Rosmarinic acid exerts an anticancer effect on osteosarcoma cells by inhibiting DJ-1 via regulation of the PTEN-PI3K-Akt signaling pathway

Journal Pre-proof

Rosmarinic acid exerts an anticancer effect on osteosarcoma cells by inhibiting DJ-1 via regulation of the PTEN-PI3K-Akt signaling pathway Zhanjun Ma , Jingjing Yang , Yang Yang , Xuexi Wang , Guohu Chen , Ancheng Shi , Yubao Lu , Shouning Jia , Xuewen Kang , Li Lu PII: DOI: Reference:

S0944-7113(20)30019-2 https://doi.org/10.1016/j.phymed.2020.153186 PHYMED 153186

To appear in:

Phytomedicine

Received date: Revised date: Accepted date:

30 August 2019 2 January 2020 7 February 2020

Please cite this article as: Zhanjun Ma , Jingjing Yang , Yang Yang , Xuexi Wang , Guohu Chen , Ancheng Shi , Yubao Lu , Shouning Jia , Xuewen Kang , Li Lu , Rosmarinic acid exerts an anticancer effect on osteosarcoma cells by inhibiting DJ-1 via regulation of the PTEN-PI3K-Akt signaling pathway, Phytomedicine (2020), doi: https://doi.org/10.1016/j.phymed.2020.153186

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier GmbH.

Rosmarinic acid exerts an anticancer effect on osteosarcoma cells by inhibiting DJ-1 via regulation of the PTEN-PI3K-Akt signaling pathway Zhanjun Maa, b, 1, Jingjing Yanga, 1, Yang Yanga, 1, Xuexi Wangc, d, *, Guohu Chene, Ancheng Shia, Yubao Lua, Shouning Jiaf, Xuewen Kangb, **, Li Luc, g, *** a. The Second Clinical Medical College, Lanzhou University, Lanzhou, Gansu 730000, China b. Department of Orthopedics, Lanzhou University Second Hospital, Lanzhou, Gansu 730000, China c. Key Laboratory of Preclinical Study for New Drugs of Gansu Province, LanzhouGansu 730000, China d. School of Basic Medical Sciences, Lanzhou University, Lanzhou, Gansu 730000, China e. The First Clinical Medical College, Lanzhou University, Lanzhou, Gansu 730000, China f. Traditional Chinese Medicine Hospital of Qinghai Province, Xining, Qinghai 810000, China g. Institute of Pharmacology, School of Basic Medical Science, Lanzhou University, Lanzhou, Gansu 730000, China 1

These authors contributed equally to this study and share first authroship.

*

Correspondence author: Xuexi Wang, School of Basic Medical Sciences of Lanzhou

University, School of Medicine 205 Tianshui Rd South Lanzhou, Gansu 730000, China; Tel.: (+86)13893338793; Fax: 0931-8915184; E-mail: [email protected] **

Correspondence author: Xuewen Kang, The Second Clinical Medical College of

Lanzhou University, No. 82 Cuiyingmen Lanzhou 730030, Gansu, 730000, China; Tel.: (+86)13919026469; Fax: 0931-8943701; E-mail: [email protected] ***

Correspondence author: Li L, School of Basic Medical Sciences of Lanzhou

University, School of Medicine 205 Tianshui Rd South Lanzhou, Gansu 730000, China; Tel.: (+86)15193131441; Fax: 0931-8915184; E-mail: [email protected]

1

ABSTRACT Background: Osteosarcoma is the most common type of primary malignant bone tumor. This disease has exhibited a progressively lower survival rate over the past several decades, which has resulted in it becoming a main cause of death in humans. Rosmarinic acid (RA), a water-soluble polyphenolic phytochemical, exerts powerful anticancer effects against multiple types of cancer; however, its potential effects on osteosarcoma remain unknown. Hence, the present study investigated the efficacy of RA against osteosarcoma and aimed to clarify the mechanisms underlying this process. Methods: The effects of RA on cell viability, apoptosis, cell cycle distribution, migration, invasion, and signaling molecules were analyzed by CCK-8 assay, flowcytometric analysis, wound healing assay, Transwell assay, proteomic analysis, and use of shRNAs. Results: RA exerted anti-proliferation and pro-apoptotic effects on U2OS and MG63 osteosarcoma cells. Apoptosis was induced via extrinsic and intrinsic pathways by increasing the Bax/Bcl-2 ratio, triggering the intracellular production of reactive oxygen species (ROS), reducing the mitochondrial membrane potential (MMP), and upregulating the cleavage rates of caspase-8, caspase-9, and caspase-3. Additionally, RA suppressed the migration and invasion of osteosarcoma cells by inhibiting the expression levels of matrix metalloproteinase-2 and -9 (MMP-2 and -9), which are associated with a weakening of the epithelial-mesenchymal transition (EMT). Moreover, proteomic analyses identified DJ-1 as a potential target for RA. Several studies have indicated an oncogenic role for DJ-1 using knockdowns via the lentiviral-mediated transfection of shRNA, which caused the conspicuous suppression of cell proliferation, migration, and invasion as well as the arrest of cell cycle progression. At the molecular level, the expression levels of DJ-1, p-PI3K, and p-Akt were reduced, whereas the protein levels of phosphatase and tensin homologue (PTEN) were increased. Conclusion: In conjunction with the high levels of DJ-1 expression in osteosarcoma tissues and cell lines, the present results suggested that RA exhibited anticancer 2

effects in osteosarcoma cells by inhibiting DJ-1 via regulation of the PTEN-PI3K-Akt signaling pathway. Therefore, DJ-1 might be a biological target for RA in osteosarcoma cells. Keywords:

Rosmarinic

acid,

osteosarcoma,

apoptosis,

proliferation,

DJ-1,

PTEN-PI3K-Akt pathway Abbreviations CCK-8: Cell Counting Kit-8; EMT: epithelial-mesenchymal transition; GSH: glutathione; LDH: lactate dehydrogenase; MMP: mitochondrial membrane potential; MMP-2: matrix metalloproteinase-2; MMP-9: matrix metalloproteinase-9; MDA: malondialdehyde; PTEN: phosphatase and tensin homologue; PAGE: polyacrylamide gel electrophoresis; PVDF: polyvinylidene difluoride; RA: Rosmarinic acid; ROS, reactive oxygen species; SOD: superoxide dismutase. TCM: Traditional Chinese Medicine; 2-DE: Two-dimensional electrophoresis.

3

Introduction Osteosarcoma is the most common malignant bone tumor, which often occurs in adolescents and children under 20 years of age; its incidence rate is 4.4/100, 000 people per year (Zhu et al., 2018). Currently, treatments for osteosarcoma include neoadjuvant chemotherapy combined with surgical resection, interventional therapies, and hot and cold ablation. However, due to lung metastasis and resistance to chemotherapy, it is difficult to achieve a 5-year survival rate for osteosarcoma that is greater than 80% (Bielack et al., 2016). Consequently, more effective therapeutic agents are needed for the treatment of osteosarcoma. Recently, the investigation and application of natural plants with potent anticancer activities have gained increasing attention due to their value and unique advantages (Han et al., 2018). One such compound used in Traditional Chinese Medicine (TCM), rosmarinic acid (RA), is a polyphenolic hydroxyl compound that is widely distributed in nature, especially in Labiatae, Boraginaceae, and Umbelliferae. The biological activities of RA include anti-mutagenic, antivirus, anti-inflammatory, antioxidant, and antitumor effects (Radziejewska et al., 2018). Additionally, the anti-neoplastic properties of RA against cancer have recently been demonstrated and some in vitro reports have shown that RA has certain protective effects against lung cancer, colon cancer, breast cancer, gastric carcinoma, and liver cancer (Radziejewska et al., 2018; Swamy et al., 2018; Khojasteh A et al., 2014). Furthermore, RA dramatically suppresses cancer cell proliferation, induces cell apoptosis, and arrests the cell cycle, which are characteristics associated with drugs that effectively prevent tumors. However, the anticancer effects of RA on osteosarcoma have yet to be investigated and the potential molecular mechanisms are unclear. TCM extracts constitute a characteristic complex material system that includes various chemical compositions that involve numerous organs, roles, and targets. Due to these diverse capabilities, evaluations of the mechanisms of action of these compounds are often challenging and difficult. Protein expression profiling has improved our understanding of the pathogenesis of multiple types of cancer. For example, when examining the molecular mechanisms underlying the anticancer 4

effects of TCMs, proteomic technology provides widespread advantages, aids in the detection of specific biomarkers, and helps to identify effective drug targets for various cancers (Lu et al., 2010). In the present study, the protein expression profiling of RA-treated osteosarcoma cells was performed using 2-dimensional electrophoresis (2-DE)

proteomic

analyses

in

conjunction

with

matrix-assisted

laser

desorption/ionization time of flight mass spectrometry (MALDI-TOF-MS) to identify and analyze differentially expressed proteins. The proteomic and bioinformatic analyses conducted in this study showed that DJ-1, which is also known as protein/nucleic acid deglycase DJ-1, was upregulated in osteosarcoma cells and was likely to participate in the development of osteosarcoma. Likewise, Niforou et al. (Niforou et al., 2008) observed high expression of DJ-1 in osteosarcoma U2OS cells using 2-DE proteomic analyses. Moreover, the present study also demonstrated that the expression of DJ-1 was markedly downregulated in osteosarcoma cells after treatment with RA. DJ-1 (PARK7/CAP1/RS) is a 189-amino acid protein that was originally identified as a putative oncogene associated with a Ras-related signaling transduction pathway (Ismail et al., 2014). DJ-1 is involved in multiple aspects of various biological processes

