Role of the LolP cytochrome P450 monooxygenase in loline alkaloid biosynthesis

Fungal Genetics and Biology 45 (2008) 1307–1314

Contents lists available at ScienceDirect

Fungal Genetics and Biology journal homepage: www.elsevier.com/locate/yfgbi

Role of the LolP cytochrome P450 monooxygenase in loline alkaloid biosynthesis Martin J. Spiering a,1, Jerome R. Faulkner a, Dong-Xiu Zhang a, Caroline Machado a, Robert B. Grossman b, Christopher L. Schardl a,* a b

Department of Plant Pathology, University of Kentucky, 201F Plant Science Building, 1405 Veterans Drive, Lexington, KY 40546-0312, USA Department of Chemistry, University of Kentucky, Lexington, KY 40506-0055, USA

a r t i c l e

i n f o

Article history: Received 16 April 2008 Accepted 1 July 2008 Available online 8 July 2008 Keywords: Epichloë Grass endophyte Loline alkaloids Pyrrolizidine N-Formylation Neotyphodium uncinatum P450 monooxygenase

a b s t r a c t The insecticidal loline alkaloids, produced by Neotyphodium uncinatum and related endophytes, are exo-1aminopyrrolizidines with an ether bridge between C-2 and C-7. Loline alkaloids vary in methyl, acetyl, and formyl substituents on the 1-amine, which affect their biological activity. Enzymes for key loline biosynthesis steps are probably encoded by genes in the LOL cluster, which is duplicated in N. uncinatum, except for a large deletion in lolP2. The role of lolP1 was investigated by its replacement with a hygromycin B phosphotransferase gene. Compared to wild type N. uncinatum and an ectopic transformant, DlolP1 cultures had greatly elevated levels of N-methylloline (NML) and lacked N-formylloline (NFL). Complementation of DlolP1 with lolP1 under control of the Emericella nidulans trpC promoter restored NFL production. These results and the inferred sequence of LolP1 indicate that it is a cytochrome P450, catalyzing oxygenation of an N-methyl group in NML to the N-formyl group in NFL. Ó 2008 Elsevier Inc. All rights reserved.

1. Introduction Lolines (exo-1-aminopyrrolizidines) (Fig. 1) are fungal alkaloids produced in cool-season grasses (Poaceae; subfamily Pooideae) infected by endophytic fungi of the genus Epichloë (Clavicipitaceae) and their asexual derivatives, the Neotyphodium species (Bush et al., 1993; Lane et al., 2000; Schardl et al., 2007; Schardl et al., 2004; Siegel et al., 1990). Occurrence of the lolines has also been reported from some plant species within the Fabaceae and Convolvulaceae (Hartmann and Witte, 1995; Tofern et al., 1999). The lolines have powerful insecticidal activity (Dougherty et al., 1999; Riedell et al., 1991; Wilkinson et al., 2000) and accumulate to high concentrations in some grass-endophyte symbiota (Craven et al., 2001; Tepaske et al., 1993). The loline chemical structure consists of three heterocyclic rings, including a saturated pyrrolizidine. Other pyrrolizidine alkaloids (necines), bearing some structural similarities to the lolines, are produced by plant species belonging to several families (Bush et al., 1993; Schardl et al., 2007). However, an unusual ether bridge between C-2 and C-7, a completely saturated pyrrolizidine ring, and an amino group at C-1 are structural features distinguishing the lolines from the necines (Bush et al., 1993; Schardl et al., 2007). Unlike the necines, which have potent anti-mammalian activities (Hartmann and Witte, 1995;

* Corresponding author. Fax: +1 859 323 1961. E-mail address: [email protected] (C.L. Schardl). 1 Present address: Center for Advanced Research in Biotechnology, UMBI, Rockville, MD, USA. 1087-1845/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.fgb.2008.07.001

Pelser et al., 2005), notably strong hepatotoxicity and carcinogenicity (Fu et al., 2004), lolines lack significant mammalian toxicity (Jackson et al., 1996). The potent insecticidal activity of the lolines and the lack of anti-mammalian activity have generated interest in these compounds as plant protectants. Studies of the loline alkaloid biosynthesis pathway were facilitated by identification of culture conditions for ex symbio expression of the alkaloids by Neotyphodium uncinatum (Blankenship et al., 2001), which remains the only isolate to produce lolines in culture. Results from applying isotopically labeled amino acids or putative intermediates to these loline-producing cultures have identified precursor amino acids (Blankenship et al., 2005) and biosynthetic intermediates (Faulkner et al., 2006), and indicate that loline biosynthesis follows a novel pathway different from the necine biosynthesis pathway (Hartmann and Witte, 1995). The loline precursor, L-homoserine (Hse) (probably in the form of O-acetylHse) is condensed with the secondary amine in L-proline (Pro) (Blankenship et al., 2005), giving N-(3-amino-3-carboxypropyl)proline as the first committed intermediate in the loline pathway (Faulkner et al., 2006). This c-substitution reaction is probably catalyzed by the product of the lolC gene, which is predicted to be a c-class pyridoxal phosphate (PLP)-containing enzyme (Spiering et al., 2002, 2005). Subsequent steps form the core pyrrolizidine ring, after which are added the ether linkage between C-2 and C7, and methyl, acetyl, or formyl groups on the C-1 amine (Faulkner et al., 2006). The LOL gene cluster in Epichloë festucae is genetically linked to loline alkaloid production (Kutil et al., 2007; Wilkinson et al.,

1308

M.J. Spiering et al. / Fungal Genetics and Biology 45 (2008) 1307–1314

Loline H

NL

CH3

H

O

C

CH3

NML N 4

NFNL

CH3

H

CH3

5

H

NFL O

N

N 6

O

N

3 8

7

O

CH3

C

H H

2

NAL

N

N

N

1

NANL

CH3

C H

CH3

O

N C H

Fig. 1. Structures of the loline alkaloids identified in grass-epichloë symbiota. Shown are the complete structure of norloline (NL) and the substituted 1-amine structures in loline, N-acetylnorloline (NANL), N-acetylloline (NAL), N-methylloline (NML), N-formylnorloline (NFNL), and N-formylloline (NFL).

