- Email: [email protected]
RT-PCR, nucleotide, amino acid and phylogenetic analyses of enterovirus type 71 strains from Asia
Journal of Virological Methods 88 (2000) 193 – 204 www.elsevier.com/locate/jviromet
RT-PCR, nucleotide, amino acid and phylogenetic analyses of enterovirus type 71 strains from Asia Sunita Singh a, Vincent T.K. Chow a,*, K.P. Chan b, A.E. Ling b, C.L. Poh a a
Programme in Infectious Diseases, Department of Microbiology, Faculty of Medicine, National Uni6ersity of Singapore, 5 Science Dri6e 2, Singapore 117597 b Department of Pathology, Singapore General Hospital, Outram Road, Singapore 169608 Received 7 February 2000; received in revised form 17 April 2000; accepted 17 April 2000
Abstract A specific and sensitive method based on RT-PCR was developed to detect enterovirus 71 (EV71) from patients with hand, foot and mouth disease, myocarditis, aseptic meningitis and acute flaccid paralysis. RT-PCR primers from conserved parts of the VP1 capsid gene were designed on the basis of good correlation with sequences of EV71 strains. These primers successfully amplified 44 strains of EV71 including 34 strains isolated from Singapore in 1997 and 1998, eight strains from Malaysia isolated in 1997 and 1998, one Japanese strain and the neurovirulent strain EV71/7423/MS/87. RT-PCR of 30 strains of other enteroviruses including coxsackievirus A and B, and echoviruses failed to give any positive amplicons. Hence, RT-PCR with these primers showed 100% correlation with serotyping. Direct sequencing of the RT-PCR products of 20 EV71 strains revealed a distinct cluster with two major subgroups, thus enabling genetic typing of the viruses. The genetic heterogeneity of these strains culminated in amino acid substitutions within the VP1, VP2 and VP3 regions. The sequencing of a 2.9 kb fragment comprising the capsid region and the major part of 5% UTR of two Singapore strains revealed that they belonged to a group distinct from the prototype EV71/BrCr strain and the EV71/7423/MS/87 strain. The dendrogram generated from 341 bp fragments within the VP1 region revealed that the strains of Singapore, Malaysia and Taiwan belong to two entirely different EV71 genogroups, distinct from the three genogroups identified in another recent study. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Asian strains; Enterovirus 71; Phylogenetic analysis; RT-PCR; Sequencing
1. Introduction Enterovirus 71 (EV71) is a major causative agent of hand, foot and mouth disease (HFMD), * Corresponding author. Tel.: +65-8746200; fax: +657766872. E-mail address: [email protected] (V.T.K. Chow).
which most commonly affects children and infants (Zheng et al., 1995). Unlike coxsackievirus A16 that is more limited in its pathogenicity to HFMD, EV71 can give rise to major complications involving the central nervous system (CNS). Recent studies have shown an aetiological link between EV71 and brainstem encephalitis as a cause of pulmonary oedema and death. In this
0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 0 0 ) 0 0 1 8 5 - 3
194
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
disease, there is involvement of the cerebellum, brainstem and diencephalon leading to seizures, coma, truncal ataxia and somnolence (Komatsu et al., 1999; Lum et al., 1998). EV71 infections have resulted in several outbreaks in Malaysia, Taiwan and Singapore in recent years. EV71 associated with other enterovirus infections in Malaysia resulted in 30 deaths in 1997 (AbuBakar et al., 1999) while 78 deaths were reported in Taiwan in 1998 (Ho et al., 1999). In Singapore, HFMD cases were found to be sporadic and rarely complicated by CNS involvement, unlike the cases occurring in neighbouring countries. EV71 is one of the major causes of HFMD in Singapore together with coxsackievirus serotypes A16, A9, B2, B3 and echoviruses. Outbreaks of HFMD were reported in 1993 (310 cases) and in 1997 (358 cases) characterized by mucocutaneous, papulovesicular rash and self-limiting febrile illness (Ministry of the Environment, Singapore, personal communication). EV71 infection was reported in 23 patients in 1997 and 16 patients in 1998, who were suffering mainly from HFMD, myocarditis, coxsackielike disease, hyperpyrexia, meningoencephalitis and/or acute flaccid paralysis. HFMD mainly affects children aged 6 months to 3 years, although some cases of infection in adults aged 24 – 36 years have been reported. So far, only one case of acute flaccid paralysis in a child was reported. Analyses of EV71 strains at the molecular level could help to explain the varied clinical patterns observed for EV71 disease, e.g. HFMD in China, Japan and Singapore, and HFMD with CNS involvement in USA, Australia, Eastern Europe and recently in Taiwan and Malaysia (Komatsu et al., 1999). EV71 possesses a single-stranded RNA genome of approximately 7500 nucleotides of positive polarity, and belongs to the genus of enteroviruses from the family Picornaviridae (Muir et al., 1998). The genome comprises a 5% untranslated region (5% UTR), a long open reading frame that encodes a protein of approximately 2100 amino acid residues, a short 3% untranslated region (3% UTR) and a polyadenylated tail. The polyprotein is co- and post-translationally cleaved to give
four structural proteins VP4, VP2, VP3 and VP1. Determination of attenuation of virulence, altered host range, persistent infection and in vitro cell tropism have all been mapped to the capsid-encoding region (Muir et al., 1998). The capsid region comprising VP1 and VP4 of coxsackievirus B4 is known to encode virulence determinants (Caggana et al., 1993). However, little is known about the virulence determinants of EV71. Comparison of the nucleotide and amino acid sequences of the non-neurovirulent EV71 strains isolated in Singapore with neurovirulent strains isolated elsewhere may reveal the pathogenic determinants. In view of the time-consuming and laborious technique of virus isolation, the limited supply of EV71-specific antisera for serotyping, and the alarming outbreaks of EV71-related diseases especially in East Asia, a rapid and precise method to identify EV71 is required urgently. Reverse transcription-polymerase chain reaction (RTPCR) is an attractive diagnostic tool particularly during outbreaks given that results can be obtained within hours, and that serologically untypable strains may even be detected. It is known that the specific epitopes responsible for serotypic specificity are clustered mainly in the VP1 region. In a recent study by Oberste et al. (1999), VP1 sequences were shown to have a better correlation with enterovirus serotypes compared to those of the 5% UTR or the VP4-VP2 junction. Thus, PCR primers designed from the VP1 region should correlate better with serotypic identification. We describe here the application of newlydesigned and highly-specific primers for RT-PCR amplification and direct cycle sequencing of EV71 strains to illustrate the genetic relationships and molecular evolution of EV71 strains from Asia.
2. Material and methods
2.1. Sample collection Cultured strains of EV71 and other enteroviruses were isolated by the Virology Laboratory, Pathology Department, Singapore General Hospital. A total of 44 EV71 samples and 30
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
other enteroviruses including coxsackievirus types A and B, echoviruses as well as serologically untypable strains were studied (Table 1). These viruses were isolated from sputum, throat swab, stool, nasal aspirate, rectal swab and vesicular fluid specimens of patients suffering from HFMD and/or other clinical symptoms. All the samples were inoculated into HeLa, HEp-2, RD and MRC-5 cell lines, and the virus isolates were typed by the microneutralization method using the Lim Benyesh-Melnick (LBM) antisera pool or the alternating intersecting pools developed at the National Institute of Public Health and the Environment in the Netherlands. The EV71-specific antiserum was from Light Diagnostics, Chemicon International, CA, USA. The viruses were harvested and stored at −70°C. The neurovirulent strain EV71/7423/MS/87 was a gift from Dr M.A. Pallansch, CDC, Atlanta, GA, USA. The cell cultures of EV71 strains from Malaysia and Japan were kindly provided by Professor S.K. Lam from the University of Malaya, Malaysia.
2.2. Primer design Two pairs of primers VP1F2/EV71R2 and EV71F4/EV71R5 were designed to amplify target fragments of 341 bp and 612 bp within the VP1 region and 5% UTR of EV71, respectively. As shown in Table 2, the first eight primers were also designed to amplify and/or sequence the capsid coding region (VP1, VP2, VP3, VP4) and part of the 5% UTR of two local EV71 strains.
2.3. RNA extraction and RT-PCR The virus-infected cells were lysed using the SDS-urea method, and RNA was purified using chloroform/isoamyl alcohol extraction followed by ethanol precipitation (Gough, 1988). The dried RNA pellet was reconstituted in sterile distilled water containing RNasin ribonuclease inhibitor (Promega, Madison, WI, USA) and stored at −70°C prior to use. The yield of RNA was determined by optical density measurements at 260 nm. Total RNA (2 – 5 mg) was mixed with 0.3 mg of random hexamer oligonucleotides (Life Technologies, Gaithersburg, MD, USA) and incu-
195
bated at 70°C for 10 min. To this reaction mixture was added first strand buffer, 0.01 M dithiothreitol, 0.5 mM of dNTP mix and 10 U of reverse transcriptase (Life Technologies) in a final volume of 20 ml. The RT reaction was incubated at 42°C for 50 min and heat inactivated at 70°C for 15 min. The cDNA was stored at –70°C and used as template for subsequent PCR experiments. With primer pairs EV7116F/EV7116R and EV71F4/EV71R4, long distance PCR catalyzed by KlenTaq2 polymerase with proof-reading activity (Clontech, Palo Alto, CA, USA), was employed to amplify the complete capsid coding region and part of the 5% UTR of Singapore EV71 strains 13/Sin/98 and 18/Sin/97. A 5 ml aliquot of the cDNA reaction product was added to the PCR mixture containing 1× PCR buffer, 0.2 mM each of the primers, 0.2 mM dNTP mix and 0.4 U of KlenTaq2 polymerase in a total reaction volume of 50 ml. The EV71 specificity of the primer pairs VP1F2/EV71R2 and EV71F4/EV71R5 were tested on the enteroviral cDNA samples using AmpliTaq DNA polymerase (Roche Molecular Systems, Branchburg, NJ, USA). A 5 ml aliquot of each cDNA template was used in a total reaction volume of 50 ml containing 1× PCR buffer, 0.2 mM dNTP mix, 0.2 mM each of forward and reverse primers, and 2.5 U of AmpliTaq polymerase. PCR was carried out at an initial 95°C for 1 min, followed by 30 cycles of 95°C for 30 s, 55°C for 30 s and 68°C for 3 min. The primer pair VP1F2/EV71R2 that was found to be specific only for EV71 was then used to amplify all the cDNA samples using KlenTaq DNA polymerase. The PCR products (10 ml each) were subjected to electrophoresis in a 1.6% agarose gel, with a 100 bp DNA ladder (New England Biolabs, Beverly, MA, USA) serving as a molecular mass marker. Tissue culture infective dose (TCID50) of the 7423/MS strain was derived using the microwell plate method and calculated by the formula of Reed and Muench (Lennette and Schmidt, 1969). The sensitivity of the RT-PCR assay was tested by amplifying tenfold serial dilutions of RNA extracted from the virus suspension of known TCID50.