including antioxidant

stress, transcriptional regulation,

fertilization, mitochondrial regulation, and cell apoptosis (Ismail et al., 2014; Cao et al., 2015). DJ-1 is overexpressed in multiple types of malignant tumors, is positively related to tumor metastasis, and negatively related to patient survival (He et al., 2012). DJ-1 is also highly correlated with the oncogenesis, development, and maintenance of tumors and can be used as an early predictive biomarker for some cancers, which emphasizes its potential for cancer diagnoses and prognoses (Tian et al., 2008). More specifically, the knockdown of DJ-1 increases susceptibility to oxidative stress, enhances Bax expression, and promotes the activation of caspase-3. These findings demonstrate that oxidative stress and the Bax/caspase pathway are activated to induce apoptosis in tumor cells through inhibition of DJ-1 expression. Furthermore, recent evidence indicates that DJ-1 modulates the phosphatidylinositol-3-kinase (PI3K)/Akt pathway by negatively regulating the reactivity of the tumor suppressor 5

gene phosphatase and tensin homolog (PTEN) to influence cell proliferation and apoptosis (Kim et al., 2005). The PTEN-PI3K-Akt signaling pathway is an intracellular pathway that plays an important role in the regulation of several cellular processes and functions, including cell apoptosis, cell proliferation, angiogenesis, metastasis, and the epithelial-mesenchymal transition (EMT) of multiple tumors (Lee et al., 2015). Thus, chemotherapy targeting DJ-1 can suppress PTEN-PI3K-Akt pathway activation to prevent cancer. Despite this evidence, the effect of DJ-1 on osteosarcoma has not yet been reported, and the underlying mechanisms are unclear. Therefore, the present study evaluated the potential anticancer effects of RA on human osteosarcoma cells and the potential underlying mechanisms. First, the effects of RA on proliferation, cell cycle, apoptosis, invasion, migration, oxidative stress, and EMT were assessed in osteosarcoma cells, and differentially expressed proteins were identified using proteomic and bioinformatic analyses. Then, DJ-1 was knocked out and reversed in U2OS cells to elucidate the role that DJ-1 plays in osteosarcoma. We demonstrated that RA exerted anticancer effects in osteosarcoma cells by inhibiting DJ-1 via regulation of the PTEN-PI3K-Akt signaling pathway. Our findings strongly suggest that DJ-1 functions as an oncogene in osteosarcoma, and that RA shows promise for the treatment of human osteosarcoma. Materials and Methods Osteosarcoma clinical samples and cell culture Paraffin-embedded sections of primary osteosarcoma tissues and their matched adjacent non-tumor tissues were collected from 12 patients (12 osteosarcoma tissues and 12 normal tissue samples) who were admitted to the Lanzhou University Second Hospital (Lanzhou, China) from January 2016 to January 2019. These patients did not receive radiation or chemotherapy before surgery. All samples were obtained after detailed consent had been obtained from each patient; the present study was approved by the Ethics Committee of Lanzhou University Second Hospital. Additionally, human osteosarcoma cell lines (U2OS and MG63) and a human normal osteoblastic cell line (hFOB1.19) were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cell lines were cultured in 6

Dulbecco’s Modified Eagle Medium (DMEM; Thermo Fisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, Thermo Fisher Scientific) and 1% penicillin/streptomycin (Gibco, Thermo Fisher Scientific) at 37°C in a humidified atmosphere containing 5% CO2. Reagents and antibodies RA (purity ≥ 98%) was obtained from Sigma-Aldrich (St Louis, MO, USA). Prior to the experiments, 100 μg quantities of RA were dissolved in individual tubes with 1 mL of culture medium to retain the stability of RA. All reagents used in the 2-DE analysis were obtained from Bio-Rad Laboratories (Milan, Italy) and silver staining chemicals were obtained from CWBIO (Beijing, China). Primary antibodies against Cdc25c, Cyclin B1, Cdc2, PHB, PIN1, PRX5, PTEN, PI3K, p-PI3K, Akt, and p-Akt were obtained from Cell Signaling Technology (Danvers, MA, USA) and antibodies against KI67, Bcl-2, Bax, caspase-8, caspase-9, caspase-3, matrix metalloproteinase-2 (MMP-2), MMP-9, N-cadherin, E-cadherin, DJ-1, and GAPDH were obtained from Proteintech Group Inc. (Chicago, IL, USA). Cell viability assay To assess cell viability, the U2OS and MG63 cells were seeded onto 96-well plates (5 × 103 cells per well) containing 100 μl of complete medium for 24 h. Then, the cells were treated with 100 μl of fresh medium containing various concentrations of RA or cisplatin (Sigma Aldrich, St. Louis, MO) for the indicated times. Next, 10 μl of Cell Counting Kit-8 (CCK-8, Beyotime; Jiangsu, China) solution were added to each well, and incubated at 37℃ for 2 h. Finally, optical absorbance at 450 nm was measured using a microplate reader (Bio-Rad; Hercules, CA, USA). Lactate dehydrogenase release assay The cytotoxicity of RA in U2OS and MG63 cells was detected using a lactate dehydrogenase (LDH) release assay kit (Beyotime). Briefly, the U2OS and MG63 cells (1 × 104 cells per well) were seeded onto 96-well plates for 24 h and then 100 μl of fresh medium containing different concentrations of RA were added to each well for 48 h. Subsequently, the concentration of LDH released into the cell culture supernatant was determined using an LDH assay kit, in accordance with the 7

manufacturer’s instructions. Optical absorbance at 450 nm was immediately measured using a microplate reader. Cell morphology assessment To assess cell morphology, the U2OS and MG63 cells were cultured on coverslips in six-well plates (5 × 104 cells per well) containing 2 ml of complete medium for 24 h. Then, the cells were treated with fresh medium containing different concentrations of RA for 48 h. Subsequently, the cells were observed under an inverted light microscope (Nikon TS100, Nikon; Tokyo, Japan). Cell nuclei were stained with 5 μg/ml of Hoechst 33258 for 10 min in the dark and washed twice with phosphate-buffered saline (PBS); the nuclear morphology was observed using fluorescence microscopy (Olympus; Yokohama, Japan). Annexin V-fluorescein isothiocyanate/propidium iodide assays of apoptosis To assess apoptosis, the U2OS and MG63 cells (1 × 105 cells per well) were seeded onto six-well plates for 24 h and treated with different concentrations of RA for 48 h. After incubation, the cells were harvested, washed twice with PBS, and resuspended in 195 μl of binding buffer containing annexin V-fluorescein isothiocyanate (FITC; 5 μl) and propidium iodide (PI; 10 μl) using the cell apoptosis assay kit (Beyotime; Jiangsu, China); they were then incubated in the dark for 15 min. The apoptosis rates of the cells were analyzed using flow cytometry (BD Biosciences; Piscataway, NJ, USA). Cell cycle distribution analysis To evaluate cell cycle activity, U2OS and MG63 cells were exposed to different concentrations of RA for 48 h, harvested, and washed twice with PBS; they were then fixed with 70% ethanol overnight at 4℃. After cells had been washed with PBS, they were resuspended in PBS containing 100 μg/ml RNase A and 50 μg/ml PI in the dark at room temperature for 30 min. Cell cycle analysis was conducted using flow cytometry. Wound healing assay To determine wound healing, the U2OS and MG63 cells were seeded onto six-well plates (2 × 105 cells per well) and allowed to grow until they reached 8

approximately 80% confluence. Next, a wound line was made using a sterile pipette tip, the cell debris was washed several times with PBS, and the cells were cultured with different concentrations of RA for 24 h. Images of wound healing were captured under an inverted light microscope. The wound area was analyzed using ImageJ software. Cell invasion assays Cell invasion assays were performed using a 24-well Transwell chamber (24-well insert, pore size: 8 μm, Corning Costar; Corning, NY, USA) coated with Matrigel (Sigma-Aldrich). Briefly, the U2OS and MG63 cells (5 × 104) were seeded in the upper part of the Transwell chamber with medium containing different concentrations of RA without FBS, while the lower Transwell chamber was filled with complete medium containing 10% FBS as a chemoattractant. After they had been treated for 24 h, the cells in the upper chamber were removed using a cotton swab and the remaining cells were immersed in 4% paraformaldehyde. Subsequently, transmigrated cells were stained with 0.1% crystal violet, rinsed twice with PBS, and enumerated using an upright light microscope. Immunofluorescence staining For the immunofluorescence procedure, the U2OS cells were treated with 25 μg/ml RA for 48 h. After incubation, the cultured cells were harvested and fixed in 4% paraformaldehyde for 10 min, washed three times with PBS, and permeabilized in a blocking solution (5% BSA) for 1 h. Next, the cells were incubated with primary antibodies overnight at 4°C in a dark room and detected using a FITC- or Cy3-conjugated secondary antibody. After the nuclei had been counterstained with 4´-6-diamidino-2-phenylindole (DAPI) for 10 min, the slides were washed three times in PBS and photographed under a fluorescence microscope. Measurement of reactive oxygen species and mitochondrial membrane potential The concentration of intracellular reactive oxygen species (ROS) was measured using an ROS assay kit with dichloro-dihydro-fluorescein diacetate (DCFH-DA, Beyotime), which is oxidized to DCF (a fluorescent product) via hydroperoxides. The mitochondrial membrane potential (MMP) was analyzed using a Rhodamine 123 9