2000). Two copies of the cluster have been characterized in N. uncinatum (Spiering et al., 2005), and predicted LOL gene products include PLP-containing enzymes (LolC, LolD, and LolT), a cytochrome P450 and a FAD-containing monooxygenase (LolP and LolF, respectively), and two non-heme iron oxidoreductases (LolO, LolE) (Spiering et al., 2005). These predicted enzyme functions fit well with a proposed biosynthesis pathway for the simplest loline alkaloid norloline (NL) (Faulkner et al., 2006; Schardl et al., 2007), though candidate genes for methylation, acetylation, and formylation of the 1-amine remain elusive. Biological activities of lolines are influenced by substituents of the 1-amine (Petroski et al., 1994; Riedell et al., 1991), and the grass endophytes produce mainly the more strongly insecticidal N-acetylnorloline (NANL), N-acetylloline (NAL), or N-formylloline (NFL). Both the N-methyl and N-formyl carbon atoms of NFL are derived from C-6 of L-methionine, suggesting that both are donated by S-adenosylmethionine in a classical methyltransferase reaction, initially giving N-methylloline (NML), of which one of the Nmethyl groups is subsequently oxygenated to the N-formyl group (Blankenship et al., 2005). Detailed studies of LOL gene roles in the loline alkaloid biosynthesis pathway would be facilitated by gene knockouts in N. uncinatum. Described herein is the first transformation and gene knockout in this fungus, which was used to characterize the function of the lolP1 gene product, a putative cytochrome P450 monooxygenase required for conversion of NML to NFL. 2. Materials and methods 2.1. Biological materials Fungal isolates were cultured from naturally infected plants as described previously (Blankenship et al., 2001). Epichloë amarillans ATCC 200744 was isolated from Agrostis hiemalis (plant 57 in our collection, from seed collected by James F. White, Jr. in Brazoria Co., TX), and Neotyphodium coenophialum was isolated from Lolium arundinaceum plant 4054 (from seed of PI 516564 of the Western Regional PI Station, Pullman, WA; collected in Morocco), and 4309 (from PI 598903, collected in Morocco). N. uncinatum CBS 102646 (W. Gams et al.) A.E. Glenn et al. (deposited in Centraalbureau voor Schimmelculture) was used in all transformation experiments and fungal cultures were grown in 20–50 ml shaking cultures as previously described (Blankenship et al., 2001). Loline alkaloid production by N. uncinatum was induced in minimal medium (MM) (Blankenship et al., 2001) with 15 mM urea and 20 mM sucrose as nitrogen and carbon sources. Three replicate cultures per treatment were used for loline alkaloid analysis. Escherichia coli strain XL1-Blue (Bullock et al., 1987) was used in DNA cloning.

2.2. General molecular techniques Plasmid DNA was isolated from bacterial cultures (LB medium at 37 °C for 16 h on a rotary shaker at 200 rpm) by the method of Ahn et al. (2000) or using the Qiaprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. Polymerase chain reactions (PCRs) for diagnostic gene detection were conducted with AmpliTaq Gold DNA polymerase (Applied Bioystems, Foster City, CA, USA) in manufacturer-provided PCR buffer with 1.5 mM MgCl2. PCR amplification for DNA cloning, thermocycler reactions, and long (>1 kb) PCR were performed with the LAPCR Vers 2.1 kit (Takara Shuzo Co., Otsu, Shiga, Japan) with PCR buffer containing 2.5 mM MgCl2. All oligonucleotides are listed in Table 1.

Table 1 Primers used in this study Name

Sequence

hph-1 hph-2 lolA-5-3 lolC-PLPsite-5-3 lolC-PLPsite-3-5 lolE1cDNA-3-5 lolP1cDNA5-3 lolP1cDNA3-5 lolP1deldetect1 lolP1deldetect2 lolP1disr1 lolP1disr2 lolP1disr3 lolP1disr4 lolP1disr5 lolP1disr6 lolP1disrnest1b lolP1disrnest2b lolp1trpcf lolP2cDNA5-3 lolP2cDNA3-5 lolP-5-3 lolP-3-5 lolU1-3-5 NcoI-Ety-tub2(3)20u nestedrevlolP outlolP1 protrpcf protrpC-5-3 revlolp1sap1 trpclolp1r XbaI-Nco-tub2(328)19d

TTCGTTGGAGATGAATTGGACAGC TGTAGAAGTACTCGCCGATAGTGG GTCTGGCGAATTCYACAGACACG GGTACTTTTGTCGTCCCATC RWAVCGRTYCSGGTGCTG GTTCTTGTCAAGTCTGCGCTT TTGCCGCCGACGGTTCATACAC ACCCCTGCCATGTGTATCCCT GCAACCTGTCGACTTCTCTC GCGTCGTCATGATGTACAGC GAAGACTAACTTCCACCGAGTCCTAG GGCTGCAGGAATTCGATATCAAGCCCAGGTTATGGGTGCTCCGTG CACGGAGCACCCATAACCTGGGCTTGATATCGAATTCCTGCAGCC ACCTCGCCCGCGTCAGGATATAGAACTAGTGGATCCATAACTTCG GTTATGGATCCACTAGTTCTATATCCTGACGCGGGCGAGGTATGA TCTTGTCAAGTCTGCGCTTCCACTG AATATGCGGCCGCTGTAGTACAAGTACAGCCGCATAG AATATGCGGCCGCTGGGACCGGTCAAAGTGGTAG GCATCGATATGGATCTGACCCAGTTCAACACAGC TTGCCACTGACGGCTCATACAG ACCACTGCCATGTGTATTCCC TTGCCRCYGACGGYTCATACAS ACCMCTGCCATGTGTATYCCY AACACGCCGAGGCTACTGAGGTTG CGCCATGGTCTCGGTTACTTGTTGACGA ACGAGAAGGCGACCCATCATCGATTACCGCGG TGGCGTCGAGCGCCATCTGA GTCGACAGAAGATGATATTGAAGGAGC GCTTGGCTGGAGCTAGTGGAGGTC TACACGAGAAGGCGACCCATCATCGATTACCGC GTTGAACTGGGTCAGATCCATATCGATGCTTCGGTAGAAT GCTCTAGACTGGTGCCTGAGATACCGC

1309

M.J. Spiering et al. / Fungal Genetics and Biology 45 (2008) 1307–1314

2.3. Plasmids and plasmid construction

Not I (671)

king regio - flan n

pKAES182

n regio ing k an

Not I (8607)

15 lP lo

10897 bp

loxP loxP

lo l P 13

- hp Pt ub B

- fl

loxP

h

Ptu

bB

XbaI (93) Nco I (428)

b le

pKAES183

b la

t erm

3529 bp

loxP

PtubB

UTR 3-

b le

te rm

lolP1

loxP

pKAES195 6287 bp

XmnI (2780)