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
196
Table 1 Enterovirus strains tested by RT-PCR Virus strainsa
No. of strains Clinical diagnosis
Enterovirus 71 strains MS/7423/87 Singapore/97
(total)
44
(18/Sin)
1 1
Singapore/97 Singapore/97
(36/Sin) (52/Sin, 53/Sin)
1 2
Singapore/97
(35/Sin, 37/Sin, 38/Sin, 39/Sin, 40/Sin, 41/Sin, 42/Sin, 43/Sin, 44/Sin, 17 48/Sin, 49/Sin, 51/Sin, 54/Sin, 55/Sin, 56/Sin, 57/Sin, 58/Sin) (26/Sin) 1 (11/Sin, 13/Sin, 14/Sin, 15/Sin, 16/Sin, 17/Sin, 20/Sin, 21/Sin, 22/Sin, 12 27/Sin, 30/Sin, 32/Sin) (23/Jap) 1 (47/Mal) 1 (45/Mal, 46/Mal) 2 (31/Mal) 1 (25/Mal, 28/Mal, 33/Mal, 34/Mal) 4
Singapore/98 Singapore/98 Osaka/98 Malaysia/97 Malaysia/97 Malaysia/98 Malaysia/98 Other Enteroviruses Coxsackievirus A16 Coxsackievirus A9 Coxsackievirus A9 Coxsackievirus B2 Coxsackievirus B2 Coxsackievirus B2 Coxsackievirus B3 Coxsackievirus B3 Coxsackievirus B5 Echovirus 3 Echovirus 3 Echovirus 6 Echovirus 6 Echovirus 7 Echovirus 20
Aseptic meningitis Acute flaccid paralysis Myocarditis Coxsackie-like disease HFMD Neonatal pyrexia HFMD – Meningoencephalitis Myocarditis Asymptomatic HFMD
(total)
30
(1/Sin, 2/Sin, 50/Sin, 72/Sin, 73/Sin)
5
HFMD
(74/Sin) (75/Sin) (6/Sin, 7/Sin, 70/Sin) (76/Sin) (77/Sin) (5/Sin) (78/Sin) (79/Sin) (60/Sin) (61/Sin) (62/Sin, 63/Sin) (3/Sin) (64/Sin, 65/Mal) (66/Mal)
1 1 3 1 1 1 1 1 1 1 2 1 1 1
Echovirus 25
(67/Sin)
1
Echovirus 30 Echovirus 30 Echovirus 33 Untypable Untypable
(68/Sin) (69/Sin) (71/Sin) (8/Sin) (9/Sin, 10/Sin)
1 1 1 1 2
HFMD Pyrexia HFMD Viral gastritis Pyrexia HFMD Contact Pyrexia Aseptic meningitis Coxsackie disease Pyrexia HFMD Viral encephalitis Acute flaccid paralysis Acute flaccid paralysis Viral meningitis Screening Meningitis Encephalitis HFMD
a Strains were assigned by the year of isolation, internal lab identifier and the country of origin, i.e., Singapore (Sin), Malaysia (Mal) and Japan (Jap). Strain 47/Mal was isolated from a brain tissue sample of a patient with meningoencephalitis, while strain 18/Sin was from a stool sample of a patient with acute flaccid paralysis.
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
197
Table 2 Oligonucleotide primers for RT-PCR and cycle sequencing of enterovirus 71 Primer (orientation)
Sequence (5%–3%)
Gene/region
Nucleotide positions
Application(s)
EV7116F (+) EV7116R (−) EV71F2 (+) EV71R2 (−) EV71F3 (+) EV71R3 (−) EV71F4 (+) EV71R4 (−) VP1F2 (+) EV71R5 (−)
CCATATAGCTATTGGATTGG GAAAAACTGACTGGATAGTG TACAAAGACTCTTATGCTGC TTGACAAAAACTGAGGGGTT GCAGGCGGCACAGGAACAGA GTGAAATTCTTTTGGGCTGCCG TTAAAACAGCTGTGGGTTG GCAGCATAAGAGTCTTTGTA GTTCTTAACTCACATAGCA AATTCTGTAATTGTCACCATA
5% UTR 2A VP4 VP1 VP2 VP3 5% UTR VP4 VP1 5% UTR
617–636 3562–3543 843–862 2986–2967 1359–1378 2389–2368 1–20 862–843 2646–2664 612–592
PCR/SEQ PCR/SEQ SEQ PCR/SEQ SEQ SEQ PCR/SEQ PCR/SEQ PCR/SEQ PCR
2.4. DNA sequence analysis To generate clean templates for DNA sequencing, PCR was repeated with KlenTaq polymerase, specific DNA bands were excised from the gel, eluted and purified using a DNA gel extraction kit (Qiagen, Germany). Purified PCR products were cycle-sequenced in both directions using the ABI PRISM BigDye Terminator cycle sequencing ready reaction kit (PE Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using the ABI PRISM 377 DNA Sequencer (PE Applied Biosystems). The DNASIS analysis software was used for conversion between RNA and DNA sequences, and for alignment. Predicted amino acid sequences were derived by translating nucleotide sequences using the ORF Finder (NCBI). The sequence data of our EV71 samples have been deposited with the GenBank database. Each batch of PCRs included a known positive control together with a ‘no DNA’ negative control to exclude the possibility of false positive reaction due to reagent contamination. PCR was also carried out with RNA extracted from uninfected RD cells to exclude non-specific results. All PCRs were repeated to exclude false positive results arising from cross contamination. Homology searches were carried out using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/ BLAST). The percentage of sequence identity was calculated with the Blast 2 sequences programme (NCBI) that produces alignment of two given
sequences using the BLAST engine for local alignment (Tatusova and Madden, 1999). The phylogenetic pattern of the South East Asian strains of EV71 was studied on the basis of the tree constructed from the 341-bp VP1 fragments flanked by specific primers. Multiple alignments and dendrograms were constructed using the TREECON programme, version 1.3b (Van de Peer and De Wachter, 1993). The genogroups were generated by the neighbour joining method rooted to the 7423/MS strain. The branched lengths were determined by the maximum likelihood method and the reliability of the neighbour joining method was estimated by bootstrap analysis of 1000 pseudoreplicate datasets using SEQBOOT analysis. Hydropathic profiles of the predicted proteins of strains 13/Sin/98 and 18/Sin/97 were plotted by the method of Kyte and Doolittle (1982).
3. Results
3.1. Specificity and sensiti6ity of RT-PCR assay Using primers VP1F2 and EV71R2, RT-PCR generated target bands of 341 bp (Fig. 1) for the neurovirulent strain 7423/MS as well as for 1, 8 and 34 EV71 strains from Japan, Malaysia and Singapore, respectively. None of the other enterovirus types that served as negative controls were amplified by RT-PCR with these primers. The RT-PCR results correlated well with the serotyping data by neutralization assay, thus em-
198
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
phasizing the high specificity of these primers for EV71. However, RT-PCR with primers EV71F4 and EV71R5 (Table 2) did not correlate well with serotyping. The TCID50 of the 7423/MS strain was found to be 106.5 per inoculum volume of 0.025 ml. RT-PCR could amplify a minimum equivalent of 101.5 or approximately 10 virus-infected cells per inoculum volume as shown in Fig. 1, thereby substantiating the sensitivity of RT-PCR with the primers and the potential applicability for detecting low virus titres in clinical specimens.
3.2. Nucleotide and amino acid sequence analysis of two local EV71 strains Using primers EV7116F and EV7116R (Table 2), a 2.9 kb fragment was amplified from each of the two Singapore EV71 strains (Fig. 1). Strain 13/Sin/98 was isolated from a case of HFMD, while strain 18/Sin/97 originated from a female infant with acute flaccid paralysis. These EV71 strains were then sequenced and compared with known virulent strains isolated elsewhere via computational analysis of nucleotide and amino acid sequences, and to yield accurate sequence information for designing specific primers based on highly conserved regions within the VP1 gene. Strains 13/Sin/98 and 18/Sin/97 showed 95% nucleotide identity to each other, reaching as high as
96% in the 5% UTR. The nucleotide sequences of these strains showed 92% identity to the neurovirulent strain EV71/7423/MS/87, first isolated from a Mississippi boy with paralysis in 1987 (Brown and Pallansch, 1995). Similarities to the nucleotide sequences of the other EV71 strains (in the GenBank database) including the prototype EV71/BrCr strain were found to be less than 85%. Comparison of the amino acid sequences of strain 13/Sin/98, 18/Sin/97 with 7423/MS and BrCr prototype strains revealed 100% identity of the VP4 region (Fig. 2). Within the VP2 region, there were two variable sites, i.e. residue 197 (serine in 13/Sin/98 but proline in 18/Sin/97, 7423/MS and BrCr strains) and residue 315 (where glycine in 7423/MS was replaced by alanine in both local strains and the BrCr strain). There were additional amino acid disparities in the BrCr strain at positions 114, 163, 195 and 212. In the VP3 region, leucine at residue 329 (in 7423/MS and BrCr) and at residue 538 (in 7423/MS alone) was conservatively substituted with proline (329) in the local strains, and with isoleucine (538) in the local strains as well as the BrCr strain, respectively. Histidine at position 557 of 7423/MS and 13/Sin/98 was replaced by arginine in strain 18/Sin/97 and by aspartic acid in BrCr. A comparison between BrCr and the other three strains revealed that glutamic acid replaced glutamine at position 560, and threonine substituted serine at position 563.
