Role of type IV secretion system genes in virulence of rice bacterial brown stripe pathogen Acidovorax oryzae strain RS-2

Microbial Pathogenesis 126 (2019) 343–350

Contents lists available at ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

Role of type IV secretion system genes in virulence of rice bacterial brown stripe pathogen Acidovorax oryzae strain RS-2

T

Solabomi Olaitan Ogunyemia,b,1, Yushi Fanga,1, Wen Qiua,∗, Bin Lia, Jie Chena, Min Yanga, Xianxian Honga, Jinyan Luoc, Yangli Wangd,∗∗, Guochang Sund a State Key Laboratory of Rice Biology, Ministry of Agriculture Key Lab of Molecular Biology of Crop Pathogens and Insects, Institute of Biotechnology, Zhejiang University, 310058, Hangzhou, China b Department of Crop Protection, Federal University of Agriculture Abeokuta, Abeokuta, Nigeria c Department of Plant Quarantine, Shanghai Extension and Service Center of Agriculture Technology, Shanghai 201103, China d State Key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences, 310021, Hangzhou, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Acidovorax oryzae T4SS Gene knock-out Virulence Biofilm Motility

Type IV secretion system (T4SS) is a specialized nanomachine that is utilized for the pathogenicity of gramnegative bacteria. However, the role of T4SS genes in virulence of rice bacterial brown stripe pathogen Acidovorax oryzae (Ao) strain RS-2 is not clear, which contains T4SS gene cluster based on genome-wide analysis. Here we compared the virulence-related phenotypes between the wild-type strain RS-2 and nine T4SS mutants, which were constructed in this study. Results indicated that mutation of pilT, pilM, pilQ, or pilZ3 genes not only significantly reduced bacterial virulence, but also caused a reduction of 20.4–62.0% in biofilm formation and 37.7–47.7% reduction in motility, but had no effect on exopolysaccharide (EPS) production or extracellular enzymatic activities when compared to the wild type. The four T4SS genes had a differential effect on bacterial growth after 24 h post-incubation. The complemented strains of the four T4SS mutants restored similar virulence symptom as the wild type. In addition, no change was observed in bacterial virulence by mutation of the other five T4SS genes. Totally, these results demonstrated that T4SS played vital roles in bacterial virulence, motility and biofilm formation in plant pathogen Ao strain RS-2.

1. Introduction The gram-negative bacteria Acidovorax oryzae (Ao, formerly Acidovorax avenae subsp. avenae) causes disease in many economically important plants, such as rice, oats, corn, millet, sugarcane, and foxtail [1–3]. Particularly, this seed borne bacterium causes rice bacterial brown stripe (BBS) in many countries around the world, which results in heavy economic losses [1,3–5]. The contaminated seeds represent the most important primary source of inocula for outbreak of the disease [1,6,7]. The economic importance of BBS makes it necessary to understand the molecular basis for the infection of Ao strain to rice plant. Our previous studies have sequenced the genome of Ao strain RS1, which provides a foundation for studying the pathogenesis of this rice bacterial pathogen [3,8–10]. The infection of bacterial phytopathogens to their host plants is

highly associated with secreted effectors proteins [4,5,7]. It has been well documented that bacterial virulence towards host was achieved by using a remarkable array of sophisticated macromolecular nanomachines (known as secretion system) to deliver extracellular molecules such as proteins effectors into the host cell cytoplasm [11,12]. Recently, at least six different secretion systems have been reported in gram-negative pathogenic bacteria [13]. A large number of studies reported that type IV secretion system (T4SS) function in the bacterial pathogenesis of a wide range of Gram-negative bacteria, including plant pathogen such as Acidovorax avenae subsp. citrulli [7], Legionella pneumophila [12], Agrobacterium tumefaciens [14], Ralstonia solanacearum [15,16], Xanthomonas oryzae pv. oryzae [17], Xanthomonas oryzae pv. oryzicola [18], and Xanthomonas citri subsp. citri [19,20]. T4SS is described to be associated with various biological functions such as bacterial pathogenicity, twitching motility, biofilm formation,

∗

Corresponding author. Corresponding author. E-mail addresses: [email protected] (W. Qiu), [email protected] (Y. Wang). 1 Equally contributed. ∗∗

https://doi.org/10.1016/j.micpath.2018.11.017 Received 8 August 2018; Received in revised form 12 November 2018; Accepted 12 November 2018 Available online 20 November 2018 0882-4010/ © 2018 Elsevier Ltd. All rights reserved.

Microbial Pathogenesis 126 (2019) 343–350

S.O. Ogunyemi et al.

2.3. Prediction of T4SS gene cluster in Ao strain RS-2

Table 1 List of oligonucleotide polymerase chain reaction primers. Primers

Primer sequences (5′-3′)

pilU-F PilU-R PilT-F PilT-R PilM-F PilM-R PilQ-F PilQ-R PilW-F PilW-R PilZ1-F PilZ1-R PilZ2-F PilZ2-R PilZ3-F PilZ3-R PilB-F PilB-R

CGGGATCCCCCTCGGGGAAGAAGT CGGAATTCTGCTCAAGGAAATCAC CGGGATCCCTGGATGGTGGAGTA CGGAATTCCAACGAGACCGAATA CGGGATCCCGCTGCGTTTCTTGC CGGAATTCCATCCCGTTCTCCCT CGGGATCCAGCGAGGACTTGAGGAAT CGGAATTCGCAGGGTGACACGGAAAT CGGGATCCCCAGCCAGAGCGATT CGGAATTCCCGTGCCTTCCTACA CGGGATCCCCTTGGGGAACTGGA CGGAATTCGCGGTATCTTCGTGC CGCGGATCCCGTGCTGGACGTTTCC CGGAATTCAGGTGGGTGGCGCTGT CGGGATCCCCCGACGGAAGAAGG CGGAATTCCACAGCCTCGCTCACC CGGGATCCTTCGGGTTCGGTCTCC CGGAATTCCTGCGCTTCGGTACTCT

T4SS gene cluster in Ao strain RS-2 was predicted according to the genome sequence analysis of this stain (unpublished) using local BLAST (BLASTN, BLASTX). And the annotation information were incorporated from those of Ao strain RS-1 [3], Acidovorax avenae subsp. avenae strain ATCC 19860 and Acidovorax citrulli AAC00-1. The reference strain RS-1 was isolated from diseased rice in our laboratory [3].