a bl

pC

Ptr

The plasmid vector pBluescript SK+ (Stratagene, La Jolla, CA, USA) was used for cloning of gene-knockout constructs. The plasmid pKAES173 (CM and CLS, unpublished) was used as template to amplify the hygromycin B-phosphotransferase (hph) gene under control of the constitutive promoter of the tubB gene (PtubB) of Epichloë typhina (GenBank Accession No. X52616) (Wang et al., 2004), flanked by loxP sites (Hoess and Abremski, 1984). pKAES173, with a loxP-hph-loxP cassette, was constructed with pBC KS+ (Stratagene) digested with BamHI, half filled with dATP and dGTP by DNA polymerase I Klenow fragment (New England Biolabs, Ipswich, MA, USA), then ligated to adapters of 34 bp containing loxP sequence and partial BamHI and SalI overhangs. The overhangs were used to ligate the hph gene from pKAES080 (Tsai et al., 1992) digested with BamHI and SalI between the two loxP sites. A phleomycin-resistance construct, designated pKAES183 (Fig. 2), was created from pUG66 (EUROSCARF, Frankfurt, Germany) by replacing the yeast promoter with the E. festucae tubB promoter (PtubB) to drive the phleomycin-resistance (ble) gene in transgenic endophytes. The tubB promoter was PCR amplified (94 °C for 3 min; 35 cycles of 94 °C for 30 s, 55 °C for 40 s, and 72 °C for 1 min) with primer pair XbaI-Nco-tub2(-328)19d and NcoI-Ety-tub2(-3)20u in 50-ll reactions with 20 ng E. festucae genomic DNA. The PCR product and pUG66 were both digested with XbaI and NcoI, and gel-purified with the QIAquick Gel Extraction kit (Qiagen). The tubB promoter was ligated into pUG66 with Fast-Link DNA ligation kit (Epicentre, Madison, WI, USA). The start codon of ble was located within the NcoI site. A lolP1 knockout (ko) construct was created by using a PCRoverlap method as described by Davidson et al. (2002) to fuse lolP1-flanking DNA regions to either side of the loxP-hph-loxP cassette. PCR was performed with 5 ng N. uncinatum genomic DNA or 0.1 ng DNA of pKAES173 in 50 ll reactions. PCR conditions were 95 °C for 60 s; 7 cycles of 95 °C for 25 s, 66 °C for 3 min and 30 cycles of 95 °C for 25 s, 70 °C for 3 min. With primers lolP1disr1 and lolP1disr2, a 3.2-kb DNA fragment was amplified from N. uncinatum genomic DNA. The amplified fragment contained the 50 -flanking region of lolP1, beginning 124 bp upstream from the putative lolP1 start codon. With primers lolP1disr3 and lolP1disr4, a 1.4kb fragment containing the loxP-hph-loxP cassette was amplified from pKAES173. With primers lolP1disr5 and lolP1disr6, a 3.5-kb DNA fragment was amplified from N. uncinatum genomic DNA. This fragment included 229 bp from the 30 end of the lolP1 ORF, containing the last lolP1 intron (113 bp) and 116 bp of 30 -exon sequence including the lolP1 stop codon. The three fragments were pooled in equimolar amounts and co-purified with the QIAquick PCR Purification Kit (Qiagen) following the manufacturer0 s instructions. Primers were designed such that the lolP1 50 -flanking-region fragment had a 45-bp overlap with one end of the loxP-hph-loxP cassette, which in turn had a 41-bp overlap at the other end with the lolP1 30 -flanking region fragment. These overlaps were used to splice the loxP-hph-loxP cassette between the 50 and 30 lolP1 flanking regions: in a thermocycle reaction (95 °C for 1 min, followed by 10 cycles of 95 °C for 25 s, 70 °C for 9 min), 500 ng of the purified DNA fragments was used in a 20-ll reaction. The product was diluted 1:50, and 2 ll of this dilution used as template in a 100-ll PCR (95 °C for 1 min, followed by 25 cycles of 95 °C for 25 s, 70 °C for 8 min) with primers lolP1disrnest1b and lolP1disrnest2b (NotI sites had been incorporated at the 50 -ends of both primers). The 7942-bp product (DlolP1-hph ko fragment) was purified with the QIAquick PCR Purification Kit, cut with NotI and ligated (FastLink Ligation Kit, Epicentre) into NotI-cut pBluescript SK+. The resulting plasmid, named pKAES182 (Fig. 2), contained the loxPhph-loxP cassette between at least 3-kb lolP1 50 - and 30 -flanking regions, including the very 30 -terminal end of the lolP1 ORF, encoding

b la

loxP

Fig. 2. Plasmid constructs pKAES182, pKAES183, and pKAES195. These plasmids were designed for deletion of lolP1 by replacement with the hph (hygromycin B phosphotransferase) marker under control of the E. typhina tubB promoter (PtubB) (pKAES182), expression of the ble gene (bleomycin and phleomycin resistance) under control of PtubB (pKAES183), and complementation by the lolP1 gene under control of the E. nidulans trpC promoter (PtrpC) (pKAES195). Other features are the blactamase gene (bla) for ampicillin resistance in E. coli, loxP sites recognized by Cre recombinase, and restriction endonuclease cleavage sites as indicated. Plasmids are not drawn to the same scale.

amino acids 460 to 496 in LolP1, out of frame with the preceding sequence and excluding the putative heme-binding site (at amino acids 436 to 445) in LolP1 (Spiering et al., 2005). pKAES182 was electroporated into E. coli XL1-Blue cells, and transformed bacterial colonies were selected on ampicillin. A vector construct containing lolP1 under control of a constitutive fungal promoter was created with the PCR-overlap method as described above. A 369-bp fragment of the Emericella nidulans trpC promoter (PtrpC) was PCR amplified (95 °C for 9 min; 35 cycles of 95 °C for 30 s, 61 °C for 30 s, and 72 °C for 1 min) from pKAES097 (H.-F. Tsai and CLS unpublished), using primers protrpcf and trpclolp1r. A 2401-bp DNA fragment containing the entire lolP1 coding sequence (CDS) and 408 bp 30 -untranslated region (UTR) of lolP1 was PCR-amplified (95 °C for 5 min; 35 cycles of 95 °C for 30 s,

1310

M.J. Spiering et al. / Fungal Genetics and Biology 45 (2008) 1307–1314

63 °C for 30 s, and 72 °C for 3 min) using primers lolp1trpcf and revlolpsap1. Primer lolp1trpcf contained 17 bp of the 30 -end of the trpC promoter and the first 17 bp, including the first ATG, in lolP1 CDS. Primer trpclolP1r contained 18 bp of the final bases at the 30 -end of the trpC promoter followed by the first 22 bp of the 50 -end of the lolP1 CDS. The two PCR products were combined in a thermocycle extension reaction (10 cycles of 95 °C for 30 s and 70 °C for 3 min) to fuse the trpC promoter fragment with the lolP1 CDS. The product of this reaction was used in PCR (95 °C for 5 min; 35 cycles of 95 °C for 30 s, 58 °C for 30 s, 68 °C for 30 s, and 72 °C for 3 min) with protrpcf and nestedrevlolP. The 2759-bp PCR product contained the entire lolP1 CDS with the trpC promoter immediately 50 of the lolP1 start codon and 408 bp of lolP1 30 -UTR. This PtrpC-lolP1 product was gel purified, treated with the End-ItTM DNA end repair kit (Epicentre), and ligated into pKAES183 that had been digested with XbaI, filled in by DNA polymerase I Klenow fragment (New England Biolabs), and dephosphorylated by calf-intestinal alkaline phosphatase (New England Biolabs). The resulting plasmid containing phleomycin resistance marker and PtrpC-lolP1 construct was named pKAES195 (Fig. 2).