fluorescent dye kit (Beyotime). In brief, the treated cells were collected, resuspended in PBS, and stained with DCFH-DA or Rhodamine 123, in accordance with the manufacturer’s instructions. The levels of ROS and MMP were determined by flow cytometry or fluorescence microscopy. Measurements of malondialdehyde, glutathione, and superoxide dismutase levels The enzymatic activities of malondialdehyde (MDA), glutathione (GSH), and superoxide dismutase (SOD) were determined using the respective commercial assay kits (Beyotime), in accordance with the manufacturer’s instructions. The concentration of MDA was assessed in U2OS cells by evaluating thiobarbituric acid (TBA)-reacting substances at a wavelength of 532 nm and is expressed as nanomoles of MDA per milligram of protein. SOD activity was measured by calculating the rate of the inhibition of reduction of nitroblue tetrazolium (NBT) and is presented as units per milligram of protein. GSH activities were evaluated by determining the oxidation rate of reduced glutathione to that of oxidized glutathione using H2O2 and is expressed as micrograms per gram of protein. Protein contents were measured using a BCA assay kit (Beyotime). Two-dimensional electrophoresis and imaging analyses The two-dimensional electrophoresis (2-DE) analysis was performed as described previously (Ma et al., 2018; Ma et al., 2018). Briefly, the U2OS cells were exposed to 25 μg/ml RA for 48 h, collected, and lysed in 250 µl of lysis buffer. Whole-cell lysates (80 μg) were added to a 17 cm immobilized pH 3–10 nonlinear gradient strip (Bio-Rad Laboratories) and rehydrated in an Ettan IPG-phor isoelectric focusing system (Bio-Rad) at 20°C and 30 V for 10 h. Sample uptake into the strip was achieved at 20°C using the following settings: 250 V for 30 min, 1,000 V for 1 h, and 500 V for 10 h. Next, the strips were incubated in equilibration buffer containing 1% (w/v) dithiothreitol and 2.5% (w/v) iodoacetamide in 6 M urea, 0.375 M Tris-HCl (pH 8.8), 20% glycerol, and 2% sodium dodecyl sulfate (SDS). The second-dimension separation was performed using 12% SDS-polyacrylamide gel electrophoresis (PAGE) in two steps at 10°C: 70 V/gel for 30 min and 300 V/gel until the bromophenol blue reached the bottom of the gel. The gels were stained with 10

a silver staining kit (CWBIO), spots were detected using a GS-800 calibrated densitometer (Bio-Rad Laboratories), and the images were analyzed using PDQuest™ 2-DE (ver. 8.0.1; Bio-Rad Laboratories). Protein spots were extracted from the 2-DE gels and identified with MALDI-TOF/MS, as previously described (Ma et al., 2018; Ma et al., 2018). Immunohistochemistry assay For immunohistochemical analyses, tissue sections were de-waxed in xylene and then rehydrated using a graded ethanol series. For antigen retrieval, the histological sections were pretreated with 0.01 M citrate buffer (pH 6.0) for 15 min at 100°C in a microwave oven, incubated with a primary antibody against DJ-1 at 4°C overnight, and then incubated with a secondary antibody kit (Solarbio; Beijing, China) using the SP method, in accordance with the manufacturer’s instructions; the enzyme substrate 3′,3-diaminobenzidine tetrahydrochloride (DAB) was used to develop color (Biological Technology; Wuhan, China). The sections were counterstained with hematoxylin and photomicrographs were captured using an upright light microscope. Knockdown of DJ-1 by transfection GPH-H-DJ-1-sh, GTP-H-DJ-1 lentivirus, and the vector control were obtained from Bio-link-gene Co., Ltd. (Shanghai, China). Prior to the transfection, the U2OS cells (5 × 104) were plated in six-well plates and cultured for 24 h until they grew to 30-40% confluency. Subsequently, the lentiviruses were added to the wells with 1 mL of DMEM and 5 μg/ml Polybrene (Sigma-Aldrich). After incubation for 48 h, the medium containing the virus was removed and replaced with normal DMEM. Then, knockdown efficiency was verified by quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot analyses. The impacts of DJ-1 on cell proliferation, migration, invasion, apoptosis, and cycle distribution in U2OS cells were evaluated in transfected cells using CCK-8 assays, scratch assays, Transwell assays, and flow cytometry analyses, respectively, as described above. Reverse transcription quantitative polymerase chain reaction analysis Total RNA was isolated from osteosarcoma cells and tissues using the TRIzol lysis reagent (Qiagen; Valencia, CA, USA) according to the manufacturer’s 11

instructions. Complementary DNA (cDNA) was synthesized from 1 μg of total RNA using a cDNA reverse transcription kit (TaKaRA; Dalian, China) according to the manufacturer’s instructions. Messenger RNA (mRNA) levels were determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR) following a standard protocol with the LightCycler 96 System (Roche; Pleasanton, CA, USA) and detection via SYBR green (SYBR Green Supermix; TaKaRa). The results were normalized to GAPDH mRNA levels and fold-change values were analyzed using the 2-ΔΔCt method. The sequences of the primers are listed in Table 1. Western blot analysis For the Western blot analyses, the U2OS and MG63 cells were washed twice with pre-cold PBS, lysed in radioimmunoprecipitation assay (RIPA) buffer, and quantified with a Bradford Protein Assay Kit (Beyotime). Equal amounts of protein samples were subjected to 10% SDS-PAGE gels, electrotransferred onto 0.45-μm polyvinylidene difluoride (PVDF) membranes (Millipore; Billerica, MA, USA), sealed with a Tris-buffered saline with Tween 20 (TBST) solution containing 5% BSA for 2 h at room temperature, and then incubated overnight with primary antibodies at 4℃. Next, the membranes were incubated with the corresponding secondary antibodies for 1 h and the signals were visualized using chemiluminescence (Bio-Rad). ImageJ software was used to analyze the Western blot data. Statistical analysis All values are shown as means ± standard deviations (SDs) of data from experiments performed in triplicate. Student’s t-tests and one-way analysis of variance (ANOVA) tests performed with SPSS ver. 21.0 software (IBM Corp., Armonk, NY, USA) were used to assess significant differences between the groups and p values < 0.05 were considered to indicate statistical significance. Results RA inhibited the proliferation of osteosarcoma cells The chemical structure of RA is presented in Fig. 1A. To assess the inhibitory effect of RA on the growth of osteosarcoma cells, U2OS and MG63 cells were exposed to different concentrations of RA for 24, 48, and 72 h. Cisplatin was used as 12

a positive control. The CCK-8 assay results demonstrated that inhibition occurred in a time- and dose-dependent manner following treatment with RA (Fig. 1B). The half maximal inhibitory concentration (IC50) value of RA for the U2OS cells was 28 ± 1.14 μg/ml and MG63 cells was 25 ± 1.37 μg/ml after 48 h of treatment. The CCK-8 assay showed that RA had a more remarkable effect on MG63 cells compared to its effect on the U2OS cells. The IC50 for cisplatin in 48 h was calculated as 12 ± 1.46 μg/ml (U2OS) or 17 ± 1.25 μg/ml (MG63), showing a bit stronger in cytotoxicity compared to RA. Above these results indicated that RA can be regarded as a potential drug targeting osteosarcoma. Meanwhile, 30 μg/ml RA was used in the subsequent 2-DE experiments. Next, the cytotoxic phenotypes were evaluated under a microscope (Fig. 1C), which indicated that the growth of U22OS and MG63 cells was suppressed by RA. LDH stably exists in the cytoplasm of normal cells but is released outside the cell if its membrane is damaged. Thus, assessing LDH activity in cell culture supernatants reveals the degree of cell damage and cytotoxicity. Compared to the control group, LDH release was significantly higher in U2OS and MG63 cells after treatment with different concentrations of RA for 48 h (Fig. 1D), which further supports RA-induced cytotoxicity in osteosarcoma cells. Additionally, Ki67 immunofluorescence staining demonstrated that RA significantly attenuated the fluorescence intensity of Ki67 and inhibited the growth of osteosarcoma cells (Fig. 1E-G). Taken together, these data demonstrate that RA exerted an anti-proliferative effect on osteosarcoma cells. RA induced G2/M phase arrest in osteosarcoma cells Cell cycle arrest is an important factor for many anticancer agents. To determine the effect of RA on the cell cycle distribution in osteosarcoma cells, a cell cycle analysis was performed by flow cytometry. Compared to the control, the ratios of cells in the G2/M phase increased from 11.21% in the untreated group to 15.05%, 17.68%, and 23.92% in U2OS cells following treatment with RA (12.5, 25, and 50 μg/ml), respectively; a similar tendency was found in MG63 cells (Fig. 2A-C). These results indicate that RA induced G2/M phase arrest in osteosarcoma cells. To determine the mechanisms underlying this inhibition, Western blot and 13

qRT-PCR analyses were performed to assess the levels of proteins that regulate G2/M phase progression. The protein and mRNA levels of Cyclin B1, Cdc2, and CDC25c decreased in U2OS and MG63 cells after treatment with RA for 48 h whereas the mRNA level of p21 increased in a dose-dependent manner (Fig. 2D-E). Taken together, the above results indicate that the RA-induced G2/M phase arrest resulted from the regulation of cell cycle-related proteins. 3.3 RA induced apoptosis in osteosarcoma cells To further evaluate the mechanism underlying the RA-induced death of osteosarcoma cells, the effects of RA in U2OS and MG63 cells were assessed in terms of apoptosis. First, nuclear morphological changes were detected using Hoechst 33258 staining. Cell nuclei in the control group were round and intact with only faint staining, which indicated that the cells were alive. However, after treatment with RA, the U2OS and MG63 cells obviously exhibited the typical characteristics of apoptosis including apparent nuclear condensation, nuclear fragmentation, and enhanced brightness (Fig. 3A). The RA-induced apoptosis of osteosarcoma cells was measured using an Annexin V-FITC/PI double-staining assay kit. The rate of apoptosis increased as the RA concentration increased, and the proportions of apoptotic cells increased from 0.75% in the control group to 6.26%, 12.27%, and 23.82% in U2OS cells after treatment with RA (12.5, 25, and 50 μg/ml), respectively, for 48 h. Similarly, the rates of apoptosis in the whole MG63 cells after RA treatment (12.5, 25, and 50 μg/ml) were 10.37%, 20.31%, and 37.51%, respectively, compared to 3.21% in the control group (Fig. 3B-D). These results indicate that RA might inhibit the proliferation of osteosarcoma cells by inducing apoptosis. To ascertain further the mechanisms supporting RA-induced apoptosis in 14