Size (bp) 490 490 482 482 423 423 486 486 246 246 174 174 210 210 304 304 388 388

2.4. Generation of T4SS mutants and complementation To investigate the role of T4SS in the virulence of Ao strain RS-2, an insertional mutagenesis on target gene was generated by suicide plasmid pJP5603 through homologous recombination on the background of wild-type strain RS-2. In-frame deletion of T4SS genes and their complementation were performed following the procedure of Liu et al. [24]. Briefly, the internal DNA fragment of each T4SS gene was amplified through PCR, in which genomic DNA of wild-type strain RS-2 was used as template. The corresponding product was cloned into pGEM-T Easy vector (Promega, WI, USA), and then verified by digestion with appropriate restriction enzymes and sequencing. Later, the verified product was ligated into the suicide vector pJP5603 [25]. The resulting plasmid constructs were transferred into wild-type strain RS-2 by biparental mating using E. coli strain S17-1 as donor [26]. Mutant checking of T4SS genes were carried out by PCR amplification using primers flanking the genes of interest. For complementation, the whole open reading frame of these genes along with 500 bp upstream of the start codon including its native promoter were amplified by PCR using wild-type strain RS-2 as template and sub-cloned into the expression vector pRADK [27]. The resulting constructs were verified by PCR and sequencing technique, which were introduced into the corresponding mutant by filter mating [28] and the complementation of the corresponding mutants was selected by Chl + Km + Rif resistance. While primers and the restriction enzymes used in making T4SS mutants and their complementation were listed in Table 2. Bacteria were cultured in LB broth supplied with antibiotic (kanamysin at 50 μg/mL for mutants, and chloromycetin at 50 μg/mL for complementation) at 30 °C in a 200 rpm/min shaker for the whole experiment.

Note: Nucleotides with underline indicated restriction sites of the enzymes: Bam H1 or EcoR1.

colonization, surface attachment and survival [11,12,21,22]. The existence of T4SS in Ao has been revealed based on genome-wide in silico analysis in our previous studies [8]. However, the role of T4SS gene cluster in virulence of Ao is yet to be explored. The aim of this study was to examine the role of T4SS in the pathogenesis of Ao strain RS-2 through comparing bacterial growth, virulence to rice seedlings, biofilm formation, swimming motility, H2O2 tolerance, extracellular polysaccharide (EPS) production and extracellular enzymatic activities between wild-type and the constructed T4SS mutants.

2. Materials and methods 2.1. Bacterial strains, growth media and inoculum preparation The bacterial strains and plasmids used in this study are described in Table 1. Ao wild-type strain RS-2 and mutant strains were cultured in Luria-Bertani (LB) agar or broth medium [23] at 30 °C. Escherichia coli strains were grown in LB agar or broth medium at 37 °C. For inoculation experiment, bacterial strains were cultured in LB broth, serially diluted in ddH2O, and the final concentration of bacterial suspension was adjusted to an approximate optical density 600 (OD600) of 0.6 (∼1 × 108 CFU/mL) with a spectrophotometer (Perkin Elmer Lambda 35 UV/VIS). When required, the culture media were supplied with the following antibiotics: of final concentrations of kanamycin (Km), 50 μg mL−1; ampicillin (Amp), 50 μg mL−1; rifampicin (Rif), 100 μg mL−1; and chloramphenicol (Chl), 3.4 μg mL−1.

2.5. Rice seedling pathogenicity test To determine the role of T4SS in pathogenicity of Ao to rice seedlings, seed transmission assays was carried out as described in Li et al. [29] with some modifications. Briefly, germinated rice seeds (cv. II You 023, n = 100/mutant) were inoculated with gentle agitation using immersion in 10 mL of an of cell suspension containing approximately ∼1 × 108 CFU/mL (OD600 = 0.6) of Ao wild-type strain RS-2 or each T4SS mutant for 6 h. Seeds treated with double-distilled water (ddH2O) were used as a negative control. After inoculation, bacterial suspensions were discarded and then seeds were air dried at room temperature for 24 h. The dried seeds were planted in plate containing 0.5% agar (13 seeds per plate) and incubated under greenhouse conditions (28 ± 2 °C, 80% humidity) with a 14/10 h light/dark photoperiod. Thus, 39 seeds were used for each treatment. Seedling emergence and plant height was recorded 5 d post-sowing. This experiment was repeated three times with three replicates for each treatment. The ANOVA test was done using the SAS software (SAS Institute, Cary, USA). Means were compared by the least significant difference (LSD) method at P < 0.05.

2.2. DNA extraction and amplification Genomic DNA was extracted using the TIANamp bacteria DNA kit (Tiangen, China) following the manufacturer's instructions. Bacterial plasmid DNA was isolated using the E.Z.N.A.® Plasmid DNA Mini Kit I (Omega, China). The concentration and purity of DNA was measured using the Nano Drop 2000 spectrophotometer (Thermo Scientific, USA). Conventional PCR reactions were performed in a Bioer XP Thermal Cycler (Bioer Tech. Co. Ltd. China). Amplification of the DNA was performed in 50 μl total volume with 2 × TSINGKE Master Mix (Beijing TsingKe Co. Ltd., China) while the PCR conditions were 94 °C for 10 min followed by 33 cycles of 30 s of denaturation at 94 °C, 30 s of annealing at Tm, and 1 min/kb of extension at 72 °C.

2.6. Bacterial growth analysis Bacterial growth was assessed by inoculating 400 μL cell suspensions (overnight broth cultures adjusted to OD600 = 0.6) into 40 mL of LB broth. Bacterial numbers were determined by measuring absorbance 344

Microbial Pathogenesis 126 (2019) 343–350

S.O. Ogunyemi et al.

