- Email: [email protected]
S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation
G Model ETP 50975 No. of Pages 6
Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Experimental and Toxicologic Pathology journal homepage: www.elsevier.de/etp
S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation Taimei Zhoua,1, Haiying Wanga,1, Shen Zhanga , Xinglin Jianga , Xiaolong Wei, MDb,* a b
Department of Medical Laboratory, Hunan University of Medicine, Huaihua 418000, China Department of Pathology, Cancer Hospital of Shantou University Medical College, Shantou 515031, China
A R T I C L E I N F O
Article history: Received 28 March 2016 Received in revised form 15 July 2016 Accepted 7 September 2016 Keywords: S100P Cadmium Cell proliferation Placenta
A B S T R A C T
Cadmium, a common and highly toxic pollutant, has been known to accumulate high concentrations in placenta with deleterious effects on placental structure and function. Cadmium inhibits cell proliferation in placenta via targeting metal binding proteins. S100P, a Ca2+-binding protein, plays an important role in promoting cell proliferation and our previous study found its downregulation was linked to cadmium exposure in Guiyu, a famous e-waste recycling town in China. So, the present study was aimed to define whether cadmium inhibited cell proliferation through interfering with S100P. Using human trophoblastderived HTR-8/SVneo cells as a model in vitro, we showed that cadmium exposure led to decreases in both cell proliferation and S100P expression. Knockdown of S100P in HTR-8/SVneo cells led to an obvious decrease of cell proliferation, and upregulation of S100P resulted in a significant increase of cell proliferation. Furthermore, after 24 h of exposure to cadmium (20 mM), cells transfected with pcDNA3.1S100P showed a 1.3-fold higher S100P protein level, 38% higher proliferation evaluated with MTT assay than cells with no transfection, indicating that S100P expression attenuated cadmium-induced inhibition of cell proliferation. Taken together, we demonstrate that cadmium inhibits S100P expression and cell proliferation in placenta, meanwhile, S100P expression affects cell proliferation. Thus, our study is the first to indicate that cadmium may induce inhibition of placental trophoblast cell proliferation through targeting S100P. ã 2016 Elsevier GmbH. All rights reserved.
1. Introduction Cadmium is a widespread environmental toxicant releasing from industrial and agricultural waste (Faroon et al., 2012). Exposure to Cadmium for the general population occurs mainly through diet, work and tabacco smoking (Jarup and Akesson, 2009). It has been identified that cadmium can accumulate in many organs, including kidney, liver, bone and nervous system, and result in adverse effects on these organs (Thevenod and Lee, 2013). Additionally, the placenta is a major target of cadmium in pregnant women for its barrier function against the transfer of heavy metals to the fetus (Myllynen et al., 2005). Cadmium can accumulate high concentrations in placenta (Esteban-Vasallo et al., 2012) and prenatal exposure to cadmium can induce both
* Corresponding author. E-mail addresses: [email protected] (T. Zhou), [email protected] (H. Wang), [email protected] (S. Zhang), [email protected] (X. Jiang), [email protected] (X. Wei). 1 These authors contributed equally to the work.
structural and functional abnormalities of placenta (Baranski et al., 1982; Di Sant'Agnese et al., 1983). It’s reported that cadmium exposure may lead to implantation delay, premature delivery, placental necrosis and early pregnancy loss by mechanisms such as oxidative stress, endocrine disorders and altered ion transportation (Kawai et al., 2002; Kippler et al., 2010, 2012; Levin et al., 1981; Lin et al., 1997; Stasenko et al., 2010). In addition, inhibition of cell proliferation has been suggested to be a potential mechanism involved in cadmium-induced impairment on placental development (Piersma et al., 1993; Powlin et al., 1997; Thompson and Bannigan, 2008). However, it is poorly known about the molecular targets of cadmium toxicity in placenta. Cadmium treatment was proved to decrease cytosolic Ca2+ binding activities and downregulate the expression of a Ca2 + -binding protein, HCaBP of trophoblastic cells (Lin et al., 1997), suggesting that the exposure to cadmium can deregulate the expression of Ca2+-binding proteins. Among the Ca2+-binding proteins, S100P, a member of the Ca2+-binding S100 protein family, attracts our attention. S100P was originally purified from the placenta and strongly expressed in trophoblast cells (Becker et al.,
http://dx.doi.org/10.1016/j.etp.2016.09.002 0940-2993/ã 2016 Elsevier GmbH. All rights reserved.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
2
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
Table 1 Primers for real-time PCR. Primer sequence(50 to 30 )
Size(bp)
Annealing Tm( C)
S100P
F:GGAGAAGGAGCTACCAGG R: GCCACGAACACGATGAAC
126
60
b-actin
F: AGCGAGCATCCCCCAAAGTT R: GGGCACGAAGGCTCATCATT
285
60
cadmium exposure on S100P expression and cell proliferation separately at different concentrations. Then we tested the effect of S100P expression on cell preliferation. Finally, we investigated the influence of increased S100P level on cell proliferation under cadmium exposure. 2. Materials and methods
F: forward. R: reverse.