Fig. 1. Visualization of RT-PCR products of enterovirus 71 by gel electrophoresis. A 100 bp DNA ladder molecular mass marker was included in lane M. Lanes 1 and 2 represent RT-PCR-amplified 2.9-kb fragments of 13/Sin/98 and 18/Sin/97, respectively. Lanes 3 and 4 represent RT-PCR-positive 341-bp fragments of 13/Sin/98 and 18/Sin/97, respectively. Lanes 5 to 11 represent RT-PCR products of neat and of ten-fold serial dilutions of EV71/7423/MS strain (with TCID50 of 106.5 per 0.025 ml of inoculum), i.e. neat, 10 − 1, 10 − 2, 10 − 3, 10 − 4, 10 − 5 and 10 − 6, respectively. No product was visible at 10 − 6 dilution (lane 11). Lanes 12 to 15 represent RT-PCR-negative results of CA16, CB2, echo 7 and untypable strains, respectively. RT-PCR of RNA from uninfected RD cells (lane 16) and a ‘‘no DNA’’ sample (lane 17) served as negative controls.
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
199
MS and BrCr strains demonstrated numerous disparities, including at residues 583, 587, 595, 596, 608, 623, 663, 710, 729, 732, 737, 748, 749, 802, 809, 811, 814, 840, 847 and 857. The results showed that the VP4 region displayed complete homology among the prototype BrCr, the neurovirulent 7423/MS and the two local strains. Relatively few mutations were noted in the VP2 and VP3 regions, whereas the VP1 region showed the greatest variation.
3.3. Analysis of the VP1 target region flanked by EV71 -specific primers Twenty out of the 44 PCR products amplified by EV71-specific primers were randomly selected and sequenced, i.e. 13 Singapore, one Japanese and six Malaysian strains (Fig. 3). Nucleotide sequences of the strains showed 91–93% homology to the bases coding for the VP1 region of the 7423/MS strain. The predicted amino acid sequences showed almost complete homology to the 7423/MS strain except at position 663 where glutamic acid was replaced with lysine in five strains, and at position 710 where glutamic acid was substituted by glutamine in five strains and by glycine in another strain. In addition, tryptophan at position 736 was replaced by glycine in 34/Mal/98. The corresponding amino acid sequences of nine strains were completely identical to those of the 7423/MS strain.
3.4. Phylogenetic analysis
Fig. 2. Comparison of predicted amino acid sequences of Singapore EV71 strains 13/Sin/98 and 18/Sin/97 (GenBank accession numbers AF251358 and AF251359) with those of strains BrCr and 7423/MS. Residues 1-926 of the four strains are aligned, with disparities highlighted in bold letters. Asterisks denote identity, colons indicate conserved residues while periods depict variable regions.
Interestingly, comparative analysis of the VP1 amino acid sequences of the two Singapore, 7423/
A phylogenetic tree was constructed based on the nucleotide sequences of the 341-bp VP1 fragments of selected strains studied by Brown et al. (1999), as well as those of Asian strains sequenced by us and those available in the GenBank database. These include the prototype BrCr, neurovirulent 7423/MS, 13 Singapore, 30 Malaysian, 31 Taiwanese, one Republic of China, one Japanese and ten Australian strains. The G10 strain of coxsackievirus A16 was included as an outgroup. The dendrogram revealed five distinct genotypes (Fig. 4). The genotypes A, B and C were
200
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
classified as proposed by Brown et al. (1999). The prototype strain BrCr was the sole member of genotype A. The neurovirulent strain 7423/MS, two Taiwanese strains and five Australian strains represented genotype B. Strains of this group (other than 7423/MS itself) showed 93 – 94% identity to the 7423/MS strain. Sixteen Taiwanese strains, five Australian, one Malaysian and one Chinese strain
Fig. 4. Dendrogram based on nucleotide divergence of the 341-bp VP1 gene fragments of Asian strains of EV71. The strains available in the GenBank are each indicated by their accession number followed by country and year of isolation.
Fig. 3. Alignment of representative VP1 nucleotide sequences of EV71 strains. Strains 13/Sin/98, 15/Sin/98, 16/Sin/98, 20/ Sin/98, 26/Sin/98 and 27/Sin/98 differed only by 9 bases and are exemplified by strain 26/Sin/98. Similarly, strains 28/Mal/ 98, 33/Mal/98 and 34/Mal/98 differed only by two bases and are represented by 28/Mal/98. Strains 18/Sin/97, 56/Sin/97 and 57/Sin/97 differed by 11 bases and are represented singly by strain 18/Sin/97. Strains 36/Sin/97 and 58/Sin/97 were different only by two bases and are represented by 36/Sin/97. Asterisks denote identity. The nucleotide sequences of these strains have been deposited in GenBank under accession numbers AF251223-AF251236 and AF251802-251805.
together represented genotype C which showed 81–83% homology to the 7423/MS strain. This study revealed two new genogroups designated D and E. Genotype D constituted the biggest cluster in this study, including all the strains from Singapore and Malaysia, except one Malaysian strain belonging to genogroup C. One strain each from Taiwan and Japan were also included in genogroup D. Strains in genogroup D showed 92–93% nucleotide identity with the 7423/MS strain. Twelve Taiwanese strains were all distinct and included in a separate genotype designated E. The strains of this group had less significant homology to the 7423/MS strain than the homology of 85–87% to the coxsackievirus A16 strain. The genotypes B, C, D and E could be further subdivided into clusters within each genotype.
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
As additional confirmation, a dendrogram generated based on 891 nucleotides of the entire VP1 region of the Singapore strains 13/Sin/98 and 18/Sin/97, together with selected strains reported by Brown et al. (1999), failed to group these two local strains into any of the three genotypes, thus reiterating that they were distinct, belonging to an entirely new genotype D.
4. Discussion The classical detection of EV71 is by virus isolation via cell culture followed by microneutralization tests (Muir et al., 1998). The culture and identification of EV71 is an intensive and time-consuming process requiring 2 – 3 weeks, often hindered by slow progression of cytopathic effects and viral aggregation (Rotbart et al., 1994; Muir et al., 1998). Reliance on such conventional typing schemes during large outbreaks would impede the implementation of control measures, and delay medical treatment options. Many patients with EV71-related hyperpyrexia, myocarditis and encephalitis are unnecessarily treated with antibiotics, antiherpes drugs or both while awaiting culture results to exclude bacterial or herpetic infections. Furthermore, the limited supply of EV71-specific antisera for neutralization tests could have serious implications during outbreaks. In emergency outbreak situations, a rapid and reliable typing method would justify the isolation of patients for quarantine purposes and the initiation of prompt preventive measures, especially in institutions associated with children. Availability of a rapid typing method would also facilitate decision-making regarding the administration of specific immunoglobins to selected high-risk patients. Rapid diagnosis is of relevance given the possibility of therapeutic intervention with new anti-enteroviral agents such as pleconaril (Pevear et al., 1999). The failure to identify EV71 by the neutralization method has been observed in many laboratories, and is of concern especially with regard to poliomyelitis eradication (Muir et al., 1998; Van Loon et al., 1999). Since EV71 may mimic the acute flaccid paralysis of polio, such patients may
201
be suspected to harbour polioviruses. EV71 is found to be more difficult than the other enteroviruses to be recognized serotypically, and may require treatment with chloroform for optimal serotyping (Van Loon et al., 1999). EV71 replicates poorly in most cell cultures, no single line currently supports the propagation of all strains, and specific antiserum is not widely available (Alexander et al., 1994; Van Loon et al., 1999). The use of virus isolation and serotyping might therefore be expected to decrease in favour of RT-PCR for the rapid diagnosis of enterovirus infections. For facilitating early detection of circulating enterovirus types, particularly for patients with aseptic meningitis, RT-PCR constitutes a markedly more sensitive and specific molecular typing scheme. For the direct detection of EV71 in clinical samples, this two-step RT-PCR could be easily improved upon by adopting a more convenient single-step RT-PCR method, coupled with the use of rapid commercial RNA extraction kits. To illustrate this, we extracted RNA from ten random samples using the Oligotex direct RNA extraction kit (Qiagen), and obtained convincing RT-PCR results (data not shown). Such modifications can enhance the rapidity and simplicity of the RT-PCR protocol. The results obtained have correlated well with the neutralization assay. Because of the practical problems associated with cell cultures, molecular typing by RT-PCR and sequencing offers a promising approach for differentiating clinical isolates of EV71 from other enteroviruses. Using a specific primer pair designed for EV71 in this study, the correlation between serotyping, RT-PCR amplification and cycle sequencing results showed that this primer pair was sufficient for amplification and sequencing of the partial VP1 region from all the 44 EV71 strains isolated from various geographic locations. PCR coupled with sequence analyses of other viruses have been reported, e.g., for identification of adenoviruses in conjuctival scrapings (Takeuchi et al., 1999) and dengue viruses in serum samples (Seah et al., 1995a,b). It is essential to understand the epidemiology of EV71 infection to monitor the emergence of new
202
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
strains and to facilitate early rapid detection of co-circulating strains during outbreak periods. Carefully optimized PCR assays are at least as sensitive as cell culture, while their accessory sequence data can elucidate biological information not obtainable by serotyping methods (Muir et al., 1998). Similar molecular detection schemes have been developed for typing enteroviruses causing aseptic meningitis where the VP1 sequences correlated with the serotypes (Oberste et al., 1999). More extensive sequencing studies will define the limits of diversity and provide a basis for improving molecular techniques of strain identification. The phylogenetic analysis of EV71 strains aids the study of their molecular evolution and their genetic relationships with strains from different outbreaks. In an earlier investigation undertaken by Brown et al. (1999), only three EV71 isolates from Asia (two from Malaysia and one from Republic of China) were studied. In our study, we have also included strains from Taiwan, Singapore and Japan. For routine molecular diagnostic and typing purposes, sequencing of the 341 bases of the VP1 region revealed sufficient data to differentiate the various EV71 strains from Asia. It was observed that some strains clustered in patterns similar to those generated by Brown et al. (1999) based on the complete VP1 region, e.g., US strains were mainly clustered in the major genogroups B and C. In their study, the Malaysian strain 0731-MAA-97 (GenBank accession no. AF135911), was observed to be related to but distinct from strains of genogroup B, and would hence justify its inclusion in a completely new genotype designated D together with the other strains from Singapore and Malaysia. Our study thus revealed a new genotype D, which represented all the strains isolated from Singapore, Japan and Malaysia except for strain 0756MAA-97 (GenBank accession no. AF135935) which was placed in genogroup C. It was also observed that there were two major co-circulating genotypes of Taiwanese strains. The Taiwanese strains belonging to genotype C were similar to the 7423/MS strain, while those of genotype E exhibited greater similarity to coxsackievirus A16. A few Taiwanese strains were also observed to
belong to genotypes B and D, thus emphasizing the genetic diversity of Taiwanese strains (Ho et al., 1999). The results clearly demonstrate the variability of EV71 genomic patterns in different geographical locations. It is noteworthy that although the strains from Singapore were isolated around the same period as those causing the outbreak in Taiwan, they displayed considerable molecular diversity and clinical patterns. The local strains showed no tendency towards neurovirulence except for a single case of mild paresis. These were totally new strains prevalent in Singapore, mainly causing hand, foot and mouth disease. Other environmental and host factors such as age, nutrition, genetic constitution, pre-existing immunity may contribute to the pathogenicity of EV71, culminating in varying clinical expressions. The outer capsid proteins displayed highest variation within and between the phylogenetic clusters, implying that evolution is more conspicuous in the VP1, VP2 and VP3 regions. Enteroviruses generally exhibit a high degree of heterogeneity due to the relatively higher rate of nucleotide misincorporation during viral RNA replication occurring both in vitro and in vivo (Muir et al., 1998). Chimeric constructs are helpful for substantiating an association of these regions with virulence determination. To elucidate the molecular basis of virulence, a panel of recombinant chimeric viruses can be constructed from virulent and non-virulent strains to ascertain their in vitro translatory effects in pathogenicity. Specific mutations thus identified can be analyzed for their role in inhibiting neurovirulence, enabling the mapping of the genetic determinants of virulence. Analysis of individual mutations in both VP1 and VP2 regions revealed that a single residue determined the virulent phenotype in coxsackievirus B4 (Ramsingh et al., 1992; Caggana et al., 1993; Ramsingh and Collins, 1995). Previous studies also identified five amino acid substitutions within the VP1, VP2 and VP4 capsid proteins of the virulent coxsackievirus B4, and the presence of major T-cell epitopes on VP3 of Theiler’s virus in demyelination –susceptible SJL/J mice (Yauch et al., 1995).