Table 2 Strains and plasmids used in this study. Strains/Plasmids

Relevant characteristicsa

Sources or references

Acidovorax oryzae strain RS-2 Escherichia coli DH5α

The pathogen of bacterial brown stripe of rice, which was isolated from the diseased rice of Zhejiang Province of China. F-Φ80d lacZΔM15Δ(lacZYA-argF) U169 recA1endA1, hsdR17 (rk–, mk+) phoAsupE44 λ– thi-1 gyrA96relA1

Escherichia coli S17-1 λpir

λ Lysogenic S17-1 derivative producing π protein for replication of plasmids carrying oriR6K; recAprohsdRRP4-2-Tc::MuKm::Tn7 λ–pir, KmR

Lab collection Invitrogen Company [19]

Mutants PilU PilT PilM PilQ PilW PilZ1 PilZ2 PilZ3 PilB PilT-comp PilM-comp PilQ-comp PilZ3-comp Plasmids pJP5603 pJP5603- PilU pJP5603- PilT pJP5603- PilM pJP5603- PilQ pJP5603- PilW pJP5603- PilZ1 pJP5603- PilZ2 pJP5603- PilZ3 pJP5603- PilB pRADK pRADK- PilT pRADK- PilM pRADK- PilQ pRADK- PilZ3 a

KmR; KmR; KmR; KmR; KmR; KmR; KmR; KmR; KmR; ChlR, ChlR, ChlR, ChlR,

RS-2 insersional mutant defective RS-2 insersional mutant defective RS-2 insersional mutant defective RS-2 insersional mutant defective RS-2 insersional mutant defective RS-2 insersional mutant defective RS-2 insersional mutant defective RS-2 insersional mutant defective RS-2 insersional mutant defective KmR;; complement strain of PilT KmR;; complement strain of PilM KmR;; complement strain of PilQ KmR;; complement strain of PilZ3

in in in in in in in in in

PilU PilT PilM PilQ PilW PilZ1 PilZ2 PilZ3 PilB

This This This This This This This This This This This This This

KanR, R6K-based sucide vector KmR, pJP5603 with PilU flanking fragment KmR, pJP5603 with PilT flanking fragment KmR, pJP5603 with PilM flanking fragment KmR, pJP5603 with PilQ flanking fragment KmR, pJP5603 with PilW flanking fragment KmR, pJP5603 with PilZ1 flanking fragment KmR, pJP5603 with PilZ2 flanking fragment KmR, pJP5603 with PilZ3 flanking fragment KmR, pJP5603 with PilB flanking fragment AmpR,ChlR,KmR, broad host expression vector AmpR,ChlR,KmR, pRADK with PilT flanking fragment AmpR,ChlR,KmR, pRADK with PilM flanking fragment AmpR,ChlR,KmR, pRADK with PilQ flanking fragment AmpR,ChlR,KmR, pRADK with PilZ3 flanking fragment

study study study study study study study study study study study study study

[18] This study This study This study This study This study This study This study This study This study [20] This study This study This study This study

AmpR, KmR, ChlR indicates Ampicillin-, Kanamycin-, Chloromycetin-resistance respectively.

2.8. Motility assays

at 600 nm using a Thermo Multiskan EX Micro plate Photometer (Perkin Elmer Lambda 35 UV/VIS, Thermo Fisher Scientific Inc., USA) after incubation at 200 rpm/min, 30 °C, for 0.0, 1.5, 3.0, 6.0, 12.0, 24.0, and 48.0 h, respectively. The LB broth was used as a negative control.

Bacteria were cultured overnight in LB broth supplied with appropriate antibiotic at 30 °C in a 200 rpm/min shaker. Cells were collected by centrifugation, then washed and diluted to OD600 = 0.6 in sterile water. LB media containing 0.3% agar was used for swimming motility test. Five μL cell suspensions of the mutants or wild-type of strain RS-2 were spotted at the center of each plate and triplicates were carried out for each treatment. The colony diameter was measured after 48 h of incubation. Similar experiment was repeated three times independently. The ANOVA test was performed as mentioned in Section 2.5 with P < 0.05.

2.7. Biofilm formation measurement Biofilm formation assay was performed for T4SS mutants and the wild type of Ao strain RS-2 in 96-well microtitre plates (Corning-Costar Corp., Corning, NY, USA) using the method described in Ref. [30]. Briefly, the overnight cell suspension was re-cultured into fresh LB broth containing appropriate antibiotic with a 1:100 dilution under shaking to mid exponential growth (OD600 = 0.6). Then approximately 200 μl of ∼ 1 × 108 CFU/mL bacterial suspensions was inoculated into each well and the plate was incubated at 30 °C for 48 h of adhesion without agitation while sterile LB without bacteria served as the control. Culture media was then poured out and each well in the plates was washed three times with sterile ddH2O. Following air-dried for 30 min, each well was stained with 150 μl of 0.1% (w/v) crystal violet solution for 30 min at room temperature. The unbound crystal violet was removed and then washed with ddH2O. To solubilize the crystal violet stained cells, 150 μl of 33% acetic acid was added. Bacterial biofilm was quantified by measuring the optical density at 570 nm using a Thermo Multiskan EX Micro plate Photometer (Thermo Fisher Scientific, Waltham, MA). Twelve replicates were used for each treatment for the quantitative measurement and the experiment was repeated three times independently. The ANOVA test was performed as mentioned in Section 2.5 with P < 0.05.

