S-adenosylhomocysteine (AdoHcy)-dependent methyltransferase inhibitor DZNep overcomes breast cancer tamoxifen resistance via induction of NSD2 degradation and suppression of NSD2-driven redox homeostasis

Journal Pre-proof S-adenosylhomocysteine (AdoHcy)-dependent methyltransferase inhibitor DZNep overcomes breast cancer tamoxifen resistance via induction of NSD2 degradation and suppression of NSD2-driven redox homeostasis Qianqian Wang, Jianwei Zheng, June X. Zou, Jianzhen Xu, Fanghai Han, Songtao Xiang, Peiqing Liu, Hong-Wu Chen, Junjian Wang PII:

S0009-2797(19)31682-5

DOI:

https://doi.org/10.1016/j.cbi.2020.108965

Reference:

CBI 108965

To appear in:

Chemico-Biological Interactions

Received Date: 24 October 2019 Revised Date:

17 January 2020

Accepted Date: 24 January 2020

Please cite this article as: Q. Wang, J. Zheng, J.X. Zou, J. Xu, F. Han, S. Xiang, P. Liu, H.-W. Chen, J. Wang, S-adenosylhomocysteine (AdoHcy)-dependent methyltransferase inhibitor DZNep overcomes breast cancer tamoxifen resistance via induction of NSD2 degradation and suppression of NSD2driven redox homeostasis, Chemico-Biological Interactions (2020), doi: https://doi.org/10.1016/ j.cbi.2020.108965. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2020 Published by Elsevier B.V.

Author statment Junjian wang, Hong-Wu Chen and June X. Zou conceived and initiated the research. Qianqian Wang, Jianwei Zhen and Junjian Wang performed the experiments. Jianzhen Xu, Fanghai Han and Songtao Xiang analyzed the data. Junjian Wang, Peiqing Liu and Hong-Wu Chen wrote and/or edited the manuscript.

S-adenosylhomocysteine

(AdoHcy)-dependent

methyltransferase

inhibitor

DZNep overcomes breast cancer tamoxifen resistance via induction of NSD2 degradation and suppression of NSD2-driven redox homeostasis. Qianqian Wanga, 1, Jianwei Zhenga, 1, June X. Zoub, c, Jianzhen Xud, Fanghai Hane, Songtao Xiangf, Peiqing Liua, g, Hong-Wu Chenb, c*, Junjian Wanga, g*

a

Guangdong Provincial Key Laboratory of New Drug Design and Evaluation, School

of Pharmaceutical Sciences, Sun Yat-sen University, Guangzhou, Guangdong, 510006, PR China b

Department of Biochemistry and Molecular Medicine, University of California,

Davis, School of Medicine, Sacramento, CA, USA. c

Comprehensive Cancer Center, University of California, Davis, Sacramento, CA,

USA. d

Shantou University Medical College, No. 22 Xinling Road, Shantou, China.

e

Department of Gastrointestinal Surgery, Sun Yat-sen Memorial Hospital, Sun Yat-sen

University, Guangzhou, Guangdong 510120, P.R. China f

Department of Urology, The Second Affiliated Hospital of Guangzhou University of

Chinese Medicine, Guangzhou, Guangdong, 510120, PR China g

National-Local Joint Engineering Laboratory of Druggability and New Drugs

Evaluation, Sun Yat-sen University, Guangzhou, Guangdong, 510006, PR China

*

Correspondence: [email protected] or [email protected]

1

These authors contribute equally to this study.

Abstract Endocrine therapies (e.g. tamoxifen and aromatase inhibitors) targeting estrogen action are effective in decreasing mortality of breast cancer. However, their efficacy is limited by intrinsic and acquired resistance. Our previous study demonstrated that overexpression of a histone methyltransferase NSD2 drives tamoxifen resistance in breast cancer cells and that NSD2 is a potential biomarker of tamoxifen resistant breast cancer. Here, we found that DZNep, an indirect inhibitor of histone methyltransferases, potently induces the degradation of NSD2 protein and inhibits the expression of NSD2 target genes (HK2, G6PD, GLUT1 and TIGAR) involved in the pentose phosphate pathway (PPP). DZNep treatment of tamoxifen-resistant breast cancer cells and xenograft tumors also strongly inhibits tumor growth and the cancer cell survival through decreasing cell production of NADPH and glutathione (GSH) and invoking elevated ROS to cause apoptosis. These findings suggest that DZNep-like agents can be developed to target NSD2 histone methyltransferase for effective treatment of tamoxifen-resistant breast cancer. Keywords: DZNep, Tamoxifen resistance, Breast cancer, NSD2

