- Email: [email protected]
Role of the LIM domains in DNA recognition by the Lhx3 neuroendocrine transcription factor
Gene 277 (2001) 239–250 www.elsevier.com/locate/gene
Role of the LIM domains in DNA recognition by the Lhx3 neuroendocrine transcription factor JeAnne L. Bridwell, Jeffrey R. Price, Gretchen E. Parker, Amy McCutchan Schiller, Kyle W. Sloop, Simon J. Rhodes* Department of Biology, Indiana University-Purdue University Indianapolis, 723 West Michigan Street, Indianapolis, IN 46202-5132, USA Received 18 June 2001; received in revised form 20 August 2001; accepted 4 September 2001 Received by A.J. Van Wijnen
Abstract LIM homeodomain transcription factors regulate many aspects of development in multicellular organisms. Such factors contain two LIM domains in their amino terminus and a DNA-binding homeodomain. To better understand the mechanism of gene regulation by these proteins, we studied the role of the LIM domains in DNA interaction by Lhx3, a protein that is essential for pituitary development and motor neuron specification in mammals. By site selection, we demonstrate that Lhx3 binds at high affinity to an AT-rich consensus DNA sequence that is similar to sequences located within the promoters of some pituitary hormone genes. The LIM domains reduce the affinity of DNA binding by Lhx3, but do not affect the specificity. Lhx3 preferentially binds to the consensus site as a monomer with minor groove contacts. The Lhx3 binding consensus site confers Lhx3-dependent transcriptional activation to heterologous promoters. Further, DNA molecules containing the consensus Lhx3 binding site are bent to similar angles in complexes containing either wild type Lhx3 or Lhx3 lacking LIM domains. These data are consistent with Lhx3 having the properties of an architectural transcription factor. We also propose that there are distinct classes of LIM homeodomain transcription factors in which the LIM domains play different roles in modulating interactions with DNA sites in target genes. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Homeodomain; Pituitary; Alpha glycoprotein subunit; Growth; Prolactin
1. Introduction DNA-binding transcription factors regulate gene expression using multiple biochemical strategies. These include the assembly of proteins required for RNA synthesis, the recruitment of coactivator or corepressor proteins that alter the accessibility of local chromatin, the recruitment of enzymes that modify DNA, and alteration of DNA topology to facilitate transcriptional activation or repression by other proteins. To mediate these activities, transcription factors typically contain one or more DNA-binding domains and other domains that either modulate protein/DNA interactions or that mediate the function of the transcription factors. The human genome encodes over 250 homeodomain Abbreviations: aGSU, alpha glycoprotein subunit; EMSA, electrophoretic mobility shift assay; GH, growth hormone; GST, glutathione-S-transferase; HD, homeodomain; Lhx3, LIM homeobox gene 3; LIM-HD, LIM homeodomain; PCR, polymerase chain reaction; PRL, prolactin; TSH, thyroid-stimulating hormone * Corresponding author. Tel.: 11-317-278-1797; fax: 11-317-274-2846. E-mail address: [email protected] (S.J. Rhodes).
(HD) transcription factors that serve diverse gene regulatory roles in development. The HD is a DNA-binding domain found in proteins that often contain other structural features. Members of the LIM homeodomain (LIM-HD) subfamily contain two LIM domains in addition to a HD. The LIM domain (named after the LIN-11, Isl-1, and MEC-3 LIMHD factors) forms a zinc-coordinated finger-like structure that is found in many types of proteins including the LIMHD transcription factors, and non-DNA-binding cytoskeletal factors, intracellular signaling proteins, and transcriptional coactivators (reviewed in Bach, 2000). LIM-HD proteins are key regulators of developmental pathways in many systems (reviewed in Hobert and Westphal, 2000). For example, Lim1/Lhx1 is essential for the formation of anterior head structures in mice and for leg and antennal development in flies; Lhx2/LH-2 is required for forebrain, eye, and erythrocyte development; Lhx4/Gsh-4 is necessary for central nervous system and pituitary development; defects in the LMX1b gene cause skeletal malformations and kidney disorders in patients with nail patella syndrome; and the Isl-1 gene is required for pancreatic cell specification and motor neuron differentiation (reviewed in Hobert
0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(01)00704-1
240
J.L. Bridwell et al. / Gene 277 (2001) 239–250
and Westphal, 2000). The LIM domains of LIM-HD factors appear to serve many functions, including mediating interactions with partner proteins such as NLI/Ldb1, Pit-1, RLIM, MRG1, and SLB (Glenn and Maurer, 1999; Howard and Maurer, 2000; and reviewed in Bach, 2000). In addition, the LIM domains can confer trans-activation function (Glenn and Maurer, 1999) and sometimes can modulate the function of LIM-HD holoproteins by repressing DNA binding (reviewed in Hobert and Westphal, 2000). Lhx3 (also known as LIM-3 or P-Lim) is a conserved LIM-HD transcription factor that has been identified in mammals, birds, fish, and insects (see Sloop et al., 1999 and references therein). Mammalian Lhx3 genes encode two protein isoforms with different amino termini: a transcriptionally active isoform, Lhx3a, and an inactive isoform, Lhx3b (Sloop et al., 1999). The actions of Lhx3 and other HD transcription factors are required for pituitary gland development in mammals. Lhx3 can activate the regulatory regions of pituitary genes, including those encoding hormones such as the alpha glycoprotein subunit (aGSU), prolactin (PRL), and thyroid-stimulating hormone beta (TSHb), and transcription factors such as Pit-1. Gene targeting experiments in mice have demonstrated that Lhx3, and the related Lhx4 gene, are required for the early structural events that mark pituitary organogenesis and for differentiation of four of the five hormone-secreting anterior pituitary cell types (Sheng et al., 1997). In addition, the actions of these genes are essential for the specification of motor neuron subtypes in the developing nervous system (Sharma et al., 1998). Recently, human patients with mutations in the Lhx3 gene have been described (Netchine et al., 2000). These growth retarded patients exhibit combined pituitary hormone deficiency, featuring deficiencies of PRL, TSH, growth hormone, follicle-stimulating hormone, and luteinizing hormone. They also have anteverted shoulders associated with restriction of cervical spine rotation. Two types of mutations were described: a missense mutation that alters one conserved amino acid in the second LIM domain and an intragenic deletion that results in a truncated protein lacking the HD (Netchine et al., 2000). Molecular analyses have demonstrated that these mutations in Lhx3 impair the activation of pituitary hormone genes (Sloop et al., 2001a; Howard and Maurer, 2001). In this study, we investigated the role of the LIM domains in DNA interaction by Lhx3a. Lhx3 binds at high affinity to an AT-rich DNA sequence as a monomer with minor groove contacts. The LIM domains reduce the affinity of DNA binding by Lhx3 but do not affect the specificity. The identified Lhx3 binding consensus site mediates Lhx3-dependent transcriptional activation. Lhx3 binding to this consensus binding site is associated with significant DNA bending in a LIM-independent fashion. These data are consistent with the LIM domains of specific LIM-HD transcription factors exerting distinct roles in regulating the interaction of the HD with target DNA elements.
2. Materials and methods 2.1. Preparation of recombinant Lhx3 proteins Most experiments were performed with murine Lhx3a (mLhx3) proteins; some also were performed with porcine Lhx3a (pLhx3) molecules. The mLhx3 and pLhx3 proteins display .90% amino acid identity and are 99% identical in the LIM domains and homeodomain. Bacterial expression vectors for glutathione-S-transferase (GST)-pLhx3 and GST-pLhx3 fusion proteins lacking the LIM domains (DLhx3) have been described (Meier et al., 1999). Plasmids for GST-mLhx3 and GST-mDLhx3 fusion proteins (removing amino acids 1–151) were generated by cloning Bam HI/ Eco RI fragments of the mLhx3a cDNA into pGEX-KT. cDNA fragments were generated by the polymerase chain reaction (PCR) using the following oligonucleotides: 5 0 -cgggatccatgctgctagaagcagaactcg-3 0 , 5 0 cggaattcagcatggtctacttcatccagcc-3 0 (mLhx3) and 5 0 cgggatccaagcagcgagaagccgaggccac-3 0 , 5 0 ggaattccatatgcagcgagaagccgaggccaca-3 0 (Dm Lhx3). Constructs were confirmed by sequencing. Proteins were prepared as described (Meier et al., 1999). If required, proteins were released by thrombin cleavage in 50 mM Tris (pH 8.0), 150 mM NaCl, 2.5 mM CaCl2, 0.1% BME with 1.5 units of bovine serum thrombin for 3 h. Proteins were analyzed on 12% SDS-PAGE. 2.2. DNA binding site selection and electrophoretic mobility shift analysis A modification of described methods (Blackwell and Weintraub, 1990) was used. 50 ng of target binding oligonucleotide (5 0 -cgggctcgaggaggaggn20cccagcggccgccacgg3 0 ) was annealed to 900 ng of a primer (5 0 -ccgtggcggccg3 0 ) and radiolabeled double-stranded random DNA targets were generated by extension with Klenow enzyme in the presence of a 32P-dCTP. Electrophoretic mobility shift analysis (EMSA) then was performed using equivalent amounts of mLhx3 or DLhx3 GST fusion proteins and 500,000 cpm gel-purified DNA random target per reaction using conditions as described in Meier et al. (1999). Positive control reactions using the defined porcine aGSU promoter 2324 bp pituitary glycoprotein basal element (PGBE, Meier et al., 1999) were analyzed in parallel. Results were visualized by autoradiography of dried, fixed gels at 2808C with intensifying screens. The shifted complexes were excised and extracted in 0.5 M sodium acetate, 10 mM MgCl2, 1 mM EDTA, 0.1% SDS at 658C. DNA was recovered by phenol extraction and ethanol precipitation using glycogen as a carrier. Selected DNA was amplified by PCR using Expand HiFi polymerase (Roche) and appropriate oligonucleotides (cgggctcgaggaggagg, ccgtggcggccgctggg) with 30 cycles of 948C, 30 s; 608C, 30 s; 728C, 60 s and one cycle of 728C, 10 min. Purified PCR products were labeled using T4 polynucleotide kinase and g 32P-ATP and EMSA was repeated as above (round 2). Selection was
J.L. Bridwell et al. / Gene 277 (2001) 239–250
repeated for a total of five rounds. Selected DNA fragments were digested with Xho I and Not I, cloned into pBluescript KSII- (Stratagene, La Jolla, CA) and sequenced after rounds 3, 4 and 5. Individual sites then were retested for Lhx3 binding using EMSA assays. Sequences were aligned using DNA analysis software (DNAsis, Hitachi Software Engineering, South San Francisco, CA) and Lhx3 binding consensus (LBC) sequences determined. For DNA minor groove binding analysis, distamycin A and mithramycin A (Sigma) were added to EMSAs at 1.5 mM to 100 mM. Control reactions received vehicle alone. 2.3. Protein/DNA UV crosslinking DLhx3 protein was crosslinked to a bromodeoxyuridinesubstituted radiolabeled LBC probe prepared using the following oligonucleotide 5 0 - cgggctcgaggaggaggcagaaaattaattaattgtacccagcggccgccacgg-3 0 . The labeled probe then was gel purified. Binding reactions contained 1 mg of protein, 100,000 cpm of radiolabeled probe in 20 ml EMSA buffer. This mixture then was irradiated from above in a 96-well microtiter plate for 1 h using an UV transilluminator (,305 nm/7000 mW/cm 2). Following irradiation, 1 ml of 0.5 M CaCl2 and 1 U micrococcal nuclease was added at 378C for 30 min. Control reactions omitting key reagents or including DNAse I also were performed. An equal volume of 2 £ SDS sample buffer was added to each reaction and the mixtures were boiled for 5 min followed by electrophoresis through 12% SDS-PAGE with 14C-labeled protein molecular markers, The gels were dried at 658C and exposed to Kodak Biomax-MR film with intensifying screens at 2808C for 2 days.