2.9. H2O2 tolerance Bacteria were cultured in LB broth supplied with proper antibiotic at 30 °C in a 200 rpm/min shaker. Cells suspension were prepared and diluted into about cell number 108 CFU/mL. LB media plate containing 0, 0.10, 0.25, and 0.50 mM of H2O2 was prepared as described with minor modification [31]. 2 μl of cell suspensions were added to the plate for tolerance test. Biological triplicates were used for each treatment. After culturing at 30 °C for 48 h, the plate was used directly for H2O2 tolerance activity analysis. 2.10. EPS production and extracellular enzyme activities Bacteria were cultured in LB broth supplied with appropriate antibiotic at 30 °C in a 200 rpm/min shaker for 18 h. Cells were collected by centrifugation, which was then washed and re-suspended to OD600 = 1.5 in sterile water. Furthermore, 50 mL of cell suspensions 345

Microbial Pathogenesis 126 (2019) 343–350

S.O. Ogunyemi et al.

were used for centrifugation at 12000 rpm/min for 10 min followed by the addition of two-fold volume of ice-cold ethanol to the supernatant which was then stirred with glass rod. EPS was collected by centrifugation at 12000 rpm/min for 2 min and the supernatant was discarded, the dry weight test was performed after drying at 37 °C for 48 h followed [32]. Similar experiment was repeated three times independently. Bacteria were cultured in LB broth supplied with proper antibiotic at 30 °C in a 200 rpm/min shaker overnight until OD600 = 1.5. Cells were collected by centrifugation, which was then washed and re-suspended in sterile water. LB media solid plate was prepared and 9 mm hole puncher was used for enzymatic activity test. Furthermore, 50 μl of cell suspension was added to the hole for cellulose activity experiment. Biological triplicates were applied for each strain. After culturing at 30 °C for 48 h, the plate was dyed using 0.1% w/v of congo red solution for 30 min, and washed twice with 1.0 M NaCl for 15 min. Diameter of transparent zone was measured and calculated for analysis. Bacteria were cultured overnight in LB broth supplied with proper antibiotic at 30 °C in a 200 rpm/min shaker until OD600 = 1.0. Certain volume (2.0 μl) of cell suspension was added to the LB solid plate for amylase and protease enzyme test. After culturing at 30 °C for 48 h, the plate was used directly for protease activity measurement. It was dyed using 1:100 I2/KI solution for 10 min, and washed with 70% ethanol. Diameter of transparent zone was measured and calculated for amylase analysis using student t-test with P < 0.05.

Fig. 2. PCR verification of nine T4SS for Acidovorax oryzae strain RS-2 using target gene primers or species-specific primer. For T4SS genes (A/B): M: Maker, DL2000; 1–9: △pilU, △pilT, △pilM, △pilQ, △pilW, △pilZ1, △pilZ2, △pilZ3 and △pilB. For virulence-associated T4SS gene complements (C/D): M is Maker, 1 kb/DL2000DNA ladder; 1–4: △pilT, △pilM, △pilQ and △pilZ3.

The resulting T4SS mutant was complemented by following the similar procedure. Briefly, a single gel band with the expected size of 1400–2500 bp was produced from the constructed complemented strains of the mutants (Fig. 2C). Subsequently, identities of the four complemented strains were validated based on regular PCR using the Ao specific primers of the above-mentioned indicator gene (370 bp) (Fig. 2D). The 16s rDNA sequences showed the highest homology (98–100%) with that of Ao (data not listed).

3. Results 3.1. In silico identification of T4SS genes By using local Blast as mentioned in Section 2.3 [3], the T4SS cluster of Ao strain RS-2 contains nine genes namely: PilU (Acav_0605), PilT (Acav_0607), PilM (Acav_0967), PilQ (Acav_0971), PilW (Acav_1461), PilB (Acav_3595), and PilZ1 (Acav_1821), PilZ2 (Acav_2102), PilZ3 (Acav_3378), respectively (as shown in Fig. 1).

3.3. T4SS involved in virulence of Ao strain RS2 to rice seedlings Effect of T4SS genes on the virulence of Ao strain RS-2 was determined according to the method of Li et al. [29] by comparing plant height of rice seedling with the wild-type and individual T4SS mutants. From Fig. 3, it can be observed that rice seedlings treated with the wild type strain (the positive control) grew poorly with an average plant height of 2.44 cm while seedlings treated with ddH2O (the negative control) grew well with the maximum plant height of 4.94 cm. Moreover, when compared to the wild type strain, treatments with the 4 mutants △pilT, △pilM, △pilQ, and △pilZ3 caused a significant (P < 0.01) reduction in bacterial virulence, while the corresponding average plant height were 4.38, 3.53, 4.53, 4.54 cm, respectively. Furthermore, no significant (P > 0.05) difference in the pathogenicity was observed between the wild-type and the other 5 mutants △pilB, △pilU, △pilW, △pilZ1 and △pilZ2, which had a plant height of 2.60–3.03 cm (supplementary Fig S1). In particular, mutation of the four T4SS genes pilM, pilT, pilQ and pilZ3 resulted in more than 40% reduction in the plant height of rice seedlings when compared to the wild type of Ao strain RS-2. Therefore, it could be inferred that the four T4SS genes pilM, pilT, pilQ and pilZ3 may be directly associated with bacterial virulence. Furthermore, there was no significant difference in the height of rice seedlings between the complemented strains △pilM-comp, △pilT-comp, △pilQ-comp, △pilZ3-comp and the wild type of Ao strain RS-2 (Fig. 3). This revealed that the complemented strains of the four mutants restored bacterial pathogenicity to rice seedlings.

3.2. Validation of T4SS genes mutants and complementation Results from this study indicated that a single gel band with the expected size of about 490, 482, 423, 486, 246, 174, 210, 304 and 388 bp, respectively, for the nine T4SS target genes of Ao strain RS-2 (Fig. 2A), which were carried out by normal PCR amplification. After that, the successful ligation of T4SS target gene PCR products into suicide vector was confirmed by using PCR amplification (data not shown). Furthermore, the constructed T4SS mutants were selected by antibiotic (Kmr) resistance. PCR using specific primers for the indicator gene of Ao strain RS-2 with 370 bp of expected product size was applied to assess the construction of T4SS mutants (Fig. 2B). Finally, the obtained strain with Kmr resistance was sequenced using 16S rDNA sequence technique, and it indicated the highest homology (98–99%) with Ao by blasting against NCBI database (data not shown).

Fig. 1. Type IV secretion system in Acidovorax oryzae strain RS-2 based on genome analysis. The database of Clusters of Orthologous Groups of proteins (COGs) was obtained from the National Center of Biotechnology Information (ftp://ftp.ncbi.nih.gov/pub/COG/COG2014/static/lists/listAciave.html).