300 ll lysis buffer consisting of 40 mM Tris–acetate, 20 mM sodium acetate, 1 mM disodium ethylenediaminetetraacetic acid (EDTA), 1% sodium dodecyl sulfate (SDS), adjusted to pH 7.8 with glacial acetic acid. The suspension was incubated at 65 °C for 30– 45 min, and then 100 ll of 5 M NaCl was added. The solution was mixed, and then centrifuged 8 min at 10,000g, and the supernatant was transferred to a fresh tube to which was added an equal volume of chloroform. The sample was thoroughly mixed, then centrifuged for 8 min at 14,000g. The aqueous phase was transferred to a fresh tube to which was added two vol absolute ethanol; after inverting 10 times, the DNA was pelleted by centrifugation (10 min at 14,000g), then washed once with 70% ethanol, air dried, and taken up in 40 ll Tris–EDTA buffer pH 7.5. Diagnostic PCR (95 °C for 9 min, then 35 cycles of 95 °C for 25 s, 64 °C for 20 s, and 72 °C for 1 min) for presence of lolP1 was performed with primers lolP1deldetect1 and lolP1deldetect2; primers lolC-PLPsite-5-3 and lolC-PLPsite-3-5, specific to the lolC gene were used for internal PCR control amplification. PCR assays for integration of hph into the lolP1 locus employed primers hph-1 with lolE1cDNA-3–5 and hph-2 with lolA-5–3 (95 °C for 1 min, then 35 cycles of 95 °C for 25 s, 64 °C for 20 s, and 70 °C for 4 min).

2.4. Preparation of single-stranded (ss)DNA for fungal transformation 2.7. Complementation of lolP1-knockout transformant Approximately 5 lg of plasmid pKAES182 was digested with NotI and used as template in a 100-ll single-primer thermocycle reaction (95 °C for 1 min, followed by 10 cycles of 95 °C for 25 s, 70 °C for 8 min) with either primer lolP1disrnest1b or primer lolP1disrnest2b (Table 1). The ssDNA from each reaction was purified separately with the QIAquick PCR Purification Kit, ethanol precipitated, and taken up in 9 ll of sterile H2O. To each ssDNA was added 1 ll (5 lg) of E. coli RecA protein (Roche Molecular Diagnostics, Pleasanton, CA). The suspension was briefly mixed by gentle pipetting, and incubated at 37 °C for 30 min. The ssDNA-RecA mixture was placed on ice for 5 min and used directly in fungal transformation. 2.5. Fungal transformation Neotyphodium uncinatum was grown 5 days in 50 ml of MM with 30 mM urea and 40 mM sucrose, at 22 °C with rotary shaking (200 rpm) (Blankenship et al., 2001). Fungal mycelium was harvested by centrifugation (5000g) and treated for 3–4 h at 30 °C with 7 mg/ml b-glucanase (InterSpex Products, San Mateo, CA), 7 mg/ml driselase (InterSpex), 1 mg/ml zymicase I (InterSpex Products), 3 mg/ml glucanex (Novo Industri AS, Bagsvaerd, Denmark), and 5 mg/ml bovine serum albumin (Sigma, St. Louis, MO) in osmotic solution (1.2 MgSO4, 50 mM sodium citrate, pH 5.8). Protoplasts were isolated as described by Tsai et al. (1992). At 1–2 h before plating of the protoplasts, 7 ml of regeneration medium (Panaccione et al., 2001) with 80 lg/ml hygromycin B (Calbiochem; San Diego, CA) and 0.7% agarose (Sigma) was used to overlay 18 ml potato dextrose agar plate (PDA; prepared with 0.7% agarose) with hygromycin B at 80 lg/ml. Protoplasts were electroporated (Tsai et al., 1992) with the ssDNA-RecA mixture (see above), added to 4 ml regeneration medium with 0.7% agarose, and plated on the dual-layer PDA-regeneration medium plates. After growth for approximately 3 weeks at 22 °C, fungal colonies were transferred to MM agar plates (Blankenship et al., 2001) to induce sporulation, and single-spore isolated on PDA for further analysis. 2.6. Fungal genomic DNA isolation and diagnostic PCR assays Fungal genomic DNA for PCR assays was isolated by a modification of the method of Al-Samarrai et al. (2000). A small (approximately 10 mm2) fungal colony was ground with a micropestle in

Fungal mycelium was grown in 50 ml potato dextrose broth (PDB) at 22 °C with rotary shaking (200 rpm) for 5 days, and protoplasts were prepared as described above. XmnI-digested pKAES195 (5 lg) was added to the protoplasts for transformation using a polyethylene glycol method as described by Panaccione et al. (2001), and protoplasts were plated on regeneration plates as described above. The PDA layer contained phleomycin (Invivogen, San Diego, CA, USA) at a concentration (29 lg/ml) calculated to reach 25 lg/ml when equilibrated over the entire plate. Selection of transformants was performed by transferring colonies from transformation plates to PDA with phleomycin at 50 lg/ml and incubation at 22 °C for 2 weeks. The phleomycin-resistant colonies were single-spore isolated three times with selection on phleomycin, and genomic DNA was extracted as described above. The presence of the PtrpC-lolP1 construct was assessed by PCR (95 °C for 5 min; 35 cycles of 95 °C for 30 s, 63 °C for 30 s, and 72 °C for 1 min) with primers outlolP1 and protrpC-5-3. 2.8. Loline alkaloid analysis Extraction of lolines from lyophilized culture aliquots and analysis by gas chromatography (GC) was performed as previously described (Blankenship et al., 2001). Loline alkaloid extraction from grass material was performed with the same procedure, using lyophilized leaf clippings obtained from the greenhouse. Limits of detection were 10 lg/ml and 10 lg/g in fungal cultures and plant material, respectively (Spiering et al., 2002). Identities of the GC peaks corresponding to the different loline derivatives were confirmed by mass spectroscopy as described by Blankenship et al. (2005, 2001). 2.9. PCR screening for lolP To detect lolP in A. hiemalis infected by E. amarillans, primers lolP-5-3 and lolP-3-5 were used with a thermocycling regime of 95 °C for 9 min, followed by 35 cycles of 95 °C for 25 s, 60 °C for 20 s, and 72 °C for 2 min. PCR with primers lolP1cDNA5-3 and lolP1cDNA3-5 or lolP2cDNA5-3 and lolP2cDNA3-5 (95 °C for 5 min; 35 cycles of 95 °C for 30 s, 64 °C for 30 s, and 72 °C for 2.5 min) was used to detect lolP1 or lolP2, respectively, in N. coenophialum-infected L. arundinaceum plants 4054 and 4309.

