, Smith LH, Walher VR, editors. Anaerobic oxalate degrading bacteria in the gut decreases fecal and urinary oxalate concentration in stone formers. Uroloithiais II, New York, Plenum Press, 1993, p. 439±41. [9] Sidhu H, Hoppe B, Hesse A, Tenbrock K, Bromme S, Dietchel E, et al. Absence of Oxalobacter formigenes in cystic ®brosis patients: a risk factor for hyperoxaluria. Lancet 1998;352:1026±9.
[10] Stacy-Phipps S, Mecca JJ, Weiss JB. Multiplex PCR assay and simple preparation method for stool specimens detect enterotoxigenic E. coli DNA during course of infection. J Clin Microbiol 1995;33:1054±9. [11] Sidhu H, Allison M, Peck AB. Identi®cation and classi®cation of Oxalobacter formigenes strains by using oligonucleotide probes and primers. J Clin Microbiol 1997;35:350±3. [12] Earnest DL. Enteric hyperoxaluria. Adv Intern Med 1979;25:407±27. [13] Hatch M, Freel RW. Oxalate transport across intestinal and renal epithelia. In: Khan S, editor. Calcium oxalate in Biological Systems, Boca Raton, FL, CRC Press, 1996, p. 217±38. [14] Hesse A, Schneeberger W, Engfeld S, Von Unruh GE, Sauerbruch T. Intestinal hyperabsorption of oxalate in calcium oxalate stone formers: application of a new test with 13 C2 oxalate. J Am Soc Nephrol 1999;10:S329±33. [15] Sidhu H, Enatska L, Ogden S, Williams WN, Allison MJ, Peck AB. Evaluating children in the Ukraine for colonization with the intestinal bacterium Oxalobacter formigenes, using a polymerase chain reaction-based detection system. Mol Diagn 1997;2:89±97. [16] Sidhu H, Holmes RP, Allison MJ, Peck AB. Direct quanti®cation of the enteric bacterium Oxalobacter formigenes in human fecal samples by quantitative competitive-template PCR. J Clin Microbiol 1999;37(5):1503±9. [17] Sidhu H, Schmidt ME, Cornelius JG, Thamilselvan S, Khan SR, Hesse A, et al. Direct correlation between hyperoxaluria/oxalate stone disease and the absence of the gastrointestinal tract-dwelling bacterium Oxalobacter formigenes: possible prevention by gut recolonization or enzyme replacement therapy. J Am Soc Nephrol 1999;10:S334±40.
European Urology 41 (2002) 318±322
Role of Oxalobacter formigenes in Calcium Oxalate Stone Disease: A Study from North India R. Kumara, M. Mukherjeeb, M. Bhandaria, A. Kumara, H. Sidhuc, R.D. Mittala,* a
Department of Urology, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Raebareli Road, Lucknow-226014, Uttar Pradesh, India Department of Genetics, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow-226014, Uttar Pradesh,, India c Division of Oxalate Research, Ixion Biotechnology, Alachua, FL, USA b
Accepted 8 January 2002
Abstract Objective: The present study was performed to detect the presence of an oxalate degrading bacteria Oxalobacter formigenes in the GI tract of calcium oxalate stone patients and normal individuals from North India. Furthermore, the possible relationship of this bacterium with number of stone episodes in this part of the world was also studied. The correlation of the presence or absence of O. formigenes with the urinary oxalate levels was evaluated. Methods: DNA was extracted from the stool samples of 63 calcium oxalate stone formers and 40 normal individuals. Polymerase chain reaction (PCR) was performed using genus speci®c primers for O. formigenes. The presence of which was con®rmed by Southern blotting. Urinary oxalate levels were tested in each patient. Results: As shown by PCR and Southern blotting, O. formigenes was present in 65% of normal individuals and in 30% of calcium oxalate stone formers. In patients with three or greater than three stone episodes colonies were present only in 5.6% of patients. Oxalate excretion was less in patients colonized with O. formigenes as compared to those with no colonization. Conclusion: In North Indian population the absence of O. formigenes can lead to a signi®cant increase in the risk of absorptive hyperoxaluria and resultant recurrent calcium oxalate stone episodes. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Calcium oxalate stones; Hyperoxaluria; Oxalobacter formigenes; Recurrent urolithiasis
1. Introduction Recurrence of urinary calculi is one of the biggest challenges faced by the urologists of today. Oxalate is the major component of majority of renal stones and is a powerful crystallization driving factor present in the urine, retention of which enhances cell injury and causes early stages of lithogenesis. A moderate increase in urinary oxalate levels result in calcium oxalate crystallization [1]. In North India more than 80% of urinary calculi are calcium oxalate stones alone or calcium oxalate mixed with calcium phosphate [2]. Lifetime recurrence of urolithiasis is as *
Corresponding author. Tel.: 91-522-440004-8x2116; Fax: 91-522-440017. E-mail addresses: [email protected], [email protected] (R.D. Mittal).