2.1. Cell culture
1992; Parkkila et al., 2008). Though little is known about its precise function in placenta, it’s important roles in tumor progression in promoting cellular proliferation and enhancing survival in different tumor cell types have been well studied (Arumugam et al., 2004; Tothova and Gibadulinova, 2013). Recently, a study reported that S100P can also regulate the proliferation of trophoblast-like cells, showing it’s potential role in pregnant development (Zhu et al., 2015). Furthermore, our previous study found that placentas from women living in Guiyu, a major processing center for electronic waste, showed lower S100P levels compared with placentas from women living in Shantou, an area without electronic waste pollution, moreover, the downregulation of S100P was associated with cadmium exposure (Zhang et al., 2011). This finding suggests S100P may be a molecular target of heavy metals, especially cadmium in placenta. As mentioned above, we hypothesized that cadmium might induce the deregulation of cell proliferation in placenta partly through targeting S100P. In the present study, we examined this hypothesis using human extravillous trophoblast-derived HTR-8/ SVneo cells as a model in vitro. We evaluated the effects of
The human trophoblast-derived HTR-8/SVneo cells were purchased from Jenniobio Biotechnology (Guangzhou, China). The cell line was cultured in RPMI 1640 medium (Life Technologies, New York, USA) supplemented with 10% fetal bovine serum and incubated at 37 C with 5% CO2. 2.2. MTT assay HTR-8/SVneo cells were seeded in 96-well plates at density of 1 104 cells/well. After being 80% confluent, Cells were treated with Cadmium chloride (CdCl2) (Sigma, USA) for 24 h at the doses of 2 and 20 mM. CdCl2 solutions were prepared using dimethyl sulfoxide (DMSO, sigma, USA) as described by Radio et al. (2008), and the final DMSO concentration in the culture media was 0.1%. In the vehicle control, cells were treat with 0.1% DMSO only. After incubation, cell proliferation was assessed by MTT assay with 3 repeated wells. In MTT assay, 20 ml of 5 mg/ml MTT solution was added in each well, and the plate was incubated for 4 h at 37 C. The medium was then removed and the colored reaction product was solubilized in
Fig. 1. Effects of CdCl2 on proliferation of HTR-8/SVneo cells and S100P expression. A. Cell proliferation was determined by MTT assay. Cells were treated with 2 and 20 mM CdCl2 for 24 h. As a contol, CdCl2 was replaced with DMSO. B. Relative mRNA levels of S100P by real-time PCR. C. Protein levels of S100P by western blot anaysis. The band intensities were quantitated using ImageJ software. The results were normalieze with b-actin and expressed as fold change relative to control. Data are represented as mean SEM of at least 3 independent experiments. *P < 0.05 vs. vehicle control.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
150 ml DMSO under gentle shaking for 10 min. Absorbance was measured at 570 nm using an ELISA reader. The corrected absorbance of each sample was calculated by comparison with that of control. 2.3. Cell transfection HTR-8/SVneo cells were seeded in 60 mm culture dishes 24 h before transfection. We transfected 5 mg pcDNA3.1 empty vector or pcDNA3.1-S100P expression vector (GenePharma, Shanghai Co. Ltd., China) into HTR-8/SVneo cells by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Specific small interference-RNAs (siRNAs) against S100P were synthesized by Genephama Biotech (Shanghai Co. Ltd., China). S100P siRNA-1 sequences were as follows: 50 -ACAAGGAUGCCGUGGAUAAdTdT-30 (sense) and 50 UUAUCCACGGCAUCCUUGUdTdT-30 (antisense). S100P siRNA-2 sequences were: 50 -CGAGUAUGAUCCUACCAGA-30 (sense) and 50 UCUGGUAGGAUCAUACUCG-30 (antisense). Scramble siRNA sequences were 50 -UUCUCCCGAACGUUCACGU-30 (sense) and 50 ACGUGACACGUUCGGAGAA-30 (antisense). Cells were transfected with 200 pmol siRNA at 50% confluence using Lipofectamine 2000 reagent according to the manufacturer’s protocol. After transfection for 24 h, cells were collected for further assays. 2.4. Real-time PCR Total RNA was isolated from cells using Trizol Regent kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol.
3
1 mg total RNA was reverse-transcribed into cDNA using PrimeScript1 RT reagent Kit (TaKaRa, Dalian, China). Real-time PCR involved 2 ml cDNA and the ABI PRISM 7300 Sequence Detection System (Applied Biosystems, Foster City, CA). b-actin, the housekeeping gene, was used as an internal control. The specific primers for S100P and b-actin were indicated in Table 1. All samples were amplified in triplicate. Relative mRNA levels of S100P were calculated by the 2DDt method (Livak and Schmittgen, 2001). 2.5. Western blot analysis Cells were collected and lysed with RIPA buffer (Sigma-Aldrich, USA), and then the protein concentration was determined using the BCA Protein Assay Kit (Beyontime, Jiangsu, China). The subsequent steps were performed as described previously (Zhang et al., 2011), and finally western blot band intensities were quantitated and normalized to the control of b-actin using ImageJ software. 2.6. Statistical analysis Data were represented as mean SEM. Differences among variables were analyzed by independent-samples t-test or oneway analysis of variance (ANOVA) with Student-Newman-Keuls for multiple comparisons. Each experiment was performed at least in triplicate. A value of P < 0.05 was considered statistically
Fig. 2. Knockdown of S100P expression (A) and inhibition of proliferation (B) of HTR-8/SVneo cells by siRNA. *P < 0.05 vs. control.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
4
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
significant. All data analysis involved use of SPSS ver. 16.0 software (SPSS Inc., Chicago, IL). 3. Results 3.1. CdCl2 inhibits proliferation of HTR-8/SVneo cells During pre-study stage, we preliminarily treated HTR-8/SVneo cells with either control (0.1% DMSO) or four different concentrations of cadmium (0.5, 2, 20 and 40 mM) and counted the attached and floating cells in each group, as reported in previous study (Powlin et al., 1997). No significant difference in cell count was observed in cells treated with 0.5 mM CdCl2 for 24 h compared with the cells of control. However, exposure to 40 mM CdCl2 resulted in a dramatic drop in cell count and floating cells were almost dead. Meanwhile, the typan blue exclusion assay indicated that most of the cells were viable after treated with 2 and 20 mM CdCl2, which suggested that these concentrations of cadmium mainly inhibited the proliferation of HTR-8/SVneo cells, but did not significantly induce cell death (data not shown). Therefore, we selected the doses of 2 and 20 mM in our study. To study the effect of cadmium on proliferation of trophoblast cells, HTR-8/SVneo cells were treated with CdCl2 (2 and 20 mM) for 24 h and cadmium-induced deregulation of cell proliferation was measured with MTT assay. As shown in Fig. 1, MTT (Fig. 1A) assay revealed that CdCl2 significantly decreased the proliferation of HTR-8/SVneo cells dose- dependently and the cell proliferation reduced 40% at 2 mM CdCl2 and 71% at 20 mM CdCl2 when compared with control.