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
It has been observed that the surfaces of rhinoviruses and polioviruses contain a series of remarkably deep crevices forming the so-called ‘canyon’, which is formed roughly at the junction of VP1 with VP2 and VP3. Occurring around each 5-fold vortex in human rhinovirus (HRV), the canyon is the site of receptor attachment. It also represents a strategy for the viruses to escape the host’s immune surveillance by protecting the receptor attachment site in a surface depression (Rossmann, 1994). The amino acid residues lining the canyon are significantly more conserved than other surface-exposed residues (Chapman and Rossmann, 1993). Site-directed mutagenesis of HRV14 indicated that modification of several amino acid residues located in the base of the canyon affects virus-receptor affinity (Colonno et al., 1988). Furthermore, Wien et al. (1997) have demonstrated a range of structural consequences arising from poliovirus receptor mutations involving VP2 residue 142 and VP1 residues 95, 158, 160, 166, 226, 228, 239 and 241. Intriguingly, the corresponding amino acids were conserved in the two Singapore (13/Sin/98 and 18/Sin/97), 7423/ MS and BrCr strains of EV71. Notwithstanding this, the residues that showed variations between these four strains (some of which resided in hydrophobic regions) may influence the canyon structure and thus virus-receptor attachment. Comparison of the conformational structures of the canyons of these strains as predicted by computer-aided modelling could provide clues on their virus-receptor affinity and other properties. The availability of EV71 sequence data will enable plasmid constructs incorporating the 5% UTR and the various capsid coding regions to be targeted as candidates for DNA vaccines against the neurovirulent enterovirus strains, as well as validating their ability to express the desired proteins and to elicit antibodies against them. Immunodominant epitopes of Theiler’s murine encephalomyelitis viruses have been localized to the capsid proteins VP1, VP2 and VP3 (Yauch et al., 1995). Mice have been protected against lethal coxsackievirus B3 infection by DNA immunization using cDNA constructs of capsid protein (Henke et al., 1998).
203
Thus, the rapid identification of EV71 through RT-PCR and direct sequencing of PCR amplicons will help to elucidate the genotypes involved in an outbreak and enable prompt implementation of measures that will minimize further transmission of viruses. The data will also aid in the long-term goal of developing a DNA vaccine effective against EV71 in view of its recent association with alarming outbreaks of severe neurological diseases.
Acknowledgements We are grateful to M.C. Phoon and S.K. Tay for their excellent technical assistance and to M. Sakharkar for biocomputing advice. Our sincere thanks to Dr M.A. Pallansch and Professor S.K. Lam for providing some EV71 strains for our study.
References AbuBakar, S., Chee, H.Y., Al-Kobaisi, M.F., et al., 1999. Identification of enterovirus 71 isolates from an outbreak of hand, foot and mouth disease (HFMD) with fatal cases of encephalomyelitis in Malaysia. Virus Res. 61, 1 – 9. Alexander, J.P., Baden, L., Pallansch, M.A., Anderson, L.J., 1994. Enterovirus 71 infection and neurologic diseaseUnited States, 1977 – 1991. J. Infect. Dis. 169, 905 – 908. Brown, B.A., Pallansch, M.A., 1995. Complete nucleotide sequence of enterovirus 71 is distinct from poliovirus. Virus Res. 39, 195 – 205. Brown, B.A., Oberste, M.S., Alexander, J.P., Kennett, M.L., Pallansch, M.A., 1999. Molecular epidemiology and evolution of enterovirus 71 strains isolated from 1970 to 1998. J. Virol. 73, 9969 – 9975. Caggana, M., Chan, P., Ramsingh, A., 1993. Identification of a single amino acid residue in the capsid protein VP1 of coxsackievirus B4 that determines the virulent phenotype. J. Virol. 67, 4797 – 4803. Chapman, M.S., Rossmann, M.G., 1993. Comparison of surface properties of picornaviruses: strategies for hiding the receptor site from immune surveillance. Virology 195, 745 – 756. Colonno, R.J., Condra, J.H., Mizutani, S., et al., 1988. Evidence for the direct involvement of the rhinovirus canyon in receptor binding. Proc. Natl. Acad. Sci. USA 85, 5449 – 5453. Gough, N.M., 1988. Rapid and quantitative preparation of cytoplasmic RNA from small numbers of cells. Anal. Biochem. 173, 93 – 95.
204
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
Henke, A., Wagner, E., Whitton, J.L., Zell, R., Stelzner, A., 1998. Protection of mice against lethal coxsackievirus B3 infection by using DNA immunization. J. Virol. 72, 8327– 8331. Ho, M., Chen, E.R., Hsu, K.H., et al., 1999. An epidemic of enterovirus 71 infection in Taiwan. N. Engl. J. Med. 341, 929 – 935. Komatsu, H., Shimizu, Y., Takeuchi, Y., Ishiko, H., Takada, H., 1999. Outbreak of severe neurologic involvement associated with enterovirus 71 infection. Pediatr. Neurol. 20, 17– 23. Kyte, J., Doolittle, R.F., 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157, 105 – 132. Lennette, E.H., Schmidt, N.J., 1969. Diagnostic Procedures for Viral and Rickettsial Infections. American Public Health Association, New York, pp. 116–117. Lum, L.C.S., Wong, K.T., Lam, S.K., et al., 1998. Fatal enterovirus 71 encephalomyelitis. J. Pediatr. 133, 795–798. Muir, P., Kammerer, U., Korn, K., et al., 1998. Molecular typing of enteroviruses: current status and future requirements. Clin. Microbiol. Rev. 11, 202–227. Oberste, M.S., Maher, K., Kilpatrick, D.R., et al., 1999. Typing of human enteroviruses by partial sequencing of VP1. J. Clin. Microbiol. 37, 1288–1293. Pevear, D.C., Tull, T.M., Seipel, M.E., Groarke, J.M., 1999. Activity of pleconaril against enteroviruses. Antimicrob. Agents Chemother. 43, 2109–2115. Ramsingh, A., Araki, H., Bryant, S., Hixson, A., 1992. Identification of candidate sequences that determine virulence in coxsackievirus B4. Virus Res. 23, 281–292. Ramsingh, A.I., Collins, D.N., 1995. A point mutation in the VP4 coding sequence of coxsackievirus B4 influences virulence. J. Virol. 69, 7278–7281. Rossmann, M.G., 1994. Viral cell recognition and entry. Protein Sci. 3, 1712 – 1725.
Rotbart, H.A., Sawyer, M.H., Fast, S., et al., 1994. Diagnosis of enteroviral meningitis by using PCR with a colorimetric microwell detection assay. J. Clin. Microbiol. 32, 2590 – 2592. Seah, C.L.K., Chow, V.T.K., Tan, H.C., Chan, Y.C., 1995a. Rapid single-step RT-PCR typing of dengue viruses using five NS3 gene primers. J. Virol. Methods 51, 193 – 200. Seah, C.L.K., Chow, V.T.K., Chan, Y.C., 1995b. Semi-nested PCR using NS3 primers for the detection and typing of dengue viruses in clinical serum specimens. Clin. Diagn. Virol. 4, 113 – 120. Takeuchi, S., Itoh, N., Uchio, E., Aoki, K., Ohno, S., 1999. Serotyping of adenoviruses on conjunctival scrapings by PCR and sequence analysis. J. Clin. Microbiol. 37, 1839 – 1845. Tatusova, T.A., Madden, T.L., 1999. Blast 2 sequences — a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174, 247 – 250. Van de Peer, Y., De Wachter, R., 1993. TREECON: a software package for the construction and drawing of evolutionary trees. Comput. Appl. Biosci. 9, 177 – 182. Van Loon, A.M., Cleator, G.C., Ras, A., 1999. External quality assessment of enterovirus detection and typing. Bull. World Health Org. 77, 217 – 223. Wien, M.W., Curry, S., Filman, D.J., Hogle, J.M., 1997. Structural studies of poliovirus mutants that overcome receptor defects. Nat. Struct. Biol. 4, 666 – 674. Yauch, R.L., Kerekes, K., Saujani, K., Kim, B.S., 1995. Identification of a major T-cell epitope within VP3 amino acid residues 24 to 37 of Theiler’s virus in demyelinationsusceptible SJL/J mice. J. Virol. 69, 7315 – 7318. Zheng, Z.M., He, P.J., Caueffield, D., et al., 1995. Enterovirus 71 isolated from China is serologically similar to the prototype E71 BrCr strain but differs in the 5%-noncoding region. J. Med. Virol. 47, 161 – 167.