3.4. T4SS involved in the growth of Ao strain RS2 Results from this study indicated that the OD600 value of the wild type strain RS-2 was 0.08, 0.18, 0.32, 0.93, 1.16 and 1.25 after 1.5, 3.0, 346

Microbial Pathogenesis 126 (2019) 343–350

S.O. Ogunyemi et al.

Fig. 3. Virulence of the four virulence-associated T4SS genes mutants and complements of Acidovorax oryzae strain RS-2 to rice seedling. Triplicates were used for each treatment that contains 13 seeds for each plate. The experiment was repeated three times independently.

Fig. 4. The growth curve of the four virulence-associated T4SS genes mutants and complements of Acidovorax oryzae strain RS-2. Six replicates were used for each treatment, and the experiment was performed 3 times independently.

reduction at 24 h was observed (Fig. 4). In addition, significant difference was observed in the OD600 values between the wild type and the other three virulence-associated T4SS genes mutants at 6–48 h of incubation except pilT mutant, which caused a significant reduction in growth of Ao strain RS-2 (Fig. 4). And there was only slight growth difference between wild type and the other 5 mutants during the whole incubation time (supplementary Fig S2).

6.0, 12.0, 24.0 and 48.0 h post-incubation respectively, while the mutation of the four virulence-associated T4SS genes △pilT, △pilQ, △pilM, and △pilZ3 caused 30.12%, 11.74%, 36.51% and 27.68% reduction in the OD600 value after 6.0 h post-incubation; 29.71%, 6.84%, 14.83%, 25.87% reduction in the OD600 value after 12.0 h post-incubation; 26.94%, 16.35%, 17.71% and 14.25% reduction in the OD600 value after 24.0 h post-incubation; 24.40%, 6.64%, 15.76% and 11.40% reduction in the OD600 value after 48.0 h post-incubation, respectively, compared to the wild type of Ao strain RS-2 (Fig. 4). In general, the OD600 value of strain RS-2 increased with increase in incubation time regardless of the wild type for the four virulence-associated T4SS mutants and their complemented strains (Fig. 4). Furthermore, there was no difference in the OD600 value between the complemented strains and the wild type of Ao strain RS-2 but slight

3.5. T4SS involved in biofilm formation of Ao strain RS2 Results from this study are shown in Fig. 5 and supplementary Fig S3. Fig. 5 indicated that the optical density (OD570) value of the wild type of Ao strain RS-2 was 1.05, while the OD570 value of the 4 virulence-associated T4SS mutants △pilT, △pilM, △pilQ and △pilZ3 was 347

Microbial Pathogenesis 126 (2019) 343–350

S.O. Ogunyemi et al.

Fig. 5. Biofilm formation of the four virulence-associated T4SS genes mutants and complements of Acidovorax oryzae strain RS-2. Bars with the same letters are not significantly different (P < 0.05). Six replicates were used for each strain. The experiment was repeated three times independently.

0.52, 0.84, 0.36 and 0.40, respectively after 48 h post-incubation at 30 °C without agitation and stained with crystal violet. Obviously, the four T4SS mutants significantly (P < 0.05) reduced biofilm adhesion in microtitre plates. However, there was no significant difference in the OD570 value between the complemented strains of the four virulenceassociated T4SS mutants and the wild type of Ao strain RS-2. This result indicates that the four T4SS genes might also be involved in the biofilm formation of Ao strain RS-2.

3.6. T4SS involved in swimming ability of Ao strain RS2 Fig. 6. Swimming ability of the four virulence-associated T4SS gene mutants and complements of Acidovorax oryzae strain RS-2. Bars with the same letters are not significantly different (P < 0.05). Six replicates were carried out for each strain. The experiment was repeated three times independently.

Results of swimming assays can be found in Fig. 6 and supplementary Fig S4. It showed that the colony diameter of the wild type of Ao strain RS-2 was 1.92 cm, which was determined by measuring the diameter of the area covered by swimming bacteria on LB plates with 0.3% agar after 48 h of incubation at 30 °C. The colony diameter was significantly reduced by the mutation of 4 virulence-associated T4SS genes except pilQ. Indeed, the colony diameters of the four mutants △pilT, △pilM, △pilZ3 and △pilQ were 1.00, 1.20, 1.01 and 2.01 cm, respectively, while the colony diameters of the complemented strains of the four mutants were 1.79, 1.84, 1.81, 1.96 cm respectively. Obviously, the former three mutants significantly reduced the swimming ability that was restored upon complementation, suggesting that the three T4SS genes may be related to swimming motility of Ao strain RS2.

3.7. T4SS associated with H2O2 tolerance of Ao strain RS2 Tolerance toward H2O2 of Ao T4SS-virulence associated mutants and wild type strain RS2 were similar except △pilZ3 (Fig. 7 and supplementary Fig S4), which was determined by testing the growth of each strain on different concentrations of H2O2 agar plate after incubation at 30 °C for 48 h. It can be seen from Fig. 7 that with the increment of H2O2 concentration (0.10, 0.25, and 0.50 mM), the growth of both mutants and wild type strain RS-2 of Ao were inhibited, which was reflected from the decreased colony diameter (0.55 cm, 0.23 cm). Comparison with the wild type strain RS-2, mutant △pilZ3 had the highest sensitivity towards hydrogen peroxide as the growth of △pilZ3 was inhibited at 0.25 mM H2O2 (0.46 cm) and no cell grew at 0.50 mM of H2O2. The bacterial growth under hydrogen peroxide conditions was restored with its complement △pilZ3-comp. Results here indicate that pilZ3 gene of T4SS may be involved in resistance of Ao strain RS-2 against oxidative stress.

Fig. 7. Tolerance hydrogen peroxide of T4SS genes mutants and complements for Acidovorax oryzae strain RS-2.