high as 80% [3]. Therefore, an extensive metabolic evaluation and medical management to reduce the recurrence of this disease is currently being emphasized. Oxalobacter formigenes is a recently identi®ed nonpathogenic, anaerobic bacterium colonizing the gastrointestinal tract of vertebrates including humans [4]. These bacteria have a symbiotic relationship with their host by regulating oxalic acid absorption in the intestine as well as maintaining oxalate levels in plasma and urine [5]. In normal individuals O. formigenes may colonize up to 5 108 CFU/g (wet wt.) of colon contents [6,7]. Colonization with these bacteria has the capacity to degrade 0.5±1.0 g of oxalate per day [7]. Absence of O. formigenes and low rate of oxalate degradation has been reported by Kleinshmidt et al. [8]. These bacteria were also reported to be absent in cystic ®brosis patients [9].
0302-2838/02/$ ± see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 3 0 2 - 2 8 3 8 ( 0 2 ) 0 0 0 4 0 - 4
R. Kumar et al. / European Urology 41 (2002) 318±322
In the present study, we have evaluated the relationship between the absence of O. formigenes with calcium oxalate urolithiasis in North Indian population. We have also studied the association of this bacterium with recurrence of oxalate stones and urinary oxalate levels. 2. Materials and methods 2.1. Selection of patients Idiopathic calcium oxalate urolithiasis patients registered between 1998±2001 in the Urology Department of Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow, India constituted the study material. Complete clinical evaluation such as screening of urinary tract calculi by plain X-ray and ultrasound of abdomen (KUB) region was done by our urologists. A total of 63 patients (57 males and 6 females) ranging in age from 9 to 68 years and 40 normal, healthy volunteers (31 males and 9 females) ranging in age from 7 to 40 years participated in the study. Of the 63 patients subjected to Polymerase chain reaction (PCR) for O. formigenes and urinary oxalate levels, 31 (49%) had single stone episode, 14 (22%) had two stone episodes and 18 (28.57%) had three or more stone episodes. The patients with different stone histories were designated as A, B and C respectively. The stones from patients were analyzed by X-ray crystallography. 2.2. Collection of human stool samples Fresh stool samples were collected from each participant with consent during their routine hospital admission or visit to the Urology OPD. Approximately 20±30 mg stool was collected as fecal swab using the fecal collection and transport system with Cary Blair media (Becton Dickinson, NJ USA). Fecal samples were collected from the individuals who were not on antibiotics for atleast 4 weeks prior to sample collection. The study was approved by institutional research and ethical committee. 2.3. DNA extraction Bacterial DNA was isolated directly from fresh stool within 2± 3 h of sample collection using the procedure of Stacy-Phipps et al. [10] with slight modi®cations. Approximately 20±25 mg of stool was suspended in 0.7 ml of phosphate buffered saline and centrifuged at 4000 rpm for 1 min to remove the debris. The supernatant was centrifuged at 10,000 rpm for 10 min. The bacterial pellet was resuspended in 0.7 ml of binding lysis buffer (5.3 M guanidine thiocyanate, 10 mM DTT, 1% Tween 20, 0.3 M sodium acetate and 50 mM sodium citrate) and incubated at 65 8C for 15 min. Glass matrix, 50 ml (Bangalore Genei, India) was added to absorb DNA. The DNA was eluted from the glass beads with 10 mM TE buffer after a brief incubation at 50 8C.