241
aattgtaa-3 0 (LBC mutant 3), 2324 paGSU PGBE (5 0 -gatccggtacttagctaattaaatga-3 0 ), 5 0 -tgctgtaattaatcaaaat-3 0 (PRL 2205), and 5 0 -attttgcttccttacagca-3 0 (PRL 2205 mutant). 2.5. Transient transfection and luciferase assays Oligonucleotides representing LBC sequences to be tested for their ability to confer Lhx3-dependent transcription were directionally cloned as multimers into the Bam HI site of the 236 bp PRL minimal promoter/luciferase reporter gene (Sloop et al., 1999). The integrity of plasmids was confirmed by sequencing. In vitro cell culture and transfection were performed as described (Meier et al., 1999). All assays were performed in triplicate. Total cell protein was determined by the Bradford method (BioRad) and luciferase activity was normalized to protein concentration. 2.6. Stable cell lines and protein extracts Clonal cell lines expressing Lhx3 were generated by stable transfection of 293 cells with pcDNA3-Myc-pLhx3. 48 h following transfection, the cell culture medium was replaced with medium containing 300 mg/ml Geneticin (Life Technologies, Bethesda, MD). After 2 weeks of selection, individual clonal lines were picked using cloning rings. Protein extracts were prepared as described (Parker et al., 2000). Briefly, 1 £ 10 6 cells in 40 ml 10 mM Tris·Cl (pH 8.0), 150 mM NaCl were mixed with 40 ml 10 mM Tris (pH 8.0), 150 mM NaCl, 2 mM EDTA, 2 mM dithiothreitol, 0.4 mM PMSF, 0.2% Nonidet P-40, 40% glycerol and incubated on ice for 1 h with shaking. Cellular debris was removed by centrifugation for 10 min at 48C. Aliquots were quick frozen in liquid nitrogen and stored at 2808C.
2.4. Affinity and competition assays DNA binding affinities were determined by Scatchard plot analysis of quantitative EMSA competition experiments as described (Amendt et al., 1998). EMSA was performed as described above except that poly (dI·dC) was omitted in some experiments. Radiolabeled LBC probe was quantitated using PicoGreen double stranded DNA quantitation reagent (Molecular Probes, Eugene, OR). Unlabeled double-stranded LBC oligonucleotides were preincubated with 150 ng Lhx3 protein for 15 min prior to addition of the radiolabeled LBC probe at 100 pM. After electrophoresis, bound and free probe was quantitated in dried EMSA gels using a Storm 860 phosphorimager (Molecular Dynamics, Sunnyvale, CA) and used to establish a binding constant for Lhx3 and relative binding affinities for individual competitor oligonucleotides. Three independent experiments were performed. Competition EMSA assays of Lhx3/LBC interaction were performed using 100-fold unlabeled double-stranded oligonucleotides incubated after addition of probe. Oligonucleotides were as follows: 5 0 -gatcccagaaaattaattaattgtaa-3 0 (LBC), 5 0 -gatcccagaaaaggaattaattgtaa-3 0 (LBC mutant 1), 5 0 -gatcccagaaaattaaggaattgtaa-3 0 (LBC mutant 2), 5 0 -gatcccagaaaaggaagg-
2.7. Antisera Polyclonal antisera recognizing Lhx3 have been described (Parker et al., 2000). Ascites fluid containing the anti-myc epitope monoclonal antibody 9E10 was obtained from the University of Iowa Developmental Studies Hybridoma Bank. Antibodies were used in EMSA assays at dilutions of 1:20–1:200. 2.8. DNA bending analysis An oligonucleotide containing the LBC sequence (5 0 ctagacagaaaattaattaattgtat-3 0 ) was cloned into the Xba I site of the pBend2 plasmid (Kim et al., 1989) and confirmed by sequencing. pBend2-LBC plasmid then was digested with Bam HI, Mlu I, Bgl II, Nhe I, Spe I, or Xho I enzymes and LBC containing fragments were radiolabeled using Klenow enzyme in the presence of a 32P-dCTP and gel-purified. EMSA then was performed with Lhx3 or DLhx3 proteins as described above except that reaction products were separated using 10% (75:1) acrylamide gels. DNA bending angles were calculated by comparing the mobility of complexes with the LBC site positioned centrally in the probe with the
242
J.L. Bridwell et al. / Gene 277 (2001) 239–250
Fig. 1. Lhx3 selects an AT-rich binding site. (A) SDS-polyacrylamide gel analysis of GST-mouse Lhx3 (Lhx3) or GST-Lhx3 lacking the LIM domains (DLhx3). A Coomassie blue stain of the protein gel is shown. (B) Representative EMSA gel showing second round separation of selected DNA from a random oligonucleotide pool (p) during the site selection process. Complexes containing Lhx3 (closed arrow) and DLhx3 (open arrow) are indicated. Equivalent amounts of Lhx3 and DLhx3 were present in EMSA reactions. (C) EMSA gel showing third round separation of selected DNA. (D) Alignment of sites selected by Lhx3 after five rounds of selection. The frequency of nucleotides within the selected sites is given. Uppercase letters represent nucleotides with the strongest frequency of selection; lowercase letters represent nucleotides with a predominant frequency of selection. An oligonucleotide containing the Lhx3 binding consensus (LBC) sequence (site 5, underlined) was selected for further study.
J.L. Bridwell et al. / Gene 277 (2001) 239–250
mobility of complexes with the LBC site positioned at the end of the probe as described (Kim et al., 1989).
3. Results 3.1. Lhx3 selects an AT-rich high-affinity binding site in a LIM-independent fashion To investigate the role of the LIM domains in DNA binding specificity, we determined the DNA binding site preferences for the full-length Lhx3a protein and a truncated protein lacking the amino terminal LIM domains (DLhx3, amino acids 152–400) using a modification of the selected and amplified binding site (SAAB) method (Blackwell and Weintraub, 1990). This type of approach has been successfully applied to determine the DNA binding preferences of transcription factors and to probe the biochemical mechanisms underlying protein/DNA interactions. First, we expressed both forms of the protein as recombinant fusions with glutathione-S-transferase (GST) and purified these proteins after expression in E. coli (Fig. 1A). Equivalent amounts of Lhx3 and DLhx3 proteins were incubated with a pool of radiolabeled oligonucleotides. The labeled oligonucleotides contained a random core of 20 bp; this extended random sequence was chosen to allow unbiased selection of high-affinity binding sites by Lhx3. After binding, the bound complexes were separated from the unbound pool using EMSA gels. Positive control reactions using a defined Lhx3 binding site, the porcine aGSU promoter pituitary glycoprotein basal element (PGBE, Meier et al., 1999), were performed in parallel (data not shown). Selected DNA was extracted from the EMSA gels and then amplified by the PCR. The purified PCR products then were radiolabeled and the EMSA was repeated as above (round 2). The selection procedure was repeated for a total of five rounds. Increased levels of Lhx3 binding were observed in each round as enrichment for high affinity sites proceeded (Fig. 1B,C). Further, DLhx3 displayed a higher affinity of binding than wild type Lhx3 throughout all stages of the experiment (Fig. 1B,C), consistent with our previous observation that the LIM domains negatively regulate the DNA binding affinity of Lhx3 (Meier et al., 1999). Selected DNA fragments were cloned after rounds 3, 4, and 5. The sequences of these sites were examined to determine whether the selected sites represented a consensus and, importantly, whether they represented predominantly independent selection events. After individual sites were re-tested for Lhx3 binding using EMSA assays, 23 positive binding site sequences for the full-length protein were aligned (Fig. 1D). Lhx3 selected a strict AT-rich consensus sequence (tAATTAATTAa). We refer to this sequence as the Lhx3-Binding Consensus sequence (or LBC), and we chose a selected site (site 5, Fig. 1D) for use in further experiments. This site was picked because it contains a perfect LBC sequence, but it is important to note that many of the other selected
243
sites also contain the LBC sequence. The DLhx3 protein selected a consensus with the same core sequence (Fig. 2), indicating that the Lhx3 LIM domains do not regulate the specificity of DNA site binding. The LBC site contains a repeat of the ATTA sequence that often is found in the binding sites of HD transcription factors, suggesting that the site might be occupied by a Lhx3 dimer. To investigate the stoichiometry of Lhx3/LBC interaction, we performed UV crosslinking analyses. These experiments indicated that Lhx3 binds predominantly in the monomer form (Fig. 3A), consistent with other studies that demonstrate LIM-HD proteins binding DNA as monomers (Behravan et al., 1997). At very high Lhx3 protein concentrations, we do observe some apparent dimer/DNA complexes in EMSA experiments, but the majority of binding remains monomeric (data not shown). To determine the affinity of Lhx3/LBC DNA binding, a competition analysis was performed using increasing levels of unlabeled LBC site in an EMSA experiment (Fig. 3B). The bound and free complexes were quantified in the resulting gel. Scatchard analysis of this data indicated that the Kd for full-length Lhx3/LBC interaction was 1.2 £ 10 29 M. To characterize the physical nature of Lhx3 interaction with the LBC DNA site, we determined whether distamycin, a drug that is known to bind to the minor groove of AT-rich DNA, would compete with Lhx3 binding to the LBC in EMSA experiments. At concentrations of 1.5 mM and greater, distamycin interfered with Lhx3 binding to the LBC sequence (Fig. 3C). Similar effects were seen in reac-
Fig. 2. DNA sites selected by Lhx3 protein lacking the LIM domains (DLhx3). Alignment of sites selected by DLhx3 after five rounds of selection. The frequency of nucleotides within the selected sites is given. Uppercase letters represent nucleotides with the strongest frequency of selection; lowercase letters represent nucleotides with a predominant frequency of selection.