3.8. T4SS mutation didn't affect EPS production and extracellular enzyme activity of Ao strain RS2 The dry weight of EPS extracted from 50 mL suspension of △pilT, △pilM, △pilQ, △pilZ3 and the wild type of Ao strain RS-2 was 17.39, 19.01, 17.50, 18.41 and 18.62 mg, respectively (Fig. 8A). In general, there was no significant difference in EPS production between the nine T4SS mutants and the wild type of Ao strain RS-2. Moreover, no significant difference was observed in activities of cellulase, amylase and protease between the nine T4SS mutants and the wild type of Ao strain RS-2 in terms of diameter of newly formed transparent zone/colony 348

Microbial Pathogenesis 126 (2019) 343–350

S.O. Ogunyemi et al.

Fig. 8. Comparisons on (A) EPS dry weight, extracellular (B) cellulose, (C) amylase and (D) protease activities between the 4 virulence-associated T4SS gene mutants and the wild type of Acidovorax oryzae strain RS-2.

result of this study highlighted that pilT, pilM, pilQ, and pilZ3 are highly associated with virulence of Ao RS-2 to rice seedling. The conflicting results of virulence-associated T4SS genes between different groups may be caused by the T4SS diversities within various genus or species of bacteria. The contributions of these T4SS genes to pathogenesis rely on its ability to mediate the initial attachment of bacteria to host receptor in early pathogenesis of infection [39]. Genes pilQ and pilM have been reported to participate in the formation of inner and outer membrane protein sub-complexes of type IV pili, and thus are required for the expression of pilus on cell surface; while pilT is responsible for pilus retraction, all of which is critical to initial infection of the pathogenesis process [40]. The result of this study revealed that mutation of the four virulenceassociated T4SS genes of Ao strain RS-2 also reduced biofilm formation, swimming motility, and tolerance toward H2O2, which have been found to be highly associated with virulence in a variety of bacterial pathoge [ [36,37,39–44]]. In agreement with the result of this study, pilM and pilZ mutants of A. avenae subsp. citrulli significantly reduced biofilm-formation and swimming motility [7]. At the molecular level, the blast result using nucleotides sequence of pilM or pilZ gene from strain RS-2 search against NCBI database indicate high similarities with genes of A. avenae subsp. citrulli (data not shown). The role of T4SS genes was demonstrated to be involved in the virulence of Ao RS-2 as well as to the bacterium's biofilm-formation and swimming motility. Biofilm formation was proposed to be associated with the pathogenicity of bacteria. Bacteria within biofilms were believed to be conferred higher resistance toward environmental stresses than planktonic cells. From this point of view, it is possible to explain the pilZ mutant of strain RS-2 indicates reduced biofilm production and less H2O2 tolerance than wild type. However, the association between these phenotypes awaits further investigation.

(indicator), which was carried out using specialized plates with dye as an indicator (Fig. 8 B ∼ D). The indicator data for cellulose, and protease enzyme was 1.39, 1.44 and 1.82 for wild type and the range was between 1.31 and 1.50, 1.42–1.54, and 1.75–1.91 for mutants, respectively. The result of this study revealed that mutation of the T4SS genes did not affect the production of EPS and activities of three extracellular enzymes in Ao strain RS-2. 4. Discussions Bacteria was able to utilize T4SS to inject a large number of virulence factors such as protein effectors, DNA or nucleoprotein complexes into extracellular milieu [22] or host cell cytoplasm [12,21]. Thus T4SS repertoire has been reported to participate in many bacterial processes, such as virulence, biofilm formation, twitching motility, virulence, bacteriophage sensitivity [33–35]. Indeed, the related function of T4SSs in the bacterial pathogenesis or physiology have been reported before in Agrobacterium tumefaciens [22], Ralstonia solanacearum [15,16], Xanthomonas spp. strains [36] and Acidovorax avenae subsp. citrulli [7]. In agreement with the reports of previous studies, the result of this study indicated that T4SS genes in particular pilT, pilM, pilQ, or pilZ3 have an important role in the pathogenicity of Ao strain RS-2 to rice seedlings. This result could be validated by RNA-Seq analysis, which revealed a strong response of T4SS to in vivo host infection of Ao strain RS-1 [9]. However, mutation of the nine T4SS genes caused differential effects in bacterial virulence, indicating the complexity and diversity of the function of T4SS genes in Ao strain RS-2. T4SS genes pilQ, pilM, pilZ and pilT have been found to be involved in virulence in many plant pathogenic bacteria. For example, researches reported the significant contribution of T4SS pilQ, pilM, pilZ or pilT genes to virulence of X. oryzae pv. oryzicola [18,36] or X. campestris pv. campestris [36]. Furthermore, mutation of △pilQ and △pilT caused a delay and less virulence symptoms in R. solanacearum [15], while pilM and pilZ mutants of A. avenae subsp. citrulli significantly reduced virulence [7]. In contrast, some studies reported the involvement of pilZ domain protein in the unusual enhancement of virulence and significant sliding motility various, while pilM and pilQ function in other cellular processes such as cell division other than bacterial virulence [38]. However, the

5. Conclusions Our present study revealed the importance of T4SS genes in virulence of rice bacterial brown stripe pathogen. However, the nine T4SS genes differed in the virulence of rice seedling. The virulence was significantly reduced by mutation of pilT, pilM, pilQ and pilZ3, but 349

Microbial Pathogenesis 126 (2019) 343–350

S.O. Ogunyemi et al.

unaffected by the other 5 genes. Furthermore, there was a difference in bacterial growth, swimming motility, biofilm formation and H2O2 tolerance between the 4 virulence-associated T4SS genes mutants and the wild type of Ao strain RS-2. However, mutation of the 4 virulence-associated T4SS genes did not affect the EPS production and extracellular enzymatic activities of Ao strain RS-2. Overall, the result of this study clearly revealed that T4SS genes have an important role in the pathogenicity of Ao strain RS-2 to rice seedlings.

[17]

[18]

[19]

[20]

Acknowledgments This work was supported by National Natural Science Foundation of China (31571971, 31872017, 31801787), Zhejiang Provincial Natural Science Foundation of China (Z19C140006), Zhejiang Provincial Project (2017C02002, 2018C02G2071267), National Key Research and Development Program of China (2017YFD0201104), Shanghai Agricultural Basic Research Project (2014:7-3-1), the Fundamental Research Funds for the Central Universities, Dabeinong Funds for Discipline Development and Talent Training in Zhejiang University, Key Subject Construction Program of Zhejiang for Modern Agricultural Biotechnology and Crop Disease Control (2010DS700124- KF1710), China Postdoctoral Science Foundation (517000-X91803) and Zhejiang Provincial Postdoctoral Foundation (517000-X81802).

