- Email: [email protected]
RT-PCR based diagnosis revealed importance of human group B rotavirus infection in childhood diarrhoea
Journal of Clinical Virology 36 (2006) 222–227
RT-PCR based diagnosis revealed importance of human group B rotavirus infection in childhood diarrhoea P. Barman a , S. Ghosh a , S. Samajdar a , U. Mitra b , P. Dutta b , S.K. Bhattacharya b , T. Krishnan a , N. Kobayashi c , T.N. Naik a,∗ a b
Division of Virology, National Institute of Cholera and Enteric Diseases, P-33 CIT Road, Scheme XM, Beliaghata, Kolkata-700010, West Bengal, India Division of Clinical Medicine, National Institute of Cholera and Enteric Diseases, Kolkata-700010, India c Department of Hygiene, Sapporo Medical University School of Medicine, Sapporo-060, Japan Received 30 August 2005; received in revised form 27 December 2005; accepted 20 February 2006
Abstract Background: Human group B rotavirus was first identified as causative agent of a large outbreak of severe gastroenteritis affecting more than 1 million people, predominantly adults in China in 1982–1983. In spite of serological evidences for the presence of group B rotavirus in many countries of the world, the virus has been detected only from China, India and Bangladesh, where most of the cases were from adults. Objectives: To ascertain the role of group B rotavirus as an aetiological agent of diarrhoea among children in Kolkata, India. Study design: An active surveillance was conducted for rotavirus infection in children in a leading referral paediatric hospital and a few samples were also collected from adults of another hospital in Kolkata, India over a period of 3 years (2002–2004). After primary screening of rotaviruses by RNA electrophoresis in polyacrylamide gel, 200 of 412 samples negative by PAGE were screened by reverse transcription polymerase chain reaction for group B rotaviruses. The group B rotavirus positives samples were also confirmed by dot-blot hybridization. Result: During the study period, we detected 37 (18.5%) sporadic cases of human group B rotavirus infection in children below 3 years of age of which 15 (7.5%) showed mixed infection with group A rotaviruses by RT-PCR. In dot-blot hybridization studies the RNA of all rotavirus positive samples hybridized with the nonisotopic psoralen-biotin labeled total RNA probe generated from a human group B rotavirus CAL-1 strain confirming the samples as group B rotaviruses. Conclusion: The shift in age preference of group B rotavirus infection from adult to children and mixed infection of group B and group A rotaviruses reveals the importance of group B rotavirus as an etiological agent of childhood diarrhoea. Therefore, future vaccination strategy should include both group A and B rotaviruses to control rotavirus diarrhoea. © 2006 Elsevier B.V. All rights reserved. Keywords: Human group B rotavirus; Children; PAGE; RT-PCR; Nonisotopic dot-blot hybridization; Sequence analysis
1. Introduction Rotaviruses, a member of Reoviridae family are important etiological agent of viral diarrhoea in humans and young ani-
Abbreviations: GAR, group A rotavirus; GBR, group B rotavirus; GCR, group C rotavirus; PAGE, polyacrylamide gel electrophoresis; RT-PCR, reverse transcription polymerase chain reaction ∗ Corresponding author. Tel.: +91 33 2370 0448/1176; fax: +91 33 2370 5066. E-mail addresses: [email protected], [email protected] (T.N. Naik). 1386-6532/$ – see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2006.02.009
mals (Kapikian et al., 2001). They posses a triple layered capsid surrounding its genome, which consists of 11-segments of double stranded RNA (dsRNA). On the basis of antigenic cross reactivity rotaviruses are divided into seven serogroups (A–G) (Kapikian et al., 2001; MacKow, 1995; Saif and Jiang, 1994). Among them group A, B and C are found in both humans and animals but other groups are found only in animals and birds (Kapikian et al., 2001). Although group A and C rotavirus causes diarrhoea in infants and children all over the world, group B rotaviruses (GBR) are predominantly responsible for adult diarrhoea (MacKow, 1995; Sen et al.,
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227
2003). The group B rotavirus was first identified as a human pathogen and designated adult diarrhoea rotavirus (ADRV), which was associated with a large-scale epidemic of diarrhoeal diseases in China in the year 1982–1983 affecting more than 1 million people (Hung et al., 1983, 1984). Since then, several small outbreaks of adult diarrhoea due to group B rotavirus infection have been reported exclusively from China (Fang et al., 1989; Yang et al., 2004). However, seroepidemiological studies suggested low prevalence of group B rotavirus infection in some other countries (MacKow, 1995). After a gap of nearly a decade, group B rotavirus infection was detected from adult in sporadic cases from Calcutta, India in 1997, Bangladesh in 2000 and recently from western part of India, indicating that the virus also existed in other Asian countries (Kelkar and Zade, 2004; Krishnan et al., 1999; Sanekata et al., 2003). Although during epidemic in China group B rotavirus infections were detected mostly from adults however, they were associated with an epidemic of diarrhoea in children (Dai et al., 1987). Recently two cases of group B rotavirus infection was reported from children in Bangladesh (Sanekata et al., 2003). Routine laboratory techniques such as ELISA, electron microscopy (EM), immuno electron microscopy (IEM), polyacrylamide gel electrophoresis (PAGE) used for detection of rotaviruses in diarrhoeic cases are not highly sensitive for detection of group B or C rotaviruses as they excrete in very low concentration in faeces (Saif and Jiang, 1994). Therefore, we screened 200 faecal samples negative by PAGE for presence of rotaviruses by a highly sensitive technique, RT-PCR. This novel strategy allowed us to detect increasing number of human group B rotavirus infections in children either single or mixed with other groups of rotaviruses which were also confirmed by RNA–RNA hybridization.
2. Materials and methods 2.1. Stool samples During the course of active surveillance between 2002 and 2004, a total of 643 diarrhoeic stool samples were collected from children admitted with severe gastroenteritis to B.C. Roy Children’s Hospital, and a very few samples from children and adults admitted to Infectious Diseases and Beliaghata General Hospital, Kolkata, India. This study has the approval of the Institutional Ethical Committees of National Institute of Cholera and Enteric Diseases, Kolkata and B.C. Roy Children’s Hospital, Kolkata.