3.2. CdCl2 reduces S100P expression To determine whether S100P expression was regulated by single exposure to cadmium, mRNA and protein levels of S100P in HTR-8/SVneo cells after 24 h of exposure to CdCl2 (2 and 20 mM) were separately detected by real-time PCR and western blot analysis. Similar to its effect on cell proliferation, CdCl2 led to decreases in both mRNA and protein levels of S100P with the final effect at 20 mM indicating 44% (Fig. 1B) and 37% (Fig. 1C) of control respectively. 3.3. Down-regulated expression of S100P inhibits proliferation of HTR8/SVneo cells To investigate the potential function of S100P against cadmiuminduced toxicity, we knocked down the expression of S100P in HTR-8/SVneo cells using S100P siRNA-1 and S100P siRNA-2 individually for 24 h. As show in Fig. 2A, the protein expression level of S100P was decreased 49% and 54% respectively. Accompanied with the decrease of S100P expression, cell proliferation reduced about 35% and 30% evaluated by MTT assay (Fig. 2B). 3.4. Overexpression of S100P attenuates CdCl2-induced inhibition of cell proliferation To further evaluate the role of S100P expression in cell proliferation under cadmium exposure, firstly, we forced S100P expression in HTR-8/SVneo cells. And then, cells were treated with
Fig. 3. Upregulation of S100P in HTR-8/SVneo cells at mRNA (A) and protein (B) levels. (C) Effect of upregulation of S100P expression on the proliferation ability of HTR-8/ SVneo cells. *P < 0.05 vs. pcDNA3.1.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
CdCl2 (20 mM) for 24 h, as a control, CdCl2 was replaced with DMSO. After transfection, S100P mRNA was about 343.7-fold increase with pcDNA3.1-S100P infection than with pcDNA3.1 infection (Fig. 3A), and the result of western blot analysis also indicated a 1.4-fold increase in S100P protein level (Fig. 3B). Significant increase of proliferation was also observed in cells transfected with pcDNA3.1-S100P compared with cells transfected with pcDNA3.1 (Fig. 3C). After exposure to CdCl2, we found that S100P protein levels were dramatically decreased when compared with untreated control group (Fig. 4A). Among the treated groups, S100P protein level in cells with pcDNA3.1-S100P transfection was 1.2-fold higher than cells with pcDNA3.1 transfection and 1.3-fold higher than cells without transfection, no difference was found between group with pcDNA3.1 transfection and group without transfection. Cell proliferation showed similar change pattern after exposure to CdCl2, and over expression of S100P significantly attenuated CdCl2-induced inhibition of cell proliferation since the proliferation evaluated with MTT assay was 38% higher in pcDNA3.1 transfection group than no transfection group (Fig. 4B). 4. Discussion Deregulation of cell proliferation is one of the most important mechanisms inferring to cadmium toxicity. Cadmium has dual effects on cell death and survival. On one hand, cadmium may inhibit cell proliferation and induce cell death leading to the impairment of target tissues or organs. On the other hand, cadmium can stimulate cell proliferation and act as a well-known carcinogen. Inhibition or promotion of cell proliferation denpends on factors such as cell type, the duration and the concentration of exposure. In this study, utilizing human trophoblast-derived HTR-
5
8/SVneo cells as a model, we demonstrated decreases of cell proliferation after treatment with 2 and 20 mM CdCl2 for 24 h. Cadmium inhibits cell proliferation via many different mechanisms and the most probable path is interfering with metal binding proteins, such as metallothionein (Babula et al., 2012) and calmodulin, an EF hand Ca2+-binding protein (Powlin et al., 1997). In our study, we found that S100P, an EF hand Ca2+-binding protein belonging to the S100 family, decreased in a same manner as the reduction of cell proliferation when exposure to cadmium, suggesting S100P might be a molecular target of cadmium-induced inhibition of cell proliferation. To further define the effects of S100P expression on cell proliferation, we separately transfected HTR-8/SVneo cells with S100P siRNA and pcDNA3.1-S100P. As expected, when S100P expression was down-and up-regulated, the proliferation of HTR-8/SVneo cells showed corresponding decrease and increase. Furthermore, increased expression of S100P significantly weakened the inhibition of cell proliferation caused by cadmium. Our results indicated that the expression of S100P affected the proliferation of human placental trophoblast cells. These findings provide important clues to the function of placental S100P in cadmium toxicity. Although the exact role of S100P in placenta remains unclear, its contribution to tumorigenesis, including tumor growth, metastasis and invasion has been well established (Jiang et al., 2012). Increased levels of S100P have been identified in different carcinomas and S100P can stimulate cell proliferation and survival by binding to receptor for advanced glycation end-products (RAGE) and via activation of ERK/MAPK pathway (Arumugam et al., 2004). Recently, S100P was found to regulate JAR cells proliferation via p38 MAPK pathway (Zhu et al., 2015), which may also be involved in cadmium-induced deregulation of cell proliferation in placenta. Furthermore, studies showed a significant increase of S100P
Fig. 4. Effects of CdCl2 (20 mM) on S100P protein expression (A) and proliferation ability (B) of HTR-8/SVneo cells transfected with or without pcDNA3.1-S100P plasmid. *P < 0.05 vs. control, #P < 0.05 vs. the other two CdCl2 treated groups.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
6
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
expression in endometrial stromal cells by co-cultured with trophoblast cells (Popovici et al., 2006), and a peak expression of S100P in human endometrium during the implantation window (Zhang et al., 2012), indicating its potential role in embryo implantation. Given that cadmium-induced inhibition of trophoblast cell proliferation have a major influence in the establishment of a viable pregnancy, the decreased expression of placental S100P induced by cadmium might be linked to deleterious outcomes, such as retardation of trophoblastic outgrowth and development, even placental necrosis by interfering with the cell proliferation of trophoblast cells. The mechanism of cell proliferation regulated by S100P and the precise function of S100P in placenta under cadmium exposure need to be further studied. 5. Conclusions For the first time, this study demonstrates that S100P expression and cell proliferation of HTR-8/SVneo cells are inhibited by cadmium exposure. Moreover, the expression of S100P affects cell proliferation under cadmium treatment. Thus, the mechanism by which cadmium interferes with cell proliferation, at least in human trophoblast-derived HTR-8/SVneo cells, may be through targeting S100P. Conflict of interest None. Acknowledgement This study was financially supported by the Scientific Research Projects of the Department of Education in Hunan Province (No. 12C1194). The authors declare they have no competing financial interests. References Arumugam T, Simeone DM, Schmidt AM, Logsdon CD. S100P stimulates cell proliferation and survival via receptor for activated glycation end products (RAGE). J. Biol. Chem. 2004;5059–65. Babula P, Masarik M, Adam V, Eckschlager T, Stiborova M, Trnkova L, Skutkova H, Provaznik I, Hubalek J, Kizek R. Mammalian metallothioneins: properties and functions. Metallomics: Integr. Biometal Sci. 2012;4(8):739–50. Baranski B, Stetkiewicz I, Trzcinka-Ochocka M, Sitarek K, Szymczak W. Teratogenicity, fetal toxicity and tissue concentration of cadmium administered to female rats during organogenesis. J. Appl. Toxicol.: JAT 1982;2(5):255–9. Becker T, Gerke V, Kube E, Weber K. S100P, a novel Ca(2+)-binding protein from human placenta. cDNA cloning, recombinant protein expression and Ca2+ binding properties. Eur. J. Biochem./FEBS 1992;207(2):541–7. Di Sant'Agnese PA, Jensen KD, Levin A, Miller RK. Placental toxicity of cadmium in the rat: an ultrastructural study. Placenta 1983;4(2):149–63. Esteban-Vasallo MD, Aragones N, Pollan M, Lopez-Abente G, Perez-Gomez B. Mercury, cadmium, and lead levels in human placenta: a systematic review. Environ. Health Perspect. 2012;120(10):1369–77.