[21] [22] [23] [24]

[25] [26]

[27]

Appendix A. Supplementary data

[28]

Supplementary data to this article can be found online at https:// doi.org/10.1016/j.micpath.2018.11.017.

[29]

[30]

References [31]

[1] G.L. Xie, X.J. Sun, T.W. Mew, Characterizatin of Acidovorax avenae subsp. avenae from rice seeds, Chin. J. Rice Sci. 12 (1998) 165–171. [2] A.B.S. Brigida, C.A. Rojas, C. Grativol, E.M.D. Armas, J.O. Entenza, F. Thiebaut, M.F. Lima, L. Farrinelli, A.S. Hemerly, S. Lifschitz, P.C. Ferreira, Sugarcane transcriptome analysis in response to infection caused by Acidovorax avenae subsp. avenae, PLoS One 11 (2016) e0166473. [3] G.L. Xie, G.Q. Zhang, H. Liu, M.M. Lou, W.X. Tian, B. Li, X.P. Zhou, B. Zhu, G.L. Jin, Genome sequence of the rice-pathogenic bacterium Acidovorax avenae subsp. avenae RS-1, J. Bacteriol. 193 (2011) 5013–5014. [4] Z. Cui, G.Q. Jin, B. Li, K.U. Kakar, M.R. Ojaghian, Y.L. Wang, G.L. Xie, G.C. Sun, Gene expression of type VI secretion system associated with environmental survival in Acidovorax avenae subsp. avenae by principle component analysis, Int. J. Mol. Sci. 16 (2015) 22008–22026. [5] Y. Zhang, F. Zhang, B. Li, Y.Z. Yang, M. Ibrahim, Y.S. Fang, W. Qiu, M.M.I. Masum, R. Oliva, Characterization and functional analysis of clpB gene from Acidovorax avenae subsp. avenae RS-1, Plant Pathol. 66 (2017) 1369–1379. [6] D.D. Shakya, F. VInther, S.B. Mathur, World wide distribution of a bacterial stripe pathogen of rice identified as Pseudomonas avenae, J. Phytopathol. 114 (1985) 256–259. [7] O. Bahar, T. Goffer, S. Burdman, Type IV Pili are required for virulence, twitching motility, and biofilm formation of Acidovorax avenae subsp. citrulli, Mol. Plant Microbe Interact. 22 (2009) 909–920. [8] M. Ibrahim, Y. Shi, H. Qiu, B. Li, A. Jabeen, L. Li, H. Liu, M. Kube, G.L. Xie, Y. Wang, C. Blondel, C.A. Santiviago, I. Contreras, G. Sun, Differential expression of in vivo and in vitro protein profile of outer membrane of Acidovorax avenae subsp. avenae, PLoS One 7 (2012) e49657. [9] B. Li, L. Wang, M. Ibrahim, M. Ge, Y. Wang, S. Mannan, M. Asif, G. Sun, Membrane protein profiling of Acidovorax avenae subsp. avenae under various growth conditions, Arch. Microbiol. 197 (2015) 673–682. [10] B. Li, X. Wang, J. Chen, H. Liu, K. Ali, Y. Wang, W. Qiu, G. Sun, IcmF and DotU are required for the virulence of Acidovorax oryzae strain RS-1, Arch. Microbiol. 200 (2018) 897–910. [11] P.J. Christie, N. Whitaker, C. González-Rivera, Mechanism and structure of the bacterialtype IV secretion systems, Biochim. Biophys. Acta 1843 (2014) 1578–1591. [12] K.C. Jeong, D. Ghosal, Y.W. Chang, G.J. Jensen, J.P. Vogel, Polar delivery of Legionella type IV secretion system substrates is essential for virulence, Proc. Natl. Acad. Sci. U. S. A 114 (2017) 8077–8082. [13] B.S. Weber, R.L. Kinsell, C.M. Harding, M.F. Feldman, The secrets of Acinetobacter secretion, Trends Microbiol. 25 (2017) 532–545. [14] P.J. Christie, E. Cascales, Structural and dynamic properties of bacterial Type IV secretion systems, Membr. Biochem. 22 (2005) 51–61. [15] H. Liu, Y. Kang, S. Genin, M.A. Schell, T.P. Denny, Twitching motility of Ralstonia solanacearum requires a type IV pilus system, Microbiol. 147 (2001) 3215–3229. [16] Y. Kang, H. Liu, S. Genin, M.A. Schell, T.P. Denny, Ralstonia solanacearum requires

[32]

[33]

[34]

[35] [36]

[37]

[38]

[39]

[40]

[41]

[42]

[43] [44]