319
2.5. Polymerase chain reaction (PCR) PCR ampli®cation was performed in 50 ml reaction mixtures containing 150±200 ng DNA, 200 mM dNTPs, 1 mM of each primer, PCR buffer and 1.5 U Taq polymerase (Genetix). After initial denaturation (94 8C for 5 min), PCR was carried out for 10 cycles of 94 8C for 1 min, 59 8C for 1 min and 72 8C for 1 min followed by another 30 cycles with an annealing temperature of 55 8C for 1 min in thermocycler (Perkin Elmer 2400). The ampli®ed PCR products were electrophorized in 1.2% agarose gels, visualized with UV light and documented (AlphaImagerTM 1220 Documentation and Analysis System, AlphaImager Innotech Corporation). Each set of PCR performed was controlled negatively using a reaction containing all the PCR components except for template DNA and positively using a reaction containing OxB DNA as the template. The primer pairs used were Oxf-6/Oxf-7 for O. formigenes and Bac-1/Bac-2 for bacterial DNA. 2.6. Southern blot analysis Southern blotting was performed according to Sidhu et al. with some modi®cation [11]. The size separated PCR products were transferred onto positively charged nylon membranes (Boehringer Mannheim GmBH, Indianapolis, IN) followed by drying and UV cross-linking. The Oxf-5 probe-sequence was end labeled using g[32 P] dATP and T4 polynucleotide kinase. The membranes were prehybridized for 60 min at 58 8C in hybridization solution (1% Blocking reagent, 5 X SSC, 0.1% Sarkosyl, 0.02% SDS) and subsequently hybridized for 10±12 h at 58 8C in fresh hybridization solution containing the labeled Oxf-5 probe. Blots were washed under stringent conditions and exposed to X-Omat XK-5 ®lm (Kodak) using an intensifying screen. The autoradiographs were analysed for the presence or absence of O. formigenes. 2.7. Urinary oxalate estimation Twenty four-hour urine samples were collected from patients and normal individuals in 10 ml concentrated HCl as acid preservative. Urinary oxalate was assayed by oxalate oxidase method using Sigma Diagnostics Kits.
2.4. Oligonucleotides The genus speci®c oligonucleotides for O. formigenes and Bac primers used for PCR were purchased from GIBCO-BRL, Bethesda, MD, USA. The oligonucleotide sequences used are as follows: Oxf-6 Oxf-7 Bac-1 Bac-2 Oxf-5
AATGTAGAGTTGACTGA TTGATGCTGTTGATACG AACTGGAGGAAGGTGGGGAT AGGAGGTGATCCAACCGCA GACAATGTAGAGTTGACTGATGGCTTTCATG
Fig. 1. Detection of O. formigenes using a genus-specific primer (Oxf-6/ Oxf-7). Lanes 1±5, PCR products of normal individuals showing presence of the bacteria. Lane 6, 100 bp DNA ladder. Lanes 7±9, PCR products of calcium oxalate stone formers showing absence of the bacteria. Lane 10, negative control. Lane 11, positive control.
320
R. Kumar et al. / European Urology 41 (2002) 318±322
Fig. 4. PCR amplification of bacterial DNA in all stool samples used for the detection of O. formigenes using universal bacterial primers Bac-1/Bac-2. Lanes 1±13, show presence of bacterial DNA. Lane M, 100 bp DNA ladder.
Fig. 2. (a) PCR amplification of DNA from stool samples of calcium oxalate stone patients using Oxf-6/Oxf-7 primers. Lane M, 100 bp DNA ladder. Lanes 1±4, absence of O. formigenes. Lanes 5 and 6, presence of O. formigenes. Lane 7, negative control. Lane 8, positive control. (b) Southern blot analysis of the above PCR products using genus-specific oligonucleotide g32 P-labelled probe Oxf-5.
3. Results The 63 patients analyzed in the present study were calcium oxalate stone formers. This was con®rmed by our X-ray crystallographic studies (not reported). In the present study, 63 idiopathic calcium oxalate urolithiasis patients and 40 normal individuals residing
Fig. 3. Bar diagram showing percentage colonization of O. formigenes in different groups of stone formers. Control, no stone episode; A, one stone episode; B, two stone episodes; C, three or greater than three stone episodes.
in North India were tested for the presence of O. formigenes (Fig. 1). Out of 63 patients, 17 (30%) tested positive for O. formigenes (Fig. 2a and b). Out of 31 patients with one stone episode 11 (35.4%) and ®ve out of 14 (35.7%) with two stone episodes tested positive for O. formigenes (Fig. 3). In the last group of patients with three or more stone episodes, only one out of 18 tested positive (5.6%) (Fig. 3). None of others showed any ampli®cation with Oxf primers. This indicated that there were no colonies of O. formigenes in these patients.