223
the gels were silver stained as described by Herring et al. (1982). 2.3. Extraction of dsRNA for RT-PCR Two hundred faecal samples negative for rotaviruses were processed for the extraction of dsRNA suitable for RT-PCR. Rotavirus dsRNA was extracted from 10% (v/v) faecal specimens by using Trizol (Invitrogen Corporation, Carlsbad, CA, USA) according to the manufacturer’s instruction. The RNA suspensions were stored at −20 ◦ C until RT-PCR procedure for amplification was carried out. 2.4. Oligo-nucleotide primers Group B rotavirus detection was carried out by RT-PCR with group B rotavirus specific primers as described by Gouvea et al. (1991). The primer sequences (5 –3 ) are as follows: B1, CTATTCAGTGTGTCGTGAGAGG; B3, CGAAGCGGGCTAGCTTGTCTGC; B4, CGTGGCTTTGGAAAATTCTTG. Presence of group A rotaviruses were confirmed by RT-PCR assays using primers C1 (5 GGTCACATCATACAATTCTAATCTAAG-3 ) and C2 (5 GGCTTTAAAAGAGAGAATTTCCGTCTGG-3 ) designed to amplify the 1062 bp VP7 encoding gene of GARs as described by Das et al. (2002). 2.5. RT-PCR of viral dsRNA Reverse transcription of dsRNA was carried out according to the methods described earlier (Das et al., 2002; Sen et al., 2000) using Superscript II Reverse Transcriptase (Invitrogen Corporation, Carlsbad, CA, USA). The resultant cDNA was amplified according to the method of Gouvea et al. (1991), Sen et al. (2000) with Taq DNA Polymerase (Invitrogen Corporation, Carlsbad, CA, USA) for an initial 5 min incubation at 95 ◦ C followed by 35 cycles (94 ◦ C for 30 s, 55 ◦ C for 30 s and 72 ◦ C for 1 min) for first round of PCR with B1 and B4 and 35 cycles (94 ◦ C for 30 s, 55 ◦ C for 30 s and 72 ◦ C for 1 min) for the nested PCR with B1 and B3 and a final extension at 72 ◦ C for 7 min. On the other hand, for GARs, the full length VP7 encoding gene (1062 bp) was amplified by RTPCR assays as described by Das et al. (2002). The RT-PCR products were visualized in 1.2% agarose gel after staining with ethidium bromide. 2.6. Sequencing
2.2. Extraction of dsRNA for PAGE The viral RNA from all 643 cases was extracted from faecal samples by standard phenol–chloroform extraction method as described by Herring et al. (1982). Electropherotyping of viral RNA was performed by the Laemmli discontinuous buffer system in 10% polyacrylamide gels and
Direct sequencing of the nested PCR amplified product were carried out using ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kits (PE Applied BioSystems, Foster City, California, USA) with an ABI Prism 3100 automated DNA sequencer (ABI Prism 3100 Genetic Analyser, PE Applied BioSystems, Foster City, California, USA).
224
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227
2.7. Sequence analysis
Table 1 Age-wise distribution of group B rotavirus isolated from children
Sequence analysis of the samples were carried out as described earlier (Varghese et al., 2004). Briefly, multiple alignments were carried out using the program CLUSTAL W (Version DDBJ, http://www.ddbj.nig.ac.jp/ E-mail/homology.html) with default parameters. Phylogenetic tree was constructed using Clustal X (version 1.8) software.
Year (no. of samples screened)
<6 m
6–12 m
13–18 m
19–24 m
25–30 m
2002 (27) 2003 (37) 2004 (136)
1 3 2
3 3 18
1 – 1
1 1 2
– 1 –
Total (200)
6
24
2
4
1
The numbers of samples screened by RT-PCR are given in parentheses, mindicates months.
2.8. Generation of total RNA probe Viral RNA was labeled using BrightStarTM psoralenbiotin Nonisotopic labeling kit (Ambion Inc., Texas, USA) according to the manufacturer’s instructions.
samples. On the other hand, only three group B rotavirus infections were detected in 2003 from adults from ID and BG Hospital. However, group B rotavirus infection was not detected from adult diarrhoeic cases in the year 2002 and 2004.
2.9. Dot-blot hybridization Dot-blotting and hybridization was carried out as described by Flores et al. (1983) with some modifications. Briefly, extracted viral RNA from clinical samples were denatured by boiling for 3 min and quenching on ice for 1–3 min. One microliter of the denatured RNA was immediately applied as dot on positively charged nylon membrane (Ambion Inc., Texas, USA) that had previously been treated with 20 × SSC [1 × SSC is 0.15 M sodium chloride plus 0.015 M sodium citrate]. The dotted membrane was then air-dried and immobilized the RNA by UV cross-linking. Prehybridization of dotted nylon membrane, hybridization with total RNA probe and washing of membranes were performed as described by Flores et al. (1983). After the primary washing step the dots were then detected by using BrightStarTM BioDetectTM Nonisotopic detection kit (Ambion Inc., Texas, USA) according to manufacturer’s instructions. The membrane was then exposed to X-ray-film (Kodak XK-5, Kodak India Ltd., Mumbai, India) at room temperature for 2 h. 2.10. Nucleotide sequence accession numbers The nucleotide sequences determined in this study have been deposited in the GenBank sequence database and have been assigned the following accession numbers: CAL-6, AY941792; CAL-8, AY864913; CAL-10, AY864914; CAL-14, AY941778; CAL-16, AY941789; CAL-17, AY941776; CAL-28, AY941777; CAL-30, AY941790; CAL-34, AY941791; CAL-41, AY941779.
3. Results 3.1. Incidence During the course of this molecular surveillance study conducted between 2002 and 2004, human group B rotavirus were detected from children in 37 out of 200 diarrhoeic
3.2. Age-wise distribution and seasonal pattern of rotavirus infection In the present study all but three group B rotavirus were detected from children below 3 years of age. During this period of study no seasonal pattern of infection was observed as seen for group A rotaviruses and group B rotaviruses were detected throughout the year as sporadic cases (Table 1). 3.3. PAGE Out of a total of 643 samples screened, 231 (35.9%) were positive for group A rotaviruses by RNA electrophoresis in polyacrylamide gels. Two hundred of the 412 samples negative for rotaviruses by PAGE were further processed for detection of group B rotaviruses by RT-PCR assays. 3.4. RT-PCR Among 200, 37 (18.5%) samples were amplified by group B rotavirus specific primers (designated as CAL-6 to CAL42). Moreover, of the 37 GBR positive samples, 15 samples showed mixed infections with group A rotaviruses. 3.5. Sequencing and sequence analysis Direct sequencing of the group B rotavirus nested PCR product, amplified a partial NSP2 sequence (from nucleotide 14–446) and sequences of 10 strains were further analysed. Multiple alignment of the sequences of GBR strains were identical among themselves and showed high sequence identity to the same sequence region of other human GBR strains such as CAL-1 (98.4%), Bang373 (99.3%) and ADRV (94.2%) and a low identity to murine strain IDIR (80.7%). By phylogenetic analysis, these strains also clustered with CAL1 and Bang373 strains away from the Chinese GBR strains (Fig. 1).
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227
Fig. 1. Phylogenetic tree of all group B rotavirus partial NSP2 nucleotide sequences. All group B rotavirus strains of Calcutta (CAL-1) and Bangladesh (Bang373) clustered together away from Chinese human group B rotavirus strains (ADRV, WH-1). Phylogenetic tree was rooted with cognate sequence of group A rotavirus strain, KU.