osteosarcoma cells, the expression levels of apoptosis-related proteins were evaluated. Immunofluorescence staining indicated that RA significantly enhanced caspase-3 activity in U2OS and MG63 cells as the concentration of RA increased (Fig. 4A-B). Additionally, RA increased the levels of caspase-9 and Bax but decreased the levels of Bcl-2 compared to control cells; these proteins are related to the intrinsic apoptosis pathway (Ren et al., 2013). Furthermore, caspase-3 and caspase-8, which are associated with the extrinsic apoptosis pathway (Fatehchand et al., 2017), were upregulated by RA in U2OS and MG63 cells (Fig. 4C-D). Moreover, the mRNA levels of Bax and Bcl-2 were enhanced after RA treatment (Fig. 4E); caspase-9 and caspase-8 activities exhibited remarkable dose-dependent increases following RA treatment (Fig. 4F). Taken together, these findings indicate that RA induced the apoptosis of osteosarcoma cells via both the intrinsic and extrinsic pathways. RA induced ROS generation and collapse of the MMP in osteosarcoma cells The MMP plays a role in the oxidative phosphorylation of mitochondrion and can be damaged prior to early uncontrolled changes in the intrinsic apoptosis pathway (Haeberlein, 2014). In the present study, the MMP in RA-treated U2OS cells decreased in a dose-dependent manner relative to the control group (Fig. 5A). Notably, oxidative stress is an important factor leading to mitochondrial dysfunction, and ROS play a key role in controlling cell proliferation and apoptosis. DCFH-DA passes through the cytomembrane, where it is oxidized by ROS (Matés et al., 2008); therefore, the effects of RA on ROS production in U2OS cells were investigated using this oxidant-sensitive fluorescent probe. There was an obvious increase in the fluorescent signal intensity, which suggests that there was an accumulation of intracellular ROS in U2OS cells exposed to RA for 48 h, compared to the control cells (Fig. 5B). Conversely, antioxidant enzymes such as MDA, GSH, and SOD protect cells against the effect of ROS. Compared to the control group, cells treated with RA 15

exhibited increased levels of MDA, but reductions in the activities of GSH and SOD (Fig. 5C-E). These findings demonstrate that elevations in oxidative stress may represent a mechanism by which RA induced the apoptosis of osteosarcoma cells. RA inhibited the migration and invasion of osteosarcoma cells Tumor invasion and metastasis are the most common characteristics correlated with the survival of patients and, thus, the inhibition of tumor migration and invasion might be an effective strategy for the prevention of metastasis. In the present study, the wound-healing assay demonstrated that treatment with RA significantly reduced the wound closure rate in U2OS and MG63 cells in a dose-dependent manner (Fig. 6A-C). Furthermore, the Transwell chamber assay showed that RA significantly reduced the numbers of invaded U2OS and MG63 cells, compared to the control (Fig. 6D-E). These results demonstrate that RA reduced the migration and invasion of U2OS and MG63 cells. Extracellular MMPs play a crucial role in tumor invasion and metastasis. Thus, the mRNA and protein expression levels of MMP-2 and MMP-9 were assessed after treatment with RA; the results showed that RA reduced both the mRNA and protein levels of MMP-2 and MMP-9 (Fig. 6F-H). These results indicate that RA inhibited the migration and invasion of osteosarcoma cells by reducing the levels of MMP-2 and MMP-9. RA inhibited the EMT of osteosarcoma cells EMT is a phenotypic conversion that accelerates the development of neoplasia and plays an important role in the metastasis of tumors (Zhou et al., 2018). To determine whether RA modulates the EMT, immunofluorescence staining was performed to assess the expression levels of N-cadherin and E-cadherin. There was significant upregulation in the expression of E-cadherin, which is an epithelial marker, whereas N-cadherin, which is a mesenchymal marker, was downregulated in U2OS cells after treatment with RA (Fig. 7A-B). Moreover, the Western blot and qRT-PCR results were consistent with the immunofluorescence results from U2OS and MG63 cells (Fig. 7C-D); other EMT-related mesenchymal markers, such as Snail, Vimentin, and Twist, were also suppressed by RA treatment (Fig. 7E-F). These results indicate 16

that RA suppresses the EMT in osteosarcoma cells. Proteomic analysis To acquire a complete view of the changes in protein synthesis and to clarify the possible molecular mechanisms underlying the response to RA treatment in U2OS cells, proteome analyses using 2-DE were performed on U2OS cells. First, the U2OS cells were exposed to 30 μg/ml RA for 48 h and harvested. Then, 2-DE protein maps were used to evaluate the RA-induced protein changes in U2OS cells. The proteins were separated using 2D-PAGE and a typical pair of silver-stained images was obtained (Fig. 8A). The 10 proteins that showed at least a two-fold difference in intensity between the RA-treated U2OS cells and control cells (p < 0.05) were used for further analysis. The identified proteins are shown by the arrows marked in spots 1–10; lists of the identified proteins with their theoretical molecular weights, protein identification (pI), coverage, MASCOT scores, MS/MS matched sequences, and changes in expression levels are presented in Table 2. Of these proteins, four were upregulated (myosin light polypeptide 6 [MYL6], ubiquitin-like modifier-activating enzyme ATG7 [ATG7], proteasome subunit alpha type-5 [PSMA5], and prohibitin [PHB]), and six were downregulated (peptidyl-prolyl cis-trans isomerase A [PIN4], complement component 1 Q subcomponent-binding protein, mitochondrial [C1QBP], protein disulfideisomerase A6 [PDIA6], peroxiredoxin-5, mitochondrial [PRX5], protein/nucleic acid deglycase DJ-1 [DJ-1], and phosphoglycerate mutase 1 [PGAM1]). Western blot analyses confirmed the differential levels of PHB, PIN1, and PRX5 in RA-treated and -untreated U2OS cells. More specifically, treatment with RA upregulated PHB protein levels and downregulated PIN1 and PRX5 protein levels in U2OS cells (Fig. 8B). The 2-DE and Western blot analyses yielded similar results. Furthermore, the online STRING database was used to predict the interaction networks among the identified proteins (Fig. 8C); PSMA5, PRAK7, and C1QBP were key nodes and modulators in the network. GO analysis uses a dynamic, controlled vocabulary that is applied to all eukaryotes to explain the roles of genes and proteins in cells. Next, an analysis of the GO function classifications of the proteins revealed 17

that 16 functions were annotated as MF, 150 as BP, and 21 as CC (p < 0.05); the top 10 significantly enriched GO terms, identified using a threshold false discovery rate of p < 0.01, are shown in Fig. 8D-F. The identified proteins were involved in multiple biological processes and exhibited different molecular functions that were mainly related to oxidative stress, metabolism, cell proliferation, and apoptosis. RA inhibited the PTEN-PI3K-Akt pathway in osteosarcoma cells STRING analysis demonstrated that DJ-1 was a key node and modulator in the identified network. DJ-1 activates the PI3K-Akt pathway by negatively regulating the function of PTEN to regulate cancer cell EMT, proliferation, and apoptosis (Kim et al., 2005). In this study, U2OS cells treated with RA exhibited a significant reduction in the protein and mRNA expression levels of DJ-1 (Fig. 9A). The effects of RA on the expression levels of certain molecules involved in the PTEN-PI3K-Akt signaling pathway were also assessed in the present study. Western blot analyses revealed that U2OS and MG63 cells treated with different concentrations of RA for 48 h exhibited significant reductions in the protein expression levels of phospho-PI3K (p-PI3K) and phospho-Akt (p-Akt) while PTEN levels increased in a dose-dependent manner. However, there were no significant differences in the expression levels of total PI3K or Akt (Fig. 9B-D). Thus, the present results demonstrated that RA inhibited the PTEN-PI3K-Akt signaling pathway in U2OS and MG63 cells. DJ-1 was unregulated in human osteosarcoma tissues and cell lines The proteomics results demonstrated that DJ-1 was likely to be a key molecule associated with osteosarcoma. Previous studies have shown that RA inhibits the proliferation, metastasis, and induction of cell apoptosis in colorectal cancer cells (Han et al., 2018). Similarly, in the present study, RA exerted anti-proliferative effects in osteosarcoma cells. Because DJ-1 plays key roles in the proliferation, oxidative stress, and cell cycle regulation of cancer cells (Gao et al., 2017; Lin et al., 2018), the present study sought to verify whether the anticancer effects of RA in osteosarcoma cells were also mediated through DJ-1. To explore the role played by DJ-1 in osteosarcoma development, 12 primary osteosarcoma tissues and their adjacent normal tissues were evaluated with a DJ-1 18

immunohistochemistry assay. In both tissue groups, DJ-1 was diffusely expressed in the cytoplasm of osteosarcoma cells; however, the average expression of DJ-1 in the osteosarcoma tissues was higher than that in the non-cancerous tissues (Fig. 10A). These expression levels were confirmed by qRT-PCR analyses of the osteosarcoma and matched normal tissues, which showed that DJ-1 mRNA was upregulated in the tumors (Fig. 10B). DJ-1 protein and mRNA expression levels were evaluated by Western blot and qRT-PCR analyses of the osteosarcoma cell lines, U2OS and MG63, and the normal human osteoblastic cell line, hFOB1.19. The protein and mRNA expression levels of DJ-1 were significantly higher in the osteosarcoma cell lines (Fig. 10C-D). Taken together, these results demonstrate that DJ-1 was upregulated in osteosarcoma tissues and cells, and that it was related to the progression of osteosarcoma; thus, it might play a role in inhibiting human osteosarcoma development. DJ-1 knockdown inhibited cell proliferation and cell metastasis and induced apoptosis in osteosarcoma cells The above results indicated that RA possesses antitumor effects that are protective against osteosarcoma and that these inhibitory effects may be due to the suppressive effects of RA on DJ-1. To verify whether RA suppresses the proliferation, migration, and invasion of osteosarcoma cells via the regulation of DJ-1 signaling, DJ-1 was knocked-down using its specific shRNA. Accordingly, U2OS cells were transfected with lentiviral vector-encoding shDJ-1 or shCtrl and the subsequent biological consequences were observed. First, analyses of DJ-1 expression levels in U2OS cells, which had been treated with lentiviral vector-encoding shDJ-1 or shCtrl, revealed the knockdown efficiency to be approximately 55% (Fig. 11A). CCK-8 analyses showed that the knockdown of DJ-1 significantly suppressed the proliferation of U2OS cells (Fig. 11B) and that shDJ-1 restrained cell migration and invasion, while it reduced the protein levels of MMP-2 and MMP-9 (Fig. 11C-F). Additionally, flow cytometry and Western blot analyses of the effects of DJ-1 on apoptosis in U2OS cells showed that the knockdown of DJ-1 significantly induced cell apoptosis and increased the expression 19