Faroon, O., Ashizawa, A., Wright, S., Tucker, P., Jenkins, K., Ingerman, L., Rudisill, C., 2012. Toxicological Profile for Cadmium, Atlanta GA, pp. 277–331. Jarup L, Akesson A. Current status of cadmium as an environmental health problem. Toxicol. Appl. Pharmacol. 2009;238(3):201–8. Jiang H, Hu H, Tong X, Jiang Q, Zhu H, Zhang S. Calcium-binding protein S100P and cancer: mechanisms and clinical relevance. J. Cancer Res. Clin. Oncol. 2012;138 (1):1–9. Kawai M, Swan KF, Green AE, Edwards DE, Anderson MB, Henson MC. Placental endocrine disruption induced by cadmium: effects on P450 cholesterol sidechain cleavage and 3beta-hydroxysteroid dehydrogenase enzymes in cultured human trophoblasts. Biol. Reprod. 2002;67(1):178–83. Kippler M, Hoque AM, Raqib R, Ohrvik H, Ekstrom EC, Vahter M. Accumulation of cadmium in human placenta interacts with the transport of micronutrients to the fetus. Toxicol. Lett. 2010;192(2):162–8. Kippler M, Hossain MB, Lindh C, Moore SE, Kabir I, Vahter M, Broberg K. Early life low-level cadmium exposure is positively associated with increased oxidative stress. Environ. Res. 2012;112:164–70. Levin AA, Plautz JR, di Sant'Agnese PA, Miller RK. Cadmium: placental mechanisms of fetal toxicity. Placenta 1981;(Suppl. 3):303–18. Lin FJ, Fitzpatrick JW, Iannotti CA, Martin DS, Mariani BD, Tuan RS. Effects of cadmium on trophoblast calcium transport. Placenta 1997;18(4):341–56. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.) 2001;25(4):402–8. Myllynen P, Pasanen M, Pelkonen O. Human placenta: a human organ for developmental toxicology research and biomonitoring. Placenta 2005;26 (5):361–71. Parkkila S, Pan PW, Ward A, Gibadulinova A, Oveckova I, Pastorekova S, Pastorek J, Martinez AR, Helin HO, Isola J. The calcium-binding protein S100P in normal and malignant human tissues. BMC Clin. Pathol. 2008;8:2. Piersma AH, Roelen B, Roest P, Haakmat-Hoesenie AS, van Achterberg TA, Mummery CL. Cadmium-induced inhibition of proliferation and differentiation of embryonal carcinoma cells and mechanistic aspects of protection by zinc. Teratology 1993;48(4):335–41. Popovici RM, Betzler NK, Krause MS, Luo M, Jauckus J, Germeyer A, Bloethner S, Schlotterer A, Kumar R, Strowitzki T, von Wolff M. Gene expression profiling of human endometrial-trophoblast interaction in a coculture model. Endocrinology 2006;147(12):5662–75. Powlin SS, Keng PC, Miller RK. Toxicity of cadmium in human trophoblast cells (JAr choriocarcinoma): role of calmodulin and the calmodulin inhibitor, zaldaride maleate. Toxicol. Appl. Pharmacol. 1997;144(2):225–34. Radio NM, Breier JM, Shafer TJ, Mundy WR. Assessment of chemical effects on neurite outgrowth in PC12 cells using high content screening. Toxicol. Sci.: Off. J. Soc. Toxicol. 2008;105(1):106–18. Stasenko S, Bradford EM, Piasek M, Henson MC, Varnai VM, Jurasovic J, Kusec V. Metals in human placenta: focus on the effects of cadmium on steroid hormones and leptin. J. Appl. Toxicol.: JAT 2010;30(3):242–53. Thevenod F, Lee WK. Toxicology of cadmium and its damage to mammalian organs. Met. Ions Life Sci. 2013;11:415–90. Thompson J, Bannigan J. Cadmium: toxic effects on the reproductive system and the embryo. Reprod. Toxicol. 2008;25(3):304–15. Tothova V, Gibadulinova A. S100P, a peculiar member of S100 family of calciumbinding proteins implicated in cancer. Acta Virol. 2013;57(2):238–46. Zhang Q, Zhou T, Xu X, Guo Y, Zhao Z, Zhu M, Li W, Yi D, Huo X. Downregulation of placental S100P is associated with cadmium exposure in Guiyu: an e-waste recycling town in China. Sci. Total Environ. 2011;410–411:53–8. Zhang D, Ma C, Sun X, Xia H, Zhang W. S100P expression in response to sex steroids during the implantation window in human endometrium. Reprod. Biol. Endocrinol.: RB&E 2012;10:106. Zhu HY, Wang JX, Tong XM, Xue YM, Zhang SY. S100P regulates trophoblast-like cell proliferation via P38 MAPK pathway. Gynecol. Endocrinol.: Off. J. Int. Soc. Gynecol. Endocrinol. 2015;31(10):796–800.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
Contents lists available at ScienceDirect
Experimental and Toxicologic Pathology journal homepage: www.elsevier.de/etp
S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation Taimei Zhoua,1, Haiying Wanga,1, Shen Zhanga , Xinglin Jianga , Xiaolong Wei, MDb,* a b
Department of Medical Laboratory, Hunan University of Medicine, Huaihua 418000, China Department of Pathology, Cancer Hospital of Shantou University Medical College, Shantou 515031, China
A R T I C L E I N F O
Article history: Received 28 March 2016 Received in revised form 15 July 2016 Accepted 7 September 2016 Keywords: S100P Cadmium Cell proliferation Placenta
A B S T R A C T
Cadmium, a common and highly toxic pollutant, has been known to accumulate high concentrations in placenta with deleterious effects on placental structure and function. Cadmium inhibits cell proliferation in placenta via targeting metal binding proteins. S100P, a Ca2+-binding protein, plays an important role in promoting cell proliferation and our previous study found its downregulation was linked to cadmium exposure in Guiyu, a famous e-waste recycling town in China. So, the present study was aimed to define whether cadmium inhibited cell proliferation through interfering with S100P. Using human trophoblastderived HTR-8/SVneo cells as a model in vitro, we showed that cadmium exposure led to decreases in both cell proliferation and S100P expression. Knockdown of S100P in HTR-8/SVneo cells led to an obvious decrease of cell proliferation, and upregulation of S100P resulted in a significant increase of cell proliferation. Furthermore, after 24 h of exposure to cadmium (20 mM), cells transfected with pcDNA3.1S100P showed a 1.3-fold higher S100P protein level, 38% higher proliferation evaluated with MTT assay than cells with no transfection, indicating that S100P expression attenuated cadmium-induced inhibition of cell proliferation. Taken together, we demonstrate that cadmium inhibits S100P expression and cell proliferation in placenta, meanwhile, S100P expression affects cell proliferation. Thus, our study is the first to indicate that cadmium may induce inhibition of placental trophoblast cell proliferation through targeting S100P. ã 2016 Elsevier GmbH. All rights reserved.