3.6. Dot hybridization Biotin labeled total RNA probe from human group B rotavirus CAL-1 strain hybridized with all the group B rotavirus strains detected from human (children and adults) and also to bovine group B rotavirus samples detected by us earlier (Barman et al., 2004). On the other hand, the probe showed no hybridization with group A or group C rotavirus samples. (Fig. 2). 4. Discussion Group A rotaviruses are the most common virus that are associated with paediatric diarrhoea all over the world. However, group B rotavirus causes severe gastroenteritis among adults and was associated with an epidemic of diarrhoeal diseases affecting more than 1 million population mainly among adults in Mainland China in 1982–1983 (Hung et al., 1983). Followed by the devastating epidemic, several small foci of outbreaks and sporadic cases of group B rotavirus
225
Fig. 2. Dot hybridizations of purified human group B rotavirus genomic RNA with psoralen-biotin labeled probes synthesized from whole genomic RNA of the CAL-1 strain of human group B rotavirus. The genomic RNA from human adults and children group B rotavirus, bovine group B rotavirus, group A and group C rotaviruses were dotted on the nylon membrane and hybridized with total RNA probe as described in materials and methods. Lane A: (1) kit labeled control DNA; (2) kit unlabelled control DNA; (3) probe positive control; (4–6) group B rotavirus RNA from adult cases. Lane B: (1–5) group B rotaviruses from children; (6) group A rotavirus; Lane C: (1–5) bovine group B rotaviruses; (6) group C rotavirus.
infection were reported from adults of 20–50 years of age in China. In an isolated epidemic of diarrhoeal diseases in a hospital, a number of children were infected with group B rotaviruses (Dai et al., 1987). On the other hand, only two cases of group B rotavirus infection in children were reported from Bangladesh (Ahmed et al., 2004; Sanekata et al., 2003). Group B rotavirus infection was also detected from several young animals (Saif and Jiang, 1994). In this study, we sporadically detected group B rotaviruses in 37 (18.5%) cases out of 200 stool samples screened for rotaviruses by RT-PCR assays indicating highly virulent nature of group B rotaviruses to both adults and children. The disease burden and epidemiology of group B rotavirus infection in human and animals have not been studied in detail and this study showed that incidence of GBR infection is much higher than expected and this may be due to limited
226
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227
sensitivity of the diagnostic tests used for detection of group B rotaviruses. Recently a number of progresses have been made on molecular virology of group B rotavirus infection, however routine methods for detection of GBR are not widely available. Moreover only one porcine GBR strain has been successfully propagated in cell culture (Sanekata et al., 1996), therefore diagnosis of GBR primarily depends on RNA electrophoresis by PAGE. It has been well established that shedding of group B rotavirus occurs in a very low concentration. Failure of detection of GBR by RNA electrophoresis in PAGE of the samples positive by RT-PCR may be due to low concentration of excretion of group B rotaviruses in faecal specimen. It has been well established that nested PCR for detection of rotaviruses from stool samples amplifies RNA concentration as low as 120 fg of template DNA (Gouvea et al., 1991). Therefore, attempts should be made to amplify the RNA from stool samples negative by PAGE by RT-PCR. Cloned cDNA probe has already been proven to be sensitive for detection of homologous and heterologous group B rotaviruses in fecal specimen (Eiden et al., 1986, 1989). In this study we have standardized nonisotopic psoralen-biotin labeled total RNA probe for detection of GBR in fecal specimen from humans and bovine. The probe was highly specific for GBR and no cross hybridization was noted between probe and human faecal specimens containing group A, or group C rotaviruses as well as with rotavirus negative stool samples. The dot hybridization assay described here may be used as a primary means for detection of GBR and may be useful in confirming the presence of group B rotaviruses in faecal specimens identified by other techniques. The routine surveillance system established in our Institute for detection of pathogenic microorganism associated with diarrhoeal diseases assigned 53% of known pathogen besides Escherichia coli infection (Unpublished information). This scenario leaves a vast number of acute diarrhoeal infections in children without any known aetiological agent and group B rotavirus infection in children may fill some percentage of the unknown pathogen associated with acute childhood diarrhoea. Mixed infections of different genotypes are frequently detected by RT-PCR for group A rotaviruses (Das et al., 2002; Varghese et al., 2004). However, mixed infections associated with different serogroups (A, B and C) of rotaviruses are rarely observed. There are evidences of mixed infections in porcine group A with group B or group C rotaviruses (Alfieri et al., 1999; Sigolo de San Juan et al., 1986) and bovine group C with group A rotaviruses (Chang et al., 1999). A very few reports of mixed infection between group A and group C rotaviruses have been reported in humans (Jiang et al., 1995; Kim et al., 1999; Phan et al., 2004; Rosa E Silva et al., 2002). Interestingly, in this study 15 GBR positive samples showed mixed infection of with group A rotaviruses. This suggests that mixed infections between viruses of different serogroups may be common in human as well. Another matter of great concern in connection with presence of group B rotavirus infection in adults or children in Southeast Asia is recent detection of bovine group B
rotaviruses from Kolkata (Barman et al., 2004), and suggests that group B rotaviruses are common enteric pathogens in animals as well as in humans that may facilitate the chances of rotavirus zoonosis. The partial sequence of gene 8 (NSP2) of GBR strains revealed maximum identity among themselves as well as to the same sequence region of human group B rotaviruses strains such as CAL-1 (98.4%), Bang373 (99.3%) and ADRV (94.2%) whereas the identities with those of murine are comparatively low (80.7%). These results indicated that the GBR strains detected in the present study from children are genetically identical to earlier reported human group B rotavirus CAL-1 strain. By phylogenetic analysis, also the GBR strains detected from India and Bangladesh cluster together, away from the Chinese GBR strains, ADRV and WH-1, which indicates that the strains from India and Bangladesh are genetically closely related to each other. Above observation suggests that routine surveillance for group B rotavirus infection in children are essential to know the actual diseases burden of group B rotavirus infection among children. Though the severity of GBR infection has been well documented in adults, the same has been underestimated in children. Present observation of the role of GBR infection in children, either single or mixed infection with other serogroups will pave the way for defining importance of GBR infection in children during designing a public health strategy to control rotavirus diarrhoea. The findings presented in this study suggested the importance of hybridization assay for under taking large-scale epidemiological studies to ascertain disease burden due to group B rotavirus infection in humans and animals. Moreover, present study clearly outlined the importance of group B rotavirus as an aetiological agent of childhood diarrhoea. This information will stimulate further research for its inclusion in future vaccine development initiatives for control of diarrhoeal diseases in children.
Acknowledgements The research was funded by Indian Council of Medical Research (ICMR), New Delhi. P. Barman, S. Ghosh and S. Samajdar were supported by Senior Research Fellowships from Council of Scientific and Industrial Research and ICMR, New Delhi.