levels of caspase-8, caspase-9, and caspase-3; however, it reduced the expression levels of Bcl-2, compared to shCtrl cells (Fig. 11G-H). The flow cytometry and Western blot results also indicated that the knockdown of DJ-1 increased the proportion of cells in the G2/M phase and significantly reduced the protein levels of Cdc25C, Cyclin D1, and Cdc2 (Fig. 11I-J). Therefore, these results demonstrate that DJ-1 enhanced proliferation and metastasis and suppressed apoptosis in osteosarcoma cells. Discussion Osteosarcoma, the most malignant primary bone tumors, frequently affects proximal humerus, distal femur, and long bone metaphysis. Although the 5-year survival rate of osteosarcoma patients who undergo surgery in conjunction with chemotherapy has improved to 50-70% over the past 30 years, this rate has not further improved due to intolerance to traditional platinum-based chemotherapy drugs. Additionally, the 5-year survival rate of patients with metastases is only 20-30%. Therefore, there is an imperative need to develop more innovative and effective drugs for the treatment of osteosarcoma. In the current study, we investigated the anticancer effects of RA on osteosarcoma and the underlying mechanisms. The findings demonstrated that RA suppressed cell proliferation, caused G2/M phase arrest, and induced apoptosis in osteosarcoma cells by inhibiting DJ-1 by regulating the PTEN-PI3K-Akt signaling pathway (Figure 9E). In recent years, many studies have demonstrated that TCMs possess unique advantages and have potential for the prevention of cancer. Although there is an increasing number of reports regarding the anti-tumor effects of RA against different types of cancer, no study has investigated the effect of RA on osteosarcoma. The current study was the first to investigate the anti-proliferative effects of RA in osteosarcoma cell lines (U2OS and MG63) and to reveal that treatment with RA suppressed the proliferation of osteosarcoma cells. Because the anti-proliferative effects of RA are intimately related to cell cycle arrest and apoptosis (Niknejad et al., 2016), changes in the cycle distribution of U2OS and MG63 cells after treatment with RA were assessed in the present study. RA-treated U2OS and MG63 cells exhibited 20

an increase in the percentage of cells in the G2/M phase. CDK1 (also known as Cdc2) activity requires the binding of a regulatory subunit (Cyclin B1); stimulation of the Cyclin B1/Cdc2 protein complex plays an important role in facilitating the transition from the G2 phase to the M phase (Gavet and Pines, 2010). In the current study, Western blot and RT-PCR analyses showed that RA reduced the expression levels of Cyclin B1 and Cdc2. During the G2/M transition, activated Cdc25C regulates both Cdc2 and Cyclin B1 to trigger the Cyclin B1/Cdc2 complex to promote mitosis (Gavet and Pines, 2010); the CDK inhibitor p21 deactivates the Cyclin B1/Cdc2 complex during p53-mediated G2/M arrest (Nakayama and Yamaguchi, 2013). The present study found that RA treatment increased the expression levels of p21 but downregulated Cdc25C, which indicates that RA induced G2/M arrest in osteosarcoma cells at the molecular level. Therefore, the present findings demonstrated that RA induced the arrest of osteosarcoma cells at the G2/M phase by inhibiting the Cyclin B1/Cdc2 complex, which has been previously reported by Lin (Lin et al., 2018). Apoptosis is mainly triggered via the extrinsic death receptor-mediated pathway (caspase-8) or the intrinsic mitochondria-mediated pathway (caspase-9). These pathways are decontrolled in cancer cells and, thus, the induction of apoptosis is an important indicator of anti-tumor agents in cancer cells (Safarzadeh et al., 2014). In the current study, RA induced the apoptosis of osteosarcoma cells. The extrinsic apoptosis pathway is triggered through the tumor necrosis factor family and, once it is stimulated, procaspase-8 is cleaved to caspase-8, which induces the activation of caspase-3 and results in cell death (Safa, 2012). The intrinsic apoptosis pathway involves depolarization of the MMP, which ultimately results in the induction of apoptosis via caspase-dependent pathways. Bcl-2 family proteins are also important regulators of apoptosis and include anti-apoptotic proteins (e.g., Bcl-2) and pro-apoptotic proteins (e.g., Bax). A higher Bax/Bcl-2 ratio could form ion channels, causing the release of cytochrome c (Cyt-C) from mitochondria into the cytosol, and leading to the activation of caspases-9 and -3, which then induce apoptosis (Lin et al., 2018). In particular, oxidative stress is an 21

important factor that results in mitochondrial dysfunction (Zhou et al., 2018). For example, elevated intracellular levels of ROS cause irreversible damage in cancer cells via cell cycle arrest and apoptosis; increased mitochondrial oxidative stress results in the release of Cyt-C, caspase activation, and cell death (Clarke et al., 2014). In the present study, treatment with RA significantly enhanced intracellular ROS production and MDA levels and decreased the activities of GSH and SOD, which are likely to be necessary for apoptosis. Additionally, RA induced cell apoptosis by increasing the Bax/Bcl-2 ratio, decreasing the MMP, and upregulating the cleavage rates of caspases-8, -9, and -3 in U2OS and MG63 cells. These results demonstrate that RA induced apoptosis of osteosarcoma cells through both the extrinsic and intrinsic apoptosis pathways. The EMT is a crucial biological process that is closely related to the progression and metastasis of tumors; it strengthens the invasion and metastasis of tumor cells, while inducing tumor cell resistance against deterioration (Zheng et al., 2015). After they undergo EMT, cancer cells will lose cell-to-cell contacts, cell-matrix connections, and normal epithelial characteristics, while obtaining mesenchymal features to achieve migration and invasion into the adjacent matrix (Tian et al., 2013). During EMT, the expression levels of epithelial markers, such as E-cadherin, are downregulated, whereas the expression levels of mesenchymal markers, such as N-cadherin, Snail, Vimentin, and Twist, are increased. In the present study, RA-treated osteosarcoma cells exhibited increased expression levels of E-cadherin and reduced expression levels of N-cadherin. Moreover, mesenchymal markers, including Snail, Vimentin, and Twist, were suppressed after treatment with RA. These data indicate that RA suppressed the EMT of osteosarcoma cells. After EMT occurs, cancer cells undergo migration and invasion, such that separate cancer cells invade the extracellular matrix (ECM) because it has been damaged by MMPs. MMP-2 and MMP-9 are key members of this family of proteolytic enzymes that are capable of destroying the ECM and supporting the penetration of cancer cells into the basement membrane (Deng et al., 2018). In this study, the Transwell assay results revealed that RA treatment inhibited the migration 22

and invasion of U2OS and MG63 cells, which might have been related to the inhibition of MMP-2 and MMP-9 expression levels in osteosarcoma cells. Similarly, previous studies have suggested that RA represses the invasion, migration, and EMT of human colorectal cancer cells by activating the AMPK signaling pathway (Han et al., 2018). To clarify the possible molecular mechanisms underlying the response of osteosarcoma cells to RA treatment, a proteomics analysis using 2-DE was performed in control cells and RA-treated U2OS cells. A comparison of the 2-DE results with MS analyses and a National Center for Biotechnology Information (NCBI) database search successfully identified a total of 10 protein spots. Additionally, the Western blot verification results were consistent with those of 2-DE analyses. Next, STRING analyses were applied to determine the interacting networks of the identified proteins and it was revealed that the proteins were closely clustered in an interaction network centered on the DJ-1, PSMA5, and C1QBP proteins. Therefore, the present results demonstrated that DJ-1 might be a potential molecular target for RA in osteosarcoma. DJ-1 was originally identified as a novel oncogene that displays important transforming activity in cooperation with c-Myc or H-Ras; plays a vital role in the initiation, progression, metastasis, oxidative stress, and apoptosis of tumors; and exhibits a degree of context dependency (Liu et al., 2018). An increasing number of reports have suggested that DJ-1 is frequently upregulated in many cancer types including prostate cancer, breast cancer, ovarian cancer, cervical cancer, and pancreatic cancer, which is consistent with its role as an oncogene (He et al., 2012; Cao et al., 2017). Furthermore, the overexpression of DJ-1 is correlated with a poor prognosis in subjects with malignant tumors (Cao et al., 2017). Downregulation of DJ-1 can suppress cell proliferation and enhance sensitivity to chemotherapies, and its inhibition strongly inhibits the proliferation and invasion of oral squamous cell carcinoma (Xu et al., 2016). Taken together, these results suggest that DJ-1 is a potential biomarker for cancer diagnoses and therapies. However, to the best of our knowledge, the clinical characteristics of DJ-1 expression in osteosarcoma have not yet been reported. 23