1. Introduction Cadmium is a widespread environmental toxicant releasing from industrial and agricultural waste (Faroon et al., 2012). Exposure to Cadmium for the general population occurs mainly through diet, work and tabacco smoking (Jarup and Akesson, 2009). It has been identified that cadmium can accumulate in many organs, including kidney, liver, bone and nervous system, and result in adverse effects on these organs (Thevenod and Lee, 2013). Additionally, the placenta is a major target of cadmium in pregnant women for its barrier function against the transfer of heavy metals to the fetus (Myllynen et al., 2005). Cadmium can accumulate high concentrations in placenta (Esteban-Vasallo et al., 2012) and prenatal exposure to cadmium can induce both
* Corresponding author. E-mail addresses: [email protected] (T. Zhou), [email protected] (H. Wang), [email protected] (S. Zhang), [email protected] (X. Jiang), [email protected] (X. Wei). 1 These authors contributed equally to the work.
structural and functional abnormalities of placenta (Baranski et al., 1982; Di Sant'Agnese et al., 1983). It’s reported that cadmium exposure may lead to implantation delay, premature delivery, placental necrosis and early pregnancy loss by mechanisms such as oxidative stress, endocrine disorders and altered ion transportation (Kawai et al., 2002; Kippler et al., 2010, 2012; Levin et al., 1981; Lin et al., 1997; Stasenko et al., 2010). In addition, inhibition of cell proliferation has been suggested to be a potential mechanism involved in cadmium-induced impairment on placental development (Piersma et al., 1993; Powlin et al., 1997; Thompson and Bannigan, 2008). However, it is poorly known about the molecular targets of cadmium toxicity in placenta. Cadmium treatment was proved to decrease cytosolic Ca2+ binding activities and downregulate the expression of a Ca2 + -binding protein, HCaBP of trophoblastic cells (Lin et al., 1997), suggesting that the exposure to cadmium can deregulate the expression of Ca2+-binding proteins. Among the Ca2+-binding proteins, S100P, a member of the Ca2+-binding S100 protein family, attracts our attention. S100P was originally purified from the placenta and strongly expressed in trophoblast cells (Becker et al.,
http://dx.doi.org/10.1016/j.etp.2016.09.002 0940-2993/ã 2016 Elsevier GmbH. All rights reserved.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
2
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
Table 1 Primers for real-time PCR. Primer sequence(50 to 30 )
Size(bp)
Annealing Tm( C)
S100P
F:GGAGAAGGAGCTACCAGG R: GCCACGAACACGATGAAC
126
60
b-actin
F: AGCGAGCATCCCCCAAAGTT R: GGGCACGAAGGCTCATCATT
285
60
cadmium exposure on S100P expression and cell proliferation separately at different concentrations. Then we tested the effect of S100P expression on cell preliferation. Finally, we investigated the influence of increased S100P level on cell proliferation under cadmium exposure. 2. Materials and methods
F: forward. R: reverse.