References Ahmed MU, Kobayashi N, Wakuda M, Sanekata T, Taniguchi K, Kader A, et al. Genetic analysis of group B human rotaviruses detected in Bangladesh in 2000 and 2001. J Med Virol 2004;72:149– 55. Alfieri AA, Leite JP, Alfieri AF, Jiang B, Glass RI, Gentsch JR. Detection of field isolates of human and animal group C rotavirus by reverse transcription-polymerase chain reaction and digoxigeninlabeled oligonucleotide probes. J Virol Methods 1999;83:35–43.
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227 Barman P, Ghosh S, Das S, Varghese V, Chaudhuri S, Sarkar S, et al. Sequencing and sequence analysis of VP7 and NSP5 genes reveal emergence of a new genotype of bovine group B rotaviruses in India. J Clin Microbiol 2004;42:2816–8. Chang KO, Nielsen PR, Ward LA, Saif LJ. Dual infection of gnotobiotic calves with bovine strains of group A and porcine-like group C rotaviruses influences pathogenesis of the group C rotavirus. J Virol 1999;73:9284–93. Dai GZ, Sun MS, Liu SQ, Ding XF, Chen YD, Wang LC, et al. First report of an epidemic of diarrhoea in human neonates involving the new rotavirus and biological characteristics of the epidemic virus strain (KMB/R85). J Med Virol 1987;22:365–73. Das S, Sen A, Uma G, Varghese V, Chaudhury S, Bhattacharya SK, et al. Genomic diversity of group A rotavirus strains infecting humans in eastern India. J Clin Microbiol 2002;40:146–9. Eiden J, Vonderfecht S, Theil K, Torres-Medina A, Yolken RH. Genetic and antigenic relatedness of human and animal strains of antigenically distinct rotaviruses. J Infect Dis 1986;154:972–82. Eiden JJ, Firoozmand F, Sato S, Vonderfecht SL, Yin FZ, Yolken RH. Detection of group B rotavirus in fecal specimens by dot hybridization with a cloned cDNA probe. J Clin Microbiol 1989;27:422–6. Fang ZY, Ye Q, Ho MS, Dong H, Qing S, Penaranda ME, et al. Investigation of an outbreak of adult diarrhea rotavirus in China. J Infect Dis 1989;160:948–53. Flores J, Boegeman E, Purcell RH, Sereno M, Perez I, White L, et al. A dot hybridization assay for detection of rotavirus. Lancet 1983;ii:555–8. Gouvea V, Allen JR, Glass RI, Fang ZY, Bremont M, Cohen J, et al. Detection of group B and C rotaviruses by polymerase chain reaction. J Clin Microbiol 1991;29:519–23. Herring AJ, Inglis NF, Ojeh CK, Snodgrass DR, Menzies JD. Rapid diagnosis of rotavirus infection by direct detection of viral nucleic acid in silver-stained polyacrylamide gels. J Clin Microbiol 1982;16:473–7. Hung T, Chen G, Wang C, Chou Z, Chao T, Ye W, et al. Rotavirus-like agent in adult non-bacterial diarrhoea in China. Lancet 1983;ii:1078–9. Hung T, Chen GM, Wang CG, Yao HL, Fang ZY, Chao TX, et al. Waterborne outbreak of rotavirus diarrhoea in adults in China caused by a novel rotavirus. Lancet 1984;ii:1139–42. Jiang B, Dennehy PH, Spangenberger S, Gentsch JR, Glass RI. First detection of group C rotavirus in fecal specimens of children with diarrhea in the United States. J Infect Dis 1995;172:45–50. Kapikian AZ, Hoshino Y, Chanock RM. Rotaviruses. In: Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B, Straus SE, editors. Field’s virology. 4th ed. Philadelphia: Lippincott. Williams and Wilkins; 2001. p. 1787–833.
227
Kelkar SD, Zade JK. Group B rotaviruses similar to strain CAL-1, have been circulating in Western India since 1991. Epidemiol Infect 2004;132:745–9. Kim Y, Chang KO, Straw B, Saif LJ. Characterization of group C rotaviruses associated with diarrhea outbreaks in feeder pigs. J Clin Microbiol 1999;37:1484–8. Krishnan T, Sen A, Choudhury JS, Das S, Naik TN, Bhattacharya SK. Emergence of adult diarrhoea rotavirus in Calcutta India. Lancet 1999;353:380–1. MacKow ER. Group B and C rotaviruses. In: Blaser MJ, Smith PD, Ravdin JI, Greenberg HB, Guerrant RL, editors. Infections of the gastrointestinal tract. NY: Raven Press Ltd.; 1995. p. 983–1008. Phan TG, Nishimura S, Okame M, Nguyen TA, Khamrin P, Okitsu S, et al. Virus diversity and an outbreak of group C rotavirus among infants and children with diarrhea in Maizuru city Japan during 2002–2003. J Med Virol 2004;74:173–9. Rosa E Silva ML, Pires De Carvalho I, Gouvea V. 1998–1999 rotavirus seasons in Juiz de Fora, Minas Gerais, Brazil: detection of an unusual G3P[4] epidemic strain. J Clin Microbiol 2002;40:2837–42. Saif LJ, Jiang B. Non group A rotaviruses of humans and animals. In: Ramig RF, editor. Rotaviruses. New York: Springer-Verlag; 1994. p. 339–71. Sanekata T, Kuwamoto Y, Akamatsu S, Sakon N, Oseto M, Taniguchi K, et al. Isolation of group B porcine rotavirus in cell culture. J Clin Microbiol 1996;34:759–61. Sanekata T, Ahmed MU, Kader A, Taniguchi K, Kobayashi N. Human group B rotavirus infections cause severe diarrhea in children and adults in Bangladesh. J Clin Microbiol 2003;41:2187–90. Sen A, Kobayashi N, Das S, Krishnan T, Bhattacharya SK, Urasawa S, et al. Amplification of various genes of human group B rotavirus from stool specimens by RT-PCR. J Clin Virol 2000;17:177–81. Sen A, Kobayashi N, Bhattacharya SK, Naik TN. Molecular characterization and epidemiology of group B rotaviruses. In: Raghunath D, Nayak R, editors. Diarrhoeal diseases, current status, research trends and field studies. New Delhi: Tata McGraw-Hill Publishing Co. Ltd; 2003. p. 137–78. Sigolo de San Juan C, Bellinzoni RC, Mattion N, La Torre J, Scodeller EA. Incidence of group A and atypical rotaviruses in Brazilian pig herds. Res Vet Sci 1986;41:270–2. Varghese V, Das S, Singh NgB, Kojima K, Bhattacharya SK, Krishnan T, et al. Molecular characterization of a human rotavirus reveals porcine characteristics in most of the genes including VP6 and NSP4. Arch Virol 2004;149:155–72. Yang JH, Kobayashi N, Wang YH, Zhou X, Li Y, Zhou DJ, et al. Phylogenetic analysis of a human group B rotavirus WH-1 detected in China in 2002. J Med Virol 2004;74:662–7.