1. Introduction Breast cancer is a malignant tumor with high morbidity and mortality in women worldwide [1]. About 70% of breast cancer is classified as estrogen receptors (ER)-positive breast cancer [2]. Reducing estrogen action and production, such as tamoxifen and aromatase inhibitors [3], has been a main endocrine therapy strategy for breast cancer. Moreover, tamoxifen, the selective estrogen receptor modulator (SERM), is the most commonly used drug to reduce the breast cancer patients mortality, but intrinsic and acquired resistance limits its use [4]. Although there are several mechanisms to illustrate how resistance arises [4], including aberrantly expresses ERα, alters expression of ERβ or alterations in co-regulatory proteins and pharmacologic tolerance, tamoxifen therapeutic resistance is still an urgent problem clinically. NSD2 also known as MMSET or WHSC1, is a member of the nuclear receptor-binding SET domain (NSD) family of histone lysine methyltransferase that can dimethylate histone H3 at lysine 36 (H3K36me2) [5]. Previous studies showed that NSD2 is overexpressed in various tumor types, such as multiple myeloma, colorectal adenocarcinoma, glioblastoma and prostate cancer. NSD2 plays critical roles in control of cancer cell survival, proliferation, adhesion and epithelial– mesenchymal transition (EMT) through reprogramming cell epigenome and de-regulating gene expression [6-9]. It was reported that NSD2 can be recruited to the ERα target genes and facilitate their expression in breast cancer cells [10]. Our study demonstrated that NSD2 overexpression alone is sufficient to confer tamoxifen

resistance and is a strong predictive factor for early relapse of tamoxifen therapy[11]. Overexpression of NSD2 coordinately stimulated the expression and enzymatic activity of HK2 (hexokinase 2), TIGAR(a fructose-2,6-bisphosphate phosphatase) and G6PD (glucose-6-phosphate dehydrogenase) and strongly augmented the pentose phosphate pathway (PPP) production of NADPH for ROS reduction, and promoted the survival of tamoxifen treated cells and tumors [11]. However, due to the lack of potent NSD2 specific inhibitors, the effect of its pharmacological inhibition of NSD2 on cancer cells and tumors remained largely unknown. 3-deazaneplanocin A(DZNep), known as a S-adenosylhomocysteine (AdoHcy) hydrolase inhibitor, can indirectly inhibit S-adenosyl-methionine - dependent reactions, including histone methylation reactions [12]. DZNep was reported to inhibit survival of many types of cancer cells, including breast cancer cells, hepatocellular carcinoma cells, acute myelocytic leukemias and lung cancer cells [13-16]. Previous research demonstrated that DZNep inhibits PRC2 components EZH2 ,SUZ12 and histone H3 lysine 27 methylation (H3K27me3) [17]. However, recent studies discovered that DZNep is not a specific inhibitor of EZH2 or the generation of H3K27me3 histone mark [16, 18], suggesting that the mechanism of DZNep action may be broader than expected. In this study, we found that DZNep induces apoptosis in breast cancer TamR cells in vitro and inhibits tumor growth in vivo via suppressing NSD2 protein expression and function and through elevating cellular ROS levels, which provides pharmacological support for targeting NSD2 for cancer therapy. Furthermore, our

results suggest that DZNep is a promising agent for tamoxifen-resistant breast cancer therapy. 2. Materials and methods 2.1 Cell culture and chemicals MCF-7 TamR, MCF-7 LCC2 cells were cultured in phenol red-free medium supplemented with 10% charcoal-stripped calf serum. The MCF-7 TamR cells were generated as described previously [11]. The MCF-7 LCC subline cells were kindly supplied by Georgetown University’s Dr. Robert Clarke. Sources of chemicals are as follows: Tamoxifen from Sigma; 3-deazaneplanocin A (DZNep) HCL from Selleck Chem; GSK126 from GlaxoSmithKline PLC. 2.2 siRNAs and transfection Cells were transfected using Dharmafect1 (Dharmacon) for siRNA knockdown. siRNAs were purchased from RIBOBIO Biotech (Guangzhou China). The siRNA target sequences for each gene are as follows: siControl

CAGUCGCGUUUGCGACUGG

siNSD2#1

AGGGAUCGGAAGAGUCUUCAA

siNSD2#2

GCACGCUACAACACCAAGU

siEZH2#1

AAGAGGUUCAGACGAGCUGAU

siEZH2#2

AAGACUCUGAAUGCAGUUGCU

2.3 Cell viability, cell apoptosis, cell growth assays and cell colony formation Cell viability was measured by Cell-Titer GLO reagents (Promega) and cell

growth was monitored by counting cell numbers as previous described [19, 20]. Caspase-3/7 activity was examined by a caspase-Glo 3/7 assay kit (Promega corporation), following the manufacturer’s instructions. For cell colony formation, 500 cells were seeded in a well of the 6-well plate, and changed the medium every 3 days until the cell clone grew to indicated size, totally about 14 days. The cells were fixed with 4% paraformaldehyde for 15 min. Plates were then washed two times with PBS and stained with 0.2% crystal violet for 30 min. The numbers of cell colonies were counted after washes with PBS. The assays were performed in triplicate and the entire experiments were repeated three times. 2.4 Western blotting and qRT-PCR Western blotting and qRT-PCR was performed as described previously [19, 20]. For western blotting, all antibodies used in this study are as follows: NSD2(Abcam, ab75359(29D1)); EZH2(cell signaling; #4905); G6PD(Abcam, ab133525); HK2(cell signaling; #9542); TIGAR(Abcam, ab37910); GLUT1(Abcam; ab652); GAPDH(cell signaling;#2118); H3K36me2 (Active Motif; #39255);