Fig. 5. Bar diagram showing the urinary oxalate levels in different groups of stone formers. Control, no stone episode; A, one stone episode; B, two stone episodes; C, three or greater than three stone episodes.
R. Kumar et al. / European Urology 41 (2002) 318±322
Amongst the 40 healthy volunteers who served as controls, 26 were positive for O. formigenes (65%). Southern blots performed for all individuals con®rmed the presence of the bacteria (Fig. 2b). The present data indicates an inverse relationship between colonization of O. formigenes and the number of recurrent calcium oxalate stone episodes (Fig. 3). To determine the suitability of our DNA preparations for O. formigenes detection, a set of universal primers (Bac-1/Bac-2) were used for PCR ampli®cation. DNA from all stool samples tested for O. formigenes showed ampli®cation of a 370 bp product with Bac-1/Bac-2 primers (Fig. 4), thereby ruling out false negativity. The oxalate concentrations measured in 24 h urine of all urolithiasis patients showed that 60% of them were hyperoxalurics. It was observed that the urinary oxalate levels were higher in the non-colonized patients as compared to those colonized with O. formigenes in all groups of stone formers (Fig. 5). The increase in oxalate levels in stone formers when compared to normal individuals was statistically highly signi®cant (P < 0:001). However, the increase in oxalate levels in non-colonized patients when compared to colonized patients was not signi®cant (P > 0:05). 4. Discussion Urolithiasis is a common urinary tract problem in North India where approximately 80% patients have calcium oxalate stones [2]. Hyperoxaluria, the major risk factor in these patients can be due to a high absorption of oxalate from the GI tract [12]. Oxalate has been shown to be absorbed all along the GI tract resulting in 10±50% contribution of dietary oxalate to the urinary pool [13]. Hesse et al. [14] have demonstrated a signi®cant increase in the intestinal absorption of oxalate in recurrent calcium oxalate stone formers using a 13 C-oxalate absorption test. They also showed a signi®cant correlation between intestinal oxalate absorption and oxalate excretion in 24 h urine among the stone formers. The intestinal anaerobic bacteria O. formigenes was reported to utilize oxalate as an exclusive energy source. Its role in regulating oxalic acid absorption in humans has attracted increasing attention in recent years [5]. The major breakthrough however, has been possible due to introduction of DNA-based methods for the detection of O. formigenes in the faeces, because of dif®culties in culturing anaerobic bacteria by standard microbiological methods [15]. Using speci®c primers of oxc gene, Sidhu et al. [15,16] developed a PCR
321
method, which can now be used to detect the presence of O. formigenes by routine laboratory protocols. In the present study, 65% of healthy individuals were observed to be colonized with these bacteria whereas in the ®rst and second time stone formers the colonization was in the range of 31±36%. In patients with three or greater than three episodes of stone formation, the colonization was only 5.6%. In our study, the stone formers showed a signi®cantly low percentage of O. formigenes colonization (P < 0:01) when compared to normal individuals. So, it is presumed that the absence of O. formigenes might have led to the formation of stones. Amongst the stone formers, noncolonized patients had higher levels of urinary oxalate in all the groups as compared to the colonized although the difference was not signi®cant. The absence of O. formigenes from the gut might have increased the urinary oxalate levels in the stone formers. In our population the absence of O. formigenes from the GI tract could be due to extensive consumption of antibiotics that are generously prescribed in common infections prevailing in the region. Antibiotics and other high dose drugs are mainly responsible for decolonization [17]. It is not known whether O. formigenes can reestablish itself naturally or what the ideal conditions might be that would allow recolonization in humans. In addition, certain environmental and genetic factors could also contribute to the absence of the bacteria. Therefore, ®rst time stone formers particularly those lacking O. formigenes may be advised low oxalate foods and judicious use of antibiotics. Introduction of oxalate degradation either through colonization with O. formigenes or through enzyme replacement therapy should have a distinct effect on lowering absorption of oxalate, ®ndings that could have an effective application in preventing urolithiasis. Also in humans, these bacteria are not present at birth but slowly colonize early in life [15]. Many epidemiological studies [15±17] including ours suggest a direct correlation between the number of recurrent stone formers and lack of O. formigenes colonization. Acknowledgements This work was supported by a grant by Uttar Pradesh Council of Science and Technology. Critical discussion and constructive suggestions through out the studies by Dr. B. Mittal, Additional Professor, Genetics is greatly acknowledged. One of the authors (MM) acknowledges the Council of Scienti®c and Industrial Research for providing research fellowship.