RT-PCR based diagnosis revealed importance of human group B rotavirus infection in childhood diarrhoea P. Barman a , S. Ghosh a , S. Samajdar a , U. Mitra b , P. Dutta b , S.K. Bhattacharya b , T. Krishnan a , N. Kobayashi c , T.N. Naik a,∗ a b
Division of Virology, National Institute of Cholera and Enteric Diseases, P-33 CIT Road, Scheme XM, Beliaghata, Kolkata-700010, West Bengal, India Division of Clinical Medicine, National Institute of Cholera and Enteric Diseases, Kolkata-700010, India c Department of Hygiene, Sapporo Medical University School of Medicine, Sapporo-060, Japan Received 30 August 2005; received in revised form 27 December 2005; accepted 20 February 2006
Abstract Background: Human group B rotavirus was first identified as causative agent of a large outbreak of severe gastroenteritis affecting more than 1 million people, predominantly adults in China in 1982–1983. In spite of serological evidences for the presence of group B rotavirus in many countries of the world, the virus has been detected only from China, India and Bangladesh, where most of the cases were from adults. Objectives: To ascertain the role of group B rotavirus as an aetiological agent of diarrhoea among children in Kolkata, India. Study design: An active surveillance was conducted for rotavirus infection in children in a leading referral paediatric hospital and a few samples were also collected from adults of another hospital in Kolkata, India over a period of 3 years (2002–2004). After primary screening of rotaviruses by RNA electrophoresis in polyacrylamide gel, 200 of 412 samples negative by PAGE were screened by reverse transcription polymerase chain reaction for group B rotaviruses. The group B rotavirus positives samples were also confirmed by dot-blot hybridization. Result: During the study period, we detected 37 (18.5%) sporadic cases of human group B rotavirus infection in children below 3 years of age of which 15 (7.5%) showed mixed infection with group A rotaviruses by RT-PCR. In dot-blot hybridization studies the RNA of all rotavirus positive samples hybridized with the nonisotopic psoralen-biotin labeled total RNA probe generated from a human group B rotavirus CAL-1 strain confirming the samples as group B rotaviruses. Conclusion: The shift in age preference of group B rotavirus infection from adult to children and mixed infection of group B and group A rotaviruses reveals the importance of group B rotavirus as an etiological agent of childhood diarrhoea. Therefore, future vaccination strategy should include both group A and B rotaviruses to control rotavirus diarrhoea. © 2006 Elsevier B.V. All rights reserved. Keywords: Human group B rotavirus; Children; PAGE; RT-PCR; Nonisotopic dot-blot hybridization; Sequence analysis
1. Introduction Rotaviruses, a member of Reoviridae family are important etiological agent of viral diarrhoea in humans and young ani-
Abbreviations: GAR, group A rotavirus; GBR, group B rotavirus; GCR, group C rotavirus; PAGE, polyacrylamide gel electrophoresis; RT-PCR, reverse transcription polymerase chain reaction ∗ Corresponding author. Tel.: +91 33 2370 0448/1176; fax: +91 33 2370 5066. E-mail addresses: [email protected], [email protected] (T.N. Naik). 1386-6532/$ – see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2006.02.009
mals (Kapikian et al., 2001). They posses a triple layered capsid surrounding its genome, which consists of 11-segments of double stranded RNA (dsRNA). On the basis of antigenic cross reactivity rotaviruses are divided into seven serogroups (A–G) (Kapikian et al., 2001; MacKow, 1995; Saif and Jiang, 1994). Among them group A, B and C are found in both humans and animals but other groups are found only in animals and birds (Kapikian et al., 2001). Although group A and C rotavirus causes diarrhoea in infants and children all over the world, group B rotaviruses (GBR) are predominantly responsible for adult diarrhoea (MacKow, 1995; Sen et al.,
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227
2003). The group B rotavirus was first identified as a human pathogen and designated adult diarrhoea rotavirus (ADRV), which was associated with a large-scale epidemic of diarrhoeal diseases in China in the year 1982–1983 affecting more than 1 million people (Hung et al., 1983, 1984). Since then, several small outbreaks of adult diarrhoea due to group B rotavirus infection have been reported exclusively from China (Fang et al., 1989; Yang et al., 2004). However, seroepidemiological studies suggested low prevalence of group B rotavirus infection in some other countries (MacKow, 1995). After a gap of nearly a decade, group B rotavirus infection was detected from adult in sporadic cases from Calcutta, India in 1997, Bangladesh in 2000 and recently from western part of India, indicating that the virus also existed in other Asian countries (Kelkar and Zade, 2004; Krishnan et al., 1999; Sanekata et al., 2003). Although during epidemic in China group B rotavirus infections were detected mostly from adults however, they were associated with an epidemic of diarrhoea in children (Dai et al., 1987). Recently two cases of group B rotavirus infection was reported from children in Bangladesh (Sanekata et al., 2003). Routine laboratory techniques such as ELISA, electron microscopy (EM), immuno electron microscopy (IEM), polyacrylamide gel electrophoresis (PAGE) used for detection of rotaviruses in diarrhoeic cases are not highly sensitive for detection of group B or C rotaviruses as they excrete in very low concentration in faeces (Saif and Jiang, 1994). Therefore, we screened 200 faecal samples negative by PAGE for presence of rotaviruses by a highly sensitive technique, RT-PCR. This novel strategy allowed us to detect increasing number of human group B rotavirus infections in children either single or mixed with other groups of rotaviruses which were also confirmed by RNA–RNA hybridization.
2. Materials and methods 2.1. Stool samples During the course of active surveillance between 2002 and 2004, a total of 643 diarrhoeic stool samples were collected from children admitted with severe gastroenteritis to B.C. Roy Children’s Hospital, and a very few samples from children and adults admitted to Infectious Diseases and Beliaghata General Hospital, Kolkata, India. This study has the approval of the Institutional Ethical Committees of National Institute of Cholera and Enteric Diseases, Kolkata and B.C. Roy Children’s Hospital, Kolkata.