In the present study, the expression of DJ-1 was analyzed in 12 osteosarcoma tissue samples and two osteosarcoma cell lines; the findings showed that DJ-1 was overexpressed in cancer cells, relative to normal tissues and cells. Furthermore, the current study was the first to report the effects of DJ-1 on the proliferation, apoptosis, and metastasis of osteosarcoma cells. The downregulation of DJ-1 expression, using lentiviral vector-based shRNA, suppressed osteosarcoma cell growth and wound healing; Transwell assays revealed that DJ-1 downregulation weakened the migration and invasion of osteosarcoma cells. Moreover, the downregulation of DJ-1 induced apoptosis and cycle arrest in the G2/M phase in osteosarcoma cells. Thus, DJ-1 may contribute to the development of osteosarcoma via a possible pathway that enriches cell proliferation and metastasis but inhibits apoptosis, which suggests that it may be a novel prognostic factor and promising therapeutic target for osteosarcoma. Similar results have been reported by Lin (Lin et al., 2018) in cases of colorectal cancer. However, the present study only examined the short-term relationship between DJ-1 expression and osteosarcoma development; thus, a follow-up study of a cohort of patients is necessary. The present study also evaluated the molecular mechanisms that lead to changes in the biological features of tumors. Some reports have shown that PTEN is negatively regulated by DJ-1 to modulate the biological properties of cancer cells (Zhu et al., 2012); Kim et al. reported that DJ-1 expression is negatively correlated with PTEN, but positively correlated with the PI3k-Akt pathway in breast cancer specimens (Kim et al., 2015). PTEN is a frequently mutated tumor suppressor that may prevent the phosphorylation of PIP2; subsequently, PIP2 reduces PIP3 generation and eventual PI3k-Akt pathway activation to inhibit the proliferation of cancer cells (Martinat et al., 2004). An increasing number of studies have shown that the PI3K-Akt pathway plays an important role in numerous processes related to cancer—including tumorigenesis, apoptosis, proliferation, and metastasis—by altering multiple downstream transcription factors (Yu et al., 2008). It has also been shown that inhibition of the PI3K-Akt pathway can induce apoptosis in osteosarcoma cells. The overexpression of DJ-1 can downregulate 24

expression of the PTEN protein and reverse the PTEN-induced inhibition of cell proliferation to promote cell proliferation and growth. Previous studies have shown that DJ-1 mediates the PI3K-AKt-mTOR pathway to influence the survival of multiple tumor cells (Kim et al., 2005); Wang et al. found that the downregulation of DJ-1 decreases cell viability and induces apoptosis in cervical carcinoma by inactivating the PTEN-PI3K-Akt pathway (Wang and Gao, 2016). Therefore, the expression levels of DJ-1, PTEN, p-PI3K, and p-Akt were evaluated in the present study to elucidate the molecular mechanisms underlying RA-dependent cell proliferation and apoptosis in osteosarcoma cells. Following RA treatment, the expression levels of DJ-1, p-PI3K, and p-Akt were reduced, while that of PTEN was increased in osteosarcoma cells. These results indicate that RA induced cell apoptosis by inhibiting DJ-1 levels through modulation of the PTEN-PI3K-Akt signaling pathway in osteosarcoma cells. To the best of our knowledge, the present study is the first to evaluate the anticancer effects of RA in human osteosarcoma cells and to demonstrate that DJ-1 expression influences cell viability, apoptosis, and invasion in osteosarcoma cells. Specially, RA had different effects on the U2OS and MG63 cells, and the reason may be related to the degree of cell differentiation and heterogeneity. U2OS and MG63 cells are both human osteosarcoma cell lines, but U2OS is a poorly differentiated epithelioid cell and MG63 is a fibroblast-like cell. MG63 cell line is obtained by continuous subculture of primary osteosarcoma tissue in vitro, which are not derived from single cells and are heterogeneous. However, our data showed that RA had the effects of inhibiting proliferation and EMT, and promoted apoptosis of both U2OS and MG63 cells. Therefore, future studies using appropriate animal models will be necessary to understand more fully the therapeutic potential and safety of RA. In summary, RA (a natural TCM compound) suppressed cell proliferation; induced apoptosis and cell cycle arrest; and altered the invasion, migration, and EMT of osteosarcoma cells by inhibiting DJ-1 through regulation of the PTEN-PI3K-Akt signaling pathway. Given the marked upregulation of DJ-1 and superior anticancer effects of RA in osteosarcoma cells, DJ-1 may be a potential therapeutic target for 25

osteosarcoma and RA may be a promising novel agent for the treatment of osteosarcoma. Further investigations are needed to identify the specific regulatory mechanisms underlying the RA-induced suppression of osteosarcoma development.

Credit Author Statement Zhanjun Ma: Conceptualization, Methodology, Writing-Original draft preparation; Jingjing Yang: Data curation, Writing-Original draft preparation. Yang Yang: Software,

Writing-Review

&

Editing;

Xuexi

Wang:

Supervision,

Project

administration, Funding acquisition; Guohu Chen: Formal analysis; Ancheng Shi: Investigation, Resources; Yubao Lu: Visualization; Shouning Jia: Supervision; Xuewen

Kang:

Funding

acquisition;

Supervision;

Li

Lu:

Software,

Writing-Reviewing and Editing.

Acknowledgments This work was financially supported by the National Natural Science Foundation of China (81000878) and Talent innovation and entrepreneurship science and technology projects of Lanzhou city (2015-RC-20) and Chengguan District Science and Technology Project of Lanzhou city (2018-7-2, 2018-7-5) and Science and Technology Plan Project of Qinghai province (2018-ZJ-756, 2019-HZ-819) and Doctoral

Research

Fund

of

Lanzhou

University

Second

Hospital

(ynbskyjj2015-2-10). Author contributions ZJ M: Experimental studies, guarantor of integrity of entire study, and manuscript preparation. JJ Y: Experimental studies. YY: Experimental studies, Manuscript preparation. XX W: Drafting the article and revising it critically. GH C: Experimental studies. AC S: Manuscript preparation and statistical analysis. YB L: Literature research. SN J: Data acquisition and literature research. LL: Statistical analysis. XW K: Drafting the article and revising it critically. All authors read and approved the final manuscript. Conflict of interest 26

The authors declare no conflicts of interest. References Bielack, S., Hecker-Nolting, S., Blattmann, C., Kager, L., 2016. Advances in the management of osteosarcoma. F1000Res. 5, 2767. Cao, J., Lou, S., Ying, M., Yang, B., 2015. DJ-1 as a human oncogene and potential therapeutic target. Biochem. Pharmacol. 93(3), 241-250. Clarke, H.J., Chambers, J.E., Liniker, E., Marciniak, S.J., 2014. Endoplasmic reticulum stress in malignancy. Cancer Cell 25(5), 563-573. Cao, J., Chen, X., Ying, M., He, Q., Yang, B., 2017. DJ-1 as a Therapeutic Target Against Cancer. Adv. Exp. Med. Biol. 1037, 203-222. Deng, W., Han, W., Fan, T., Wang, X., Cheng, Z., Wan, B., Chen, J., 2018. Scutellarin inhibits human renal cancer cell proliferation and migration via upregulation of PTEN. Biomed. Pharmacother. 107, 1505-1513. Fatehchand, K., Santhanam, R., Shen, B., Erickson, E.L., Gautam, S., Elavazhagan, Mo X., Belay, T., Tridandapani, S., Butchar, J.P., 2017. Active hexose-correlated compound enhances extrinsic-pathway-mediated apoptosis of Acute Myeloid Leukemic cells. PLoS One 12(7), e0181729. Gao, H., Niu, Y., Li, M., Fang, S., Guo, L., 2017. Identification of DJ-1 as a contributor to multidrug resistance in human small-cell lung cancer using proteomic analysis. Int. J. Exp. Pathol. 98(2), 67-74. Gavet, O., Pines, J., 2010. Progressive activation of CyclinB1-Cdk1 coordinates entry to mitosis. Dev. Cell 18(4), 533-543. Han, Y.H., Kee, J.Y., Hong, S.H., 2018. Rosmarinic Acid Activates AMPK to Inhibit Metastasis of Colorectal Cancer. Front. Pharmacol. 9, 68. He, X., Zheng, Z., Li, J., Ben, Q., Liu, J., Zhang, J., Ji, J., Yu, B., Chen, X., Su, L., Zhou, L., Liu, B., Yuan, Y., 2012. DJ-1 promotes invasion and metastasis of pancreatic cancer cells by activating SRC/ERK/uPA. Carcinogenesis 33(3), 555562. Haeberlein, S.L., 2004. Mitochondrial function in apoptotic neuronal cell death. Neurochem Res. 29(3), 521-530. 27

Khojasteh, A., Mirjalili, M.H., Hidalgo, D., Corchete, P., Palazon, J., 2014. New trends in biotechnological production of rosmarinic acid. Biotechnol. Lett. 36(12), 2393-2406. Kim, R.H., Peters, M., Jang, Y., Shi, W., Pintilie, M., Fletcher, G.C., DeLuca, C., Liepa, J., Zhou, L., Snow, B., Binari, R.C., Manoukian, A.S., Bray, M.R., Liu, F.F., Tsao, M.S., Mak, T.W., 2005. DJ-1, a novel regulator of the tumor suppressor PTEN. Cancer Cell 7(3), 263-273. Lu, C.L., Qv, X.Y., Jiang, J.G., 2010. Proteomics and syndrome of Chinese medicine. J. Cell Mol. Med. 14(12), 2721-2728. Lee, M.S., Jeong, M.H., Lee, H.W., Han, H.J., Ko, A., Hewitt, S.M., Kim, J.H., Chun, K.H., Chung, J.Y., Lee, C., Cho, H., Song, J., 2015. PI3K/AKT activation induces PTEN ubiquitination and destabilization accelerating tumourigenesis. Nat. Commun. 6, 7769. Lin, Y., Chen, Q., Liu, Q.X., Zhou, D., Lu, X., Deng, X.F., Yang, H., Zheng, H., Qiu, Y., 2018. High expression of DJ-1 promotes growth and invasion via the PTEN-AKT pathway and predicts a poor prognosis in colorectal cancer. Cancer Med. 7(3), 809-819. Lin, W., Xie, J., Xu, N., Huang, L., Xu, A., Li, H., Li, C., Gao, Y., Watanabe, M., Liu, C., Huang, P., 2018. Glaucocalyxin A induces G2/M cell cycle arrest and apoptosis through the PI3K/Akt pathway in human bladder cancer cells. Int. J. Biol. Sci. 14(4), 418-426. Liu, R., Yang, Y.N., Yi, L., Qing, J., Li, Q.Y., Wang, W.S., Wang, J., Tang, Y.X., Tan, H., 2018. Diallyl disulfide effect on the invasion and migration ability of HL-60 cells with a high expression of DJ-1 in the nucleus through the suppression of the Src signaling pathway. Oncol. Lett. 15(5), 6377-6385. Ma, Z.J., Lu, L., Yang, J.J., Wang, X.X., Su, G., Wang, Z.L., Chen, G.H., Sun, H.M., Wang, M.Y., Yang, Y., 2018. Lariciresinol induces apoptosis in HepG2 cells via mitochondrial- mediated apoptosis pathway. Eur. J. Pharmacol. 821, 1-10. Ma, Z.J., Yan, H., Wang, Y.J., Yang, Y., Li, X.B., Shi, A.C., Xu, J.W., Lu, Y.B., Lu, L., Wang, X.X., 2018. Proteomics analysis demonstrating rosmarinic acid suppresses 28