2.1. Cell culture
1992; Parkkila et al., 2008). Though little is known about its precise function in placenta, it’s important roles in tumor progression in promoting cellular proliferation and enhancing survival in different tumor cell types have been well studied (Arumugam et al., 2004; Tothova and Gibadulinova, 2013). Recently, a study reported that S100P can also regulate the proliferation of trophoblast-like cells, showing it’s potential role in pregnant development (Zhu et al., 2015). Furthermore, our previous study found that placentas from women living in Guiyu, a major processing center for electronic waste, showed lower S100P levels compared with placentas from women living in Shantou, an area without electronic waste pollution, moreover, the downregulation of S100P was associated with cadmium exposure (Zhang et al., 2011). This finding suggests S100P may be a molecular target of heavy metals, especially cadmium in placenta. As mentioned above, we hypothesized that cadmium might induce the deregulation of cell proliferation in placenta partly through targeting S100P. In the present study, we examined this hypothesis using human extravillous trophoblast-derived HTR-8/ SVneo cells as a model in vitro. We evaluated the effects of
The human trophoblast-derived HTR-8/SVneo cells were purchased from Jenniobio Biotechnology (Guangzhou, China). The cell line was cultured in RPMI 1640 medium (Life Technologies, New York, USA) supplemented with 10% fetal bovine serum and incubated at 37 C with 5% CO2. 2.2. MTT assay HTR-8/SVneo cells were seeded in 96-well plates at density of 1 104 cells/well. After being 80% confluent, Cells were treated with Cadmium chloride (CdCl2) (Sigma, USA) for 24 h at the doses of 2 and 20 mM. CdCl2 solutions were prepared using dimethyl sulfoxide (DMSO, sigma, USA) as described by Radio et al. (2008), and the final DMSO concentration in the culture media was 0.1%. In the vehicle control, cells were treat with 0.1% DMSO only. After incubation, cell proliferation was assessed by MTT assay with 3 repeated wells. In MTT assay, 20 ml of 5 mg/ml MTT solution was added in each well, and the plate was incubated for 4 h at 37 C. The medium was then removed and the colored reaction product was solubilized in
Fig. 1. Effects of CdCl2 on proliferation of HTR-8/SVneo cells and S100P expression. A. Cell proliferation was determined by MTT assay. Cells were treated with 2 and 20 mM CdCl2 for 24 h. As a contol, CdCl2 was replaced with DMSO. B. Relative mRNA levels of S100P by real-time PCR. C. Protein levels of S100P by western blot anaysis. The band intensities were quantitated using ImageJ software. The results were normalieze with b-actin and expressed as fold change relative to control. Data are represented as mean SEM of at least 3 independent experiments. *P < 0.05 vs. vehicle control.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
150 ml DMSO under gentle shaking for 10 min. Absorbance was measured at 570 nm using an ELISA reader. The corrected absorbance of each sample was calculated by comparison with that of control. 2.3. Cell transfection HTR-8/SVneo cells were seeded in 60 mm culture dishes 24 h before transfection. We transfected 5 mg pcDNA3.1 empty vector or pcDNA3.1-S100P expression vector (GenePharma, Shanghai Co. Ltd., China) into HTR-8/SVneo cells by using Lipofectamine 2000 (Invitrogen, Carlsbad, CA). Specific small interference-RNAs (siRNAs) against S100P were synthesized by Genephama Biotech (Shanghai Co. Ltd., China). S100P siRNA-1 sequences were as follows: 50 -ACAAGGAUGCCGUGGAUAAdTdT-30 (sense) and 50 UUAUCCACGGCAUCCUUGUdTdT-30 (antisense). S100P siRNA-2 sequences were: 50 -CGAGUAUGAUCCUACCAGA-30 (sense) and 50 UCUGGUAGGAUCAUACUCG-30 (antisense). Scramble siRNA sequences were 50 -UUCUCCCGAACGUUCACGU-30 (sense) and 50 ACGUGACACGUUCGGAGAA-30 (antisense). Cells were transfected with 200 pmol siRNA at 50% confluence using Lipofectamine 2000 reagent according to the manufacturer’s protocol. After transfection for 24 h, cells were collected for further assays. 2.4. Real-time PCR Total RNA was isolated from cells using Trizol Regent kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol.
3
1 mg total RNA was reverse-transcribed into cDNA using PrimeScript1 RT reagent Kit (TaKaRa, Dalian, China). Real-time PCR involved 2 ml cDNA and the ABI PRISM 7300 Sequence Detection System (Applied Biosystems, Foster City, CA). b-actin, the housekeeping gene, was used as an internal control. The specific primers for S100P and b-actin were indicated in Table 1. All samples were amplified in triplicate. Relative mRNA levels of S100P were calculated by the 2DDt method (Livak and Schmittgen, 2001). 2.5. Western blot analysis Cells were collected and lysed with RIPA buffer (Sigma-Aldrich, USA), and then the protein concentration was determined using the BCA Protein Assay Kit (Beyontime, Jiangsu, China). The subsequent steps were performed as described previously (Zhang et al., 2011), and finally western blot band intensities were quantitated and normalized to the control of b-actin using ImageJ software. 2.6. Statistical analysis Data were represented as mean SEM. Differences among variables were analyzed by independent-samples t-test or oneway analysis of variance (ANOVA) with Student-Newman-Keuls for multiple comparisons. Each experiment was performed at least in triplicate. A value of P < 0.05 was considered statistically
Fig. 2. Knockdown of S100P expression (A) and inhibition of proliferation (B) of HTR-8/SVneo cells by siRNA. *P < 0.05 vs. control.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
4
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
significant. All data analysis involved use of SPSS ver. 16.0 software (SPSS Inc., Chicago, IL). 3. Results 3.1. CdCl2 inhibits proliferation of HTR-8/SVneo cells During pre-study stage, we preliminarily treated HTR-8/SVneo cells with either control (0.1% DMSO) or four different concentrations of cadmium (0.5, 2, 20 and 40 mM) and counted the attached and floating cells in each group, as reported in previous study (Powlin et al., 1997). No significant difference in cell count was observed in cells treated with 0.5 mM CdCl2 for 24 h compared with the cells of control. However, exposure to 40 mM CdCl2 resulted in a dramatic drop in cell count and floating cells were almost dead. Meanwhile, the typan blue exclusion assay indicated that most of the cells were viable after treated with 2 and 20 mM CdCl2, which suggested that these concentrations of cadmium mainly inhibited the proliferation of HTR-8/SVneo cells, but did not significantly induce cell death (data not shown). Therefore, we selected the doses of 2 and 20 mM in our study. To study the effect of cadmium on proliferation of trophoblast cells, HTR-8/SVneo cells were treated with CdCl2 (2 and 20 mM) for 24 h and cadmium-induced deregulation of cell proliferation was measured with MTT assay. As shown in Fig. 1, MTT (Fig. 1A) assay revealed that CdCl2 significantly decreased the proliferation of HTR-8/SVneo cells dose- dependently and the cell proliferation reduced 40% at 2 mM CdCl2 and 71% at 20 mM CdCl2 when compared with control.