223
the gels were silver stained as described by Herring et al. (1982). 2.3. Extraction of dsRNA for RT-PCR Two hundred faecal samples negative for rotaviruses were processed for the extraction of dsRNA suitable for RT-PCR. Rotavirus dsRNA was extracted from 10% (v/v) faecal specimens by using Trizol (Invitrogen Corporation, Carlsbad, CA, USA) according to the manufacturer’s instruction. The RNA suspensions were stored at −20 ◦ C until RT-PCR procedure for amplification was carried out. 2.4. Oligo-nucleotide primers Group B rotavirus detection was carried out by RT-PCR with group B rotavirus specific primers as described by Gouvea et al. (1991). The primer sequences (5 –3 ) are as follows: B1, CTATTCAGTGTGTCGTGAGAGG; B3, CGAAGCGGGCTAGCTTGTCTGC; B4, CGTGGCTTTGGAAAATTCTTG. Presence of group A rotaviruses were confirmed by RT-PCR assays using primers C1 (5 GGTCACATCATACAATTCTAATCTAAG-3 ) and C2 (5 GGCTTTAAAAGAGAGAATTTCCGTCTGG-3 ) designed to amplify the 1062 bp VP7 encoding gene of GARs as described by Das et al. (2002). 2.5. RT-PCR of viral dsRNA Reverse transcription of dsRNA was carried out according to the methods described earlier (Das et al., 2002; Sen et al., 2000) using Superscript II Reverse Transcriptase (Invitrogen Corporation, Carlsbad, CA, USA). The resultant cDNA was amplified according to the method of Gouvea et al. (1991), Sen et al. (2000) with Taq DNA Polymerase (Invitrogen Corporation, Carlsbad, CA, USA) for an initial 5 min incubation at 95 ◦ C followed by 35 cycles (94 ◦ C for 30 s, 55 ◦ C for 30 s and 72 ◦ C for 1 min) for first round of PCR with B1 and B4 and 35 cycles (94 ◦ C for 30 s, 55 ◦ C for 30 s and 72 ◦ C for 1 min) for the nested PCR with B1 and B3 and a final extension at 72 ◦ C for 7 min. On the other hand, for GARs, the full length VP7 encoding gene (1062 bp) was amplified by RTPCR assays as described by Das et al. (2002). The RT-PCR products were visualized in 1.2% agarose gel after staining with ethidium bromide. 2.6. Sequencing
2.2. Extraction of dsRNA for PAGE The viral RNA from all 643 cases was extracted from faecal samples by standard phenol–chloroform extraction method as described by Herring et al. (1982). Electropherotyping of viral RNA was performed by the Laemmli discontinuous buffer system in 10% polyacrylamide gels and
Direct sequencing of the nested PCR amplified product were carried out using ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction Kits (PE Applied BioSystems, Foster City, California, USA) with an ABI Prism 3100 automated DNA sequencer (ABI Prism 3100 Genetic Analyser, PE Applied BioSystems, Foster City, California, USA).
224
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227
2.7. Sequence analysis
Table 1 Age-wise distribution of group B rotavirus isolated from children
Sequence analysis of the samples were carried out as described earlier (Varghese et al., 2004). Briefly, multiple alignments were carried out using the program CLUSTAL W (Version DDBJ, http://www.ddbj.nig.ac.jp/ E-mail/homology.html) with default parameters. Phylogenetic tree was constructed using Clustal X (version 1.8) software.
Year (no. of samples screened)
<6 m
6–12 m
13–18 m
19–24 m
25–30 m
2002 (27) 2003 (37) 2004 (136)
1 3 2
3 3 18
1 – 1
1 1 2
– 1 –
Total (200)
6
24
2
4
1
The numbers of samples screened by RT-PCR are given in parentheses, mindicates months.
2.8. Generation of total RNA probe Viral RNA was labeled using BrightStarTM psoralenbiotin Nonisotopic labeling kit (Ambion Inc., Texas, USA) according to the manufacturer’s instructions.
samples. On the other hand, only three group B rotavirus infections were detected in 2003 from adults from ID and BG Hospital. However, group B rotavirus infection was not detected from adult diarrhoeic cases in the year 2002 and 2004.
2.9. Dot-blot hybridization Dot-blotting and hybridization was carried out as described by Flores et al. (1983) with some modifications. Briefly, extracted viral RNA from clinical samples were denatured by boiling for 3 min and quenching on ice for 1–3 min. One microliter of the denatured RNA was immediately applied as dot on positively charged nylon membrane (Ambion Inc., Texas, USA) that had previously been treated with 20 × SSC [1 × SSC is 0.15 M sodium chloride plus 0.015 M sodium citrate]. The dotted membrane was then air-dried and immobilized the RNA by UV cross-linking. Prehybridization of dotted nylon membrane, hybridization with total RNA probe and washing of membranes were performed as described by Flores et al. (1983). After the primary washing step the dots were then detected by using BrightStarTM BioDetectTM Nonisotopic detection kit (Ambion Inc., Texas, USA) according to manufacturer’s instructions. The membrane was then exposed to X-ray-film (Kodak XK-5, Kodak India Ltd., Mumbai, India) at room temperature for 2 h. 2.10. Nucleotide sequence accession numbers The nucleotide sequences determined in this study have been deposited in the GenBank sequence database and have been assigned the following accession numbers: CAL-6, AY941792; CAL-8, AY864913; CAL-10, AY864914; CAL-14, AY941778; CAL-16, AY941789; CAL-17, AY941776; CAL-28, AY941777; CAL-30, AY941790; CAL-34, AY941791; CAL-41, AY941779.
3. Results 3.1. Incidence During the course of this molecular surveillance study conducted between 2002 and 2004, human group B rotavirus were detected from children in 37 out of 200 diarrhoeic
3.2. Age-wise distribution and seasonal pattern of rotavirus infection In the present study all but three group B rotavirus were detected from children below 3 years of age. During this period of study no seasonal pattern of infection was observed as seen for group A rotaviruses and group B rotaviruses were detected throughout the year as sporadic cases (Table 1). 3.3. PAGE Out of a total of 643 samples screened, 231 (35.9%) were positive for group A rotaviruses by RNA electrophoresis in polyacrylamide gels. Two hundred of the 412 samples negative for rotaviruses by PAGE were further processed for detection of group B rotaviruses by RT-PCR assays. 3.4. RT-PCR Among 200, 37 (18.5%) samples were amplified by group B rotavirus specific primers (designated as CAL-6 to CAL42). Moreover, of the 37 GBR positive samples, 15 samples showed mixed infections with group A rotaviruses. 3.5. Sequencing and sequence analysis Direct sequencing of the group B rotavirus nested PCR product, amplified a partial NSP2 sequence (from nucleotide 14–446) and sequences of 10 strains were further analysed. Multiple alignment of the sequences of GBR strains were identical among themselves and showed high sequence identity to the same sequence region of other human GBR strains such as CAL-1 (98.4%), Bang373 (99.3%) and ADRV (94.2%) and a low identity to murine strain IDIR (80.7%). By phylogenetic analysis, these strains also clustered with CAL1 and Bang373 strains away from the Chinese GBR strains (Fig. 1).
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227
Fig. 1. Phylogenetic tree of all group B rotavirus partial NSP2 nucleotide sequences. All group B rotavirus strains of Calcutta (CAL-1) and Bangladesh (Bang373) clustered together away from Chinese human group B rotavirus strains (ADRV, WH-1). Phylogenetic tree was rooted with cognate sequence of group A rotavirus strain, KU.