H3K36me3(Abcam; ab9050);

H3K4me3(Millipore; 04-745); H3K27me3 (Abcam; ab6002);

H3K27ac (Abcam;

ab4729); Cytochrome C (Proteintech; 10993-1-AP); Bcl-2(Santa Claus; sc-7382); Bcl-Xl(Santa Claus; sc-8392); Mcl-1(cell signaling;#4572); Bax (Abcam, ab32503). For qRT-PCR, all PCR primers are purchased from Sangon Biotech (Shanghai China) and Primer sequences are as follows: NSD2-F: TCAAGCAGA AGA AGCTGC AA

NSD2-R: TCTGCCGTCTTTTGAGGAGT

TIGAR-F: CGTGTTTGAGCATCAGAGGA

TIGAR-R: GCAAGCAGATGAACAGGTG

HK2-F: GTACACATTGCAGACAGCACC

HK2-R: TCTTGGACATGGGATGGGGT

G6PD-F: AAACGGTCGTACACTTCGGG

G6PD-R: AGCCCACGATGAAGGTGTTT

GLUT1-F: TGAGCATCGTGGCCATCTTT

GLUT1-R: CCGGAAGCGATCTCATCGAA

βactin-F: GAGAAAATCTGGCACCACACC

βactin-R: ATACCCCTCGTAGATGGGCAC.

2.5 ROS level measurement ROS level was measured as described previously [21]. Briefly, cells were washed 3 times with PBS and incubated with 5 µM DCFH-DA (Beyotime, Shanghai, China) in the dark for 20 minutes. ROS levels were measured by flow cytometry 2.6 Assays for NADPH/NADP+ ratio, GSH level and G6PD activity After indicated treatment, cells were washed with PBS and collected. NADPH/NADP+ ratios were measured by using NADP+/NADPH-Glo Assay (Promega, G9081). GSH level was measured by using GSH/GSSG-GLO Assay (Promega v6611). G6PD activity was measured by using the Glucose-6-Phosphate Dehydrogenase(G6PDH) Activity Assay Kit (BioVision). All above assays were performed following the manufacturer’s instructions. 2.7 Xenograft tumor models For establishing breast cancer cells xenograft tumors, 5 × 106 cells were suspended in total 100µl PBS and Matrigel (1:1), and implanted subcutaneously into the dorsal flank on both sides of the female BALB/c nu/nu athymic mice (4 weeks old, Sprague Dawley, Harlan). When the tumor volume was approximately 80 mm3, the mice were randomized into two groups, one group were treated with 100µl of PBS

and another were treated with 100µl 2.5mg/KG DZNep for three times per week. Tumor volumes were measured weekly by calipers and volume was calculated with the equation V=π/6(length ×width2). Tumors were collected and used to analyze NADPH production and G6PD activity. 2.8 Statistics Data was presented as mean values ± standard deviation (SD) from three independent experiments. GraphPad Prism 7 software (GraphPad, San Diego, CA) was used for statistical analyses and the two-tailed student t tests were used to compare the means. P < 0.05 was considered to be significant. 3. Results 3.1 DZNep potently inhibits the growth and survival of tamoxifen-resistant breast cancer cells To examine whether DZNep can inhibit the growth of tamoxifen-resistant cells, we treated MCF-7 cells and two different tamoxifen-resistant sublines of MCF-7 cells (MCF-7 TamR

and MCF-7 LCC2[11]) with different concentrations of DZNep.

Results shown in Fig. 1A and 1B demonstrated that at a relatively low concentration (0.25 µM), DZNep displayed a potent inhibitory effect on the growth of MCF-7 and its tamoxifen-resistant derivatives. Interestingly, DZNep showed a stronger growth inhibition in the two tamoxifen-resistant breast cancer cells than in the tamoxifen-sensitive cells (Fig. 1A and 1B). The strong growth inhibition effects in the tamoxifen-resistant cells (MCF-7 TamR) could be observed as early as 24 hours after the DZNep treatment (Fig.1C). Moreover, DZNep strongly induced apoptosis of the

TamR cells, as demonstrated by the activation of caspase-3 and caspase-7, and increased the expression of apoptotic gene Bax and Cyt-C while suppressed anti-apoptotic protein Bcl2, Bcl-xl and Mcl-1 gene expression (Fig.1D and supplementary Fig. 1). In line with its effect on the cell survival, we found that DZNep potently reduced colony formation of the TamR cells, compared to that of cells treated with vehicle (Fig.1E and 1F). Together, these results suggest that DZNep can strongly inhibit the growth and survival of tamoxifen-resistant breast cancer cells. Moreover, we found that DZNep strongly sensitized MCF-7 TamR cells to tamoxifen induced cell survival inhibition (Fig.1G).