244
J.L. Bridwell et al. / Gene 277 (2001) 239–250
tions containing DLhx3 protein, except that higher concentrations of distamycin were required to achieve equivalent levels of inhibition, due to the higher affinity of binding of DLhx3 (Fig. 3C). Inhibition of Lhx3 binding was not observed in control experiments using mithramycin A, a drug that interacts with GC-rich DNA (Fig. 3D). We also examined the ability of non-recombinant Lhx3 to interact with the LBC site. Human embryonic kidney 293 cells (that do not express Lhx3) were stably transfected with an expression vector encoding Lhx3 with a myc epitope tag and a clonal cell line was derived. Protein extracts were prepared from both this cell line and the parent line and were used in EMSA experiments with a LBC probe. An LBC-binding complex was observed in reactions containing
protein from the Lhx3-expressing cells but not the parent cell line (closed arrow, Fig. 4). This complex was disrupted by anti-Lhx3 antibodies, but not by pre-immune serum (Fig. 4). Addition of an antibody against the myc epitope resulted in a supershift of the Lhx3/LBC complex (open arrow, Fig. 4). This experiment demonstrates that non-recombinant Lhx3 in a complex mixture of cellular proteins specifically recognizes the LBC site. 3.2. The LBC sequence confers Lhx3-dependent transcriptional activation upon heterologous promoters We analyzed the DNA sequence requirements for Lhx3 interaction with the LBC site. The LBC contains two ATTA
Fig. 3. Analysis of Lhx3 binding to the selected consensus sequence. (A) UV crosslinking analysis. DLhx3 protein was crosslinked to radiolabeled LBC oligonucleotide probe and the products were analyzed by denaturing electrophoresis. The migration positions of radiolabeled protein molecular markers (in kilodaltons) are indicated. Lane 1 ¼ no UV treatment; lane 2 ¼ no protein added; lane 3 ¼ DNase I added; lane 4 ¼ complete reaction with DLhx3 protein; lane 5 ¼ nuclease treatment omitted; lane 6 ¼ proteinase K added. The arrow indicates the DLhx3/DNA complex in the complete reaction. (B) EMSA competition assay to determine the Kd of Lhx3 with the LBC site. Equivalent amounts of radiolabeled LBC were incubated with Lhx3 protein and various concentrations of cold competitor LBC (0 to 1500-fold excess). Bound complexes (b) then were separated from free probe (f) by electrophoresis and the complexes were quantified using a phosphorimager. (C) Distamycin competes with Lhx3 and DLIM Lhx3 for interaction with the LBC site. EMSA analyses using Lhx3 and DLhx3 proteins and radiolabeled LBC probe were performed in the presence of increasing concentrations of distamycin (1.5 mM to 100 mM). (D) EMSA analyses using LBC probe and Lhx3 or DLhx3 proteins in the presence of 1.5 mM to 100 mM mithramycin.
J.L. Bridwell et al. / Gene 277 (2001) 239–250
motifs. Mutations were introduced to disrupt either the first motif (LBC M1, Fig. 5A), the second motif (LBC M2), or both motifs (LBC M3). These sites then were tested for Lhx3 and DLhx3 binding in EMSA reactions containing equivalent amounts of each protein (Fig. 5B). Mutation of the second ATTA motif (LBC M2) had a more severe effect than mutation of the first (LBC M1). Although Lhx3 bound poorly to both the M1 and M2 mutants, DLhx3 bound much better to the LBC M1 site than to the LBC M2 site (Fig. 5B). Mutation of both motifs (LBC M3) abolished Lhx3 and DLhx3 binding entirely (Fig. 5B). In these experiments, we also compared Lhx3 binding to the LBC to its binding to the aGSU gene PGBE. LIM-HD proteins such as Lhx2 and Lhx3 can induce transcription from the aGSU gene by binding to this element (e.g. Roberson et al., 1994; Meier et al., 1999) and transgenic experiments indicate that it is required to restrict expression of the aGSU gene to the appropriate pituitary cell types (Brinkmeier et al., 1998). The LBC is a higher affinity Lhx3 binding site than the PGBE (Fig. 5B). Similar data were obtained in experiments using recombinant Lhx3 proteins that were cleaved from GST using thrombin (data not shown). Together, these
245
data indicate that the ATTA motifs are critical for Lhx3 recognition of the LBC. Intriguingly, the downstream motif appears to be more important for Lhx3 binding suggesting that the LBC has polarity and that the sequences outside the core impact Lhx3 recognition. We next determined whether the LBC site could mediate Lhx3 transcriptional activation. Synthetic luciferase reporter genes were constructed such that three copies of the LBC, LBC M1, LBC M2, or LBC M3 elements were directionally cloned next to a minimal promoter derived from the rat PRL gene. This promoter was chosen because it is a TATA box-containing region that does not contain response elements for other transcription factors and has previously been used to study individual transcription factor response elements. These plasmids were transiently co-transfected into 293 cells with titrated amounts of an Lhx3 expression vector. Lhx3 induced transcription from the LBC reporter gene (Fig. 5C), demonstrating that the LBC was capable of mediating Lhx3 activity. Lhx3 also activated transcription from reporter genes containing LBC elements cloned next to the thymidine kinase and Pit-1 gene promoters (data not shown). A reporter gene containing the LBC M1 element was induced by Lhx3 but was not as potent as the wild type LBC reporter gene (Fig. 5C). Consistent with the observed levels of Lhx3 binding to these elements, reporter genes containing the LBC M2 or LBC M3 elements did not respond to Lhx3 (Fig. 5C). Lhx3 also activated a reporter gene containing four copies of the aGSU PGBE in control experiments (Fig. 5C). We conclude that the LBC can confer Lhx3-dependent transcription and that the second ATTA motif is most critical for this function. 3.3. Comparison of the Lhx3 LBC site with other DNA elements
Fig. 4. Analysis of LBC interaction with protein extracts from Lhx3-expressing cells. Mouse Lhx3 with a myc epitope tag (myc-Lhx3) was expressed in heterologous human 293 cells. Protein extracts were made and used in EMSA analysis with a radiolabeled LBC probe. Antibodies against Lhx3 (aLhx3), the myc epitope (amyc), or preimmune serum (PI) were added to reactions to confirm the specificity of interactions. The closed arrow indicates the myc-Lhx3/LBC complex; the open arrow denotes the larger mycLhx3/LBC/amyc complex. f ¼ free probe.
A previous study using a biased pool of oligonucleotides also has determined a consensus site for the full-length Lhx3 molecule (Girardin et al., 1998). The binding site defined by Girardin et al. [ANNAG(G/T)AAA(T/C)GA(C/G)AA] is similar to a sequence located at 2205 bp in the rat PRL promoter (Girardin et al., 1998). We therefore examined binding of Lhx3 to this element. Equivalent amounts of cold competitor oligonucleotides were added to EMSA reactions containing full-length Lhx3 and labeled LBC site (Fig. 6A). After electrophoresis, bound and free complexes were quantified by phosphorimager scanning and the percent inhibition of Lhx3 binding was calculated. The LBC site was the strongest inhibitor, followed by the aGSU PGBE element, and the LBC M1, M2, and M3 mutant oligonucleotides (Fig. 6B). The PRL 2205 site and a mutated version of this sequence (PRL 2205m) were relatively poor competitors, exhibiting weaker Lhx3 binding than the non-functional LBC M2 element (Fig. 6B). We conclude that the PRL 2205 site is a relatively low affinity Lhx3 binding site and the biological significance of this element is not clear.
246
J.L. Bridwell et al. / Gene 277 (2001) 239–250
3.4. Lhx3 bends DNA sequences containing the LBC site in a LIM-independent fashion Transcription factor interaction with DNA recognition elements can not only result in the recruitment of coregu-
latory proteins but also can result in alteration of local DNA topology. Such interactions may mediate association of protein/DNA complexes and increase transcription rates at specific promoters. We tested the hypothesis that Lhx3 has such architectural properties using circular permutation
Fig. 5. The Lhx3 binding consensus sequence confers Lhx3-dependent activation to a heterologous promoter. (A) Sequences of the selected LBC site, mutant derivatives of the LBC, and the PGBE element from the aGSU gene promoter. (B) EMSA analysis comparing interaction of radiolabeled probes of equal specific activities representing the LBC, mutant LBC, or aGSU sites with equivalent amounts of Lhx3 and DLhx3 proteins. f ¼ free probe. (C) 293 cells were transiently co-transfected with a Lhx3 expression vector and the indicated reporter genes. Luciferase activity was determined after 48 h. Representative experiments of at least four experiments are shown. Values represent means of triplicate samples ^SEM.
J.L. Bridwell et al. / Gene 277 (2001) 239–250
247
Fig. 6. Competition analysis comparing the relative affinities of the LBC, mutant LBC, aGSU, and PRL 2205 sites for interaction with Lhx3. (A) EMSA was performed using Lhx3 and a radiolabeled LBC probe in the presence of 100-fold excess of the indicated cold competitor sites. PRL-205m ¼ mutated PRL 2205 site (see Section 2); b ¼ bound complexes; f ¼ free probe. Gels then were analyzed using a phosphorimager and the degree of inhibition of LBC binding was calculated (panel B).
Fig. 7. Lhx3 bends DNA molecules containing the consensus binding site. (A) The Lhx3 binding consensus (LBC) site was cloned into the Xba I site of the pBend2 plasmid. (B) DNA fragments of identical length with different placements of the LBC site were generated by digestion with the indicated restriction enzymes. (C) Circular permutation/EMSA analysis using Lhx3 and the LBC-containing fragments from panel B. b ¼ bound complexes, f ¼ free probes.
248
J.L. Bridwell et al. / Gene 277 (2001) 239–250
experiments. An oligonucleotide containing the LBC sequence was cloned into the pBEND2 plasmid (Fig. 7A). The resulting plasmid then was digested with restriction enzymes to generate of series of DNA fragments of equal length and composition with the LBC site located at various positions within the molecules (Fig. 7B). These DNA fragments then were radiolabeled and used in EMSA with full-length and DLhx3 proteins. Full-length Lhx3 bound to the LBC-containing DNA fragments and the observed protein/DNA complexes migrated at a slower rate in reactions containing DNA fragments with a centrally placed LBC site (Fig. 7C). By contrast, the free probes all exhibited similar migration rates (Fig. 7C). These data are consistent with Lhx3/LBC interaction resulting in a bending of the DNA molecule. Comparisons of the migration rates of the bound and free complexes indicate a bending angle of 628. Experiments using the DLhx3 protein also record a bending angle of 628 (data not shown), indicating that the LIM domains do not impact the ability of the Lhx3 molecule to bend DNA.