3.6. Dot hybridization Biotin labeled total RNA probe from human group B rotavirus CAL-1 strain hybridized with all the group B rotavirus strains detected from human (children and adults) and also to bovine group B rotavirus samples detected by us earlier (Barman et al., 2004). On the other hand, the probe showed no hybridization with group A or group C rotavirus samples. (Fig. 2). 4. Discussion Group A rotaviruses are the most common virus that are associated with paediatric diarrhoea all over the world. However, group B rotavirus causes severe gastroenteritis among adults and was associated with an epidemic of diarrhoeal diseases affecting more than 1 million population mainly among adults in Mainland China in 1982–1983 (Hung et al., 1983). Followed by the devastating epidemic, several small foci of outbreaks and sporadic cases of group B rotavirus
225
Fig. 2. Dot hybridizations of purified human group B rotavirus genomic RNA with psoralen-biotin labeled probes synthesized from whole genomic RNA of the CAL-1 strain of human group B rotavirus. The genomic RNA from human adults and children group B rotavirus, bovine group B rotavirus, group A and group C rotaviruses were dotted on the nylon membrane and hybridized with total RNA probe as described in materials and methods. Lane A: (1) kit labeled control DNA; (2) kit unlabelled control DNA; (3) probe positive control; (4–6) group B rotavirus RNA from adult cases. Lane B: (1–5) group B rotaviruses from children; (6) group A rotavirus; Lane C: (1–5) bovine group B rotaviruses; (6) group C rotavirus.
infection were reported from adults of 20–50 years of age in China. In an isolated epidemic of diarrhoeal diseases in a hospital, a number of children were infected with group B rotaviruses (Dai et al., 1987). On the other hand, only two cases of group B rotavirus infection in children were reported from Bangladesh (Ahmed et al., 2004; Sanekata et al., 2003). Group B rotavirus infection was also detected from several young animals (Saif and Jiang, 1994). In this study, we sporadically detected group B rotaviruses in 37 (18.5%) cases out of 200 stool samples screened for rotaviruses by RT-PCR assays indicating highly virulent nature of group B rotaviruses to both adults and children. The disease burden and epidemiology of group B rotavirus infection in human and animals have not been studied in detail and this study showed that incidence of GBR infection is much higher than expected and this may be due to limited
226
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227
sensitivity of the diagnostic tests used for detection of group B rotaviruses. Recently a number of progresses have been made on molecular virology of group B rotavirus infection, however routine methods for detection of GBR are not widely available. Moreover only one porcine GBR strain has been successfully propagated in cell culture (Sanekata et al., 1996), therefore diagnosis of GBR primarily depends on RNA electrophoresis by PAGE. It has been well established that shedding of group B rotavirus occurs in a very low concentration. Failure of detection of GBR by RNA electrophoresis in PAGE of the samples positive by RT-PCR may be due to low concentration of excretion of group B rotaviruses in faecal specimen. It has been well established that nested PCR for detection of rotaviruses from stool samples amplifies RNA concentration as low as 120 fg of template DNA (Gouvea et al., 1991). Therefore, attempts should be made to amplify the RNA from stool samples negative by PAGE by RT-PCR. Cloned cDNA probe has already been proven to be sensitive for detection of homologous and heterologous group B rotaviruses in fecal specimen (Eiden et al., 1986, 1989). In this study we have standardized nonisotopic psoralen-biotin labeled total RNA probe for detection of GBR in fecal specimen from humans and bovine. The probe was highly specific for GBR and no cross hybridization was noted between probe and human faecal specimens containing group A, or group C rotaviruses as well as with rotavirus negative stool samples. The dot hybridization assay described here may be used as a primary means for detection of GBR and may be useful in confirming the presence of group B rotaviruses in faecal specimens identified by other techniques. The routine surveillance system established in our Institute for detection of pathogenic microorganism associated with diarrhoeal diseases assigned 53% of known pathogen besides Escherichia coli infection (Unpublished information). This scenario leaves a vast number of acute diarrhoeal infections in children without any known aetiological agent and group B rotavirus infection in children may fill some percentage of the unknown pathogen associated with acute childhood diarrhoea. Mixed infections of different genotypes are frequently detected by RT-PCR for group A rotaviruses (Das et al., 2002; Varghese et al., 2004). However, mixed infections associated with different serogroups (A, B and C) of rotaviruses are rarely observed. There are evidences of mixed infections in porcine group A with group B or group C rotaviruses (Alfieri et al., 1999; Sigolo de San Juan et al., 1986) and bovine group C with group A rotaviruses (Chang et al., 1999). A very few reports of mixed infection between group A and group C rotaviruses have been reported in humans (Jiang et al., 1995; Kim et al., 1999; Phan et al., 2004; Rosa E Silva et al., 2002). Interestingly, in this study 15 GBR positive samples showed mixed infection of with group A rotaviruses. This suggests that mixed infections between viruses of different serogroups may be common in human as well. Another matter of great concern in connection with presence of group B rotavirus infection in adults or children in Southeast Asia is recent detection of bovine group B
rotaviruses from Kolkata (Barman et al., 2004), and suggests that group B rotaviruses are common enteric pathogens in animals as well as in humans that may facilitate the chances of rotavirus zoonosis. The partial sequence of gene 8 (NSP2) of GBR strains revealed maximum identity among themselves as well as to the same sequence region of human group B rotaviruses strains such as CAL-1 (98.4%), Bang373 (99.3%) and ADRV (94.2%) whereas the identities with those of murine are comparatively low (80.7%). These results indicated that the GBR strains detected in the present study from children are genetically identical to earlier reported human group B rotavirus CAL-1 strain. By phylogenetic analysis, also the GBR strains detected from India and Bangladesh cluster together, away from the Chinese GBR strains, ADRV and WH-1, which indicates that the strains from India and Bangladesh are genetically closely related to each other. Above observation suggests that routine surveillance for group B rotavirus infection in children are essential to know the actual diseases burden of group B rotavirus infection among children. Though the severity of GBR infection has been well documented in adults, the same has been underestimated in children. Present observation of the role of GBR infection in children, either single or mixed infection with other serogroups will pave the way for defining importance of GBR infection in children during designing a public health strategy to control rotavirus diarrhoea. The findings presented in this study suggested the importance of hybridization assay for under taking large-scale epidemiological studies to ascertain disease burden due to group B rotavirus infection in humans and animals. Moreover, present study clearly outlined the importance of group B rotavirus as an aetiological agent of childhood diarrhoea. This information will stimulate further research for its inclusion in future vaccine development initiatives for control of diarrhoeal diseases in children.
Acknowledgements The research was funded by Indian Council of Medical Research (ICMR), New Delhi. P. Barman, S. Ghosh and S. Samajdar were supported by Senior Research Fellowships from Council of Scientific and Industrial Research and ICMR, New Delhi.
References Ahmed MU, Kobayashi N, Wakuda M, Sanekata T, Taniguchi K, Kader A, et al. Genetic analysis of group B human rotaviruses detected in Bangladesh in 2000 and 2001. J Med Virol 2004;72:149– 55. Alfieri AA, Leite JP, Alfieri AF, Jiang B, Glass RI, Gentsch JR. Detection of field isolates of human and animal group C rotavirus by reverse transcription-polymerase chain reaction and digoxigeninlabeled oligonucleotide probes. J Virol Methods 1999;83:35–43.