.
RT-PCR, nucleotide, amino acid and phylogenetic analyses of enterovirus type 71 strains from Asia Sunita Singh a, Vincent T.K. Chow a,*, K.P. Chan b, A.E. Ling b, C.L. Poh a a
Programme in Infectious Diseases, Department of Microbiology, Faculty of Medicine, National Uni6ersity of Singapore, 5 Science Dri6e 2, Singapore 117597 b Department of Pathology, Singapore General Hospital, Outram Road, Singapore 169608 Received 7 February 2000; received in revised form 17 April 2000; accepted 17 April 2000
Abstract A specific and sensitive method based on RT-PCR was developed to detect enterovirus 71 (EV71) from patients with hand, foot and mouth disease, myocarditis, aseptic meningitis and acute flaccid paralysis. RT-PCR primers from conserved parts of the VP1 capsid gene were designed on the basis of good correlation with sequences of EV71 strains. These primers successfully amplified 44 strains of EV71 including 34 strains isolated from Singapore in 1997 and 1998, eight strains from Malaysia isolated in 1997 and 1998, one Japanese strain and the neurovirulent strain EV71/7423/MS/87. RT-PCR of 30 strains of other enteroviruses including coxsackievirus A and B, and echoviruses failed to give any positive amplicons. Hence, RT-PCR with these primers showed 100% correlation with serotyping. Direct sequencing of the RT-PCR products of 20 EV71 strains revealed a distinct cluster with two major subgroups, thus enabling genetic typing of the viruses. The genetic heterogeneity of these strains culminated in amino acid substitutions within the VP1, VP2 and VP3 regions. The sequencing of a 2.9 kb fragment comprising the capsid region and the major part of 5% UTR of two Singapore strains revealed that they belonged to a group distinct from the prototype EV71/BrCr strain and the EV71/7423/MS/87 strain. The dendrogram generated from 341 bp fragments within the VP1 region revealed that the strains of Singapore, Malaysia and Taiwan belong to two entirely different EV71 genogroups, distinct from the three genogroups identified in another recent study. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Asian strains; Enterovirus 71; Phylogenetic analysis; RT-PCR; Sequencing
1. Introduction Enterovirus 71 (EV71) is a major causative agent of hand, foot and mouth disease (HFMD), * Corresponding author. Tel.: +65-8746200; fax: +657766872. E-mail address: [email protected] (V.T.K. Chow).
which most commonly affects children and infants (Zheng et al., 1995). Unlike coxsackievirus A16 that is more limited in its pathogenicity to HFMD, EV71 can give rise to major complications involving the central nervous system (CNS). Recent studies have shown an aetiological link between EV71 and brainstem encephalitis as a cause of pulmonary oedema and death. In this
0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 0 0 ) 0 0 1 8 5 - 3
194
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
disease, there is involvement of the cerebellum, brainstem and diencephalon leading to seizures, coma, truncal ataxia and somnolence (Komatsu et al., 1999; Lum et al., 1998). EV71 infections have resulted in several outbreaks in Malaysia, Taiwan and Singapore in recent years. EV71 associated with other enterovirus infections in Malaysia resulted in 30 deaths in 1997 (AbuBakar et al., 1999) while 78 deaths were reported in Taiwan in 1998 (Ho et al., 1999). In Singapore, HFMD cases were found to be sporadic and rarely complicated by CNS involvement, unlike the cases occurring in neighbouring countries. EV71 is one of the major causes of HFMD in Singapore together with coxsackievirus serotypes A16, A9, B2, B3 and echoviruses. Outbreaks of HFMD were reported in 1993 (310 cases) and in 1997 (358 cases) characterized by mucocutaneous, papulovesicular rash and self-limiting febrile illness (Ministry of the Environment, Singapore, personal communication). EV71 infection was reported in 23 patients in 1997 and 16 patients in 1998, who were suffering mainly from HFMD, myocarditis, coxsackielike disease, hyperpyrexia, meningoencephalitis and/or acute flaccid paralysis. HFMD mainly affects children aged 6 months to 3 years, although some cases of infection in adults aged 24 – 36 years have been reported. So far, only one case of acute flaccid paralysis in a child was reported. Analyses of EV71 strains at the molecular level could help to explain the varied clinical patterns observed for EV71 disease, e.g. HFMD in China, Japan and Singapore, and HFMD with CNS involvement in USA, Australia, Eastern Europe and recently in Taiwan and Malaysia (Komatsu et al., 1999). EV71 possesses a single-stranded RNA genome of approximately 7500 nucleotides of positive polarity, and belongs to the genus of enteroviruses from the family Picornaviridae (Muir et al., 1998). The genome comprises a 5% untranslated region (5% UTR), a long open reading frame that encodes a protein of approximately 2100 amino acid residues, a short 3% untranslated region (3% UTR) and a polyadenylated tail. The polyprotein is co- and post-translationally cleaved to give
four structural proteins VP4, VP2, VP3 and VP1. Determination of attenuation of virulence, altered host range, persistent infection and in vitro cell tropism have all been mapped to the capsid-encoding region (Muir et al., 1998). The capsid region comprising VP1 and VP4 of coxsackievirus B4 is known to encode virulence determinants (Caggana et al., 1993). However, little is known about the virulence determinants of EV71. Comparison of the nucleotide and amino acid sequences of the non-neurovirulent EV71 strains isolated in Singapore with neurovirulent strains isolated elsewhere may reveal the pathogenic determinants. In view of the time-consuming and laborious technique of virus isolation, the limited supply of EV71-specific antisera for serotyping, and the alarming outbreaks of EV71-related diseases especially in East Asia, a rapid and precise method to identify EV71 is required urgently. Reverse transcription-polymerase chain reaction (RTPCR) is an attractive diagnostic tool particularly during outbreaks given that results can be obtained within hours, and that serologically untypable strains may even be detected. It is known that the specific epitopes responsible for serotypic specificity are clustered mainly in the VP1 region. In a recent study by Oberste et al. (1999), VP1 sequences were shown to have a better correlation with enterovirus serotypes compared to those of the 5% UTR or the VP4-VP2 junction. Thus, PCR primers designed from the VP1 region should correlate better with serotypic identification. We describe here the application of newlydesigned and highly-specific primers for RT-PCR amplification and direct cycle sequencing of EV71 strains to illustrate the genetic relationships and molecular evolution of EV71 strains from Asia.
2. Material and methods
2.1. Sample collection Cultured strains of EV71 and other enteroviruses were isolated by the Virology Laboratory, Pathology Department, Singapore General Hospital. A total of 44 EV71 samples and 30
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
other enteroviruses including coxsackievirus types A and B, echoviruses as well as serologically untypable strains were studied (Table 1). These viruses were isolated from sputum, throat swab, stool, nasal aspirate, rectal swab and vesicular fluid specimens of patients suffering from HFMD and/or other clinical symptoms. All the samples were inoculated into HeLa, HEp-2, RD and MRC-5 cell lines, and the virus isolates were typed by the microneutralization method using the Lim Benyesh-Melnick (LBM) antisera pool or the alternating intersecting pools developed at the National Institute of Public Health and the Environment in the Netherlands. The EV71-specific antiserum was from Light Diagnostics, Chemicon International, CA, USA. The viruses were harvested and stored at −70°C. The neurovirulent strain EV71/7423/MS/87 was a gift from Dr M.A. Pallansch, CDC, Atlanta, GA, USA. The cell cultures of EV71 strains from Malaysia and Japan were kindly provided by Professor S.K. Lam from the University of Malaya, Malaysia.
2.2. Primer design Two pairs of primers VP1F2/EV71R2 and EV71F4/EV71R5 were designed to amplify target fragments of 341 bp and 612 bp within the VP1 region and 5% UTR of EV71, respectively. As shown in Table 2, the first eight primers were also designed to amplify and/or sequence the capsid coding region (VP1, VP2, VP3, VP4) and part of the 5% UTR of two local EV71 strains.
2.3. RNA extraction and RT-PCR The virus-infected cells were lysed using the SDS-urea method, and RNA was purified using chloroform/isoamyl alcohol extraction followed by ethanol precipitation (Gough, 1988). The dried RNA pellet was reconstituted in sterile distilled water containing RNasin ribonuclease inhibitor (Promega, Madison, WI, USA) and stored at −70°C prior to use. The yield of RNA was determined by optical density measurements at 260 nm. Total RNA (2 – 5 mg) was mixed with 0.3 mg of random hexamer oligonucleotides (Life Technologies, Gaithersburg, MD, USA) and incu-
195
bated at 70°C for 10 min. To this reaction mixture was added first strand buffer, 0.01 M dithiothreitol, 0.5 mM of dNTP mix and 10 U of reverse transcriptase (Life Technologies) in a final volume of 20 ml. The RT reaction was incubated at 42°C for 50 min and heat inactivated at 70°C for 15 min. The cDNA was stored at –70°C and used as template for subsequent PCR experiments. With primer pairs EV7116F/EV7116R and EV71F4/EV71R4, long distance PCR catalyzed by KlenTaq2 polymerase with proof-reading activity (Clontech, Palo Alto, CA, USA), was employed to amplify the complete capsid coding region and part of the 5% UTR of Singapore EV71 strains 13/Sin/98 and 18/Sin/97. A 5 ml aliquot of the cDNA reaction product was added to the PCR mixture containing 1× PCR buffer, 0.2 mM each of the primers, 0.2 mM dNTP mix and 0.4 U of KlenTaq2 polymerase in a total reaction volume of 50 ml. The EV71 specificity of the primer pairs VP1F2/EV71R2 and EV71F4/EV71R5 were tested on the enteroviral cDNA samples using AmpliTaq DNA polymerase (Roche Molecular Systems, Branchburg, NJ, USA). A 5 ml aliquot of each cDNA template was used in a total reaction volume of 50 ml containing 1× PCR buffer, 0.2 mM dNTP mix, 0.2 mM each of forward and reverse primers, and 2.5 U of AmpliTaq polymerase. PCR was carried out at an initial 95°C for 1 min, followed by 30 cycles of 95°C for 30 s, 55°C for 30 s and 68°C for 3 min. The primer pair VP1F2/EV71R2 that was found to be specific only for EV71 was then used to amplify all the cDNA samples using KlenTaq DNA polymerase. The PCR products (10 ml each) were subjected to electrophoresis in a 1.6% agarose gel, with a 100 bp DNA ladder (New England Biolabs, Beverly, MA, USA) serving as a molecular mass marker. Tissue culture infective dose (TCID50) of the 7423/MS strain was derived using the microwell plate method and calculated by the formula of Reed and Muench (Lennette and Schmidt, 1969). The sensitivity of the RT-PCR assay was tested by amplifying tenfold serial dilutions of RNA extracted from the virus suspension of known TCID50.