cell growth by blocking the glycolytic pathway in human HepG2 cells. Biomed. Pharmacother. 105, 334-349. Matés, J.M., Segura, J.A., Alonso, F.J., Márquez, J., 2008. Intracellular redox status and oxidative stress: implications for cell proliferation, apoptosis, and carcinogenesis. Arch. Toxicol. 82(5), 273-299. Martinat, C., Shendelman, S., Jonason, A., Leete, T., Beal, M.F., Yang, L., Floss, T., Abeliovich, A., 2004. Sensitivity to oxidative stress in DJ-1-deficient dopamine neurons: an ES-derived cell model of primary Parkinsonism. PLoS Biol. 2(11), e327. Niforou, K.M., Anagnostopoulos, A.K., Vougas, K., Kittas, C., Gorgoulis, V.G., Tsangaris, G.T., 2008. The proteome profile of the human osteosarcoma U2OS cell line. Cancer Genomics Proteomics 5(1), 63-78. Niknejad, H., Yazdanpanah, G., Ahmadiani, A., 2016. Induction of apoptosis, stimulation of cell-cycle arrest and inhibition of angiogenesis make human amnion-derived cells promising sources for cell therapy of cancer. Cell Tissue Res. 363(3), 599-608. Nakayama, Y., Yamaguchi, N., 2013. Role of cyclin B1 levels in DNA damage and DNA damage-induced senescence. Int. Rev. Cell Mol. Biol. 305, 303-337. Radziejewska, I., Supruniuk, K., Nazaruk, J., Karna, E., Popławska, B., Bielawska, A., Galicka, A., 2018. Rosmarinic acid influences collagen, MMPs, TIMPs, glycosylation and MUC1 in CRL-1739 gastric cancer cell line. Biomed. Pharmacother. 107, 397-407. Ren, X., Zhang, Y., Li, C., Wang, H., Jiang, Z., Zhang, Z., Guo, Q., Song, G., Bi, K., Jiang, G., 2013. Enhancement of baicalin by hexamethylene bisacetamide on the induction of apoptosis contributes to simultaneous activation of the intrinsic and extrinsic apoptotic pathways in human leukemia cells. Oncol. Rep. 30(5), 2071-2080. Swamy, M.K., Sinniah, U.R., Ghasemzadeh, A., 2018. Anticancer potential of rosmarinic acid and its improved production through biotechnological interventions and functional genomics. Appl. Microbiol. Biotechnol. 102(18), 29

7775-7793. Safarzadeh, E., Sandoghchian Shotorbani, S., Baradaran, B., 2014. Herbal medicine as inducers of apoptosis in cancer treatment. Adv. Pharm. Bull. 4(Suppl 1), 421-427. Safa, A.R., 2012. c-FLIP, a master anti-apoptotic regulator. Exp. Oncol. 4(3), 176-184. Tian, M., Cui, Y.Z., Song, G.H., Zong, M.J., Zhou, X.Y., Chen, Y., Han, J.X., 2008. Proteomic analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in pancreatic juice from pancreatic ductal adenocarcinoma patients. BMC Cancer 8, 241. Tian, L., Shen, D., Li, X., Shan, X., Wang, X., Yan, Q., Liu, J., 2016. Ginsenoside Rg3 inhibits epithelial-mesenchymal transition (EMT) and invasion of lung cancer by down- regulating FUT4. Oncotarget 7(2), 1619-1632. Wang, H., Gao, W., 2016. DJ-1 Expression in Cervical Carcinoma and its Effects on Cell Viability and Apoptosis. Med. Sci. Monit. 22, 2943-2949. Xu, S., Ma, D., Zhuang, R., Sun, W., Liu, Y., Wen, J., Cui, L., 2016. DJ-1 Is Upregulated in Oral Squamous Cell Carcinoma and Promotes Oral Cancer Cell Proliferation and Invasion. J. Cancer 7(8), 1020-1028. Yu, H.G., Ai, Y.W., Yu, L.L., Zhou, X.D., Liu, J., Li, J.H., Xu, X.M., Liu, S., Chen, J., Liu, F., Qi, Y.L., Deng, Q., Cao, J., Liu, S.Q., Luo, H.S., Yu, J.P., 2008. Phosphoinositide

3-kinase/Akt

pathway

plays

an

important

role

in

chemoresistance of gastric cancer cells against etoposide and doxorubicin induced cell death. Int. J. Cancer 122(2), 433-443. Zhu, J., Sun, Y., Lu, Y., Jiang, X., Ma, B., Yu, L., Zhang, J., Dong, X., Zhang, Q., 2018. Glaucocalyxin A exerts anticancer effect on osteosarcoma by inhibiting GLI1 nuclear translocation via regulating PI3K/Akt pathway. Cell Death Dis. 9(6), 708. Zhou, B., Guo, W., Sun, C., Zhang, B., Zheng, F., 2018. Linc00462 promotes pancreatic cancer

invasiveness through the

miR-665/TGFBR1-TGFBR2/

SMAD2/3 pathway. Cell Death Dis. 9(6), 706. Zheng, X., Carstens, J.L., Kim, J., Scheible, M., Kaye, J., Sugimoto, H., Wu, C.C., 30

LeBleu, V.S., Kalluri, R., 2015. Epithelial-to-mesenchymal transition is dispensable for metastasis but induces chemoresistance in pancreatic cancer. Nature 527(7579), 525-530. Zhu, X.L., Wang, Z.F., Lei, W.B., Zhuang, H.W., Hou, W.J., Wen, Y.H., Wen, W.P., 2012. Tumorigenesis role and clinical significance of DJ-1, a negative regulator of PTEN, in supraglottic squamous cell carcinoma. J. Exp. Clin. Cancer Res. 31, 94. A

B

C

31

D

E

F

32

G.

Fig. 1. RA inhibits the proliferation of human osteosarcoma cells. (A) Chemical structure of RA. (B) CCK8 assays were used to evaluate the viabilities of U2OS and MG63 cells after treatment with different concentrations of RA or cisplatin for 24, 48, and 72 h. (C) Morphologies of U2OS and MG63 cells treated with different concentrations of RA for 48 h. Images were obtained using an inverted light microscope at a magnification of 200× (Scale bar = 50 μm). (D) Relative extracellular LDH concentrations of U2OS and MG63 cells, determined by LDH release assay. (E-G) Representative fluorescence images of Ki67 immunostaining of U2OS and MG63 cells treated with or without 25 μg/ml RA for 48 h at a magnification of 200× (Scale bar = 50 μm). Green florescence indicates Ki67-positive cells. Results are means ± SDs from three independent experiments. *P < 0.05 or **P < 0.01 indicates 33

a significant difference compared with the control group. A

B

C

D

34

E

Fig. 2. RA induces G2/M phase arrest in human osteosarcoma cells. (A, B) RA induced G2/M cell cycle arrest. U2OS and MG63 cells were treated with different concentrations of RA for 48 h. Cell cycle distribution was evaluated by flow cytometry. (C) Populations of RA-treated U2OS and MG63 cells in G2/M phase. (D) U2OS and MG63 cells were treated with RA for 48 h. Levels of cell cycle-related proteins were determined by Western blotting. (E) mRNA levels of Cyclin B1, Cdc2, CDC25c, and P21, as determined by qRT-PCR, in U2OS and MG63 cells treated with RA for 48 h. GAPDH was used as the loading control. Results are means ± SDs from three independent experiments. *P < 0.05 indicates a significant difference compared with the control group. A

35

B

C

36

Fig. 3. RA induces apoptosis of human osteosarcoma cells. (A) Apoptotic nuclear morphology changes induced by RA were detected by Hoechst 33258 staining and fluorescence microscopy at a magnification of 200× (scale bar = 50 μm). Arrows indicate apoptotic cells with typical nuclear condensation, nuclear fragmentation, and enhanced brightness. (B-D) U2OS and MG63 cells were cultured with different concentrations of RA for 48 h; apoptosis was evaluated by Annexin V-FITC and PI staining, as well as flow cytometry. Results are means ± SDs from three independent experiments. *P < 0.05 indicates a significant difference compared with the control group. A

B

37

C

D

E

F

38

G

Fig. 4. RA induces apoptosis of human osteosarcoma cells through extrinsic and intrinsic apoptosis pathways. (A, B) Representative immunofluorescence images of caspase-3 in U2OS cells (A) and MG63 cells (B) treated with RA for 48 h at a magnification of 200× (scale bar = 50 μm). Nuclei were stained with DAPI (blue) and images were obtained using a fluorescence microscope. (C, D) U2OS and MG63 cells were treated with RA for 48 h and Western blotting was performed to assess expression levels of Bcl-2, Bax, cleaved-caspase-8, cleaved-caspase-9, and cleaved-caspase-3. (E) Quantitative RT-PCR of the mRNA levels of Bax and Bcl-2 in RA-treated U2OS and MG63 cells. (F) Activities of caspase-8 and caspase-9 in U2OS 39

and MG63 cells. GAPDH was used as the loading control. Results are means ± SDs from three independent experiments. *P < 0.05 or **P < 0.01 indicates a significant difference compared with the control group. A