3.2. CdCl2 reduces S100P expression To determine whether S100P expression was regulated by single exposure to cadmium, mRNA and protein levels of S100P in HTR-8/SVneo cells after 24 h of exposure to CdCl2 (2 and 20 mM) were separately detected by real-time PCR and western blot analysis. Similar to its effect on cell proliferation, CdCl2 led to decreases in both mRNA and protein levels of S100P with the final effect at 20 mM indicating 44% (Fig. 1B) and 37% (Fig. 1C) of control respectively. 3.3. Down-regulated expression of S100P inhibits proliferation of HTR8/SVneo cells To investigate the potential function of S100P against cadmiuminduced toxicity, we knocked down the expression of S100P in HTR-8/SVneo cells using S100P siRNA-1 and S100P siRNA-2 individually for 24 h. As show in Fig. 2A, the protein expression level of S100P was decreased 49% and 54% respectively. Accompanied with the decrease of S100P expression, cell proliferation reduced about 35% and 30% evaluated by MTT assay (Fig. 2B). 3.4. Overexpression of S100P attenuates CdCl2-induced inhibition of cell proliferation To further evaluate the role of S100P expression in cell proliferation under cadmium exposure, firstly, we forced S100P expression in HTR-8/SVneo cells. And then, cells were treated with
Fig. 3. Upregulation of S100P in HTR-8/SVneo cells at mRNA (A) and protein (B) levels. (C) Effect of upregulation of S100P expression on the proliferation ability of HTR-8/ SVneo cells. *P < 0.05 vs. pcDNA3.1.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
CdCl2 (20 mM) for 24 h, as a control, CdCl2 was replaced with DMSO. After transfection, S100P mRNA was about 343.7-fold increase with pcDNA3.1-S100P infection than with pcDNA3.1 infection (Fig. 3A), and the result of western blot analysis also indicated a 1.4-fold increase in S100P protein level (Fig. 3B). Significant increase of proliferation was also observed in cells transfected with pcDNA3.1-S100P compared with cells transfected with pcDNA3.1 (Fig. 3C). After exposure to CdCl2, we found that S100P protein levels were dramatically decreased when compared with untreated control group (Fig. 4A). Among the treated groups, S100P protein level in cells with pcDNA3.1-S100P transfection was 1.2-fold higher than cells with pcDNA3.1 transfection and 1.3-fold higher than cells without transfection, no difference was found between group with pcDNA3.1 transfection and group without transfection. Cell proliferation showed similar change pattern after exposure to CdCl2, and over expression of S100P significantly attenuated CdCl2-induced inhibition of cell proliferation since the proliferation evaluated with MTT assay was 38% higher in pcDNA3.1 transfection group than no transfection group (Fig. 4B). 4. Discussion Deregulation of cell proliferation is one of the most important mechanisms inferring to cadmium toxicity. Cadmium has dual effects on cell death and survival. On one hand, cadmium may inhibit cell proliferation and induce cell death leading to the impairment of target tissues or organs. On the other hand, cadmium can stimulate cell proliferation and act as a well-known carcinogen. Inhibition or promotion of cell proliferation denpends on factors such as cell type, the duration and the concentration of exposure. In this study, utilizing human trophoblast-derived HTR-
5
8/SVneo cells as a model, we demonstrated decreases of cell proliferation after treatment with 2 and 20 mM CdCl2 for 24 h. Cadmium inhibits cell proliferation via many different mechanisms and the most probable path is interfering with metal binding proteins, such as metallothionein (Babula et al., 2012) and calmodulin, an EF hand Ca2+-binding protein (Powlin et al., 1997). In our study, we found that S100P, an EF hand Ca2+-binding protein belonging to the S100 family, decreased in a same manner as the reduction of cell proliferation when exposure to cadmium, suggesting S100P might be a molecular target of cadmium-induced inhibition of cell proliferation. To further define the effects of S100P expression on cell proliferation, we separately transfected HTR-8/SVneo cells with S100P siRNA and pcDNA3.1-S100P. As expected, when S100P expression was down-and up-regulated, the proliferation of HTR-8/SVneo cells showed corresponding decrease and increase. Furthermore, increased expression of S100P significantly weakened the inhibition of cell proliferation caused by cadmium. Our results indicated that the expression of S100P affected the proliferation of human placental trophoblast cells. These findings provide important clues to the function of placental S100P in cadmium toxicity. Although the exact role of S100P in placenta remains unclear, its contribution to tumorigenesis, including tumor growth, metastasis and invasion has been well established (Jiang et al., 2012). Increased levels of S100P have been identified in different carcinomas and S100P can stimulate cell proliferation and survival by binding to receptor for advanced glycation end-products (RAGE) and via activation of ERK/MAPK pathway (Arumugam et al., 2004). Recently, S100P was found to regulate JAR cells proliferation via p38 MAPK pathway (Zhu et al., 2015), which may also be involved in cadmium-induced deregulation of cell proliferation in placenta. Furthermore, studies showed a significant increase of S100P
Fig. 4. Effects of CdCl2 (20 mM) on S100P protein expression (A) and proliferation ability (B) of HTR-8/SVneo cells transfected with or without pcDNA3.1-S100P plasmid. *P < 0.05 vs. control, #P < 0.05 vs. the other two CdCl2 treated groups.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002
G Model ETP 50975 No. of Pages 6
6
T. Zhou et al. / Experimental and Toxicologic Pathology xxx (2016) xxx–xxx
expression in endometrial stromal cells by co-cultured with trophoblast cells (Popovici et al., 2006), and a peak expression of S100P in human endometrium during the implantation window (Zhang et al., 2012), indicating its potential role in embryo implantation. Given that cadmium-induced inhibition of trophoblast cell proliferation have a major influence in the establishment of a viable pregnancy, the decreased expression of placental S100P induced by cadmium might be linked to deleterious outcomes, such as retardation of trophoblastic outgrowth and development, even placental necrosis by interfering with the cell proliferation of trophoblast cells. The mechanism of cell proliferation regulated by S100P and the precise function of S100P in placenta under cadmium exposure need to be further studied. 5. Conclusions For the first time, this study demonstrates that S100P expression and cell proliferation of HTR-8/SVneo cells are inhibited by cadmium exposure. Moreover, the expression of S100P affects cell proliferation under cadmium treatment. Thus, the mechanism by which cadmium interferes with cell proliferation, at least in human trophoblast-derived HTR-8/SVneo cells, may be through targeting S100P. Conflict of interest None. Acknowledgement This study was financially supported by the Scientific Research Projects of the Department of Education in Hunan Province (No. 12C1194). The authors declare they have no competing financial interests. References Arumugam T, Simeone DM, Schmidt AM, Logsdon CD. S100P stimulates cell proliferation and survival via receptor for activated glycation end products (RAGE). J. Biol. Chem. 2004;5059–65. Babula P, Masarik M, Adam V, Eckschlager T, Stiborova M, Trnkova L, Skutkova H, Provaznik I, Hubalek J, Kizek R. Mammalian metallothioneins: properties and functions. Metallomics: Integr. Biometal Sci. 2012;4(8):739–50. Baranski B, Stetkiewicz I, Trzcinka-Ochocka M, Sitarek K, Szymczak W. Teratogenicity, fetal toxicity and tissue concentration of cadmium administered to female rats during organogenesis. J. Appl. Toxicol.: JAT 1982;2(5):255–9. Becker T, Gerke V, Kube E, Weber K. S100P, a novel Ca(2+)-binding protein from human placenta. cDNA cloning, recombinant protein expression and Ca2+ binding properties. Eur. J. Biochem./FEBS 1992;207(2):541–7. Di Sant'Agnese PA, Jensen KD, Levin A, Miller RK. Placental toxicity of cadmium in the rat: an ultrastructural study. Placenta 1983;4(2):149–63. Esteban-Vasallo MD, Aragones N, Pollan M, Lopez-Abente G, Perez-Gomez B. Mercury, cadmium, and lead levels in human placenta: a systematic review. Environ. Health Perspect. 2012;120(10):1369–77.