M.J. Spiering et al. / Fungal Genetics and Biology 45 (2008) 1307–1314

3. Results 3.1. lolP1 knockout, protoplast regeneration, and analysis of loline phenotypes To knock out lolP1 in N. uncinatum by marker replacement via homologous genomic integration (Panaccione et al., 2001; Tanaka et al., 2005; Wang et al., 2004), we created a construct (pKAES182) consisting of more than 3 kb genomic DNA sequence from each side of the lolP1 open reading frame (ORF), with 1571 bp of the lolP1 gene replaced by a selectable loxP-hph-loxP cassette (Fig. 2). The deleted lolP1 region in this construct included the coding sequence for the putative heme-binding site and 124 bp lolP1 50 -UTR. Mycelium of N. uncinatum for transformation with the lolP1 knockout construct was grown under conditions known to induce expression of lolP1 (Spiering et al., 2005), since expression of genes targeted for knockout may increase the frequency of homologous integration (Natsume et al., 2004). To mimic DNA transfer as in Agrobacterium tumefaciens-based fungal transformation reported to increase rates of homologous integration (Michielse et al., 2005), the lolP1-ko construct was prepared as single-stranded (ss)DNA and mixed with RecA, a DNA-binding protein targeting ssDNA to homologous DNA double strands (Roberts and Roberts,

1311

1981). The mixture was used to transform N. uncinatum protoplasts. Protoplast-regeneration plates were prepared with PDA-regeneration multilayer medium, reducing the total amount of sucrose in regeneration plates, while maintaining osmotic protection of the protoplasts immediately after plating. Protoplasts plated in this way gave colonies that could be subcultured after 3 weeks of growth compared to at least 6 weeks for protoplasts on plates consisting entirely of regeneration medium (Spiering et al., 2005). Transformation of N. uncinatum protoplasts with the lolP1-ko construct gave 83 hygromycin-resistant colonies. Single-spored transformants were screened by a negative PCR test with two primers annealing within the lolP1 gene region targeted for deletion with the lolP1-ko construct (see Section 2), and multiplexed with a primer pair amplifying part of the lolC gene as a positive control for DNA integrity and PCR conditions. One transformant was identified from which amplification of the lolP1 allele was undetected (Fig. 3, panel B), and this transformant was designated DlolP1. PCR amplification with primers annealing to sites within the hph gene and to LOL1-cluster regions lying outside the lolP1ko construct confirmed homologous genomic integration of the entire lolP1-ko construct into lolP1 in this transformant (Fig. 3, panels C and D). The PCR-based analysis also suggested that the LOL1 regions 50 and 30 of the lolP1 ORF were left intact in DlolP1. PCR with

Fig. 3. PCR analysis of the lolP1 locus in DlolP1 and an ectopic strain. (A) Schematic of lolP1 replacement with hph and PCR-based detection of the replacement. A 10-kb-long region of the LOL1 cluster in N. uncinatum is shown: Black arrows and lines indicate lol genes and intergenic regions, respectively, and the white arrow and line indicates the hph gene and tubB promoter, respectively. Dashed lines indicate the replaced region. Thick bars indicate products expected from PCR with the primers indicated as half arrows lettered a–h. Primers were designated as follows: a = lolP1deldetect1, b = lolP1deldetect2, c = lolA-5–3, d = hph-2, e = hph-1, f = lolE1cDNA-3-5, g = lolU1-3–5, and h = lolP1disrnest2 (see Table 1 for primer sequences). Primer pair a with b was used to specifically detect lolP1 sequence, primer pairs c with d and e with f were used to detect the expected linkage of hph with flanking genomic sequence in DlolP1, and primer pairs h with d and e with g were used as PCR controls for the DlolP1 and ectopic strain. Bars indicate lengths of expected PCR products. (B) PCR-amplified fragments from lolP1 (primer pair a with b; 449 bp) and, as an internal PCR control, lolC (primer pair lolCPLPsite-5–3 with lolC-PLPsite-3–5; 143 bp). Template DNAs were from transformants ectopic strain (Ec) and DlolP1 (D). Size markers are in lane M, where arrowheads indicate the 100 bp and 500 bp markers. (C) PCR with primer pair c with d gave no product from genomic DNA of the ectopic strain (Ec), but gave a 4.4-kb DNA fragment from DlolP1 DNA (D). (D) PCR with primer pairs e with f (lanes 1 and 4), e with g (lanes 2 and 5), and d with h (lanes 3 and 6), using DNA templates from ectopic strain (lanes 1–3) and DlolP1 (lanes 4–6). Size markers are in lanes M of panels (C and D), where arrowheads indicate the 3-kb marker.

M.J. Spiering et al. / Fungal Genetics and Biology 45 (2008) 1307–1314

1.25 1.00 0.75

NFL NML NANL L

0.50

HO P E13

HO P E04

Ectop ic

0.00

ΔlolP 1

0.25

WT

the same primer combinations indicated ectopic integration of the lolP1-ko construct in another hygromycin-resistant transformant, designated ectopic strain. DlolP1 and ectopic strain were tested for loline production in culture. Both transformants produced lolines; however, whereas the ectopic strain produced loline, NML, NANL, and NFL, the DlolP1 cultures lacked NFL (Fig. 4). Deletion of lolP1 also affected the relative proportions of the lolines: DlolP1 accumulated 3–4-fold higher levels of NML than the ectopic strain cultures (significant at p < 0.001; t-test), and DlolP1 accumulated significantly (p < 0.01; t-test) lower levels of NANL compared to the ectopic strain (Fig. 5). Loline alkaloid profiles very similar to ectopic strain were obtained with two additional lolP1-ko construct ectopic transformants (not shown). To confirm that the lack of NFL production by DlolP1 was caused by the deletion of lolP1, a lolP1-complementation construct, pKAES195, was created and transformed into DlolP1. Titration with different phleomycin concentrations of pKAES183-transformed N. uncinatum protoplasts suggested an optimum phleomycin concentration of 20 lg/ml for selecting transformants. Two phleomycinresistant transformants, designated HOPE04 and HOPE13, were analyzed by Southern blot for presence of lolP1. The hybridization probe was a 430-bp DNA fragment spanning the region of lolP1 (575–1004 bp after the lolP1 start codon) that is not present in N. uncinatum lolP2. The results (not shown) confirmed deletion of lolP1 in DlolP1, also included in this analysis, and indicated genomic integration of a tandem array of twenty or more copies of pKAES195 into HOPE04 and HOPE13 (not shown). Both HOPE04 and HOPE13 accumulated NFL in loline-producing cultures (Fig. 5), indicating that reintegration of constitutively expressed lolP1 into DlolP1 restored production of NFL. HOPE04 accumulated significantly less (p < 0.05; t-test) NML than DlolP1 in culture.

Lolines (normalized peak areas)

1312

Fig. 5. Relative abundances of loline alkaloids in N. uncinatum strains. The lolines were analyzed from cultures of wild-type N. uncinatum (WT), knockout mutant DlolP1, the ectopic strain, and lolP1-complemented strains, HOPE04 and HOPE13. Bar graphs represent peak areas for each loline alkaloid normalized to the sum of all loline alkaloid peak areas (data show the means of 2–4 experiments). Abbreviations are: NFL = N-formylloline, NML = N-methylloline, NANL = N-acetylnorloline, and L = loline. Other lolines were not detected in the cultures. Error bars indicate standard error of the mean.