3.2 DZNep inhibits tamoxifen-resistant cell growth via induction of NSD2 protein degradation Our previous study revealed that overexpression of NSD2 drove tamoxifen resistance in breast cancer via its methylase activity [11]. Since it is reported that DZNep inhibits cancer cell proliferation through suppressing histone methylations [12], we investigated whether DZNep inhibition of tamoxifen-resistant cell survival was associated with alteration of NSD2 function. We thus performed Western blotting analysis of two major histone methyltransferases NSD2 and EZH2 and the major methylated histone marks.

Results in Fig. 2A demonstrated that the level of NSD2

protein was strongly reduced 24 hours after DZNep treatment of MCF-7 TamR and LCC2 cells. Interestingly, EZH2 protein level is only marginally reduced only 48 hours after the DZNep treatment.

Consistent with the less pronounced effect of

DZNep on EZH2, siRNA knockdown of EZH2 displayed growth inhibition effects that were less strong than that by knockdown of NSD2 (Fig. 2B and 2C). Furthermore, GSK126, a specific and potent antagonist of EZH2, showed less potent growth-inhibitory effects on MCF-7 TamR cells with an IC50 of 5.3 µM when compared to that of DZNep (IC50 of 0.11 µM) (Fig. 2D). Together with our previous finding of pivotal role of NSD2 in driving tamoxifen resistance, these results suggest that the potent inhibitory effect of DZNep on the growth and survival of the tamoxifen-resistant cells is primarily through its inhibition of NSD2 protein and not through control of EZH2. We then used MG-132, a proteasome inhibitor, to examine whether DZNep reduced NSD2 protein through proteasome-mediated degradation, and found that indeed MG-132 could effectively restore the level of NSD2 protein in TamR cells treated with DZNep and mitigate DZNep toxicity (Fig. 2E and supplementary Fig. 2), while translation inhibitor cycloheximide had no obvious effect on DZNep induced NSD2 degradation (supplementary Fig. 3). Moreover, consistent with NSD2 being the primary target of DZNep, DZNep treatment significantly decreased global H3K36me2 and H3K36me3 levels (Fig. 2F). Together, these results suggest that DZNep inhibits the growth

and survival of

tamoxifen-resistant breast cancer cells primarily induction of NSD2 protein degradation.

3.3 DZNep inhibits tamoxifen-resistant cancer cell survival through suppressing NSD2 functions and increasing ROS production

The strong and preferential effect of DZNep on NSD2 protein promoted us to examine whether DZNep inhibits tamoxifen-resistant cell survival through suppressing NSD2 functions. Firstly, we performed Western blotting and qRT-PCR analysis of DZNep-treated cells. We found that DZNep strongly suppressed the expression of NSD2 target genes such as HK2, G6PD, GLUT1 and TIGAR (Fig. 3A and

3B)[11].

Studies

by

us

and

others

have

demonstrated

that

those

NSD2-upregulated genes play key roles in mediating the activation of cellular pentose phosphate pathway (PPP) in production of NADPH and reduced glutathione (GSH) for maintaining cellular redox homeostasis [22]. As expected, DZNep treatment markedly reduced the NADPH level along with a decreased level of GSH in MCF-7 TamR cells (Fig. 3C and D). GSH is the cellular main antioxidant to counter ROS. Consistent with the reduced level of GSH, DZNep treatment markedly elevated ROS level in MCF-7 TamR cells (Fig. 4A and Fig. 4B). Moreover, in supporting the notion that DZNep induces cell death through elevation of ROS, the inhibition of DZNep on cell survival was effectively rescued by ROS scavenger N-acetylcysteine (NAC) (Fig. 4C). Together, these results suggest that DZNep inhibited tamoxifen-resistant cell growth through suppression of NSD2 function in maintaining cellular redox balance.

3.4 DZNep inhibits tumor growth and reduces tumor NADPH level To assess the activity of DZNep in vivo, we generated xenograft tumors via implanting MCF-7 TamR cells in female athymic nude mice as previously reported

[23]. When the tumor volumes were approximately 80 mm3, the mice were randomized and then treated with either vehicle or DZNep three times per week for four weeks. As shown in Fig. 5A, while tumors in vehicle-treated mice continued to grow over the treatment time, the growth of tumors in DZNep-treated mice was strongly

inhibited,

suggesting

that

DZNep

can

significantly

suppress

tamoxifen-resistant tumor growth in vivo. Consistent with the in vitro results shown in Fig. 3, DZNep treatment of mice also significantly decreased tumor NADPH production and G6PD activity (Fig. 5B). Together, these results suggest that DZNep inhibits tamoxifen-resistant tumor growth through suppression of NSD2 up-regulated PPP and tumor production of NADPH.