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
196
Table 1 Enterovirus strains tested by RT-PCR Virus strainsa
No. of strains Clinical diagnosis
Enterovirus 71 strains MS/7423/87 Singapore/97
(total)
44
(18/Sin)
1 1
Singapore/97 Singapore/97
(36/Sin) (52/Sin, 53/Sin)
1 2
Singapore/97
(35/Sin, 37/Sin, 38/Sin, 39/Sin, 40/Sin, 41/Sin, 42/Sin, 43/Sin, 44/Sin, 17 48/Sin, 49/Sin, 51/Sin, 54/Sin, 55/Sin, 56/Sin, 57/Sin, 58/Sin) (26/Sin) 1 (11/Sin, 13/Sin, 14/Sin, 15/Sin, 16/Sin, 17/Sin, 20/Sin, 21/Sin, 22/Sin, 12 27/Sin, 30/Sin, 32/Sin) (23/Jap) 1 (47/Mal) 1 (45/Mal, 46/Mal) 2 (31/Mal) 1 (25/Mal, 28/Mal, 33/Mal, 34/Mal) 4
Singapore/98 Singapore/98 Osaka/98 Malaysia/97 Malaysia/97 Malaysia/98 Malaysia/98 Other Enteroviruses Coxsackievirus A16 Coxsackievirus A9 Coxsackievirus A9 Coxsackievirus B2 Coxsackievirus B2 Coxsackievirus B2 Coxsackievirus B3 Coxsackievirus B3 Coxsackievirus B5 Echovirus 3 Echovirus 3 Echovirus 6 Echovirus 6 Echovirus 7 Echovirus 20
Aseptic meningitis Acute flaccid paralysis Myocarditis Coxsackie-like disease HFMD Neonatal pyrexia HFMD – Meningoencephalitis Myocarditis Asymptomatic HFMD
(total)
30
(1/Sin, 2/Sin, 50/Sin, 72/Sin, 73/Sin)
5
HFMD
(74/Sin) (75/Sin) (6/Sin, 7/Sin, 70/Sin) (76/Sin) (77/Sin) (5/Sin) (78/Sin) (79/Sin) (60/Sin) (61/Sin) (62/Sin, 63/Sin) (3/Sin) (64/Sin, 65/Mal) (66/Mal)
1 1 3 1 1 1 1 1 1 1 2 1 1 1
Echovirus 25
(67/Sin)
1
Echovirus 30 Echovirus 30 Echovirus 33 Untypable Untypable
(68/Sin) (69/Sin) (71/Sin) (8/Sin) (9/Sin, 10/Sin)
1 1 1 1 2
HFMD Pyrexia HFMD Viral gastritis Pyrexia HFMD Contact Pyrexia Aseptic meningitis Coxsackie disease Pyrexia HFMD Viral encephalitis Acute flaccid paralysis Acute flaccid paralysis Viral meningitis Screening Meningitis Encephalitis HFMD
a Strains were assigned by the year of isolation, internal lab identifier and the country of origin, i.e., Singapore (Sin), Malaysia (Mal) and Japan (Jap). Strain 47/Mal was isolated from a brain tissue sample of a patient with meningoencephalitis, while strain 18/Sin was from a stool sample of a patient with acute flaccid paralysis.
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
197
Table 2 Oligonucleotide primers for RT-PCR and cycle sequencing of enterovirus 71 Primer (orientation)
Sequence (5%–3%)
Gene/region
Nucleotide positions
Application(s)
EV7116F (+) EV7116R (−) EV71F2 (+) EV71R2 (−) EV71F3 (+) EV71R3 (−) EV71F4 (+) EV71R4 (−) VP1F2 (+) EV71R5 (−)
CCATATAGCTATTGGATTGG GAAAAACTGACTGGATAGTG TACAAAGACTCTTATGCTGC TTGACAAAAACTGAGGGGTT GCAGGCGGCACAGGAACAGA GTGAAATTCTTTTGGGCTGCCG TTAAAACAGCTGTGGGTTG GCAGCATAAGAGTCTTTGTA GTTCTTAACTCACATAGCA AATTCTGTAATTGTCACCATA
5% UTR 2A VP4 VP1 VP2 VP3 5% UTR VP4 VP1 5% UTR
617–636 3562–3543 843–862 2986–2967 1359–1378 2389–2368 1–20 862–843 2646–2664 612–592
PCR/SEQ PCR/SEQ SEQ PCR/SEQ SEQ SEQ PCR/SEQ PCR/SEQ PCR/SEQ PCR
2.4. DNA sequence analysis To generate clean templates for DNA sequencing, PCR was repeated with KlenTaq polymerase, specific DNA bands were excised from the gel, eluted and purified using a DNA gel extraction kit (Qiagen, Germany). Purified PCR products were cycle-sequenced in both directions using the ABI PRISM BigDye Terminator cycle sequencing ready reaction kit (PE Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using the ABI PRISM 377 DNA Sequencer (PE Applied Biosystems). The DNASIS analysis software was used for conversion between RNA and DNA sequences, and for alignment. Predicted amino acid sequences were derived by translating nucleotide sequences using the ORF Finder (NCBI). The sequence data of our EV71 samples have been deposited with the GenBank database. Each batch of PCRs included a known positive control together with a ‘no DNA’ negative control to exclude the possibility of false positive reaction due to reagent contamination. PCR was also carried out with RNA extracted from uninfected RD cells to exclude non-specific results. All PCRs were repeated to exclude false positive results arising from cross contamination. Homology searches were carried out using the BLAST algorithm (http://www.ncbi.nlm.nih.gov/ BLAST). The percentage of sequence identity was calculated with the Blast 2 sequences programme (NCBI) that produces alignment of two given
sequences using the BLAST engine for local alignment (Tatusova and Madden, 1999). The phylogenetic pattern of the South East Asian strains of EV71 was studied on the basis of the tree constructed from the 341-bp VP1 fragments flanked by specific primers. Multiple alignments and dendrograms were constructed using the TREECON programme, version 1.3b (Van de Peer and De Wachter, 1993). The genogroups were generated by the neighbour joining method rooted to the 7423/MS strain. The branched lengths were determined by the maximum likelihood method and the reliability of the neighbour joining method was estimated by bootstrap analysis of 1000 pseudoreplicate datasets using SEQBOOT analysis. Hydropathic profiles of the predicted proteins of strains 13/Sin/98 and 18/Sin/97 were plotted by the method of Kyte and Doolittle (1982).
3. Results
3.1. Specificity and sensiti6ity of RT-PCR assay Using primers VP1F2 and EV71R2, RT-PCR generated target bands of 341 bp (Fig. 1) for the neurovirulent strain 7423/MS as well as for 1, 8 and 34 EV71 strains from Japan, Malaysia and Singapore, respectively. None of the other enterovirus types that served as negative controls were amplified by RT-PCR with these primers. The RT-PCR results correlated well with the serotyping data by neutralization assay, thus em-
198
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
phasizing the high specificity of these primers for EV71. However, RT-PCR with primers EV71F4 and EV71R5 (Table 2) did not correlate well with serotyping. The TCID50 of the 7423/MS strain was found to be 106.5 per inoculum volume of 0.025 ml. RT-PCR could amplify a minimum equivalent of 101.5 or approximately 10 virus-infected cells per inoculum volume as shown in Fig. 1, thereby substantiating the sensitivity of RT-PCR with the primers and the potential applicability for detecting low virus titres in clinical specimens.
3.2. Nucleotide and amino acid sequence analysis of two local EV71 strains Using primers EV7116F and EV7116R (Table 2), a 2.9 kb fragment was amplified from each of the two Singapore EV71 strains (Fig. 1). Strain 13/Sin/98 was isolated from a case of HFMD, while strain 18/Sin/97 originated from a female infant with acute flaccid paralysis. These EV71 strains were then sequenced and compared with known virulent strains isolated elsewhere via computational analysis of nucleotide and amino acid sequences, and to yield accurate sequence information for designing specific primers based on highly conserved regions within the VP1 gene. Strains 13/Sin/98 and 18/Sin/97 showed 95% nucleotide identity to each other, reaching as high as
96% in the 5% UTR. The nucleotide sequences of these strains showed 92% identity to the neurovirulent strain EV71/7423/MS/87, first isolated from a Mississippi boy with paralysis in 1987 (Brown and Pallansch, 1995). Similarities to the nucleotide sequences of the other EV71 strains (in the GenBank database) including the prototype EV71/BrCr strain were found to be less than 85%. Comparison of the amino acid sequences of strain 13/Sin/98, 18/Sin/97 with 7423/MS and BrCr prototype strains revealed 100% identity of the VP4 region (Fig. 2). Within the VP2 region, there were two variable sites, i.e. residue 197 (serine in 13/Sin/98 but proline in 18/Sin/97, 7423/MS and BrCr strains) and residue 315 (where glycine in 7423/MS was replaced by alanine in both local strains and the BrCr strain). There were additional amino acid disparities in the BrCr strain at positions 114, 163, 195 and 212. In the VP3 region, leucine at residue 329 (in 7423/MS and BrCr) and at residue 538 (in 7423/MS alone) was conservatively substituted with proline (329) in the local strains, and with isoleucine (538) in the local strains as well as the BrCr strain, respectively. Histidine at position 557 of 7423/MS and 13/Sin/98 was replaced by arginine in strain 18/Sin/97 and by aspartic acid in BrCr. A comparison between BrCr and the other three strains revealed that glutamic acid replaced glutamine at position 560, and threonine substituted serine at position 563.