3.2. Absence of lolP associated with a lack of NFL We also tested if presence or absence of NFL in endophytegrass symbiota was associated with a corresponding variation in the lolP gene. GC–MS analysis of leaf extracts from A. hiemalis infected by E. amarillans, detected NL, loline, and NANL, but NFL was undetected. The predominant loline in E. amarillans-infected A. hiemalis was NANL (data not shown). In two Moroccan L. arundinaceum plants—designated 4054 and 4309—both infected with N. coenophialum, only NANL was detected (data not shown). PCR with genomic DNA from E. amarillans mycelium and lolP-specific primers annealing to both lolP1 and lolP2 of N. uncinatum, failed to give any amplification products (data not shown). PCR with genomic DNA from L. arundinaceum plants 4054 and 4309 infected by N. coenophialum and lolP1-specific primers failed to give amplification products, while lolP2-specific primers gave amplification of lolP2 sequence from both symbiota (data not shown). 4. Discussion

Fig. 4. Loline alkaloid production in DlolP1and ectopic strain. Shown are GC trace chromatograms from extracts from loline-induced cultures of (A) DlolP1 or (B) ectopic strain control. Equal amounts of each extract had been injected onto the GC. Retention times for NML, NANL, and NFL are indicated next to each peak.

In this study, procedures for protoplast regeneration and gene knockout by homologous integration in N. uncinatum were improved and gave the first targeted deletion mutant in this fungus. Deletion of lolP1 abolished production of NFL in cultures of N. uncinatum DlolP1. NFL accumulated in cultures of an N. uncinatum transformant with an ectopically integrated lolP1-knockout cassette and in cultures of DlolP1 expressing lolP1 by complementation. These results indicated that lolP1 is the only functional lolP allele in N. uncinatum CBS 102646, and demonstrated that LolP activity is required for the formation of NFL. Production of loline, NANL, and NML in DlolP1 cultures indicated that lolP is not required for the formation of the core pyrrolizidine ring structure, the ether bridge between C-2 and C-7, or methylation of the exo-1-amine group. Attempts to knock out LOL genes in N. uncinatum by markerreplacement methods commonly used for several epichloae (Panaccione et al., 2001; Tanaka et al., 2005; Wang et al., 2004), were previously unsuccessful, despite screening more than 350 hygromycin B-resistant transformants (unpublished results), suggesting a very low frequency of homologous integration in N. uncinatum. This, along with very slow regeneration of transformed protoplasts (Spiering et al., 2005), has hampered testing of gene function in N. uncinatum. Modified fungal transformation

M.J. Spiering et al. / Fungal Genetics and Biology 45 (2008) 1307–1314

and protoplast regeneration methods used here greatly decreased regeneration times of N. uncinatum protoplasts and gave a targeted gene knockout with a frequency of >1%. Duplicate LOL loci are present in N. uncinatum (Spiering et al., 2005), but we hypothesized that only one lolP allele, lolP1, may be functional because of a large (469-bp) intragenic deletion predicted to severely truncate the product of the second allele, designated lolP2 (Spiering et al., 2005). Abolished production of NFL in cultures of the N. uncinatum transformant, DlolP1, supports this hypothesis. PCR amplification of the lolP1 ko construct had the potential to introduce mutations into the lolP1-flanks in the ko construct; however, NFL production was restored by complementation with lolP1 expressed from the trpC promoter, indicating that loss of NFL production in DlolP1 was due to deletion of lolP1, and not caused by any PCR-generated mutations in genes or regulatory sequences flanking lolP1. Blankenship et al. (2005) demonstrated that label from 13 L-[6- C]methionine incorporates into NML and into the N-methyl and N-formyl groups in NFL. These results suggest that the N-formyl group is formed by oxidation of one of the N-methyl groups in NML. Significantly increased accumulation of NML in DlolP1 compared with cultures of the ectopic strain and one complemented DlolP1 supports the hypothesis that NML is a proximate precursor to NFL. The inferred LolP1 amino acid sequence has significant similarities to fungal cytochrome P450s, and has P450protein signature sequences (Spiering et al., 2005). Therefore, LolP1 is apparently a cytochrome P450 monooxygenase that probably catalyzes oxidation of an N-methyl group in NML to the N-formyl group in NFL. LolP-catalyzed oxygenation of NML rules out alternative reaction mechanisms for formation of NFL, such as condensation of formaldehyde with the C-1 amine in loline, a reaction suggested for the formation of N-formylnornicotine, from nornicotine (Bartholomeusz et al., 2005). At least two oxygenations are required for the NML-to-NFL conversion: hydroxylation of the N-methyl group giving an N-methylhydroxyl group followed by dehydrogenation of the alcohol to give the N-formyl group (Fig. 6). We do not know if LolP catalyzes both steps, but precedence exists for P450 monooxygenases catalyzing multiple reactions in a single biosynthetic pathway (Rojas et al., 2001; Saikia et al., 2007; Tokai et al., 2007). Munday-Finch et al. (1996) proposed formylation of C-30 in paspaline to give paspaline B in the fungus Penicillium paxilli. However, in contrast to the abundant end product, NFL, paspaline B may only be an intermediate in the sequential oxidation of paspaline to 13-desoxypaxilline catalyzed by the P450 enzyme, PaxP (Saikia et al., 2007). Two sequential LolP-catalyzed hydroxylations of the Nmethyl group in NML might give an unstable dihydroxylated methyl group, which, after spontaneous release of water, could give the formyl group in NFL. Such a mechanism has been proposed for formylation of carbon 8 in the conversion of heme O to heme A catalyzed by heme A synthase (CtaA) (Brown et al.,