4. Discussion In this study, we demonstrate that the Lhx3 LIM-HD transcription factor binds to an AT-rich consensus sequence (LBC) at high affinity with minor groove contacts. The LIM domains regulate the affinity of Lhx3 DNA interaction but do not modulate the sequence specificity of the molecule. The LBC is able to confer Lhx3-dependent transcription to heterologous promoters and the DNA molecule is bent in Lhx3/LBC complexes. Recent experiments have suggested that the manner by which the Pit-1 transcription factor interacts with specific DNA elements may determine its transcriptional activity in differentiated cell types (Scully et al., 2000). Pit-1 is an essential regulator of the growth hormone (GH), PRL, and TSHb genes in the somatotrope, lactotrope, and thyrotrope pituitary cell types, respectively. Scully and colleagues (2000) demonstrate that whereas the Pit-1 protein activates the GH gene in the somatotrope, it serves as a repressor of GH in the (PRL-expressing) lactotrope cell. This differential activity is mediated by the nature of Pit-1 interaction with binding sites in the GH gene. Structural studies demonstrate that there are striking differences in the minor groove contacts of the amino-terminal arm of the POU HD of Pit1 with binding sites from the GH and PRL genes. It is proposed that the distinct conformations of Pit-1 allow selective recruitment of coregulatory proteins, thereby mediating cell-specific gene expression (Scully et al., 2000). Like Pit-1, Lhx3 is expressed in multiple anterior pituitary cell types and is required for their development (Sheng et al., 1997). The data presented in this study (defining a high-affinity Lhx3 recognition sequence that features minor groove contacts) will provide a basis for future investigation of the mechanisms by which
Lhx3 might achieve cell-specific actions. Indeed, in this study, we demonstrate that the selected Lhx3 consensus site is related to the PGBE element in the aGSU gene, and similar DNA binding sites are important in regulation of the rat gonadotropin-releasing hormone receptor gene (Pincas et al., 2001). Investigation of additional candidate Lhx3 binding sites in other pituitary and nervous system genes is underway. The DNA molecule is bent to an angle of 628 in Lhx3/ LBC complexes. In this study, the characterization of DNA bending by Lhx3 served as an additional assay of the role the LIM domains play in Lhx3/DNA interactions. However, nuclear DNA-binding proteins may serve architectural functions by altering the topology of genes in order to indirectly increase or decrease the rate of transcription from the gene. Such architectural transcription factors have been reported to often recognize and bend AT-rich DNA sequences (including minor groove interaction) and to be associated with the nuclear matrix (reviewed in Bewley et al., 1998). The nuclear matrix is an insoluble proteinaceous nuclear substructure that has been hypothesized to mediate the actions of some extranuclear and extracellular signals that result in altered gene expression. In addition, transcriptionally active genes may be associated with the nuclear matrix (reviewed in Lelie`vre et al., 1996). Indeed, some gene loci contain matrix attachment regions containing many copies of the ATTA sequence that is the core of some HD recognition sequences. These regions have been proposed as recruitment sites for gene regulatory proteins. HD transcription factors, including Lhx3 and Pit-1, have been demonstrated to be associated with the nuclear matrix (Mancini et al., 1999; Parker et al., 2000). Further, Lhx3 has been demonstrated to synergize with the Pit-1 pituitary transcription factor to activate the PRL, TSHb, and Pit-1 pituitary-specific genes (Meier et al., 1999; Sloop et al., 1999, 2001a). The observations that Lhx3 prefers an AT-rich binding site, interacts with the minor groove, and significantly bends DNA are consistent with Lhx3 being a multifunctional protein that has properties in common with architectural transcription factors, and that these activities may play important roles in higher-order transcription factor interactions in the regulation of tissue-specific genes in the pituitary and ner-vous system. The role of the LIM domains in LIM-HD protein activities is complex. For example, the LIM domains of apterous are specifically required for axon pathfinding in Drosophila; LIM domains from other proteins cannot perform this role, implying specificity of LIM domain function in target gene regulation (O’Keefe et al., 1998). Gene targeting experiments demonstrate that the LIM domains are essential for function of the mouse Lim1/ Lhx1 protein (Cheah et al., 2000). The demonstration that a point mutation in the LIM domains of the Lhx3 protein is associated with a severe endocrine disease (Netchine et al., 2000) and that this mutation impairs the
J.L. Bridwell et al. / Gene 277 (2001) 239–250
ability of Lhx3 to activate pituitary genes (Sloop et al., 2001a; Howard and Maurer, 2001) underscores the importance of the LIM domains for Lhx3 function in vivo. In addition, alternate isoforms of Lhx3 (with distinct amino termini) display different DNA binding activities; the alternate domains may indirectly regulate DNA binding in part by affecting the LIM domains (Sloop et al., 1999). However, we recently have identified a novel truncated form of Lhx3 (M2-Lhx3) that lacks the LIM domains but retains some gene activation activities, suggesting that not all Lhx3 functions are LIM domain-dependent (Sloop et al., 2001b). In this study we demonstrate that the LIM domains of Lhx3 regulate the DNA binding affinity, but not the specificity, of Lhx3. By contrast, studies of Isl-1 show that the full-length protein does not recognize a specific sequence but a truncated protein lacking LIM domains selects a high affinity consensus sequence (Sa´ nchez-Garcia et al., 1993). A third type of observation has been made for the Lmx1 and Isl-2 LIM-HD proteins; in these factors, the LIMs do not affect DNA binding (Gong and Hew, 1994; Jurata and Gill, 1997). These data suggest that there are at least three classes of LIM-HD proteins in which the LIM domains play unique roles in regulation of nucleic acid interaction. Future studies are required to determine the role of known and uncharacterized LIM-interacting partner proteins in regulating the actions of the LIM domains. Acknowledgements We are grateful to Drs. J. Bidwell, B. Blazer-Yost, E. Long, J. Voss, and D. Williams for reagents and constructive discussions. We thank Dr. Lisa Cushman for comments on the manuscript. Supported by grants to SJR from the National Science Foundation and the U.S. Department of Agriculture National Research Initiative Competitive Grants Program. References Amendt, B.A., Sutherland, L.B., Semina, E.V., Russo, A.F., 1998. The molecular basis of Rieger syndrome. Analysis of Pitx2 homeodomain protein activities. J. Biol. Chem. 273, 20066–20072. Bach, I., 2000. The LIM domain: regulation by association. Mech. Dev. 91, 5–17. Behravan, G., Lycksell, P.O., Larsson, G., 1997. Expression, purification and characterization of the homeodomain of rat ISL-1 protein. Protein Eng. 10, 1327–1331. Bewley, C.A., Gronenborn, A.M., Clore, G.M., 1998. Minor groove-binding architectural proteins: structure, function, and DNA recognition. Annu. Rev. Biophys. Biomol. Struct. 27, 105–131. Blackwell, T.K., Weintraub, H., 1990. Differences and similarities in DNAbinding preferences of MyoD and E2A protein complexes revealed by binding site selection. Science 250, 1104–1111. Brinkmeier, M.L., Gordon, D.F., Dowding, J.M., Saunders, T.L., Kendall, S.K., Sarapura, V.D., Wood, W.M., Ridgway, E.C., Camper, S.A., 1998. Cell-specific expression of the mouse glycoprotein hormone alpha-subunit gene requires multiple interacting DNA elements in transgenic mice and cultured cells. Mol. Endocrinol. 12, 622–633.
249
Cheah, S.S., Kwan, K.M., Behringer, R.R., 2000. Requirement of LIM domains for LIM1 function in mouse head development. Genesis 27, 12–21. Girardin, S.E., Benjannet, S., Barale, J.C., Chretien, M., Seidah, N.G., 1998. The LIM homeobox protein mLIM3/Lhx3 induces expression of the prolactin gene by a Pit-1/GHF-1-independent pathway in corticotroph AtT20 cells. FEBS Lett. 431, 333–338. Glenn, D.J., Maurer, R.A., 1999. MRG1 binds to the LIM domain of Lhx2 and may function as a coactivator to stimulate glycoprotein hormone alpha-subunit gene expression. J. Biol. Chem. 274, 36159–36167. Gong, Z., Hew, C.L., 1994. Zinc and DNA binding properties of a novel LIM homeodomain protein Isl-2. Biochemistry 33, 15149–15158. Hobert, O., Westphal, H., 2000. Functions of LIM-homeobox genes. Trends Genet. 16, 75–83. Howard, P.W., Maurer, R.A., 2000. Identification of a conserved protein that interacts with specific LIM homeodomain transcription factors. J. Biol. Chem. 275, 13336–13342. Howard, P.W., Maurer, R.A., 2001. A point mutation in the LIM domain of Lhx3 reduces activation of the glycoprotein hormone alpha-subunit promoter. J. Biol. Chem. 276, 19020–19026. Jurata, L.W., Gill, G.N., 1997. Functional analysis of the nuclear LIM domain interactor NLI. Mol. Cell. Biol. 17, 5688–5698. Kim, J., Zwieb, C., Wu, C., Adhya, S., 1989. Bending of DNA by generegulatory proteins: construction and use of a DNA bending vector. Gene 85, 15–23. Lelie`vre, S., Weaver, V.M., Bissell, M.J., 1996. Extracellular matrix signaling from the cellular membrane skeleton to the nuclear skeleton: a model of gene regulation. Rec. Prog. Horm. Res. 51, 417–432. Mancini, M.G., Liu, B., Sharp, Z.D., Mancini, M.A., 1999. Subnuclear partitioning and functional regulation of the Pit-1 transcription factor. J. Cell. Biochem. 72, 322–338. Meier, B.C., Price, J.R., Parker, G.E., Bridwell, J.L., Rhodes, S.J., 1999. Characterization of the porcine Lhx3/LIM-3/P-Lim LIM homeodomain transcription factor. Mol. Cell. Endocrinol. 147, 65–74. Netchine, I., Sobrier, M.L., Krude, H., Schnabel, D., Maghnie, M., Marcos, E., Duriez, B., Cacheux, V., Moers, A., Goossens, M., Gruters, A., Amselem, S., 2000. Mutations in LHX3 result in a new syndrome revealed by combined pituitary hormone deficiency. Nat. Genet. 25, 182–186. O’Keefe, D.D., Thor, S., Thomas, J.B., 1998. Function and specificity of LIM domains in Drosophila nervous system and wing development. Development 125, 3915–3923. Parker, G.E., Sandoval, R.M., Feister, H.A., Bidwel, J.P., Rhodes, S.J., 2000. The homeodomain coordinates nuclear entry of the Lhx3 neuroendocrine transcription factor and association with the nuclear matrix. J. Biol. Chem. 275, 23891–23898. Pincas, H., Amoyel, K., Counis, R., Laverriere, J.N., 2001. Proximal cisacting elements, including steroidogenic factor 1, mediate the efficiency of a distal enhancer in the promoter of the rat gonadotropin-releasing hormone receptor gene. Mol. Endocrinol. 15, 319–337. Roberson, M.S., Schoderbek, W.E., Tremml, G., Maurer, R.A., 1994. Activation of the glycoprotein hormone alpha subunit promoter by a LIM-homeodomain transcription factor. Mol. Cell. Biol. 14, 2985– 2993. Sa´ nchez-Garcia, I., Osada, H., Forster, A., Rabbitts, T.H., 1993. The cysteine-rich LIM domains inhibit DNA binding by the associated homeodomain in Isl-1. EMBO J. 12, 4243–4250. Scully, K.M., Jacobson, E.M., Jepsen, K., Lunyak, V., Viadiu, H., Carriere, C., Rose, D.W., Hooshmand, F., Aggarwal, A.K., Rosenfeld, M.G., 2000. Allosteric effects of Pit-1 DNA sites on long-term repression in cell type specification. Science 290, 1127–1131. Sharma, K., Sheng, H.Z., Lettieri, K., Li, H., Karavanov, A., Potter, S., Westphal, H., Pfaff, S.L., 1998. LIM homeodomain factors Lhx3 and Lhx4 assign subtype identities for motor neurons. Cell 95, 817– 828. Sheng, H.Z., Moriyama, K., Yamashita, T., Li, H., Potter, S.S., Mahon,
250
J.L. Bridwell et al. / Gene 277 (2001) 239–250
K.A., Westphal, H., 1997. Multistep control of pituitary organogenesis. Science 278, 1809–1812. Sloop, K.W., Meier, B.C., Bridwell, J.L., Parker, G.E., Schiller, A.M., Rhodes, S.J., 1999. Differential activation of pituitary hormone genes by human Lhx3 isoforms with distinct DNA binding properties. Mol. Endocrinol. 13, 2212–2225. Sloop, K.W., Parker, G.E., Hanna, K.R., Wright, H.A., Rhodes, S.J., 2001a.
LHX3 transcription factor mutations associated with combined pituitary hormone deficiency impair the activation of pituitary target genes. Gene 265, 61–69. Sloop, K.W., Dwyer, C., Rhodes, S.J., 2001b. An isoform-specific inhibitory domain regulates the LHX3 LIM homeodomain factor holoprotein and the production of a functional alternate translation form. J. Biol. Chem. (in press).