4. Discussion Endocrine therapy, such as tamoxifen, is commonly used to treat patients with ER-positive breast cancer. Although tamoxifen has significantly improved their overall survival rate, patients who develop resistance to tamoxifen tend to have high mortality [24, 25]. Therefore, there is an urgent need for development of strategies to overcome the resistance. Epigenetic reprogramming is a common feature of drug resistance. DZNep inhibits multiple histone methylations (such as H3K27me3 and H3K4me3) and exhibits anticancer activity in various cancer cells, which makes DZNep a promising epigenetic agent for cancer therapy. However, the effect of DZNep in TamR breast cancer and its underlying mechanisms remained unknown. In this study, we found that DZNep inhibited TamR breast cancer cell growth both in

vitro and in vivo via degrading NSD2 protein, suppressing NSD2-controlled gene programs and elevating cellular ROS levels. To explore the cellular activity of DZNep in TamR breast cancer cells, we first examined the effect of DZNep on TamR cell growth and survival. Interestingly, we found that DZNep showed a stronger growth inhibition in TamR breast cancer cells than in their parental cells. Since our previous data have demonstrated that NSD2 overexpression is a key driver in endocrine resistant progression, we then investigated whether the inhibition of DZNep on TamR cell survival is associated with NSD2 function. Indeed, DZNep significantly induced NSD2 protein degradation and decreased related global H3K36me2 marker level. In accordance with our recent study that NSD2 directly enhanced the expression of key metabolic enzymes G6PD, TIGAR, HK2 and GLUT1 [11], DZNep treatment strongly suppressed their expression. Concerted functions of these enzymes can strongly increase the metabolic flux of the PPP pathway which leads to an enhanced production of NADPH and GSH. Both NADPH and GSH are crucial antioxidants for maintaining cellular redox homeostasis [22, 26-29]. It is demonstrated that oxidative stress is a major mechanism of tamoxifen-induced killing of breast cancer cells [30]. To maintain redox balance, tamoxifen-resistant cells reprogram their gene expression and metabolism to increase their antioxidant production. Our recent study demonstrated that elevated levels of NSD2 in tamoxifen-treated cells mediate the reprogramming and enhanced production of NADPH and GSH. Consistent with our interpretation that NSD2 is the major target of DZNep, we found that DZNep treatment significantly down-regulated

NADPH and GSH production and up-regulated ROS level. Our further analysis demonstrated that ROS scavenger NAC effectively rescued the killing of TamR cells by DZNep. Consistent with the results from our cell culture studies, we found that DZNep significantly suppressed TamR tumor growth via down-regulating the PPP pathway. Several studies have demonstrated that DZNep is capable of degradation of EZH2 and inhibits its activity in certain cells and tumors [17]. We then explored whether the effect of DZNep on NSD2 was dependent on EZH2 activity. Our data revealed that DZNep decreased NSD2 protein level prior to its effect on EZH2 level. Importantly, we found that GSK126, a more specific and potent antagonist of EZH2 showed much lower inhibition on TamR cells growth when compared to DZNep and that EZH2 siRNAs caused only minor inhibition of cell growth of TamR breast cancer cells. Collectively, these results suggest that in the tamoxifen-resistant cells, the primary target of DZNep is NSD2. NSD2 primarily methylates H3K36 while EZH2/PRC2 tri-methylates H3K27 [5]. Consistently, we found that DZNep, as a degradation agent of NSD2, significantly decreased global H3K36me2 and H3K36me3 levels in TamR cells. On the other hand, DZNep is also an inhibitor of S-adenosylmethionine (SAM)-dependent methyltransferases which include NSD2 and EZH2. Therefore, it is not surprising that we also observed a decrease in H3K27me3 level in TamR cells. Interestingly, our observation here is seemingly not in line with previous reports that knockdown of NSD2 by siRNA decreased levels of H3K36me2 which was accompanied with increased levels of H3K27me3 in multiple myeloma [31,

32]. Although incompletely understood, the mechanism underlying the increase of H3K27me3 mark by knockdown of NSD2 in the multiple myeloma cells might involve the alteration of the expression and/or activities of downstream targets of NSD2, possibly some of the histone H3K27 demethylases. It is likely that the function of NSD2 is cell type-specific and that decreasing NSD2 protein level by DZNep in our tamoxifen-resistant breast cancer cells may not cause the downregulation of the histone demethylases. Moreover, since DZNep is a pan-inhibitor of SAM-dependent methylases including EZH2, increase of H3K27me3 mark due to the decreased histone demethylases may not be sufficient to overcome the strong inhibition of EZH2 methylase activity by DZNep. Hence, we observed a decreased level of H3K27me3 in the cells treated with DZNep. Nevertheless, the exact effects of DZNep on the protein stability and function of NSD2 and EZH2 are likely cell context-dependent and still await to be elucidated. 5. Conclusions Taking our current data together, we have demonstrated that DZNep can significantly suppress tamoxifen-resistant breast cancer cell survival and induce apoptosis both in vitro and in vivo. The major mechanisms of DZNep action include induction of NSD2 protein degradation and suppression of cancer cell production of NADPH and GSH which in turn result in ROS-dependent apoptosis. Our study thus suggests that DZNep can be further developed as a feasible therapeutic drug for treatment of tamoxifen-resistant breast cancer.