322
R. Kumar et al. / European Urology 41 (2002) 318±322
References [1] Leiske JC, Deganello S. Nucleation, adhesion and internalization of calcium containing urinary crystals by renal cells. J Am Soc Nephrol 1999;10:S422±9. [2] Ahalawat R, Goel MC, Elhence A. Upper urinary tract stone analysis using X-ray diffraction: results from a tertiary referral centre in Northern India. Natl Med J India 1996;9(1):10±2. [3] Pernminger G.M. Medical management of urinary calculus disease. Ptl, Pathogenesis and evaluation AUA update series 1995;14. [4] Allison MJ, Dawson KA, Mayberry WR, Foss JG. Oxalobacter formigenes gen. nov. sp nov: oxalate degrading bacteria that inhabit the gastrointestinal tract. Arch Microbiol 1985;141:1±7. [5] Doane LA, Liebman M, Caldwell DR. Microbial oxalate degradation: effects on oxalate and calcium balance in humans. Nutr Res 1989;9: 957±64. [6] Allison MJ, Cook HM, Milne DB, Gallaher S, Clayman RV. Oxalate degradation by gastrointestinal bacteria from humans. J Nutr 1986;116:455±60. [7] Allison MJ, Daniel SL, Cornick NA. Oxalate degrading bacteria. In: Khan S, editor. Calcium oxalate in biological systems. Boca Raton, FL, CRC Press, 1996, p. 131±67. [8] Kleinshmidt K, Mahmann A, Hautmann R. In: Ryall R, Marshall VR, Rofe AM, Smith LH, Walher VR, editors. Anaerobic oxalate degrading bacteria in the gut decreases fecal and urinary oxalate concentration in stone formers. Uroloithiais II, New York, Plenum Press, 1993, p. 439±41. [9] Sidhu H, Hoppe B, Hesse A, Tenbrock K, Bromme S, Dietchel E, et al. Absence of Oxalobacter formigenes in cystic ®brosis patients: a risk factor for hyperoxaluria. Lancet 1998;352:1026±9.
[10] Stacy-Phipps S, Mecca JJ, Weiss JB. Multiplex PCR assay and simple preparation method for stool specimens detect enterotoxigenic E. coli DNA during course of infection. J Clin Microbiol 1995;33:1054±9. [11] Sidhu H, Allison M, Peck AB. Identi®cation and classi®cation of Oxalobacter formigenes strains by using oligonucleotide probes and primers. J Clin Microbiol 1997;35:350±3. [12] Earnest DL. Enteric hyperoxaluria. Adv Intern Med 1979;25:407±27. [13] Hatch M, Freel RW. Oxalate transport across intestinal and renal epithelia. In: Khan S, editor. Calcium oxalate in Biological Systems, Boca Raton, FL, CRC Press, 1996, p. 217±38. [14] Hesse A, Schneeberger W, Engfeld S, Von Unruh GE, Sauerbruch T. Intestinal hyperabsorption of oxalate in calcium oxalate stone formers: application of a new test with 13 C2 oxalate. J Am Soc Nephrol 1999;10:S329±33. [15] Sidhu H, Enatska L, Ogden S, Williams WN, Allison MJ, Peck AB. Evaluating children in the Ukraine for colonization with the intestinal bacterium Oxalobacter formigenes, using a polymerase chain reaction-based detection system. Mol Diagn 1997;2:89±97. [16] Sidhu H, Holmes RP, Allison MJ, Peck AB. Direct quanti®cation of the enteric bacterium Oxalobacter formigenes in human fecal samples by quantitative competitive-template PCR. J Clin Microbiol 1999;37(5):1503±9. [17] Sidhu H, Schmidt ME, Cornelius JG, Thamilselvan S, Khan SR, Hesse A, et al. Direct correlation between hyperoxaluria/oxalate stone disease and the absence of the gastrointestinal tract-dwelling bacterium Oxalobacter formigenes: possible prevention by gut recolonization or enzyme replacement therapy. J Am Soc Nephrol 1999;10:S334±40.