Fig. 1. Visualization of RT-PCR products of enterovirus 71 by gel electrophoresis. A 100 bp DNA ladder molecular mass marker was included in lane M. Lanes 1 and 2 represent RT-PCR-amplified 2.9-kb fragments of 13/Sin/98 and 18/Sin/97, respectively. Lanes 3 and 4 represent RT-PCR-positive 341-bp fragments of 13/Sin/98 and 18/Sin/97, respectively. Lanes 5 to 11 represent RT-PCR products of neat and of ten-fold serial dilutions of EV71/7423/MS strain (with TCID50 of 106.5 per 0.025 ml of inoculum), i.e. neat, 10 − 1, 10 − 2, 10 − 3, 10 − 4, 10 − 5 and 10 − 6, respectively. No product was visible at 10 − 6 dilution (lane 11). Lanes 12 to 15 represent RT-PCR-negative results of CA16, CB2, echo 7 and untypable strains, respectively. RT-PCR of RNA from uninfected RD cells (lane 16) and a ‘‘no DNA’’ sample (lane 17) served as negative controls.
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
199
MS and BrCr strains demonstrated numerous disparities, including at residues 583, 587, 595, 596, 608, 623, 663, 710, 729, 732, 737, 748, 749, 802, 809, 811, 814, 840, 847 and 857. The results showed that the VP4 region displayed complete homology among the prototype BrCr, the neurovirulent 7423/MS and the two local strains. Relatively few mutations were noted in the VP2 and VP3 regions, whereas the VP1 region showed the greatest variation.
3.3. Analysis of the VP1 target region flanked by EV71 -specific primers Twenty out of the 44 PCR products amplified by EV71-specific primers were randomly selected and sequenced, i.e. 13 Singapore, one Japanese and six Malaysian strains (Fig. 3). Nucleotide sequences of the strains showed 91–93% homology to the bases coding for the VP1 region of the 7423/MS strain. The predicted amino acid sequences showed almost complete homology to the 7423/MS strain except at position 663 where glutamic acid was replaced with lysine in five strains, and at position 710 where glutamic acid was substituted by glutamine in five strains and by glycine in another strain. In addition, tryptophan at position 736 was replaced by glycine in 34/Mal/98. The corresponding amino acid sequences of nine strains were completely identical to those of the 7423/MS strain.
3.4. Phylogenetic analysis
Fig. 2. Comparison of predicted amino acid sequences of Singapore EV71 strains 13/Sin/98 and 18/Sin/97 (GenBank accession numbers AF251358 and AF251359) with those of strains BrCr and 7423/MS. Residues 1-926 of the four strains are aligned, with disparities highlighted in bold letters. Asterisks denote identity, colons indicate conserved residues while periods depict variable regions.
Interestingly, comparative analysis of the VP1 amino acid sequences of the two Singapore, 7423/
A phylogenetic tree was constructed based on the nucleotide sequences of the 341-bp VP1 fragments of selected strains studied by Brown et al. (1999), as well as those of Asian strains sequenced by us and those available in the GenBank database. These include the prototype BrCr, neurovirulent 7423/MS, 13 Singapore, 30 Malaysian, 31 Taiwanese, one Republic of China, one Japanese and ten Australian strains. The G10 strain of coxsackievirus A16 was included as an outgroup. The dendrogram revealed five distinct genotypes (Fig. 4). The genotypes A, B and C were
200
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
classified as proposed by Brown et al. (1999). The prototype strain BrCr was the sole member of genotype A. The neurovirulent strain 7423/MS, two Taiwanese strains and five Australian strains represented genotype B. Strains of this group (other than 7423/MS itself) showed 93 – 94% identity to the 7423/MS strain. Sixteen Taiwanese strains, five Australian, one Malaysian and one Chinese strain
Fig. 4. Dendrogram based on nucleotide divergence of the 341-bp VP1 gene fragments of Asian strains of EV71. The strains available in the GenBank are each indicated by their accession number followed by country and year of isolation.
Fig. 3. Alignment of representative VP1 nucleotide sequences of EV71 strains. Strains 13/Sin/98, 15/Sin/98, 16/Sin/98, 20/ Sin/98, 26/Sin/98 and 27/Sin/98 differed only by 9 bases and are exemplified by strain 26/Sin/98. Similarly, strains 28/Mal/ 98, 33/Mal/98 and 34/Mal/98 differed only by two bases and are represented by 28/Mal/98. Strains 18/Sin/97, 56/Sin/97 and 57/Sin/97 differed by 11 bases and are represented singly by strain 18/Sin/97. Strains 36/Sin/97 and 58/Sin/97 were different only by two bases and are represented by 36/Sin/97. Asterisks denote identity. The nucleotide sequences of these strains have been deposited in GenBank under accession numbers AF251223-AF251236 and AF251802-251805.
together represented genotype C which showed 81–83% homology to the 7423/MS strain. This study revealed two new genogroups designated D and E. Genotype D constituted the biggest cluster in this study, including all the strains from Singapore and Malaysia, except one Malaysian strain belonging to genogroup C. One strain each from Taiwan and Japan were also included in genogroup D. Strains in genogroup D showed 92–93% nucleotide identity with the 7423/MS strain. Twelve Taiwanese strains were all distinct and included in a separate genotype designated E. The strains of this group had less significant homology to the 7423/MS strain than the homology of 85–87% to the coxsackievirus A16 strain. The genotypes B, C, D and E could be further subdivided into clusters within each genotype.
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
As additional confirmation, a dendrogram generated based on 891 nucleotides of the entire VP1 region of the Singapore strains 13/Sin/98 and 18/Sin/97, together with selected strains reported by Brown et al. (1999), failed to group these two local strains into any of the three genotypes, thus reiterating that they were distinct, belonging to an entirely new genotype D.
4. Discussion The classical detection of EV71 is by virus isolation via cell culture followed by microneutralization tests (Muir et al., 1998). The culture and identification of EV71 is an intensive and time-consuming process requiring 2 – 3 weeks, often hindered by slow progression of cytopathic effects and viral aggregation (Rotbart et al., 1994; Muir et al., 1998). Reliance on such conventional typing schemes during large outbreaks would impede the implementation of control measures, and delay medical treatment options. Many patients with EV71-related hyperpyrexia, myocarditis and encephalitis are unnecessarily treated with antibiotics, antiherpes drugs or both while awaiting culture results to exclude bacterial or herpetic infections. Furthermore, the limited supply of EV71-specific antisera for neutralization tests could have serious implications during outbreaks. In emergency outbreak situations, a rapid and reliable typing method would justify the isolation of patients for quarantine purposes and the initiation of prompt preventive measures, especially in institutions associated with children. Availability of a rapid typing method would also facilitate decision-making regarding the administration of specific immunoglobins to selected high-risk patients. Rapid diagnosis is of relevance given the possibility of therapeutic intervention with new anti-enteroviral agents such as pleconaril (Pevear et al., 1999). The failure to identify EV71 by the neutralization method has been observed in many laboratories, and is of concern especially with regard to poliomyelitis eradication (Muir et al., 1998; Van Loon et al., 1999). Since EV71 may mimic the acute flaccid paralysis of polio, such patients may
201
be suspected to harbour polioviruses. EV71 is found to be more difficult than the other enteroviruses to be recognized serotypically, and may require treatment with chloroform for optimal serotyping (Van Loon et al., 1999). EV71 replicates poorly in most cell cultures, no single line currently supports the propagation of all strains, and specific antiserum is not widely available (Alexander et al., 1994; Van Loon et al., 1999). The use of virus isolation and serotyping might therefore be expected to decrease in favour of RT-PCR for the rapid diagnosis of enterovirus infections. For facilitating early detection of circulating enterovirus types, particularly for patients with aseptic meningitis, RT-PCR constitutes a markedly more sensitive and specific molecular typing scheme. For the direct detection of EV71 in clinical samples, this two-step RT-PCR could be easily improved upon by adopting a more convenient single-step RT-PCR method, coupled with the use of rapid commercial RNA extraction kits. To illustrate this, we extracted RNA from ten random samples using the Oligotex direct RNA extraction kit (Qiagen), and obtained convincing RT-PCR results (data not shown). Such modifications can enhance the rapidity and simplicity of the RT-PCR protocol. The results obtained have correlated well with the neutralization assay. Because of the practical problems associated with cell cultures, molecular typing by RT-PCR and sequencing offers a promising approach for differentiating clinical isolates of EV71 from other enteroviruses. Using a specific primer pair designed for EV71 in this study, the correlation between serotyping, RT-PCR amplification and cycle sequencing results showed that this primer pair was sufficient for amplification and sequencing of the partial VP1 region from all the 44 EV71 strains isolated from various geographic locations. PCR coupled with sequence analyses of other viruses have been reported, e.g., for identification of adenoviruses in conjuctival scrapings (Takeuchi et al., 1999) and dengue viruses in serum samples (Seah et al., 1995a,b). It is essential to understand the epidemiology of EV71 infection to monitor the emergence of new
202
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
strains and to facilitate early rapid detection of co-circulating strains during outbreak periods. Carefully optimized PCR assays are at least as sensitive as cell culture, while their accessory sequence data can elucidate biological information not obtainable by serotyping methods (Muir et al., 1998). Similar molecular detection schemes have been developed for typing enteroviruses causing aseptic meningitis where the VP1 sequences correlated with the serotypes (Oberste et al., 1999). More extensive sequencing studies will define the limits of diversity and provide a basis for improving molecular techniques of strain identification. The phylogenetic analysis of EV71 strains aids the study of their molecular evolution and their genetic relationships with strains from different outbreaks. In an earlier investigation undertaken by Brown et al. (1999), only three EV71 isolates from Asia (two from Malaysia and one from Republic of China) were studied. In our study, we have also included strains from Taiwan, Singapore and Japan. For routine molecular diagnostic and typing purposes, sequencing of the 341 bases of the VP1 region revealed sufficient data to differentiate the various EV71 strains from Asia. It was observed that some strains clustered in patterns similar to those generated by Brown et al. (1999) based on the complete VP1 region, e.g., US strains were mainly clustered in the major genogroups B and C. In their study, the Malaysian strain 0731-MAA-97 (GenBank accession no. AF135911), was observed to be related to but distinct from strains of genogroup B, and would hence justify its inclusion in a completely new genotype designated D together with the other strains from Singapore and Malaysia. Our study thus revealed a new genotype D, which represented all the strains isolated from Singapore, Japan and Malaysia except for strain 0756MAA-97 (GenBank accession no. AF135935) which was placed in genogroup C. It was also observed that there were two major co-circulating genotypes of Taiwanese strains. The Taiwanese strains belonging to genotype C were similar to the 7423/MS strain, while those of genotype E exhibited greater similarity to coxsackievirus A16. A few Taiwanese strains were also observed to
belong to genotypes B and D, thus emphasizing the genetic diversity of Taiwanese strains (Ho et al., 1999). The results clearly demonstrate the variability of EV71 genomic patterns in different geographical locations. It is noteworthy that although the strains from Singapore were isolated around the same period as those causing the outbreak in Taiwan, they displayed considerable molecular diversity and clinical patterns. The local strains showed no tendency towards neurovirulence except for a single case of mild paresis. These were totally new strains prevalent in Singapore, mainly causing hand, foot and mouth disease. Other environmental and host factors such as age, nutrition, genetic constitution, pre-existing immunity may contribute to the pathogenicity of EV71, culminating in varying clinical expressions. The outer capsid proteins displayed highest variation within and between the phylogenetic clusters, implying that evolution is more conspicuous in the VP1, VP2 and VP3 regions. Enteroviruses generally exhibit a high degree of heterogeneity due to the relatively higher rate of nucleotide misincorporation during viral RNA replication occurring both in vitro and in vivo (Muir et al., 1998). Chimeric constructs are helpful for substantiating an association of these regions with virulence determination. To elucidate the molecular basis of virulence, a panel of recombinant chimeric viruses can be constructed from virulent and non-virulent strains to ascertain their in vitro translatory effects in pathogenicity. Specific mutations thus identified can be analyzed for their role in inhibiting neurovirulence, enabling the mapping of the genetic determinants of virulence. Analysis of individual mutations in both VP1 and VP2 regions revealed that a single residue determined the virulent phenotype in coxsackievirus B4 (Ramsingh et al., 1992; Caggana et al., 1993; Ramsingh and Collins, 1995). Previous studies also identified five amino acid substitutions within the VP1, VP2 and VP4 capsid proteins of the virulent coxsackievirus B4, and the presence of major T-cell epitopes on VP3 of Theiler’s virus in demyelination –susceptible SJL/J mice (Yauch et al., 1995).