P. Barman et al. / Journal of Clinical Virology 36 (2006) 222–227 Barman P, Ghosh S, Das S, Varghese V, Chaudhuri S, Sarkar S, et al. Sequencing and sequence analysis of VP7 and NSP5 genes reveal emergence of a new genotype of bovine group B rotaviruses in India. J Clin Microbiol 2004;42:2816–8. Chang KO, Nielsen PR, Ward LA, Saif LJ. Dual infection of gnotobiotic calves with bovine strains of group A and porcine-like group C rotaviruses influences pathogenesis of the group C rotavirus. J Virol 1999;73:9284–93. Dai GZ, Sun MS, Liu SQ, Ding XF, Chen YD, Wang LC, et al. First report of an epidemic of diarrhoea in human neonates involving the new rotavirus and biological characteristics of the epidemic virus strain (KMB/R85). J Med Virol 1987;22:365–73. Das S, Sen A, Uma G, Varghese V, Chaudhury S, Bhattacharya SK, et al. Genomic diversity of group A rotavirus strains infecting humans in eastern India. J Clin Microbiol 2002;40:146–9. Eiden J, Vonderfecht S, Theil K, Torres-Medina A, Yolken RH. Genetic and antigenic relatedness of human and animal strains of antigenically distinct rotaviruses. J Infect Dis 1986;154:972–82. Eiden JJ, Firoozmand F, Sato S, Vonderfecht SL, Yin FZ, Yolken RH. Detection of group B rotavirus in fecal specimens by dot hybridization with a cloned cDNA probe. J Clin Microbiol 1989;27:422–6. Fang ZY, Ye Q, Ho MS, Dong H, Qing S, Penaranda ME, et al. Investigation of an outbreak of adult diarrhea rotavirus in China. J Infect Dis 1989;160:948–53. Flores J, Boegeman E, Purcell RH, Sereno M, Perez I, White L, et al. A dot hybridization assay for detection of rotavirus. Lancet 1983;ii:555–8. Gouvea V, Allen JR, Glass RI, Fang ZY, Bremont M, Cohen J, et al. Detection of group B and C rotaviruses by polymerase chain reaction. J Clin Microbiol 1991;29:519–23. Herring AJ, Inglis NF, Ojeh CK, Snodgrass DR, Menzies JD. Rapid diagnosis of rotavirus infection by direct detection of viral nucleic acid in silver-stained polyacrylamide gels. J Clin Microbiol 1982;16:473–7. Hung T, Chen G, Wang C, Chou Z, Chao T, Ye W, et al. Rotavirus-like agent in adult non-bacterial diarrhoea in China. Lancet 1983;ii:1078–9. Hung T, Chen GM, Wang CG, Yao HL, Fang ZY, Chao TX, et al. Waterborne outbreak of rotavirus diarrhoea in adults in China caused by a novel rotavirus. Lancet 1984;ii:1139–42. Jiang B, Dennehy PH, Spangenberger S, Gentsch JR, Glass RI. First detection of group C rotavirus in fecal specimens of children with diarrhea in the United States. J Infect Dis 1995;172:45–50. Kapikian AZ, Hoshino Y, Chanock RM. Rotaviruses. In: Knipe DM, Howley PM, Griffin DE, Lamb RA, Martin MA, Roizman B, Straus SE, editors. Field’s virology. 4th ed. Philadelphia: Lippincott. Williams and Wilkins; 2001. p. 1787–833.
227
Kelkar SD, Zade JK. Group B rotaviruses similar to strain CAL-1, have been circulating in Western India since 1991. Epidemiol Infect 2004;132:745–9. Kim Y, Chang KO, Straw B, Saif LJ. Characterization of group C rotaviruses associated with diarrhea outbreaks in feeder pigs. J Clin Microbiol 1999;37:1484–8. Krishnan T, Sen A, Choudhury JS, Das S, Naik TN, Bhattacharya SK. Emergence of adult diarrhoea rotavirus in Calcutta India. Lancet 1999;353:380–1. MacKow ER. Group B and C rotaviruses. In: Blaser MJ, Smith PD, Ravdin JI, Greenberg HB, Guerrant RL, editors. Infections of the gastrointestinal tract. NY: Raven Press Ltd.; 1995. p. 983–1008. Phan TG, Nishimura S, Okame M, Nguyen TA, Khamrin P, Okitsu S, et al. Virus diversity and an outbreak of group C rotavirus among infants and children with diarrhea in Maizuru city Japan during 2002–2003. J Med Virol 2004;74:173–9. Rosa E Silva ML, Pires De Carvalho I, Gouvea V. 1998–1999 rotavirus seasons in Juiz de Fora, Minas Gerais, Brazil: detection of an unusual G3P[4] epidemic strain. J Clin Microbiol 2002;40:2837–42. Saif LJ, Jiang B. Non group A rotaviruses of humans and animals. In: Ramig RF, editor. Rotaviruses. New York: Springer-Verlag; 1994. p. 339–71. Sanekata T, Kuwamoto Y, Akamatsu S, Sakon N, Oseto M, Taniguchi K, et al. Isolation of group B porcine rotavirus in cell culture. J Clin Microbiol 1996;34:759–61. Sanekata T, Ahmed MU, Kader A, Taniguchi K, Kobayashi N. Human group B rotavirus infections cause severe diarrhea in children and adults in Bangladesh. J Clin Microbiol 2003;41:2187–90. Sen A, Kobayashi N, Das S, Krishnan T, Bhattacharya SK, Urasawa S, et al. Amplification of various genes of human group B rotavirus from stool specimens by RT-PCR. J Clin Virol 2000;17:177–81. Sen A, Kobayashi N, Bhattacharya SK, Naik TN. Molecular characterization and epidemiology of group B rotaviruses. In: Raghunath D, Nayak R, editors. Diarrhoeal diseases, current status, research trends and field studies. New Delhi: Tata McGraw-Hill Publishing Co. Ltd; 2003. p. 137–78. Sigolo de San Juan C, Bellinzoni RC, Mattion N, La Torre J, Scodeller EA. Incidence of group A and atypical rotaviruses in Brazilian pig herds. Res Vet Sci 1986;41:270–2. Varghese V, Das S, Singh NgB, Kojima K, Bhattacharya SK, Krishnan T, et al. Molecular characterization of a human rotavirus reveals porcine characteristics in most of the genes including VP6 and NSP4. Arch Virol 2004;149:155–72. Yang JH, Kobayashi N, Wang YH, Zhou X, Li Y, Zhou DJ, et al. Phylogenetic analysis of a human group B rotavirus WH-1 detected in China in 2002. J Med Virol 2004;74:662–7.