Acknowledgements This research was supported by the National Natural Science Foundation of China (81572925 and 81872891), the Guangdong Natural Science Funds for Distinguished Young Scholar (No. 2019B151502016), the science and Technology Planning Project of Guangdong Province (No. 2017A050506042), the NIH grants R01 DK060019 and R01 CA224900.

Completing Financial Interests The authors declare no competing financial interests.

References [1] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA Cancer J Clin 68(6) (2018) 394-424. [2] J.M. Harvey, G.M. Clark, C.K. Osborne, D.C. Allred, Estrogen receptor status by immunohistochemistry is superior to the ligand-binding assay for predicting response to adjuvant endocrine therapy in breast cancer, Journal of Clinical Oncology 17(5) (1999) 1474-1481. [3] S.R.D. Johnston, D. Mitch, Aromatase inhibitors for breast cancer: lessons from the laboratory, Nature Reviews Cancer 3(11) (2003) 821-31. [4] A. Ring, M. Dowsett, Mechanisms of tamoxifen resistance, Endocr Relat Cancer 11(4) (2004) 643-58. [5] V. Saloura, H.S. Cho, K. Kiyotani, H. Alachkar, Z. Zuo, M. Nakakido, T. Tsunoda, T. Seiwert, M. Lingen, J. Licht, WHSC1 promotes oncogenesis through regulation of NIMA-related kinase-7 in squamous cell carcinoma of the head and neck, Molecular Cancer Research 13(2) (2015) 293-304. [6] H. Heidi Rye, S.R. Eric, S. Ronald, R.R. Elisabeth, R. Henrik Holm, J. Jens Vilstrup, J.R. Mette, S. Guido, H. Kristian, The histone methyltransferase and putative oncoprotein MMSET is overexpressed in a large variety of human tumors, Clinical Cancer Research 17(9) (2011) 2919-2933. [7] M. Morishita, E.D. Luccio, Cancers and the NSD family of histone lysine methyltransferases, Biochimica Et Biophysica Acta 1816(2) (2011) 158-163.

[8] T. Ezponda, ., R. Popovic, ., M.Y. Shah, E. Martinez-Garcia, ., Y. Zheng, ., M. D-J, C. Will, ., A. Neri, ., N.L. Kelleher, J. Yu, . The histone methyltransferase MMSET/WHSC1 activates TWIST1 to promote an epithelial-mesenchymal transition and invasive properties of prostate cancer, Oncogene 32(23) (2013) 2882-2890. [9] M. Morishita, D. Mevius, E.D. Luccio, In vitro histone lysine methylation by NSD1, NSD2/MMSET/WHSC1 and NSD3/WHSC1L, BMC Structural Biology,14,1(2014-12-12) 14(1) (2014) 1-13. [10] Q. Feng, Z. Zhang, M.J. Shea, C.J. Creighton, C. Coarfa, S.G. Hilsenbeck, R. Lanz, B. He, L. Wang, X. Fu, An epigenomic approach to therapy for tamoxifen-resistant breast cancer, Cell Research 24(7) (2014) 809-819. [11] J. Wang, Z. Duan, Z. Nugent, J.X. Zou, A.D. Borowsky, Y. Zhang, C.G. Tepper, J.L. Jian, O. Fiehn, J. Xu, Reprogramming metabolism by histone methyltransferase NSD2 drives endocrine resistance via coordinated activation of pentose phosphate pathway enzymes, Cancer Letters 378(2) (2016) 69-79. [12] P.K. Chiang, Biological Effects of Inhibitors of S -Adenosylhomocysteine Hydrolase, Pharmacology & Therapeutics 77(2) (1998) 115. [13] T. Chiba, E. Suzuki, M. Negishi, A. Saraya, S. Miyagi, T. Konuma, S. Tanaka, M. Tada, F. Kanai, F. Imazeki, 3‐Deazaneplanocin A is a promising therapeutic agent for the eradication of tumor‐initiating hepatocellular carcinoma cells, International Journal of Cancer 130(11) (2012) 2557-2567. [14] A.M. Wagner, M.P. Gran, N.A. Peppas, Designing the new generation of intelligent biocompatible carriers for protein and peptide delivery, Acta Pharmaceutica Sinica B 8(2)