Role of the LIM domains in DNA recognition by the Lhx3 neuroendocrine transcription factor JeAnne L. Bridwell, Jeffrey R. Price, Gretchen E. Parker, Amy McCutchan Schiller, Kyle W. Sloop, Simon J. Rhodes* Department of Biology, Indiana University-Purdue University Indianapolis, 723 West Michigan Street, Indianapolis, IN 46202-5132, USA Received 18 June 2001; received in revised form 20 August 2001; accepted 4 September 2001 Received by A.J. Van Wijnen
Abstract LIM homeodomain transcription factors regulate many aspects of development in multicellular organisms. Such factors contain two LIM domains in their amino terminus and a DNA-binding homeodomain. To better understand the mechanism of gene regulation by these proteins, we studied the role of the LIM domains in DNA interaction by Lhx3, a protein that is essential for pituitary development and motor neuron specification in mammals. By site selection, we demonstrate that Lhx3 binds at high affinity to an AT-rich consensus DNA sequence that is similar to sequences located within the promoters of some pituitary hormone genes. The LIM domains reduce the affinity of DNA binding by Lhx3, but do not affect the specificity. Lhx3 preferentially binds to the consensus site as a monomer with minor groove contacts. The Lhx3 binding consensus site confers Lhx3-dependent transcriptional activation to heterologous promoters. Further, DNA molecules containing the consensus Lhx3 binding site are bent to similar angles in complexes containing either wild type Lhx3 or Lhx3 lacking LIM domains. These data are consistent with Lhx3 having the properties of an architectural transcription factor. We also propose that there are distinct classes of LIM homeodomain transcription factors in which the LIM domains play different roles in modulating interactions with DNA sites in target genes. q 2001 Elsevier Science B.V. All rights reserved. Keywords: Homeodomain; Pituitary; Alpha glycoprotein subunit; Growth; Prolactin
1. Introduction DNA-binding transcription factors regulate gene expression using multiple biochemical strategies. These include the assembly of proteins required for RNA synthesis, the recruitment of coactivator or corepressor proteins that alter the accessibility of local chromatin, the recruitment of enzymes that modify DNA, and alteration of DNA topology to facilitate transcriptional activation or repression by other proteins. To mediate these activities, transcription factors typically contain one or more DNA-binding domains and other domains that either modulate protein/DNA interactions or that mediate the function of the transcription factors. The human genome encodes over 250 homeodomain Abbreviations: aGSU, alpha glycoprotein subunit; EMSA, electrophoretic mobility shift assay; GH, growth hormone; GST, glutathione-S-transferase; HD, homeodomain; Lhx3, LIM homeobox gene 3; LIM-HD, LIM homeodomain; PCR, polymerase chain reaction; PRL, prolactin; TSH, thyroid-stimulating hormone * Corresponding author. Tel.: 11-317-278-1797; fax: 11-317-274-2846. E-mail address: [email protected] (S.J. Rhodes).
(HD) transcription factors that serve diverse gene regulatory roles in development. The HD is a DNA-binding domain found in proteins that often contain other structural features. Members of the LIM homeodomain (LIM-HD) subfamily contain two LIM domains in addition to a HD. The LIM domain (named after the LIN-11, Isl-1, and MEC-3 LIMHD factors) forms a zinc-coordinated finger-like structure that is found in many types of proteins including the LIMHD transcription factors, and non-DNA-binding cytoskeletal factors, intracellular signaling proteins, and transcriptional coactivators (reviewed in Bach, 2000). LIM-HD proteins are key regulators of developmental pathways in many systems (reviewed in Hobert and Westphal, 2000). For example, Lim1/Lhx1 is essential for the formation of anterior head structures in mice and for leg and antennal development in flies; Lhx2/LH-2 is required for forebrain, eye, and erythrocyte development; Lhx4/Gsh-4 is necessary for central nervous system and pituitary development; defects in the LMX1b gene cause skeletal malformations and kidney disorders in patients with nail patella syndrome; and the Isl-1 gene is required for pancreatic cell specification and motor neuron differentiation (reviewed in Hobert
0378-1119/01/$ - see front matter q 2001 Elsevier Science B.V. All rights reserved. PII: S 0378-111 9(01)00704-1
240
J.L. Bridwell et al. / Gene 277 (2001) 239–250
and Westphal, 2000). The LIM domains of LIM-HD factors appear to serve many functions, including mediating interactions with partner proteins such as NLI/Ldb1, Pit-1, RLIM, MRG1, and SLB (Glenn and Maurer, 1999; Howard and Maurer, 2000; and reviewed in Bach, 2000). In addition, the LIM domains can confer trans-activation function (Glenn and Maurer, 1999) and sometimes can modulate the function of LIM-HD holoproteins by repressing DNA binding (reviewed in Hobert and Westphal, 2000). Lhx3 (also known as LIM-3 or P-Lim) is a conserved LIM-HD transcription factor that has been identified in mammals, birds, fish, and insects (see Sloop et al., 1999 and references therein). Mammalian Lhx3 genes encode two protein isoforms with different amino termini: a transcriptionally active isoform, Lhx3a, and an inactive isoform, Lhx3b (Sloop et al., 1999). The actions of Lhx3 and other HD transcription factors are required for pituitary gland development in mammals. Lhx3 can activate the regulatory regions of pituitary genes, including those encoding hormones such as the alpha glycoprotein subunit (aGSU), prolactin (PRL), and thyroid-stimulating hormone beta (TSHb), and transcription factors such as Pit-1. Gene targeting experiments in mice have demonstrated that Lhx3, and the related Lhx4 gene, are required for the early structural events that mark pituitary organogenesis and for differentiation of four of the five hormone-secreting anterior pituitary cell types (Sheng et al., 1997). In addition, the actions of these genes are essential for the specification of motor neuron subtypes in the developing nervous system (Sharma et al., 1998). Recently, human patients with mutations in the Lhx3 gene have been described (Netchine et al., 2000). These growth retarded patients exhibit combined pituitary hormone deficiency, featuring deficiencies of PRL, TSH, growth hormone, follicle-stimulating hormone, and luteinizing hormone. They also have anteverted shoulders associated with restriction of cervical spine rotation. Two types of mutations were described: a missense mutation that alters one conserved amino acid in the second LIM domain and an intragenic deletion that results in a truncated protein lacking the HD (Netchine et al., 2000). Molecular analyses have demonstrated that these mutations in Lhx3 impair the activation of pituitary hormone genes (Sloop et al., 2001a; Howard and Maurer, 2001). In this study, we investigated the role of the LIM domains in DNA interaction by Lhx3a. Lhx3 binds at high affinity to an AT-rich DNA sequence as a monomer with minor groove contacts. The LIM domains reduce the affinity of DNA binding by Lhx3 but do not affect the specificity. The identified Lhx3 binding consensus site mediates Lhx3-dependent transcriptional activation. Lhx3 binding to this consensus binding site is associated with significant DNA bending in a LIM-independent fashion. These data are consistent with the LIM domains of specific LIM-HD transcription factors exerting distinct roles in regulating the interaction of the HD with target DNA elements.
2. Materials and methods 2.1. Preparation of recombinant Lhx3 proteins Most experiments were performed with murine Lhx3a (mLhx3) proteins; some also were performed with porcine Lhx3a (pLhx3) molecules. The mLhx3 and pLhx3 proteins display .90% amino acid identity and are 99% identical in the LIM domains and homeodomain. Bacterial expression vectors for glutathione-S-transferase (GST)-pLhx3 and GST-pLhx3 fusion proteins lacking the LIM domains (DLhx3) have been described (Meier et al., 1999). Plasmids for GST-mLhx3 and GST-mDLhx3 fusion proteins (removing amino acids 1–151) were generated by cloning Bam HI/ Eco RI fragments of the mLhx3a cDNA into pGEX-KT. cDNA fragments were generated by the polymerase chain reaction (PCR) using the following oligonucleotides: 5 0 -cgggatccatgctgctagaagcagaactcg-3 0 , 5 0 cggaattcagcatggtctacttcatccagcc-3 0 (mLhx3) and 5 0 cgggatccaagcagcgagaagccgaggccac-3 0 , 5 0 ggaattccatatgcagcgagaagccgaggccaca-3 0 (Dm Lhx3). Constructs were confirmed by sequencing. Proteins were prepared as described (Meier et al., 1999). If required, proteins were released by thrombin cleavage in 50 mM Tris (pH 8.0), 150 mM NaCl, 2.5 mM CaCl2, 0.1% BME with 1.5 units of bovine serum thrombin for 3 h. Proteins were analyzed on 12% SDS-PAGE. 2.2. DNA binding site selection and electrophoretic mobility shift analysis A modification of described methods (Blackwell and Weintraub, 1990) was used. 50 ng of target binding oligonucleotide (5 0 -cgggctcgaggaggaggn20cccagcggccgccacgg3 0 ) was annealed to 900 ng of a primer (5 0 -ccgtggcggccg3 0 ) and radiolabeled double-stranded random DNA targets were generated by extension with Klenow enzyme in the presence of a 32P-dCTP. Electrophoretic mobility shift analysis (EMSA) then was performed using equivalent amounts of mLhx3 or DLhx3 GST fusion proteins and 500,000 cpm gel-purified DNA random target per reaction using conditions as described in Meier et al. (1999). Positive control reactions using the defined porcine aGSU promoter 2324 bp pituitary glycoprotein basal element (PGBE, Meier et al., 1999) were analyzed in parallel. Results were visualized by autoradiography of dried, fixed gels at 2808C with intensifying screens. The shifted complexes were excised and extracted in 0.5 M sodium acetate, 10 mM MgCl2, 1 mM EDTA, 0.1% SDS at 658C. DNA was recovered by phenol extraction and ethanol precipitation using glycogen as a carrier. Selected DNA was amplified by PCR using Expand HiFi polymerase (Roche) and appropriate oligonucleotides (cgggctcgaggaggagg, ccgtggcggccgctggg) with 30 cycles of 948C, 30 s; 608C, 30 s; 728C, 60 s and one cycle of 728C, 10 min. Purified PCR products were labeled using T4 polynucleotide kinase and g 32P-ATP and EMSA was repeated as above (round 2). Selection was
J.L. Bridwell et al. / Gene 277 (2001) 239–250
repeated for a total of five rounds. Selected DNA fragments were digested with Xho I and Not I, cloned into pBluescript KSII- (Stratagene, La Jolla, CA) and sequenced after rounds 3, 4 and 5. Individual sites then were retested for Lhx3 binding using EMSA assays. Sequences were aligned using DNA analysis software (DNAsis, Hitachi Software Engineering, South San Francisco, CA) and Lhx3 binding consensus (LBC) sequences determined. For DNA minor groove binding analysis, distamycin A and mithramycin A (Sigma) were added to EMSAs at 1.5 mM to 100 mM. Control reactions received vehicle alone. 2.3. Protein/DNA UV crosslinking DLhx3 protein was crosslinked to a bromodeoxyuridinesubstituted radiolabeled LBC probe prepared using the following oligonucleotide 5 0 - cgggctcgaggaggaggcagaaaattaattaattgtacccagcggccgccacgg-3 0 . The labeled probe then was gel purified. Binding reactions contained 1 mg of protein, 100,000 cpm of radiolabeled probe in 20 ml EMSA buffer. This mixture then was irradiated from above in a 96-well microtiter plate for 1 h using an UV transilluminator (,305 nm/7000 mW/cm 2). Following irradiation, 1 ml of 0.5 M CaCl2 and 1 U micrococcal nuclease was added at 378C for 30 min. Control reactions omitting key reagents or including DNAse I also were performed. An equal volume of 2 £ SDS sample buffer was added to each reaction and the mixtures were boiled for 5 min followed by electrophoresis through 12% SDS-PAGE with 14C-labeled protein molecular markers, The gels were dried at 658C and exposed to Kodak Biomax-MR film with intensifying screens at 2808C for 2 days.