B

C

D

E

40

Fig. 5. RA induces ROS generation and collapse of MMP activity in osteosarcoma cells. (A) MMP activity was determined by Rhodamine 123 fluorescence intensity in U2OS cells treated with various concentrations of RA for 48 h (magnification, 200×; scale bar = 50 μm). (B) Scatter diagram of DCFH-DA results shows the levels of ROS in U2OS cells treated with different concentrations of RA for 48 h, followed by flow cytometry. (C-E) Effects of RA on MDA activity (C), GSH level (D), and SOD activity (E) in U2OS cells treated with RA for 48 h. *P < 0.05 or **P < 0.01 indicates a significant difference compared with the control group. A

B

41

C

D

E

42

F

G

H 43

Fig. 6. RA suppresses the migration and invasion of human osteosarcoma cells and inhibits the expression of related proteins. (A-C) Effects of RA on the migration of U2OS and MG63 cells, determined by wound-healing assay. After treatment of U2OS and MG63 cells with RA for 24 h, images were obtained using a microscope (100×; scale bar = 50 μm). (D, E) Effects of RA on invasion by U2OS and MG63 cells were assessed by Transwell assay with Matrigel; images were obtained using a microscope (100×; scale bar = 50 μm). (F, G) Protein levels of MMP-2 and MMP-9 in U2OS and MG63 cells treated with RA for 48 h were analyzed by Western blotting. (H) MMP-2 and MMP-9 mRNA levels were assessed by qRT-PCR. GAPDH was used as the loading control. Results are means ± SDs from three independent experiments. *P < 0.05 indicates a significant difference compared with the control group. A

44

B

C

D

E

45

F

Fig. 7. RA regulates the EMT of human osteosarcoma cells. (A, B) Representative immunofluorescence images of N-cadherin (A) and E-cadherin (B) in U2OS cells treated with RA for 48 h. Nuclei were stained with DAPI (blue) and images were obtained using a fluorescence microscope at a magnification of 200× (scale bar = 50 μm). (C, D) Protein levels of N-cadherin and E-cadherin in U2OS and MG63 cells after treatment with RA for 48 h were assessed by Western blotting. (E) mRNA levels of E-cadherin and N-cadherin in RA-treated U2OS and MG63 cells by qRT-PCR. (F) mRNA levels of Snail, Vimentin, and Twist in RA-treated U2OS and MG63 cells. GAPDH was used as the loading control. Results are means ± SDs from three independent experiments. *P < 0.05 indicates a significant difference compared with the control group. A

46

B

C

D 47

E

F

48

Fig. 8. Representative 2-DE gels of U2OS cells exposed to RA, protein interaction network, and functional analyses. (A) Cells were treated with 25 µg/ml RA or the control for 48 h. Total protein extracts were separated on pH 3–10 nonlinear IPG strips in the first dimension, followed by 12% SDS-PAGE in the second dimension and visualization by silver staining. Ten differentially expressed spots were identified by MS (arrow and number). (B) Confirmation of the MALDI/TOF/MS results by Western blotting of U2OS cells treated with different concentration of RA. PRX5 and PIN1 were downregulated and PHB was upregulated after RA treatment for 48 h in U2OS cells. GAPDH was used as the loading control. Results are means ± SDs from three independent experiments. *P < 0.05 or **P < 0.01 indicates a significant difference compared with the control group. (C) Protein-protein interaction networks built on STRING for the identified proteins. (D–F) GO classification of the proteins affected by RA in U2OS cells. y-axis shows significantly enriched GO terms relative to the genome; x-axis shows enrichment scores of those terms. (D) MF categories in GO. (E) BP categories in GO. (F) CC categories in GO. A

B

49

C

D

E

50

Fig. 9. RA suppresses the levels of DJ-1, PTEN, and PI3K-Akt signaling pathway-associated proteins in human osteosarcoma cells. (A) Effects of RA on the DJ-1 level in U2OS cells treated with different concentrations of RA were determined by Western blotting and qRT-PCR, respectively. (B) U2OS and MG63 cells were treated with RA for 48 h; Western blotting was performed to determine the levels of PTEN, p-PI3K, PI3K, p-Akt, and Akt. (C, D) p-PI3K/PI3K and p-Akt/Akt ratios. (E) RA exerts a significant anticancer effect by suppressing proliferation and the EMT in osteosarcoma cells, as well as by inducing apoptosis in those cells, possibly by blocking the PTEN-PI3K-Akt pathway. GAPDH was used as the loading control. Results are means ± SDs from three independent experiments. *P < 0.05 or **P < 0.01 indicates a significant difference compared with the control group. A

51

B

C

D

52

Fig. 10. Expression of DJ-1 in human osteosarcoma tissues and established cell lines. (A) Expression of DJ-1 in human osteosarcoma tissues and control tissues was evaluated by immunohistochemistry. (B) DJ-1 mRNA level in osteosarcoma tissues and matched adjacent non-cancerous bone tissues, as determined by qRT-PCR. (C, D) Expression levels of DJ-1 in human osteosarcoma cell lines, MG63 and U2OS, and human osteoblast cell line, hFOB1.19, were determined by Western blotting and qRT-PCR, respectively. GAPDH was used as the loading control. Results are means ± SDs from three independent experiments. *P < 0.05 indicates a significant difference compared with the control group. A

B

C

53

D

E

54

F

G

H

I

55

J

Fig. 11. Knockdown of DJ-1 inhibits the proliferation and metastasis of U2OS cells, while inducing their apoptosis. (A) Quantitative RT-PCR and Western blotting of DJ-1 mRNA and protein levels at 48 h after infection of U2OS cells with shCtrl or DJ-1 shRNA (shDJ-1) lentivirus. (B) Proliferation in U2OS cells after DJ-1 knockdown was measured by CCK-8 assay at 0, 24, 48 and 72 h after virus infection. (C-E) Effects of DJ-1 knockdown on cell migration and invasion by wound healing assay and Transwell assay. (F) Western blotting was performed to compare levels of MMP-2 and MMP-9 proteins between shCtrl- and shDJ-1-infected U2OS cells. (G) Apoptosis of shCtrl- and DJ-1 shRNA (shDJ-1)-infected cells at 48 h after infection was determined by flow cytometry. (H) Western blotting was performed to compare levels of Bcl-2, Bax, caspase-8, caspase-9, and caspase-3 proteins between shCtrland shDJ-1-infected U2OS cells. (I) Cell cycle analysis of shCtrl- and shDJ-1-infected cells at 48 h after infection. DNA content was measured by flow cytometry. (J) Western blotting was performed to compare the levels of cell cycle-related proteins—Cdc25C, Cyclin D1, and Cdc2—between shCtrl- and shDJ-1-infected cells. GAPDH was used as the loading control. Results are means ± 56

SDs from three independent experiments. *P < 0.05 or **P < 0.01 indicates a significant difference compared with the control group.

Table 1 Primer sequences for qRT-PCR GENE Cyclin B1 Cdc2

Forward primer sequence

Reverse primer sequence

TTGATACTGCCTCTCCAAGCCCAA TTGGTCTGACTGCTTGCTCTTCCT GAGCTGGCGCCCTGGTTCTG

CGGTCGCAGCGGTAGGTGTC

TGGTCACCTGGATTCTTC

ACCATTCGGAGTGCTA CA

P21

GGATTGGTTGGTTTGTTGGAATTT

ACAACCCTAATATACAACCACCCC

Bax

ATCCACCAAGAAGCTGAG

GTAGAAGAGGGCAACCAC

Bcl-2

CGGGAGAACAGGGTATGA

CAGGCTGGAAGGAGAAGAT

MMP-2

TATGGCTTCTGCCCTGAGAC

CACACCACATCTTTCCGTCA

MMP-9

AGTCCACCCTTGTGCTCTTC

ACTCTCCACGCATCTCTGC

GACCGAGAGAGTTTCCCTACG

TCAGGCACCTGACCCTTGTA

CDC25c

E-cadherin

N-cadherin GAGATCCTACTGGACGGTTCC Snail

TCTTGGCGAATGATCTTAGGA

CTGCGGGAAGGCCTTCTCT

CGCCTGGCACTGGTACTTCTT

CCTTGAACGCAAAGTGGAATC

TGAGGTCAGGCTTGGAAACAT

Twist

AGCTACGCCTTCTCGGTCT

CCTTCTCTGGAAACAATGACA

DJ-1

GCCAGCCTTGAAGATGCAAA

GGCTTGTAAGAATCAGGCCGT

GAPDH

GCACCGTCAAGGCTGAGAAC

ATGGTGGTGAAGACGCCAGT

Vimentin

57

Table 2 MALDI-TOF-MS/MS identification results of differentially expressed protein spots in RA treated U2OS cells

Spot

Accession

MW

Protein name No.

Sequence pI

No.

(KD)

score

Expression

Quantitative

change

changes (%)

matches coverage（%）

1

Myosin light polypeptide 6

P60660

18.311

4.68

76

14

4(2)

Increase

2.65±0.44

2

Ubiquitin-like modifier-activating enzyme ATG7

O95352

79.05

5.85

62

5

1(1)

Increase

2.25±0.18

3

Peptidyl-prolyl cis-trans isomerase A

P62937

18.229

7.68

51

15

4(3)

Decrease

2.54±0.25

4

Complement component 1 Q subcomponent-binding protein, mitochondrial

Q07021

31.742

4.74

74

23

1(1)

Decrease

2.87±0.43

5

Protein disulfide-isomerase A6

Q15084

48.49

4.95

97

9

3(1)

Decrease

3.05±0.39

6

Proteasome subunit alpha type-5

P28066

26.565

4.74

104

12

2(2)

Increase

2.52±0.32

7

Peroxiredoxin-5, mitochondrial

P30044

22.301

8.93

53

26

5(4)

Decrease

2.48±0.39

8

Prohibitin

P35232

29.843

5.57

638

34

7(6)

Increase

3.21±0.34

9

Protein/nucleic acid deglycase DJ-1

Q99497

18.07

6.81

84

25

2(2)

Decrease

3.25±0.48

10

Phosphoglycerate mutase 1

P18669

28.9

6.67

51

4

3(2)

Decrease

3.41±0.42

Graphical abstract