350

type 4 pili to adhere to multiple surfaces and for natural transformation and virulence, Mol. Microbiol. 46 (2002) 427–437. A. Das, N. Rangaraj, R.V. Sonti, Multiple adhesin-like functions of Xanthomonas oryzae pv. oryzae are involved in promoting leaf attachment, entry, and virulence on rice, Mol. Plant Microbe Interact. 22 (2009) 73–85. L. Wang, S. Makino, A. Subedee, A.J. Bogdanove, Novel candidate virulence factors in rice pathogen Xanthomonas oryzae pv. oryzicola as revealed by mutational analysis, Appl. Environ. Microbiol. 73 (2007) 8023–8027. G. Dunger, C.R. Guzzo, M.O. Andrade, J.B. Jones, C.S. Farah, Xanthomonas citri subsp. citri type IV Pilus is required for twitching motility, biofilm development, and adherence, Mol. Plant Microbe Interact. 27 (2014) 1132–1147. S. Petrocelli, M.R. Arana, M.N. Cabrini, A.C. Casabuono, L. Moyano, M. Beltramino, L.M. Moreira, A.S. Couto, E.G. Orellano, Deletion of pilA, a minor pilin-like gene, from Xanthomonas citri subsp. citri influences bacterial physiology and pathogenesis, Curr. Microbiol. 73 (2016) 904–914. J.K. Morgan, B.E. Luedtke, E.I. Shaw, Polar localization of the Coxiella burnetii type IVB secretion system, FEMS Microbiol. Lett. 305 (2010) 177–183. P.J. Christie, J.P. Vogel, Bacterial type IV secretion: conjugation systems adapted to deliver effector molecules to host cells, J. Trends. Microbiol. 8 (2000) 354–360. J. Sambrook, E. Fritsch, T. Maniatis, Molecular cloning: a laboratory manual+ cold spring harbor, J. Immunol. 49 (1989) 411. H. Liu, W.X. Tian, M. Ibrahim, B. Li, G.Q. Zhang, B. Zhu, G.L. Xie, Characterization of pilP, a gene required for twitching motility, pathogenicity, and biofilm formation of Acidovorax avenae subsp. avenae RS-1, Eur. J. Plant Pathol. 134 (2012) 551–560. R.J. Penfold, J.M. Pemberton, An improved suicide vector for construction of chromosomal insertion mutations in bacteria, Gene 118 (1992) 145–146. R. Simon, U. Priefer, A. Pühler, A broad host range mobilization system for in vivo genetic engineering: transposon mutagenesis in gram negative Bacteria, Nat. Biotechnol. 1 (1983) 784–791. G. Gao, H. Lu, L. Huang, Y. Hua, Construction of DNA damage response gene pprI function-deficient and function-complementary mutants in Deinococcus radiodurans, Sci. Bull. 50 (2005) 311–316. M.D. Smith, W.R. Guild, Improved method for conjugative transfer by filter mating of Streptococcus pneumoniae, J. Bacteriol. 144 (1980) 457–459. B. Li, B.P. Liu, R.R. Yu, Z.Y. Tao, Y.L. Wang, G.L. Xie, H.Y. Li, G. Sun, Bacterial brown stripe of rice in soil-less culture system caused by Acidovorax avenae subsp. avenae in China, J. Gen. Plant Pathol. 77 (2011) 64–67. E. Peeters, H.J. Nelis, T. Coenye, Comparison of multiple methods for quantification of microbial biofilms grown in microtiter plates, J. Microbiol. Methods 72 (2008) 157–165. Y. Xu, A. Itzek, J. Kreth, Comparison of genes required for H2O2 resistance in Streptococcus gordonii and Streptococcus sanguinis, J. Microbiol. 160 (2014) 2627–2638. R. Batool, K. Yrjälä, K. Shaukat, N. Jamil, S. Hasnain, Production of EPS under Cr (VI) challenge in two indigenous bacteria isolated from a tannery effluent, J. Basic Microbiol. 55 (2015) 1064–1074. C.L. Shaffer, J.A. Gadd, J.T. Loh, E.M. Johnson, S. Hill, E.E. Hennig, M.S. McClain, W.H. McDonald, T.L. Cover, Helicobacter pylori exploits a unique repertoire of type IV secretion system components for pilus assembly at the bacteria-host cell interface, PLoS Pathog. 7 (2011) e1002237. N. Tegtmeyer, S. Wessler, S. Backert, Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis, FEBS J. 278 (2011) 1190–1202. S. Backert, N. Tegtmeyer, Type IV Secretion and signal transduction of Helicobacter pylori CagA through interactions with host cell receptors, Toxins 9 (2017) pii: E115. Y. McCarthy, R.P. Ryan, K. O'Donovan, Y.Q. He, B.L. Jiang, J.X. Feng, J.L. Tang, J.M. Dow, The role of PilZ domain proteins in the virulence of Xanthomonas campestris pv. campestris, Mol. Plant Pathol. 9 (2008) 819–824. F. Yang, F. Tian, H. Chen, W. Hutchins, C.H. Yang, C. He, The Xanthomonas oryzae pv. oryzae PilZ domain proteins function differentially in cyclic di-GMP binding and regulation of virulence and motility, Appl. Environ. Microbiol. 81 (2015) 4358–4367. T. Carter, R.N. Buensuceso, S. Tammam, R.P. Lamers, H. Harvey, P.L. Howell, L.L. Burrows, The type IVa pilus machinery is recruited to sites of future cell division, mBio 8 (2017) e02103-e02116. S. Faezi, A.R. Bahrmand, S.D. Siadat, I. Nikokar, S. Sardari, M. Mahdavi, Construction, expression, purification and characterization of secretin domain of PilQ and triple PilA-related disulfide loop peptides fusion protein from Pseudomonas aeruginosa, Iran, J. Basic. Med. Sci. 20 (2017) 458–466. M. Ayers, L. Sampaleanu, S. Tammam, J. Koo, H. Harvey, P.L. Howell, L.L. Burrows, PilM/N/O/P proteins form an inner membrane complex that affects the stability of the Pseudomonas aeruginosa type IV pilus secretin, J. Mol. Biol. 394 (2009) 128–142. J.T. Pratt, R. Tamayo, A.D. Tischler, A. Camilli, PilZ domain proteins bind cyclic diguanylate and regulate diverse processes in Vibrio cholerae, J. Biol. Chem. 282 (2007) 12860–12870. F. Martínez-Granero, A. Navazo, E. Barahona, M. Redondo-Nieto, E. González de Heredia, I. Baena, I. Martín-Martín, R. Rivilla, M. Martín, Identification of flgZ as a flagellar gene encoding a PilZ domain protein that regulates swimming motility and biofilm formation in Pseudomonas, PLoS One 9 (2014) e87608. S. Burdman, O. Bahar, J.K. Parker, L.F. L De, Involvement of type IV pili in pathogenicity of plant pathogenic Bacteria, Genes 2 (2011) 706–735. M.H.N. Shikata, A. Fujimoto, T. Nakamura, N. Matsui, A. Ishiyama, Y. Maekawa, N. Gotoh, The pilT gene contributes to type III ExoS effector injection into epithelial cells in Pseudomonas aeruginosa, J. Infect. Chemother. 22 (2016) 216–220.