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
It has been observed that the surfaces of rhinoviruses and polioviruses contain a series of remarkably deep crevices forming the so-called ‘canyon’, which is formed roughly at the junction of VP1 with VP2 and VP3. Occurring around each 5-fold vortex in human rhinovirus (HRV), the canyon is the site of receptor attachment. It also represents a strategy for the viruses to escape the host’s immune surveillance by protecting the receptor attachment site in a surface depression (Rossmann, 1994). The amino acid residues lining the canyon are significantly more conserved than other surface-exposed residues (Chapman and Rossmann, 1993). Site-directed mutagenesis of HRV14 indicated that modification of several amino acid residues located in the base of the canyon affects virus-receptor affinity (Colonno et al., 1988). Furthermore, Wien et al. (1997) have demonstrated a range of structural consequences arising from poliovirus receptor mutations involving VP2 residue 142 and VP1 residues 95, 158, 160, 166, 226, 228, 239 and 241. Intriguingly, the corresponding amino acids were conserved in the two Singapore (13/Sin/98 and 18/Sin/97), 7423/ MS and BrCr strains of EV71. Notwithstanding this, the residues that showed variations between these four strains (some of which resided in hydrophobic regions) may influence the canyon structure and thus virus-receptor attachment. Comparison of the conformational structures of the canyons of these strains as predicted by computer-aided modelling could provide clues on their virus-receptor affinity and other properties. The availability of EV71 sequence data will enable plasmid constructs incorporating the 5% UTR and the various capsid coding regions to be targeted as candidates for DNA vaccines against the neurovirulent enterovirus strains, as well as validating their ability to express the desired proteins and to elicit antibodies against them. Immunodominant epitopes of Theiler’s murine encephalomyelitis viruses have been localized to the capsid proteins VP1, VP2 and VP3 (Yauch et al., 1995). Mice have been protected against lethal coxsackievirus B3 infection by DNA immunization using cDNA constructs of capsid protein (Henke et al., 1998).
203
Thus, the rapid identification of EV71 through RT-PCR and direct sequencing of PCR amplicons will help to elucidate the genotypes involved in an outbreak and enable prompt implementation of measures that will minimize further transmission of viruses. The data will also aid in the long-term goal of developing a DNA vaccine effective against EV71 in view of its recent association with alarming outbreaks of severe neurological diseases.
Acknowledgements We are grateful to M.C. Phoon and S.K. Tay for their excellent technical assistance and to M. Sakharkar for biocomputing advice. Our sincere thanks to Dr M.A. Pallansch and Professor S.K. Lam for providing some EV71 strains for our study.
References AbuBakar, S., Chee, H.Y., Al-Kobaisi, M.F., et al., 1999. Identification of enterovirus 71 isolates from an outbreak of hand, foot and mouth disease (HFMD) with fatal cases of encephalomyelitis in Malaysia. Virus Res. 61, 1 – 9. Alexander, J.P., Baden, L., Pallansch, M.A., Anderson, L.J., 1994. Enterovirus 71 infection and neurologic diseaseUnited States, 1977 – 1991. J. Infect. Dis. 169, 905 – 908. Brown, B.A., Pallansch, M.A., 1995. Complete nucleotide sequence of enterovirus 71 is distinct from poliovirus. Virus Res. 39, 195 – 205. Brown, B.A., Oberste, M.S., Alexander, J.P., Kennett, M.L., Pallansch, M.A., 1999. Molecular epidemiology and evolution of enterovirus 71 strains isolated from 1970 to 1998. J. Virol. 73, 9969 – 9975. Caggana, M., Chan, P., Ramsingh, A., 1993. Identification of a single amino acid residue in the capsid protein VP1 of coxsackievirus B4 that determines the virulent phenotype. J. Virol. 67, 4797 – 4803. Chapman, M.S., Rossmann, M.G., 1993. Comparison of surface properties of picornaviruses: strategies for hiding the receptor site from immune surveillance. Virology 195, 745 – 756. Colonno, R.J., Condra, J.H., Mizutani, S., et al., 1988. Evidence for the direct involvement of the rhinovirus canyon in receptor binding. Proc. Natl. Acad. Sci. USA 85, 5449 – 5453. Gough, N.M., 1988. Rapid and quantitative preparation of cytoplasmic RNA from small numbers of cells. Anal. Biochem. 173, 93 – 95.
204
S. Singh et al. / Journal of Virological Methods 88 (2000) 193–204
Henke, A., Wagner, E., Whitton, J.L., Zell, R., Stelzner, A., 1998. Protection of mice against lethal coxsackievirus B3 infection by using DNA immunization. J. Virol. 72, 8327– 8331. Ho, M., Chen, E.R., Hsu, K.H., et al., 1999. An epidemic of enterovirus 71 infection in Taiwan. N. Engl. J. Med. 341, 929 – 935. Komatsu, H., Shimizu, Y., Takeuchi, Y., Ishiko, H., Takada, H., 1999. Outbreak of severe neurologic involvement associated with enterovirus 71 infection. Pediatr. Neurol. 20, 17– 23. Kyte, J., Doolittle, R.F., 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157, 105 – 132. Lennette, E.H., Schmidt, N.J., 1969. Diagnostic Procedures for Viral and Rickettsial Infections. American Public Health Association, New York, pp. 116–117. Lum, L.C.S., Wong, K.T., Lam, S.K., et al., 1998. Fatal enterovirus 71 encephalomyelitis. J. Pediatr. 133, 795–798. Muir, P., Kammerer, U., Korn, K., et al., 1998. Molecular typing of enteroviruses: current status and future requirements. Clin. Microbiol. Rev. 11, 202–227. Oberste, M.S., Maher, K., Kilpatrick, D.R., et al., 1999. Typing of human enteroviruses by partial sequencing of VP1. J. Clin. Microbiol. 37, 1288–1293. Pevear, D.C., Tull, T.M., Seipel, M.E., Groarke, J.M., 1999. Activity of pleconaril against enteroviruses. Antimicrob. Agents Chemother. 43, 2109–2115. Ramsingh, A., Araki, H., Bryant, S., Hixson, A., 1992. Identification of candidate sequences that determine virulence in coxsackievirus B4. Virus Res. 23, 281–292. Ramsingh, A.I., Collins, D.N., 1995. A point mutation in the VP4 coding sequence of coxsackievirus B4 influences virulence. J. Virol. 69, 7278–7281. Rossmann, M.G., 1994. Viral cell recognition and entry. Protein Sci. 3, 1712 – 1725.
Rotbart, H.A., Sawyer, M.H., Fast, S., et al., 1994. Diagnosis of enteroviral meningitis by using PCR with a colorimetric microwell detection assay. J. Clin. Microbiol. 32, 2590 – 2592. Seah, C.L.K., Chow, V.T.K., Tan, H.C., Chan, Y.C., 1995a. Rapid single-step RT-PCR typing of dengue viruses using five NS3 gene primers. J. Virol. Methods 51, 193 – 200. Seah, C.L.K., Chow, V.T.K., Chan, Y.C., 1995b. Semi-nested PCR using NS3 primers for the detection and typing of dengue viruses in clinical serum specimens. Clin. Diagn. Virol. 4, 113 – 120. Takeuchi, S., Itoh, N., Uchio, E., Aoki, K., Ohno, S., 1999. Serotyping of adenoviruses on conjunctival scrapings by PCR and sequence analysis. J. Clin. Microbiol. 37, 1839 – 1845. Tatusova, T.A., Madden, T.L., 1999. Blast 2 sequences — a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174, 247 – 250. Van de Peer, Y., De Wachter, R., 1993. TREECON: a software package for the construction and drawing of evolutionary trees. Comput. Appl. Biosci. 9, 177 – 182. Van Loon, A.M., Cleator, G.C., Ras, A., 1999. External quality assessment of enterovirus detection and typing. Bull. World Health Org. 77, 217 – 223. Wien, M.W., Curry, S., Filman, D.J., Hogle, J.M., 1997. Structural studies of poliovirus mutants that overcome receptor defects. Nat. Struct. Biol. 4, 666 – 674. Yauch, R.L., Kerekes, K., Saujani, K., Kim, B.S., 1995. Identification of a major T-cell epitope within VP3 amino acid residues 24 to 37 of Theiler’s virus in demyelinationsusceptible SJL/J mice. J. Virol. 69, 7315 – 7318. Zheng, Z.M., He, P.J., Caueffield, D., et al., 1995. Enterovirus 71 isolated from China is serologically similar to the prototype E71 BrCr strain but differs in the 5%-noncoding region. J. Med. Virol. 47, 161 – 167.
.