Faroon, O., Ashizawa, A., Wright, S., Tucker, P., Jenkins, K., Ingerman, L., Rudisill, C., 2012. Toxicological Profile for Cadmium, Atlanta GA, pp. 277–331. Jarup L, Akesson A. Current status of cadmium as an environmental health problem. Toxicol. Appl. Pharmacol. 2009;238(3):201–8. Jiang H, Hu H, Tong X, Jiang Q, Zhu H, Zhang S. Calcium-binding protein S100P and cancer: mechanisms and clinical relevance. J. Cancer Res. Clin. Oncol. 2012;138 (1):1–9. Kawai M, Swan KF, Green AE, Edwards DE, Anderson MB, Henson MC. Placental endocrine disruption induced by cadmium: effects on P450 cholesterol sidechain cleavage and 3beta-hydroxysteroid dehydrogenase enzymes in cultured human trophoblasts. Biol. Reprod. 2002;67(1):178–83. Kippler M, Hoque AM, Raqib R, Ohrvik H, Ekstrom EC, Vahter M. Accumulation of cadmium in human placenta interacts with the transport of micronutrients to the fetus. Toxicol. Lett. 2010;192(2):162–8. Kippler M, Hossain MB, Lindh C, Moore SE, Kabir I, Vahter M, Broberg K. Early life low-level cadmium exposure is positively associated with increased oxidative stress. Environ. Res. 2012;112:164–70. Levin AA, Plautz JR, di Sant'Agnese PA, Miller RK. Cadmium: placental mechanisms of fetal toxicity. Placenta 1981;(Suppl. 3):303–18. Lin FJ, Fitzpatrick JW, Iannotti CA, Martin DS, Mariani BD, Tuan RS. Effects of cadmium on trophoblast calcium transport. Placenta 1997;18(4):341–56. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.) 2001;25(4):402–8. Myllynen P, Pasanen M, Pelkonen O. Human placenta: a human organ for developmental toxicology research and biomonitoring. Placenta 2005;26 (5):361–71. Parkkila S, Pan PW, Ward A, Gibadulinova A, Oveckova I, Pastorekova S, Pastorek J, Martinez AR, Helin HO, Isola J. The calcium-binding protein S100P in normal and malignant human tissues. BMC Clin. Pathol. 2008;8:2. Piersma AH, Roelen B, Roest P, Haakmat-Hoesenie AS, van Achterberg TA, Mummery CL. Cadmium-induced inhibition of proliferation and differentiation of embryonal carcinoma cells and mechanistic aspects of protection by zinc. Teratology 1993;48(4):335–41. Popovici RM, Betzler NK, Krause MS, Luo M, Jauckus J, Germeyer A, Bloethner S, Schlotterer A, Kumar R, Strowitzki T, von Wolff M. Gene expression profiling of human endometrial-trophoblast interaction in a coculture model. Endocrinology 2006;147(12):5662–75. Powlin SS, Keng PC, Miller RK. Toxicity of cadmium in human trophoblast cells (JAr choriocarcinoma): role of calmodulin and the calmodulin inhibitor, zaldaride maleate. Toxicol. Appl. Pharmacol. 1997;144(2):225–34. Radio NM, Breier JM, Shafer TJ, Mundy WR. Assessment of chemical effects on neurite outgrowth in PC12 cells using high content screening. Toxicol. Sci.: Off. J. Soc. Toxicol. 2008;105(1):106–18. Stasenko S, Bradford EM, Piasek M, Henson MC, Varnai VM, Jurasovic J, Kusec V. Metals in human placenta: focus on the effects of cadmium on steroid hormones and leptin. J. Appl. Toxicol.: JAT 2010;30(3):242–53. Thevenod F, Lee WK. Toxicology of cadmium and its damage to mammalian organs. Met. Ions Life Sci. 2013;11:415–90. Thompson J, Bannigan J. Cadmium: toxic effects on the reproductive system and the embryo. Reprod. Toxicol. 2008;25(3):304–15. Tothova V, Gibadulinova A. S100P, a peculiar member of S100 family of calciumbinding proteins implicated in cancer. Acta Virol. 2013;57(2):238–46. Zhang Q, Zhou T, Xu X, Guo Y, Zhao Z, Zhu M, Li W, Yi D, Huo X. Downregulation of placental S100P is associated with cadmium exposure in Guiyu: an e-waste recycling town in China. Sci. Total Environ. 2011;410–411:53–8. Zhang D, Ma C, Sun X, Xia H, Zhang W. S100P expression in response to sex steroids during the implantation window in human endometrium. Reprod. Biol. Endocrinol.: RB&E 2012;10:106. Zhu HY, Wang JX, Tong XM, Xue YM, Zhang SY. S100P regulates trophoblast-like cell proliferation via P38 MAPK pathway. Gynecol. Endocrinol.: Off. J. Int. Soc. Gynecol. Endocrinol. 2015;31(10):796–800.
Please cite this article in press as: T. Zhou, et al., S100P is a potential molecular target of cadmium-induced inhibition of human placental trophoblast cell proliferation, Exp Toxicol Pathol (2016), http://dx.doi.org/10.1016/j.etp.2016.09.002