241
aattgtaa-3 0 (LBC mutant 3), 2324 paGSU PGBE (5 0 -gatccggtacttagctaattaaatga-3 0 ), 5 0 -tgctgtaattaatcaaaat-3 0 (PRL 2205), and 5 0 -attttgcttccttacagca-3 0 (PRL 2205 mutant). 2.5. Transient transfection and luciferase assays Oligonucleotides representing LBC sequences to be tested for their ability to confer Lhx3-dependent transcription were directionally cloned as multimers into the Bam HI site of the 236 bp PRL minimal promoter/luciferase reporter gene (Sloop et al., 1999). The integrity of plasmids was confirmed by sequencing. In vitro cell culture and transfection were performed as described (Meier et al., 1999). All assays were performed in triplicate. Total cell protein was determined by the Bradford method (BioRad) and luciferase activity was normalized to protein concentration. 2.6. Stable cell lines and protein extracts Clonal cell lines expressing Lhx3 were generated by stable transfection of 293 cells with pcDNA3-Myc-pLhx3. 48 h following transfection, the cell culture medium was replaced with medium containing 300 mg/ml Geneticin (Life Technologies, Bethesda, MD). After 2 weeks of selection, individual clonal lines were picked using cloning rings. Protein extracts were prepared as described (Parker et al., 2000). Briefly, 1 £ 10 6 cells in 40 ml 10 mM Tris·Cl (pH 8.0), 150 mM NaCl were mixed with 40 ml 10 mM Tris (pH 8.0), 150 mM NaCl, 2 mM EDTA, 2 mM dithiothreitol, 0.4 mM PMSF, 0.2% Nonidet P-40, 40% glycerol and incubated on ice for 1 h with shaking. Cellular debris was removed by centrifugation for 10 min at 48C. Aliquots were quick frozen in liquid nitrogen and stored at 2808C.
2.4. Affinity and competition assays DNA binding affinities were determined by Scatchard plot analysis of quantitative EMSA competition experiments as described (Amendt et al., 1998). EMSA was performed as described above except that poly (dI·dC) was omitted in some experiments. Radiolabeled LBC probe was quantitated using PicoGreen double stranded DNA quantitation reagent (Molecular Probes, Eugene, OR). Unlabeled double-stranded LBC oligonucleotides were preincubated with 150 ng Lhx3 protein for 15 min prior to addition of the radiolabeled LBC probe at 100 pM. After electrophoresis, bound and free probe was quantitated in dried EMSA gels using a Storm 860 phosphorimager (Molecular Dynamics, Sunnyvale, CA) and used to establish a binding constant for Lhx3 and relative binding affinities for individual competitor oligonucleotides. Three independent experiments were performed. Competition EMSA assays of Lhx3/LBC interaction were performed using 100-fold unlabeled double-stranded oligonucleotides incubated after addition of probe. Oligonucleotides were as follows: 5 0 -gatcccagaaaattaattaattgtaa-3 0 (LBC), 5 0 -gatcccagaaaaggaattaattgtaa-3 0 (LBC mutant 1), 5 0 -gatcccagaaaattaaggaattgtaa-3 0 (LBC mutant 2), 5 0 -gatcccagaaaaggaagg-
2.7. Antisera Polyclonal antisera recognizing Lhx3 have been described (Parker et al., 2000). Ascites fluid containing the anti-myc epitope monoclonal antibody 9E10 was obtained from the University of Iowa Developmental Studies Hybridoma Bank. Antibodies were used in EMSA assays at dilutions of 1:20–1:200. 2.8. DNA bending analysis An oligonucleotide containing the LBC sequence (5 0 ctagacagaaaattaattaattgtat-3 0 ) was cloned into the Xba I site of the pBend2 plasmid (Kim et al., 1989) and confirmed by sequencing. pBend2-LBC plasmid then was digested with Bam HI, Mlu I, Bgl II, Nhe I, Spe I, or Xho I enzymes and LBC containing fragments were radiolabeled using Klenow enzyme in the presence of a 32P-dCTP and gel-purified. EMSA then was performed with Lhx3 or DLhx3 proteins as described above except that reaction products were separated using 10% (75:1) acrylamide gels. DNA bending angles were calculated by comparing the mobility of complexes with the LBC site positioned centrally in the probe with the
242
J.L. Bridwell et al. / Gene 277 (2001) 239–250
Fig. 1. Lhx3 selects an AT-rich binding site. (A) SDS-polyacrylamide gel analysis of GST-mouse Lhx3 (Lhx3) or GST-Lhx3 lacking the LIM domains (DLhx3). A Coomassie blue stain of the protein gel is shown. (B) Representative EMSA gel showing second round separation of selected DNA from a random oligonucleotide pool (p) during the site selection process. Complexes containing Lhx3 (closed arrow) and DLhx3 (open arrow) are indicated. Equivalent amounts of Lhx3 and DLhx3 were present in EMSA reactions. (C) EMSA gel showing third round separation of selected DNA. (D) Alignment of sites selected by Lhx3 after five rounds of selection. The frequency of nucleotides within the selected sites is given. Uppercase letters represent nucleotides with the strongest frequency of selection; lowercase letters represent nucleotides with a predominant frequency of selection. An oligonucleotide containing the Lhx3 binding consensus (LBC) sequence (site 5, underlined) was selected for further study.
J.L. Bridwell et al. / Gene 277 (2001) 239–250
mobility of complexes with the LBC site positioned at the end of the probe as described (Kim et al., 1989).
3. Results 3.1. Lhx3 selects an AT-rich high-affinity binding site in a LIM-independent fashion To investigate the role of the LIM domains in DNA binding specificity, we determined the DNA binding site preferences for the full-length Lhx3a protein and a truncated protein lacking the amino terminal LIM domains (DLhx3, amino acids 152–400) using a modification of the selected and amplified binding site (SAAB) method (Blackwell and Weintraub, 1990). This type of approach has been successfully applied to determine the DNA binding preferences of transcription factors and to probe the biochemical mechanisms underlying protein/DNA interactions. First, we expressed both forms of the protein as recombinant fusions with glutathione-S-transferase (GST) and purified these proteins after expression in E. coli (Fig. 1A). Equivalent amounts of Lhx3 and DLhx3 proteins were incubated with a pool of radiolabeled oligonucleotides. The labeled oligonucleotides contained a random core of 20 bp; this extended random sequence was chosen to allow unbiased selection of high-affinity binding sites by Lhx3. After binding, the bound complexes were separated from the unbound pool using EMSA gels. Positive control reactions using a defined Lhx3 binding site, the porcine aGSU promoter pituitary glycoprotein basal element (PGBE, Meier et al., 1999), were performed in parallel (data not shown). Selected DNA was extracted from the EMSA gels and then amplified by the PCR. The purified PCR products then were radiolabeled and the EMSA was repeated as above (round 2). The selection procedure was repeated for a total of five rounds. Increased levels of Lhx3 binding were observed in each round as enrichment for high affinity sites proceeded (Fig. 1B,C). Further, DLhx3 displayed a higher affinity of binding than wild type Lhx3 throughout all stages of the experiment (Fig. 1B,C), consistent with our previous observation that the LIM domains negatively regulate the DNA binding affinity of Lhx3 (Meier et al., 1999). Selected DNA fragments were cloned after rounds 3, 4, and 5. The sequences of these sites were examined to determine whether the selected sites represented a consensus and, importantly, whether they represented predominantly independent selection events. After individual sites were re-tested for Lhx3 binding using EMSA assays, 23 positive binding site sequences for the full-length protein were aligned (Fig. 1D). Lhx3 selected a strict AT-rich consensus sequence (tAATTAATTAa). We refer to this sequence as the Lhx3-Binding Consensus sequence (or LBC), and we chose a selected site (site 5, Fig. 1D) for use in further experiments. This site was picked because it contains a perfect LBC sequence, but it is important to note that many of the other selected
243
sites also contain the LBC sequence. The DLhx3 protein selected a consensus with the same core sequence (Fig. 2), indicating that the Lhx3 LIM domains do not regulate the specificity of DNA site binding. The LBC site contains a repeat of the ATTA sequence that often is found in the binding sites of HD transcription factors, suggesting that the site might be occupied by a Lhx3 dimer. To investigate the stoichiometry of Lhx3/LBC interaction, we performed UV crosslinking analyses. These experiments indicated that Lhx3 binds predominantly in the monomer form (Fig. 3A), consistent with other studies that demonstrate LIM-HD proteins binding DNA as monomers (Behravan et al., 1997). At very high Lhx3 protein concentrations, we do observe some apparent dimer/DNA complexes in EMSA experiments, but the majority of binding remains monomeric (data not shown). To determine the affinity of Lhx3/LBC DNA binding, a competition analysis was performed using increasing levels of unlabeled LBC site in an EMSA experiment (Fig. 3B). The bound and free complexes were quantified in the resulting gel. Scatchard analysis of this data indicated that the Kd for full-length Lhx3/LBC interaction was 1.2 £ 10 29 M. To characterize the physical nature of Lhx3 interaction with the LBC DNA site, we determined whether distamycin, a drug that is known to bind to the minor groove of AT-rich DNA, would compete with Lhx3 binding to the LBC in EMSA experiments. At concentrations of 1.5 mM and greater, distamycin interfered with Lhx3 binding to the LBC sequence (Fig. 3C). Similar effects were seen in reac-
Fig. 2. DNA sites selected by Lhx3 protein lacking the LIM domains (DLhx3). Alignment of sites selected by DLhx3 after five rounds of selection. The frequency of nucleotides within the selected sites is given. Uppercase letters represent nucleotides with the strongest frequency of selection; lowercase letters represent nucleotides with a predominant frequency of selection.
244
J.L. Bridwell et al. / Gene 277 (2001) 239–250
tions containing DLhx3 protein, except that higher concentrations of distamycin were required to achieve equivalent levels of inhibition, due to the higher affinity of binding of DLhx3 (Fig. 3C). Inhibition of Lhx3 binding was not observed in control experiments using mithramycin A, a drug that interacts with GC-rich DNA (Fig. 3D). We also examined the ability of non-recombinant Lhx3 to interact with the LBC site. Human embryonic kidney 293 cells (that do not express Lhx3) were stably transfected with an expression vector encoding Lhx3 with a myc epitope tag and a clonal cell line was derived. Protein extracts were prepared from both this cell line and the parent line and were used in EMSA experiments with a LBC probe. An LBC-binding complex was observed in reactions containing
protein from the Lhx3-expressing cells but not the parent cell line (closed arrow, Fig. 4). This complex was disrupted by anti-Lhx3 antibodies, but not by pre-immune serum (Fig. 4). Addition of an antibody against the myc epitope resulted in a supershift of the Lhx3/LBC complex (open arrow, Fig. 4). This experiment demonstrates that non-recombinant Lhx3 in a complex mixture of cellular proteins specifically recognizes the LBC site. 3.2. The LBC sequence confers Lhx3-dependent transcriptional activation upon heterologous promoters We analyzed the DNA sequence requirements for Lhx3 interaction with the LBC site. The LBC contains two ATTA
Fig. 3. Analysis of Lhx3 binding to the selected consensus sequence. (A) UV crosslinking analysis. DLhx3 protein was crosslinked to radiolabeled LBC oligonucleotide probe and the products were analyzed by denaturing electrophoresis. The migration positions of radiolabeled protein molecular markers (in kilodaltons) are indicated. Lane 1 ¼ no UV treatment; lane 2 ¼ no protein added; lane 3 ¼ DNase I added; lane 4 ¼ complete reaction with DLhx3 protein; lane 5 ¼ nuclease treatment omitted; lane 6 ¼ proteinase K added. The arrow indicates the DLhx3/DNA complex in the complete reaction. (B) EMSA competition assay to determine the Kd of Lhx3 with the LBC site. Equivalent amounts of radiolabeled LBC were incubated with Lhx3 protein and various concentrations of cold competitor LBC (0 to 1500-fold excess). Bound complexes (b) then were separated from free probe (f) by electrophoresis and the complexes were quantified using a phosphorimager. (C) Distamycin competes with Lhx3 and DLIM Lhx3 for interaction with the LBC site. EMSA analyses using Lhx3 and DLhx3 proteins and radiolabeled LBC probe were performed in the presence of increasing concentrations of distamycin (1.5 mM to 100 mM). (D) EMSA analyses using LBC probe and Lhx3 or DLhx3 proteins in the presence of 1.5 mM to 100 mM mithramycin.
J.L. Bridwell et al. / Gene 277 (2001) 239–250
motifs. Mutations were introduced to disrupt either the first motif (LBC M1, Fig. 5A), the second motif (LBC M2), or both motifs (LBC M3). These sites then were tested for Lhx3 and DLhx3 binding in EMSA reactions containing equivalent amounts of each protein (Fig. 5B). Mutation of the second ATTA motif (LBC M2) had a more severe effect than mutation of the first (LBC M1). Although Lhx3 bound poorly to both the M1 and M2 mutants, DLhx3 bound much better to the LBC M1 site than to the LBC M2 site (Fig. 5B). Mutation of both motifs (LBC M3) abolished Lhx3 and DLhx3 binding entirely (Fig. 5B). In these experiments, we also compared Lhx3 binding to the LBC to its binding to the aGSU gene PGBE. LIM-HD proteins such as Lhx2 and Lhx3 can induce transcription from the aGSU gene by binding to this element (e.g. Roberson et al., 1994; Meier et al., 1999) and transgenic experiments indicate that it is required to restrict expression of the aGSU gene to the appropriate pituitary cell types (Brinkmeier et al., 1998). The LBC is a higher affinity Lhx3 binding site than the PGBE (Fig. 5B). Similar data were obtained in experiments using recombinant Lhx3 proteins that were cleaved from GST using thrombin (data not shown). Together, these
245
data indicate that the ATTA motifs are critical for Lhx3 recognition of the LBC. Intriguingly, the downstream motif appears to be more important for Lhx3 binding suggesting that the LBC has polarity and that the sequences outside the core impact Lhx3 recognition. We next determined whether the LBC site could mediate Lhx3 transcriptional activation. Synthetic luciferase reporter genes were constructed such that three copies of the LBC, LBC M1, LBC M2, or LBC M3 elements were directionally cloned next to a minimal promoter derived from the rat PRL gene. This promoter was chosen because it is a TATA box-containing region that does not contain response elements for other transcription factors and has previously been used to study individual transcription factor response elements. These plasmids were transiently co-transfected into 293 cells with titrated amounts of an Lhx3 expression vector. Lhx3 induced transcription from the LBC reporter gene (Fig. 5C), demonstrating that the LBC was capable of mediating Lhx3 activity. Lhx3 also activated transcription from reporter genes containing LBC elements cloned next to the thymidine kinase and Pit-1 gene promoters (data not shown). A reporter gene containing the LBC M1 element was induced by Lhx3 but was not as potent as the wild type LBC reporter gene (Fig. 5C). Consistent with the observed levels of Lhx3 binding to these elements, reporter genes containing the LBC M2 or LBC M3 elements did not respond to Lhx3 (Fig. 5C). Lhx3 also activated a reporter gene containing four copies of the aGSU PGBE in control experiments (Fig. 5C). We conclude that the LBC can confer Lhx3-dependent transcription and that the second ATTA motif is most critical for this function. 3.3. Comparison of the Lhx3 LBC site with other DNA elements
Fig. 4. Analysis of LBC interaction with protein extracts from Lhx3-expressing cells. Mouse Lhx3 with a myc epitope tag (myc-Lhx3) was expressed in heterologous human 293 cells. Protein extracts were made and used in EMSA analysis with a radiolabeled LBC probe. Antibodies against Lhx3 (aLhx3), the myc epitope (amyc), or preimmune serum (PI) were added to reactions to confirm the specificity of interactions. The closed arrow indicates the myc-Lhx3/LBC complex; the open arrow denotes the larger mycLhx3/LBC/amyc complex. f ¼ free probe.
A previous study using a biased pool of oligonucleotides also has determined a consensus site for the full-length Lhx3 molecule (Girardin et al., 1998). The binding site defined by Girardin et al. [ANNAG(G/T)AAA(T/C)GA(C/G)AA] is similar to a sequence located at 2205 bp in the rat PRL promoter (Girardin et al., 1998). We therefore examined binding of Lhx3 to this element. Equivalent amounts of cold competitor oligonucleotides were added to EMSA reactions containing full-length Lhx3 and labeled LBC site (Fig. 6A). After electrophoresis, bound and free complexes were quantified by phosphorimager scanning and the percent inhibition of Lhx3 binding was calculated. The LBC site was the strongest inhibitor, followed by the aGSU PGBE element, and the LBC M1, M2, and M3 mutant oligonucleotides (Fig. 6B). The PRL 2205 site and a mutated version of this sequence (PRL 2205m) were relatively poor competitors, exhibiting weaker Lhx3 binding than the non-functional LBC M2 element (Fig. 6B). We conclude that the PRL 2205 site is a relatively low affinity Lhx3 binding site and the biological significance of this element is not clear.
246
J.L. Bridwell et al. / Gene 277 (2001) 239–250
3.4. Lhx3 bends DNA sequences containing the LBC site in a LIM-independent fashion Transcription factor interaction with DNA recognition elements can not only result in the recruitment of coregu-
latory proteins but also can result in alteration of local DNA topology. Such interactions may mediate association of protein/DNA complexes and increase transcription rates at specific promoters. We tested the hypothesis that Lhx3 has such architectural properties using circular permutation
Fig. 5. The Lhx3 binding consensus sequence confers Lhx3-dependent activation to a heterologous promoter. (A) Sequences of the selected LBC site, mutant derivatives of the LBC, and the PGBE element from the aGSU gene promoter. (B) EMSA analysis comparing interaction of radiolabeled probes of equal specific activities representing the LBC, mutant LBC, or aGSU sites with equivalent amounts of Lhx3 and DLhx3 proteins. f ¼ free probe. (C) 293 cells were transiently co-transfected with a Lhx3 expression vector and the indicated reporter genes. Luciferase activity was determined after 48 h. Representative experiments of at least four experiments are shown. Values represent means of triplicate samples ^SEM.
J.L. Bridwell et al. / Gene 277 (2001) 239–250
247
Fig. 6. Competition analysis comparing the relative affinities of the LBC, mutant LBC, aGSU, and PRL 2205 sites for interaction with Lhx3. (A) EMSA was performed using Lhx3 and a radiolabeled LBC probe in the presence of 100-fold excess of the indicated cold competitor sites. PRL-205m ¼ mutated PRL 2205 site (see Section 2); b ¼ bound complexes; f ¼ free probe. Gels then were analyzed using a phosphorimager and the degree of inhibition of LBC binding was calculated (panel B).
Fig. 7. Lhx3 bends DNA molecules containing the consensus binding site. (A) The Lhx3 binding consensus (LBC) site was cloned into the Xba I site of the pBend2 plasmid. (B) DNA fragments of identical length with different placements of the LBC site were generated by digestion with the indicated restriction enzymes. (C) Circular permutation/EMSA analysis using Lhx3 and the LBC-containing fragments from panel B. b ¼ bound complexes, f ¼ free probes.
248
J.L. Bridwell et al. / Gene 277 (2001) 239–250
experiments. An oligonucleotide containing the LBC sequence was cloned into the pBEND2 plasmid (Fig. 7A). The resulting plasmid then was digested with restriction enzymes to generate of series of DNA fragments of equal length and composition with the LBC site located at various positions within the molecules (Fig. 7B). These DNA fragments then were radiolabeled and used in EMSA with full-length and DLhx3 proteins. Full-length Lhx3 bound to the LBC-containing DNA fragments and the observed protein/DNA complexes migrated at a slower rate in reactions containing DNA fragments with a centrally placed LBC site (Fig. 7C). By contrast, the free probes all exhibited similar migration rates (Fig. 7C). These data are consistent with Lhx3/LBC interaction resulting in a bending of the DNA molecule. Comparisons of the migration rates of the bound and free complexes indicate a bending angle of 628. Experiments using the DLhx3 protein also record a bending angle of 628 (data not shown), indicating that the LIM domains do not impact the ability of the Lhx3 molecule to bend DNA.