1313

2004; Hederstedt et al., 2005). Methyl group oxidation to a formyl group is also used in the conversion of chlorophyll a to chlorophyll b via 7-hydroxymethyl chlorophyll catalyzed by chlorophyll a oxygenase (CAO) (Tanaka et al., 1998). However, both CtaA and CAO proteins show distinct differences from LolP in structure and mechanisms; CtaA lacks typical P450 signatures and CAO contains a [2Fe–2S] Rieske center in its active domain (Tanaka et al., 1998). Reduction of the prosthetic heme-iron P450 cofactor—a prerequisite for substrate oxygenation by the cytochrome P450—requires the activity of an NAD(P)H-dependent oxidoreductase or other enzymes (McLean et al., 2005; Munro et al., 2007). NADPHcytochrome P450 oxidoreductase (CPR) forms a multi-enzyme complex with the P450 monooxygenase it reduces (Munro et al., 2007). In the related fungus, Gibberella fujikuroi, one cpr gene (GenBank Accession No. AJ576025) was identified and determined to be essential for P450 activity in gibberellin biosynthesis (Malonek et al., 2004). An apparent ortholog (GenBank Accession No. EU367940) of the G. fujikuroi cpr gene is identifiable in the recently completed sequence for E. festucae (unpublished data), a sexual congener of N. uncinatum. This raises the possibility that the E. festucae putative cpr ortholog may be required for activity of LolP in loline biosynthesis. Three endophyte–plant symbioses—Agrostis hiemalis with E. amarillans, and two Moroccan plants of L. arundinaceum with N. coenophialum—lacked NFL, but contained NANL. lolP was not detected in the genome of E. amarillans by PCR, although it was detected in the N. coenophialum strains. Absence of lolP in E. amarillans is consistent with its function on N-methylated versions of loline alkaloids, which are lacking in the A. hiemalis-E. amarillans symbiotum as well as in those L. arundinaceum–N. coenophialum symbiota that lack NFL. Apparently, these endophytes in these symbiota lack the capability to N-methylate lolines. In summary, we have presented evidence for direct involvement of another LOL gene, lolP, in loline alkaloid biosynthesis. Knocking out lolP1 in N. uncinatum, the only functional lolP allele in this fungus, demonstrated that lolP is required for the biosynthesis of NFL but not for the formation of the core pyrrolizidine ring, the ether bridge between C-2 and C-7, or methylation of the C-1 amine. Increased accumulation of NML in DlolP1, similarities of LolP to cytochrome P450s, and the presence of a cytochrome P450 signature sequence in LolP all suggest that lolP encodes a cytochrome-P450 monooxygenase catalyzing oxygenation of NML for formation of NFL. LolP likely catalyzes hydroxylation of the methyl group in NML and further oxygenation to NFL. Acknowledgments This work was supported by US National Science Foundation Grant MCB-0213217 and U.S. Department of Agriculture Grant 200506271031. We thank Walter Hollin, Alfred D. Byrd, and LaTa-

Fig. 6. Proposed reaction sequence of LolP-catalyzed oxygenation of NML to NFL. LolP is proposed to catalyze hydroxylation of one N-methyl group in NML, and further oxidation gives NFL. Cytochrome P450 oxidoreductase (CPR), likely involved in transfer of NADPH-derived electrons to LolP, is also indicated; LolP-CPR activity splits dioxygen, one oxygen of which is used for hydroxylation of the N-methyl group in NML, and the other oxygen is reduced to water by NADPH.

1314

M.J. Spiering et al. / Fungal Genetics and Biology 45 (2008) 1307–1314

sha S. Williams for valuable technical support. Sequence analyses were conducted in the University of Kentucky Advanced Genetic Technologies Center. This is Kentucky Agricultural Experiment Station publication number 08-12-090, published with the approval of the director. References Ahn, S.C., Baek, B.S., Oh, T., Song, C.S., Chatterje, B., 2000. Rapid mini-scale plasmid isolation for DNA sequencing and restriction mapping. Biotechniques 29, 266– 368. Al-Samarrai, T.H., Schmid, J., 2000. A simple method for extraction of fungal genomic DNA. Lett. Appl. Microbiol. 30, 53–56. Bartholomeusz, T.A., Bhogal, R.K., Molinie, R., Felpin, F.X., Mathe-Allainmat, M., Meier, A.C., Drager, B., Lebreton, J., Roscher, A., Richard, R.J., Mesnard, F., 2005. Nicotine demethylation in Nicotiana cell suspension cultures: N0 formylnornicotine is not involved. Phytochemistry 66, 2432–2440. Blankenship, J.D., Houseknecht, J.B., Pal, S., Bush, L.P., Grossman, R.B., Schardl, C.L., 2005. Biosynthetic precursors of fungal pyrrolizidines, the loline alkaloids. Chembiochem 6, 1016–1022. Blankenship, J.D., Spiering, M.J., Wilkinson, H.H., Fannin, F.F., Bush, L.P., Schardl, C.L., 2001. Production of loline alkaloids by the grass endophyte, Neotyphodium uncinatum, in defined media. Phytochemistry 58, 395–401. Brown, K.R., Brown, B.M., Hoagland, E., Mayne, C.L., Hegg, E.L., 2004. Heme A synthase does not incorporate molecular oxygen into the formyl group of heme A. Biochemistry 43, 8616–8624. Bullock, W.O., Fernandez, J.M., Short, J.M., 1987. XL1-Blue—a high-efficiency plasmid transforming RecA Escherichia coli strain with beta-galactosidase selection. Biotechniques 5, 376–378. Bush, L.P., Fannin, F.F., Siegel, M.R., Dahlman, D.L., Burton, H.R., 1993. Chemistry, occurrence and biological effects of saturated pyrrolizidine alkaloids associated with endophyte-grass interactions. Agric. Ecosyst. Environ. 44, 81–102. Craven, K.D., Blankenship, J.D., Leuchtmann, A., Hignight, K., Schardl, C.L., 2001. Hybrid fungal endophytes symbiotic with the grass Lolium pratense. Sydowia 53, 44–73. Davidson, R.C., Blankenship, J.R., Kraus, P.R., Berrios, M.D., Hull, C.M., D’Souza, C., Wang, P., Heitman, J., 2002. A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Microbiology 148, 2607–2615. Dougherty, C.T., Knapp, F.W., LP, B., 1999. Mortality of horn fly larvae (Diptera: Muscidae) in bovine dung supplemented with ergotamine and N-formyl loline. J. Med. Entomol. 36, 73–77. Faulkner, J.R., Hussaini, S.R., Blankenship, J.D., Pal, S., Branan, B.M., Grossman, R.B., Schardl, C.L., 2006. On the sequence of bond formation in loline alkaloid biosynthesis. Chembiochem 7, 1078–1088. Fu, P.P., Xia, Q.S., Lin, G., Chou, M.W., 2004. Pyrrolizidine alkaloids—genotoxicity, metabolism enzymes, metabolic activation, and mechanisms. Drug Metabol. Rev. 36, 1–55. Hartmann, T., Witte, L., 1995. Chemistry, biology and chemoecology of the pyrrolizidine alkaloids. In: Pelletier, S.W. (Ed.), The Alkaloids: Chemical and Biological Perspectives. Springer, New York, pp. 155–231. Hederstedt, L., Lewin, A., Throne-Holst, M., 2005. Heme A synthase enzyme functions dissected by mutagenesis of Bacillus subtilis CtaA. J. Bacteriol. 187, 8361–8369. Hoess, R.H., Abremski, K., 1984. Interaction of the Bacteriophage-P1 recombinase Cre with the recombining site LoxP. Proc. Natl. Acad. Sci. USA 81, 1026–1029. Jackson, J.A., Varney, D.R., Petroski, R.J., Powell, R.G., Bush, L.P., Siegel, M.R., Hemken, R.W., Zavos, P.M., 1996. Physiological responses of rats fed loline and ergot alkaloids from endophyte-infected tall fescue. Drug Chem. Toxicol. 19, 85–96. Kutil, B.L., Greenwald, C., Liu, G., Spiering, M.J., Schardl, C.L., Wilkinson, H.H., 2007. Comparison of loline alkaloid gene clusters across fungal endophytes: predicting the co-regulatory sequence motifs and the evolutionary history. Fungal Genet. Biol. 44, 1002–1010. Lane, G.A., Christensen, M.J., Miles, C.O., 2000. Coevolution of fungal endophytes with grasses: the significance of secondary metabolites. In: Bacon, C.W., White, J.F., Jr. (Eds.), Microbial Endophytes. Marcel Dekker, New York, pp. 341–388. Malonek, S., Rojas, M.C., Hedden, P., Gaskin, P., Hopkins, P., Tudzynski, B., 2004. The NADPH-cytochrome P450 reductase gene from Gibberella fujikuroi is essential for gibberellin biosynthesis. J. Biol. Chem. 279, 25075–25084. McLean, K.J., Sabri, M., Marshall, K.R., Lawson, R.J., Lewis, D.G., Clift, D., Balding, P.R., Dunford, A.J., Warman, A.J., McVey, J.P., Quinn, A.M., Sutcliffe, M.J., Scrutton,