(2018) 147-164. [15] F. Warren, W. Yongchao, S. Arun, K.M. Buckley, S. Huidong, J. Anand, U. Celalettin, R. Rekha, F. Pravina, C. Jianguang, Combined epigenetic therapy with the histone methyltransferase EZH2 inhibitor 3-deazaneplanocin A and the histone deacetylase inhibitor panobinostat against human AML cells, Blood 114(13) (2009) 2733. [16] J.K. Lee, K.C. Kim, DZNep, inhibitor of S-adenosylhomocysteine hydrolase, down-regulates expression of SETDB1 H3K9me3 HMTase in human lung cancer cells, Biochemical & Biophysical Research Communications 438(4) (2013) 647-652. [17] J. Tan, X. Yang, L. Zhuang, X. Jiang, W. Chen, P.L. Lee, R.K. Karuturi, P.B. Tan, E.T. Liu, Q. Yu, Pharmacologic disruption of Polycomb-repressive complex 2-mediated gene repression selectively induces apoptosis in cancer cells, Genes Dev 21(9) (2007) 1050-1063. [18] T.B. Miranda, DZNep is a global histone methylation inhibitor that reactivates developmental genes not silenced by DNA methylation, Molecular Cancer Therapeutics 8(6) (2009) 1579-1588. [19] P. Yang, L. Guo, Z.J. Duan, C.G. Tepper, L. Xue, X. Chen, H.J. Kung, A.C. Gao, J.X. Zou, H.W. Chen, Histone methyltransferase NSD2/MMSET mediates constitutive NF-κB signaling for cancer cell proliferation, survival, and tumor growth via a feed-forward loop, Molecular & Cellular Biology 32(15) (2012) 3121-31. [20] D. Cai, J. Wang, B. Gao, J. Li, F. Wu, J.X. Zou, J. Xu, Y. Jiang, H. Zou, Z. Huang, A.D. Borowsky, R.J. Bold, P.N. Lara, J.J. Li, X. Chen, K.S. Lam, K.-F. To, H.-J. Kung, O. Fiehn, R. Zhao, R.M. Evans, H.-W. Chen, RORγ is a targetable master regulator of cholesterol biosynthesis in a cancer subtype, Nature Communications 10(1) (2019) 4621.

[21] N. Granofszky, M. Lang, V. Khare, G. Schmid, T. Scharl, F. Ferk, K. Jimenez, S. Knasmüller, C. Campregher, C. Gasche, Identification of PMN-released mutagenic factors in a co-culture model for colitis-associated cancer, Carcinogenesis 39(2) (2017) 146-157. [22] C. Riganti, E. Gazzano, M. Polimeni, E. Aldieri, D. Ghigo, The pentose phosphate pathway: An antioxidant defense and a crossroad in tumor cell fate, Free Radic Biol Med 53(3) (2012) 421-436. [23] S. Massarweh, C.K. Osborne, C.J. Creighton, L. Qin, A. Tsimelzon, S. Huang, H. Weiss, M. Rimawi, R. Schiff, Tamoxifen resistance in breast tumors is driven by growth factor receptor signaling with repression of classic estrogen receptor genomic function, Cancer Research 68(3) (2008) 826-833. [24] C. Davies, ., J. Godwin, ., R. Gray, ., M. Clarke, ., D. Cutter, ., S. Darby, ., P. Mcgale, ., H.C. Pan, C. Taylor, ., Y.C. Wang, Relevance of breast cancer hormone receptors and other factors to the efficacy of adjuvant tamoxifen: patient-level meta-analysis of randomised trials, Lancet 378(9793) (2011) 771-784. [25] E.B.C.T.C. Group, Aromatase inhibitors versus tamoxifen in early breast cancer: patient-level meta-analysis of the randomised trials, Lancet 386(10001) (2015) 1341-1352. [26] S. Salvioli, ., G. Storci, ., M. Pinti, ., D. Quaglino, ., L. Moretti, ., M. Merlo-Pich, ., G. Lenaz, ., S. Filosa, ., A. Fico, ., M. Bonafè, . Apoptosis-resistant phenotype in HL-60-derived cells HCW-2 is related to changes in expression of stress-induced proteins that impact on redox status and mitochondrial metabolism, Cell Death & Differentiation 10(2) (2003) 163-174. [27] C. Friesen, Y. Kiess, K.M. Debatin, A critical role of glutathione in determining apoptosis sensitivity and resistance in leukemia cells, Cell Death & Differentiation 11 Suppl 1(7) (2004)

S73. [28] G.D. Kruh, Z. Hao, P.A. Rea, G. Liu, Z.S. Chen, K. Lee, M.G. Belinsky, MRP Subfamily Transporters and Resistance to Anticancer Agents, Journal of Bioenergetics & Biomembranes 33(6) (2001) 493-501. [29] I. Meijerman, J. Beijnen, Jh, Combined action and regulation of phase II enzymes and multidrug resistance proteins in multidrug resistance in cancer, Cancer Treatment Reviews 34(6) (2008) 505-520. [30] R.T. Bekele, G. Venkatraman, R.-Z. Liu, X. Tang, S. Mi, M.G.K. Benesch, J.R. Mackey, R. Godbout, J.M. Curtis, T.P.W. McMullen, D.N. Brindley, Oxidative stress contributes to the tamoxifen-induced killing of breast cancer cells: implications for tamoxifen therapy and resistance, Scientific Reports 6(1) (2016) 21164. [31] M.Y. Shah, E. Martinez-Garcia, J.M. Phillip, A.B. Chambliss, R. Popovic, T. Ezponda, E.C. Small, C. Will, M.P. Phillip, P. Neri, N.J. Bahlis, D. Wirtz, J.D. Licht, MMSET/WHSC1 enhances DNA damage repair leading to an increase in resistance to chemotherapeutic agents, Oncogene 35(45) (2016) 5905-5915. [32] R. Popovic, E. Martinez-Garcia, E.G. Giannopoulou, Q. Zhang, Q. Zhang, T. Ezponda, M.Y. Shah, Y. Zheng, C.M. Will, E.C. Small, Y. Hua, M. Bulic, Y. Jiang, M. Carrara, R.A. Calogero, W.L. Kath, N.L. Kelleher, J.-P. Wang, O. Elemento, J.D. Licht, Histone methyltransferase MMSET/NSD2 alters EZH2 binding and reprograms the myeloma epigenome through global and focal changes in H3K36 and H3K27 methylation, PLoS Genet 10(9) (2014) e1004566-e1004566.