4. Discussion In this study, we demonstrate that the Lhx3 LIM-HD transcription factor binds to an AT-rich consensus sequence (LBC) at high affinity with minor groove contacts. The LIM domains regulate the affinity of Lhx3 DNA interaction but do not modulate the sequence specificity of the molecule. The LBC is able to confer Lhx3-dependent transcription to heterologous promoters and the DNA molecule is bent in Lhx3/LBC complexes. Recent experiments have suggested that the manner by which the Pit-1 transcription factor interacts with specific DNA elements may determine its transcriptional activity in differentiated cell types (Scully et al., 2000). Pit-1 is an essential regulator of the growth hormone (GH), PRL, and TSHb genes in the somatotrope, lactotrope, and thyrotrope pituitary cell types, respectively. Scully and colleagues (2000) demonstrate that whereas the Pit-1 protein activates the GH gene in the somatotrope, it serves as a repressor of GH in the (PRL-expressing) lactotrope cell. This differential activity is mediated by the nature of Pit-1 interaction with binding sites in the GH gene. Structural studies demonstrate that there are striking differences in the minor groove contacts of the amino-terminal arm of the POU HD of Pit1 with binding sites from the GH and PRL genes. It is proposed that the distinct conformations of Pit-1 allow selective recruitment of coregulatory proteins, thereby mediating cell-specific gene expression (Scully et al., 2000). Like Pit-1, Lhx3 is expressed in multiple anterior pituitary cell types and is required for their development (Sheng et al., 1997). The data presented in this study (defining a high-affinity Lhx3 recognition sequence that features minor groove contacts) will provide a basis for future investigation of the mechanisms by which
Lhx3 might achieve cell-specific actions. Indeed, in this study, we demonstrate that the selected Lhx3 consensus site is related to the PGBE element in the aGSU gene, and similar DNA binding sites are important in regulation of the rat gonadotropin-releasing hormone receptor gene (Pincas et al., 2001). Investigation of additional candidate Lhx3 binding sites in other pituitary and nervous system genes is underway. The DNA molecule is bent to an angle of 628 in Lhx3/ LBC complexes. In this study, the characterization of DNA bending by Lhx3 served as an additional assay of the role the LIM domains play in Lhx3/DNA interactions. However, nuclear DNA-binding proteins may serve architectural functions by altering the topology of genes in order to indirectly increase or decrease the rate of transcription from the gene. Such architectural transcription factors have been reported to often recognize and bend AT-rich DNA sequences (including minor groove interaction) and to be associated with the nuclear matrix (reviewed in Bewley et al., 1998). The nuclear matrix is an insoluble proteinaceous nuclear substructure that has been hypothesized to mediate the actions of some extranuclear and extracellular signals that result in altered gene expression. In addition, transcriptionally active genes may be associated with the nuclear matrix (reviewed in Lelie`vre et al., 1996). Indeed, some gene loci contain matrix attachment regions containing many copies of the ATTA sequence that is the core of some HD recognition sequences. These regions have been proposed as recruitment sites for gene regulatory proteins. HD transcription factors, including Lhx3 and Pit-1, have been demonstrated to be associated with the nuclear matrix (Mancini et al., 1999; Parker et al., 2000). Further, Lhx3 has been demonstrated to synergize with the Pit-1 pituitary transcription factor to activate the PRL, TSHb, and Pit-1 pituitary-specific genes (Meier et al., 1999; Sloop et al., 1999, 2001a). The observations that Lhx3 prefers an AT-rich binding site, interacts with the minor groove, and significantly bends DNA are consistent with Lhx3 being a multifunctional protein that has properties in common with architectural transcription factors, and that these activities may play important roles in higher-order transcription factor interactions in the regulation of tissue-specific genes in the pituitary and ner-vous system. The role of the LIM domains in LIM-HD protein activities is complex. For example, the LIM domains of apterous are specifically required for axon pathfinding in Drosophila; LIM domains from other proteins cannot perform this role, implying specificity of LIM domain function in target gene regulation (O’Keefe et al., 1998). Gene targeting experiments demonstrate that the LIM domains are essential for function of the mouse Lim1/ Lhx1 protein (Cheah et al., 2000). The demonstration that a point mutation in the LIM domains of the Lhx3 protein is associated with a severe endocrine disease (Netchine et al., 2000) and that this mutation impairs the
J.L. Bridwell et al. / Gene 277 (2001) 239–250
ability of Lhx3 to activate pituitary genes (Sloop et al., 2001a; Howard and Maurer, 2001) underscores the importance of the LIM domains for Lhx3 function in vivo. In addition, alternate isoforms of Lhx3 (with distinct amino termini) display different DNA binding activities; the alternate domains may indirectly regulate DNA binding in part by affecting the LIM domains (Sloop et al., 1999). However, we recently have identified a novel truncated form of Lhx3 (M2-Lhx3) that lacks the LIM domains but retains some gene activation activities, suggesting that not all Lhx3 functions are LIM domain-dependent (Sloop et al., 2001b). In this study we demonstrate that the LIM domains of Lhx3 regulate the DNA binding affinity, but not the specificity, of Lhx3. By contrast, studies of Isl-1 show that the full-length protein does not recognize a specific sequence but a truncated protein lacking LIM domains selects a high affinity consensus sequence (Sa´ nchez-Garcia et al., 1993). A third type of observation has been made for the Lmx1 and Isl-2 LIM-HD proteins; in these factors, the LIMs do not affect DNA binding (Gong and Hew, 1994; Jurata and Gill, 1997). These data suggest that there are at least three classes of LIM-HD proteins in which the LIM domains play unique roles in regulation of nucleic acid interaction. Future studies are required to determine the role of known and uncharacterized LIM-interacting partner proteins in regulating the actions of the LIM domains. Acknowledgements We are grateful to Drs. J. Bidwell, B. Blazer-Yost, E. Long, J. Voss, and D. Williams for reagents and constructive discussions. We thank Dr. Lisa Cushman for comments on the manuscript. Supported by grants to SJR from the National Science Foundation and the U.S. Department of Agriculture National Research Initiative Competitive Grants Program. References Amendt, B.A., Sutherland, L.B., Semina, E.V., Russo, A.F., 1998. The molecular basis of Rieger syndrome. Analysis of Pitx2 homeodomain protein activities. J. Biol. Chem. 273, 20066–20072. Bach, I., 2000. The LIM domain: regulation by association. Mech. Dev. 91, 5–17. Behravan, G., Lycksell, P.O., Larsson, G., 1997. Expression, purification and characterization of the homeodomain of rat ISL-1 protein. Protein Eng. 10, 1327–1331. Bewley, C.A., Gronenborn, A.M., Clore, G.M., 1998. Minor groove-binding architectural proteins: structure, function, and DNA recognition. Annu. Rev. Biophys. Biomol. Struct. 27, 105–131. Blackwell, T.K., Weintraub, H., 1990. Differences and similarities in DNAbinding preferences of MyoD and E2A protein complexes revealed by binding site selection. Science 250, 1104–1111. Brinkmeier, M.L., Gordon, D.F., Dowding, J.M., Saunders, T.L., Kendall, S.K., Sarapura, V.D., Wood, W.M., Ridgway, E.C., Camper, S.A., 1998. Cell-specific expression of the mouse glycoprotein hormone alpha-subunit gene requires multiple interacting DNA elements in transgenic mice and cultured cells. Mol. Endocrinol. 12, 622–633.
249
Cheah, S.S., Kwan, K.M., Behringer, R.R., 2000. Requirement of LIM domains for LIM1 function in mouse head development. Genesis 27, 12–21. Girardin, S.E., Benjannet, S., Barale, J.C., Chretien, M., Seidah, N.G., 1998. The LIM homeobox protein mLIM3/Lhx3 induces expression of the prolactin gene by a Pit-1/GHF-1-independent pathway in corticotroph AtT20 cells. FEBS Lett. 431, 333–338. Glenn, D.J., Maurer, R.A., 1999. MRG1 binds to the LIM domain of Lhx2 and may function as a coactivator to stimulate glycoprotein hormone alpha-subunit gene expression. J. Biol. Chem. 274, 36159–36167. Gong, Z., Hew, C.L., 1994. Zinc and DNA binding properties of a novel LIM homeodomain protein Isl-2. Biochemistry 33, 15149–15158. Hobert, O., Westphal, H., 2000. Functions of LIM-homeobox genes. Trends Genet. 16, 75–83. Howard, P.W., Maurer, R.A., 2000. Identification of a conserved protein that interacts with specific LIM homeodomain transcription factors. J. Biol. Chem. 275, 13336–13342. Howard, P.W., Maurer, R.A., 2001. A point mutation in the LIM domain of Lhx3 reduces activation of the glycoprotein hormone alpha-subunit promoter. J. Biol. Chem. 276, 19020–19026. Jurata, L.W., Gill, G.N., 1997. Functional analysis of the nuclear LIM domain interactor NLI. Mol. Cell. Biol. 17, 5688–5698. Kim, J., Zwieb, C., Wu, C., Adhya, S., 1989. Bending of DNA by generegulatory proteins: construction and use of a DNA bending vector. Gene 85, 15–23. Lelie`vre, S., Weaver, V.M., Bissell, M.J., 1996. Extracellular matrix signaling from the cellular membrane skeleton to the nuclear skeleton: a model of gene regulation. Rec. Prog. Horm. Res. 51, 417–432. Mancini, M.G., Liu, B., Sharp, Z.D., Mancini, M.A., 1999. Subnuclear partitioning and functional regulation of the Pit-1 transcription factor. J. Cell. Biochem. 72, 322–338. Meier, B.C., Price, J.R., Parker, G.E., Bridwell, J.L., Rhodes, S.J., 1999. Characterization of the porcine Lhx3/LIM-3/P-Lim LIM homeodomain transcription factor. Mol. Cell. Endocrinol. 147, 65–74. Netchine, I., Sobrier, M.L., Krude, H., Schnabel, D., Maghnie, M., Marcos, E., Duriez, B., Cacheux, V., Moers, A., Goossens, M., Gruters, A., Amselem, S., 2000. Mutations in LHX3 result in a new syndrome revealed by combined pituitary hormone deficiency. Nat. Genet. 25, 182–186. O’Keefe, D.D., Thor, S., Thomas, J.B., 1998. Function and specificity of LIM domains in Drosophila nervous system and wing development. Development 125, 3915–3923. Parker, G.E., Sandoval, R.M., Feister, H.A., Bidwel, J.P., Rhodes, S.J., 2000. The homeodomain coordinates nuclear entry of the Lhx3 neuroendocrine transcription factor and association with the nuclear matrix. J. Biol. Chem. 275, 23891–23898. Pincas, H., Amoyel, K., Counis, R., Laverriere, J.N., 2001. Proximal cisacting elements, including steroidogenic factor 1, mediate the efficiency of a distal enhancer in the promoter of the rat gonadotropin-releasing hormone receptor gene. Mol. Endocrinol. 15, 319–337. Roberson, M.S., Schoderbek, W.E., Tremml, G., Maurer, R.A., 1994. Activation of the glycoprotein hormone alpha subunit promoter by a LIM-homeodomain transcription factor. Mol. Cell. Biol. 14, 2985– 2993. Sa´ nchez-Garcia, I., Osada, H., Forster, A., Rabbitts, T.H., 1993. The cysteine-rich LIM domains inhibit DNA binding by the associated homeodomain in Isl-1. EMBO J. 12, 4243–4250. Scully, K.M., Jacobson, E.M., Jepsen, K., Lunyak, V., Viadiu, H., Carriere, C., Rose, D.W., Hooshmand, F., Aggarwal, A.K., Rosenfeld, M.G., 2000. Allosteric effects of Pit-1 DNA sites on long-term repression in cell type specification. Science 290, 1127–1131. Sharma, K., Sheng, H.Z., Lettieri, K., Li, H., Karavanov, A., Potter, S., Westphal, H., Pfaff, S.L., 1998. LIM homeodomain factors Lhx3 and Lhx4 assign subtype identities for motor neurons. Cell 95, 817– 828. Sheng, H.Z., Moriyama, K., Yamashita, T., Li, H., Potter, S.S., Mahon,
250
J.L. Bridwell et al. / Gene 277 (2001) 239–250
K.A., Westphal, H., 1997. Multistep control of pituitary organogenesis. Science 278, 1809–1812. Sloop, K.W., Meier, B.C., Bridwell, J.L., Parker, G.E., Schiller, A.M., Rhodes, S.J., 1999. Differential activation of pituitary hormone genes by human Lhx3 isoforms with distinct DNA binding properties. Mol. Endocrinol. 13, 2212–2225. Sloop, K.W., Parker, G.E., Hanna, K.R., Wright, H.A., Rhodes, S.J., 2001a.
LHX3 transcription factor mutations associated with combined pituitary hormone deficiency impair the activation of pituitary target genes. Gene 265, 61–69. Sloop, K.W., Dwyer, C., Rhodes, S.J., 2001b. An isoform-specific inhibitory domain regulates the LHX3 LIM homeodomain factor holoprotein and the production of a functional alternate translation form. J. Biol. Chem. (in press).