N.S., Munro, A.W., . Biodiversity of cytochrome P450 redox systems. Biochem. Soc. Trans. 33, 796–801. Michielse, C.B., Hooykaas, P.J.J., van den Hondel, C., Ram, A.F.J., 2005. Agrobacteriummediated transformation as a tool for functional genomics in fungi. Curr. Genet. 48, 1–17. Munday-Finch, S.C., Wilkins, A.L., Miles, C.O., 1996. Isolation of paspaline B, an indole-diterpenoid from Penicillium paxilli. Phytochemistry 41, 327–332. Munro, A.W., Girvan, H.M., McLean, K.J., 2007. Cytochrome P450-redox partner fusion enzymes. Biochim. Biophys. Acta 1770, 345–359. Natsume, T., Egusa, M., Kodama, M., Johnson, R., Itoh, T., Itoh, Y., 2004. An appropriate increase in the transcription of Aspergillus nidulans uvsC improved gene targeting efficiency. Biosci. Biotechnol. Biochem. 68, 1649–1656. Panaccione, D.G., Johnson, R.D., Wang, J.H., Young, C.A., Damrongkool, P., Scott, B., Schardl, C.L., 2001. Elimination of ergovaline from a grass-Neotyphodium endophyte symbiosis by genetic modification of the endophyte. Proc. Natl. Acad. Sci. USA 98, 12820–12825. Pelser, P.B., de Vos, H., Theuring, C., Beuerle, T., Vrieling, K., Hartmann, T., 2005. Frequent gain and loss of pyrrolizidine alkaloids in the evolution of Senecio section Jacobaea (Asteraceae). Phytochemistry 66, 1285–1295. Petroski, R.J., Powell, R.G., Sunil, R., McLaughlin, J.L., 1994. Cytotoxic activities of Nacyllolines. Int. J. Pharmacognosy 32, 409–412. Riedell, W.E., Kieckhefer, R.E., Petroski, R.J., Powell, R.G., 1991. Naturally occurring and synthetic loline alkaloid derivatives: insect feeding behavior modification and toxicity. J. Entomol. Sci. 26, 122–129. Roberts, J.W., Roberts, C.W., 1981. Two mutations that alter the regulatory activity of Escherichia coli RecA protein. Nature 290, 422–424. Rojas, M.C., Hedden, P., Gaskin, P., Tudzynki, B., 2001. The P450-1 gene of Gibberella fujikuroi encodes a multifunctional enzyme in gibberellin biosynthesis. Proc. Natl. Acad. Sci. USA 98, 5838–5843. Saikia, S., Parker, E.J., Koulman, A., Scott, B., 2007. Defining paxilline biosynthesis in Penicillium paxilli—functional characterization of two cytochrome P450 monooxygenases. J. Biol. Chem. 282, 16829–16837. Schardl, C.L., Grossman, R.B., Nagabhyru, P., Faulkner, J.R., Mallik, U.P., 2007. Loline alkaloids: currencies of mutualism. Phytochemistry 68, 980–996. Schardl, C.L., Leuchtmann, A., Spiering, M.J., 2004. Symbioses of grasses with seedborne fungal endophytes. Annu. Rev. Plant Biol. 55, 315–340. Siegel, M.R., Latch, G.C.M., Bush, L.P., Fannin, F.F., Rowan, D.D., Tapper, B.A., Bacon, C.W., Johnson, M.C., 1990. Fungal endophyte-infected grasses: alkaloid distribution and aphid response. J. Chem. Ecol. 16, 3301–3315. Spiering, M.J., Moon, C.D., Wilkinson, H.H., Schardl, C.L., 2005. Gene clusters for insecticidal loline alkaloids in the grass-endophytic fungus Neotyphodium uncinatum. Genetics 169, 1403–1414. Spiering, M.J., Wilkinson, H.H., Blankenship, J.D., Schardl, C.L., 2002. Expressed sequence tags and genes associated with loline alkaloid production in the grass endophyte Neotyphodium uncinatum. Fungal Genet. Biol. 36, 242–254. Tanaka, A., Ito, H., Tanaka, R., Tanaka, N.K., Yoshida, K., Okada, K., 1998. Chlorophyll a oxygenase (CAO) is involved in chlorophyll b formation from chlorophyll a. Proc. Natl. Acad. Sci. USA 95, 12719–12723. Tanaka, A., Tapper, B.A., Popay, A., Parker, E.J., Scott, B., 2005. A symbiosis expressed non-ribosomal peptide synthetase from a mutualistic fungal endophyte of perennial ryegrass confers protection to the symbiotum from insect herbivory. Mol. Microbiol. 57, 1036–1050. Tepaske, M.R., Powell, R.G., Clement, S.L., 1993. Analyses of selected endophyteinfected grasses for the presence of loline-type and ergot-type alkaloids. J. Agric. Food Chem. 41, 2299–2303. Tofern, B., Kaloga, M., Witte, L., Hartmann, T., Eich, E., 1999. Phytochemistry and chemotaxonomy of the Convolvulaceae part 8-occurrence of loline alkaloids in Argyreia mollis (Convolvulaceae). Phytochemistry 51, 1177– 1180. Tokai, T., Koshino, H., Takahashi-Ando, N., Sato, M., Fujimura, M., Kimura, M., 2007. Fusarium Tri4 encodes a key multifunctional cytochrome P450 monooxygenase for four consecutive oxygenation steps in trichothecene biosynthesis. Biochem. Biophys. Res. Commun. 353, 412–417. Tsai, H.-F., Siegel, M.R., Schardl, C.L., 1992. Transformation of Acremonium coenophialum, a protective fungal symbiont of the grass Festuca arundinacea. Curr. Genet. 22, 399–406. Wang, J.H., Machado, C., Panaccione, D.G., Tsai, H.F., Schardl, C.L., 2004. The determinant step in ergot alkaloid biosynthesis by an endophyte of perennial ryegrass. Fungal Genet. Biol. 41, 189–198. Wilkinson, H.H., Siegel, M.R., Blankenship, J.D., Mallory, A.C., Bush, L.P., Schardl, C.L., 2000. Contribution of fungal loline production to protection from aphids in a grass-fungus mutualism. Mol. Plant Microbe Interact. 13, 1027–1033.