Figure legends:

Fig.1. DZNep inhibits tamoxifen resistant breast cancer cell survival. (A) Chemical structure of DZNep. (B) Effect of DZNep on growth of breast cancer cells. Cells were seeded in 6-well plates and counted after cells were treated with indicated concentrations of DZNep for 48 hours by Coulter counter. (C) Cell viability of MCF-7 TamR cells treated with vehicle or indicated concentrations of DZNep for 24, 48 and 72 hours. (D) Caspase3/7(Cas3/7) activities in MCF-7 TamR cells treated with vehicle or indicated concentrations of DZNep for 48 hours. (E and F) Colony formation assay was performed in MCF-7 TamR cells, which were treated with vehicle or indicated concentrations of DZNep for 14 days. (G) Cell viability of MCF-7 TamR cells treated with vehicle, DZNep (0.25 µM) and/or Tamoxifen (5 µM) for 96 hours. The data are presented as the mean ± SD. *p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Fig.2. DZNep inhibits TamR cell growth via degrading NSD2 protein. (A) Immublotting analysis of NSD2 in MCF-7 TamR cells and MCF-7 LCC2 cells treated with 1µM DZNep for indicated times. (B) Immublotting analysis of the indicated proteins in MCF-7 TamR cells transfected with control or EZH2 siRNA and incubated for 72 hours. (C) MCF-7 TamR cells were transfected with control, NSD2 or EZH2 siRNA and incubated for 4 days, cells were collected and counted by Coulter counter. (D) Cell viability, as measured by Cell-Titer Glo of MCF-7 TamR cells treated with the indicated concentrations of DZNep and EZH2 antagonist GSK126. (E) Immublotting analysis of NSD2 in MCF-7 TamR cells following treatment with vehicle, DZNep and/or MG132 for 24 hours. (F) Immublotting analysis of H3K36me2, H3K36me3, H3K27me3, H3K4me3 and GAPDH in MCF-7 cells and TamR cells treated with 1µM DZNep or vehicle for 72 hours.

The data are presented as the mean ± SD. *p < 0.05; ** p < 0.01;*** p < 0.001; **** p < 0.0001.

Fig.3. DZNep suppresses NSD2 signaling. (A) MCF-7 TamR cells were treated with DZNep for 72 hours before collected for immunoblotting with indicated antibodies. (B) qRT-PCR analysis of indicated genes expression in MCF-7 TamR cells treated with vehicle or indicated concentration of DZNep for 48 hours. (C and D) MCF-7 TamR cells were treated with different concentrations DZNep for 48 hours and harvested for NADPH and NADP+ production and GSH level measurement as described in Experimental Procedures. The data are presented as the mean ± SD. *p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001.

Fig.4. DZNep inhibits MCF-7 TamR cell growth through up-regulating ROS reduction. (A and B) MCF-7 TamR cells were treated with vehicle or indicated concentration of DZNep for 24 hours and harvested for ROS measurement by flow cytometry. (C) MCF-7 TamR cells were treated with DZNep and/or NAC(3mM) as indicated and harvested for cell viability measurement. The data are presented as the mean ± SD. *p < 0.05; ** p < 0.01; *** p < 0.001.

Fig.5. DZNep inhibits tumor growth in breast cancer TamR xenograft model. (A) MCF-7 TamR cells were implanted s.c. athymic mice. Mice with ~80 mm3 were randomized into 2 groups for indicated treatment. Tumor size was measured over the weeks. Tumor images representative of different treatment groups were shown. Mean tumor volume ±s.e.m was shown, **p < 0.01. (B) Xenograft tumors of MCF-7 TamR cells treated with PBS or DZNep were harvested for NADPH/NADP + ratio and G6PD activity measurement. The data are presented as the mean ± SD. * p < 0.05, ** p < 0.01.

Highlights DZNep potently induces the degradation of NSD2 protein. DZNep inhibits the expression of NSD2 target genes (HK2, G6PD, GLUT1 and TIGAR) involved in the pentose phosphate pathway. DZNep decreases cell production of NADPH and glutathione (GSH), and elevated ROS. DZNep inhibits TamR breast cancer cell growth in vitro and in vivo.

Declaration of interests ☒ The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. ☐The authors declare the following financial interests/personal relationships which may be considered as potential competing interests: