Saliva initiates the formation of pro-inflammatory macrophages in vitro

Archives of Oral Biology 73 (2017) 295–301

Contents lists available at ScienceDirect

Archives of Oral Biology journal homepage: www.elsevier.com/locate/aob

Saliva initiates the formation of pro-inflammatory macrophages in vitro Solmaz Pourgonabadia , Heinz-Dieter Müllera,b , João Rui Mendesa , Reinhard Grubera,b,c,* a

Department of Oral Biology, Dental School, Medical University of Vienna, Austria Department of Preventive, Restorative and Pediatric Dentistry, School of Dental Medicine, University of Bern, Switzerland c Austrian Cluster for Tissue Regeneration, Austria b

A R T I C L E I N F O

A B S T R A C T

Article history: Received 10 May 2016 Received in revised form 26 July 2016 Accepted 14 October 2016

Objectives: Saliva can support oral wound healing, a process that requires a temporary inflammatory reaction. We have reported previously that saliva provokes a strong inflammatory response in oral fibroblasts. Bone marrow cells also give rise to macrophages, a heterogeneous subset of cell population involved in wound healing. Lipopolysaccharide (LPS) and interleukin 4 (IL-4) induce activation of pro-(M1), and anti-(M2) inflammatory macrophages, respectively. Yet, the impact of saliva on programming bone marrow cells into either M1 or M2 macrophages remains unclear . Design: Herein, we examined whether sterile saliva affects the in vitro process of macrophage polarization based on murine bone marrow cultures and RAW264.7 mouse macrophages. Results: We report that sterile saliva, similar to lipopolysaccharides, provoked a robust activation of the M1 phenotype which is characterized by a strong increase of the respective genes IL-12 and IL-6, based on a real-time gene expression analysis, and for IL-6 with immunoassay. Arginase-1 and Ym1, both genes characteristic for the M2 phenotype, were not considerably modulated by saliva. Inhibition of TLR4 signaling with TAK-242, blocking NFkB signaling with Bay 11-7085, but also autoclaving saliva greatly reduced the development of the M1 phenotype. Conclusion: These data suggest that saliva activates the TLR4 dependent polarization into proinflammatory M1 macrophages in vitro. ã 2016 Elsevier Ltd. All rights reserved.

Keywords: Saliva Inflammation Primary macrophages RAW264.7 Mouse TLR4

1. Introduction Saliva is a unique and multifunctional oral body fluid necessary for moistening and lubrication, taste and smell, digestion, as well as protection of the oral mucosa and the tooth surface (Dawes et al., 2015). Support of wound healing, as it may become necessary after cheek bites, tooth extractions, and surgery, is also among the properties of saliva (Dawes et al., 2015). Saliva reaches sites where the integrity of the oral mucosa is impaired (Presland & Jurevic, 2002), for example, upon chemotherapy and radiation (Squier & Kremer, 2001). In a pig model, wound epithelialization requires one week, suggesting that saliva can reach superficial cells involved in the inflammatory phase of wound healing (Wong et al., 2009). The concept that saliva contributes to wound healing is indirectly supported by the observation that desalivated rodents experience impaired oral (Bodner, Dayan, Pinto, & Hammel, 1993; Bodner, Dayan, Rothchild, & Hammel, 1991b; Mohn et al., 2015) and skin wound healing (Bodner, Knyszynski, Adler-Kunin, &

* Corresponding author at : Department of Oral Biology, Medical University of Vienna, Austria. E-mail address: [email protected] (R. Gruber). http://dx.doi.org/10.1016/j.archoralbio.2016.10.012 0003-9969/ã 2016 Elsevier Ltd. All rights reserved.

Danon, 1991c). Moreover, saliva contains growth factors, (Zelles, Purushotham, Macauley, Oxford, & Humphreys-Beher, 1995) including epidermal growth factor (Noguchi, Ohba, & Oka, 1991), and other bioactive molecules such as histatin (Oudhoff et al., 2008) that might have an effect on oral wound healing. In addition, tissue factor accelerates blood coagulation (Zacharski & Rosenstein, 1979). The cellular and molecular mechanism of how saliva can contribute to oral wound healing, however, remains unknown. Macrophages play an essential role in wound healing as indicated by depletion (Leibovich & Ross, 1975) and dysfunctional (Goren et al., 2009; Mirza, DiPietro, & Koh, 2009) models. Macrophages polarize either to an inflammatory phenotype after stimulation with lipopolysaccharide or interferon-g or to an alternatively activated phenotype induced by IL-4 or IL-13 (Mosser & Edwards, 2008). The inflammatory and the alternatively activated phenotype are commonly termed M1 and M2 macrophages, respectively (Mosser & Edwards, 2008). M1 cells are characterized by their expression of cytokines such as interleukin (IL)-12 and IL-6. M2 macrophages typically express arginase-1 and YM1, the latter gene is also termed chitinase-like 3 (Biswas & Mantovani, 2010). During wound healing, macrophages undergo a transition from M1 pro-inflammatory to an alternatively activated

296

S. Pourgonabadi et al. / Archives of Oral Biology 73 (2017) 295–301

phenotype that supports granulation tissue formation and epithelialization (Ferrante & Leibovich, 2012). Once the integrity of the epithelial barrier is impaired, saliva can come into contact with macrophages. At least theoretically, saliva can cause macrophages polarization thereby indirectly affecting early wound healing. Wound healing requires both the inflammatory M1 and the alternatively activated M2 macrophages (Novak & Koh, 2013). Saliva, when prepared freshly and sterile filtered, causes a strong pro-inflammatory response of oral fibroblasts in vitro (Cvikl, Lussi, Moritz, Sculean, & Gruber, 2015b). Saliva also elicits a complete inhibition of osteoclastogenesis in murine bone marrow cultures (Caballe-Serrano et al., 2015). The molecular mechanism responsible for the pro-inflammatory activity of saliva has not been completely determined, but presumably involves endotoxins, particular lipopolysaccharides (LPS). Endotoxins are released from gram-negative microorganisms and an estimated 0–20 ng per milliliter mouth rinse have been reported (Leenstra, van Saene, van Saene, & Martin, 1996; Millns, Martin, & Williams, 1999). Lipopolysaccharides bind to pattern recognition receptors, particular toll-like receptor 4 (TLR4) (Park & Lee, 2013). To study signaling, a small inhibitor of TLR4 was introduced (Ii et al., 2006); TAK-242 prevents the association of TLR4 with adaptor proteins (Matsunaga, Tsuchimori, Matsumoto, & Ii, 2011). TAK-242 greatly inhibited the effects of saliva on the pro-inflammatory response of oral fibroblasts (Muller, Caballé-Serrano, Lussi, & Gruber, 2016a; Muller, Cvikl, Lussi, & Gruber, 2016b) and on osteoclastogenesis (Muller et al., 2016a; Muller et al., 2016b). Consistent with TLR4 activation, saliva activates NFkB signaling in vitro (Cvikl et al., 2015b). It is particular the TLR4 that regulates wound healing (Suga et al., 2014). Further support for an endotoxin-mediated cell response comes from observations that autoclaved saliva had a considerably lower activity than saliva kept at room temperature (Cvikl, Lussi, Moritz, Sawada, & Gruber, 2015a; Cvikl et al., 2015b). Endotoxins lose activity upon exposure to heat (Fujii, Takai, & Maki, 2002). This does not rule out that other salivary components, besides endotoxins, provoke an inflammatory response in vitro. Considering that saliva requires TLR4 signaling for its in vitro activity on fibroblast and bone marrow cells, and that TLR4 signaling favors the development of M1 macrophages, we tested the hypothesis that saliva causes the polarization of cells into the M1 pro-inflammatory phenotype involving TLR4 signaling. 2. Materials and methods 2.1. Isolation and culture of murine bone marrow-derived macrophages and RAW264.7 cells Bone marrow cells were collected from the femora and tibiae of Balb/c mice aged 6–8 weeks old. The mice were sacrificed and the femora and tibiae of the mice were removed. Bone marrow cells were seeded at 1 106 cells/cm2 into 6-well plates and grown for 7 days in Dulbecco Modified Medium (DMEM) supplemented with 10% fetal bovine serum, antibiotics (all Invitrogen, Grand Island, NY) and with 15% supernatant from L-929 cells (Ying, Cheruku, Bazer, Safe, & Zhou, 2013). RAW 264.7 macrophage-like cells (ATCC, Manassas, VA) were expanded in growth medium and seeded 1 106 cells/cm2 into 6-well plates. Bone marrow macrophages and RAW 264.7 were exposed to the respective treatments for another 24 h under standard conditions at 37  C, 5% CO2, and 95% humidity. 2.2. Saliva sampling and thermal treatment Whole human saliva was collected from the authors who are non-smokers and gave their informed consent. Saliva flow was stimulated by chewing paraffin wax (Ivoclar Vivadent AG, Schaan,

Liechtenstein) without eating and drinking for 1 h prior to collection. Immediately after collection, saliva was centrifuged at 4,000g for 5 min. The saliva supernatant was passed through a filter with a pore diameter of 0.2 mm (Diafil PS, Graphic Controls/ DIA-Nielsen GmbH & Co. KG, Düren, Germany). In indicated experiments, sterile saliva was subjected to heating at 95  C or 120  C for 30 min. For cell exposure, saliva was used individually and the data from independent experiments with the three donors were pooled. Saliva was sampled on the day of cell exposure. For does- and time response experiments, saliva from frozen stocks was used. Endotoxin detection was performed with a Limulus amebocyte lysate assay (LAL; Life Technologies, Carlsbad, USA). 2.3. Stimulation of murine bone marrow-derived macrophage and RAW 264.7 cells Macrophages were exposed to LPS from Escherichia coli 0111:B4 at 100 ng/ml (Sigma-Aldrich, St. Louis, MO, USA), recombinant mouse IL-4 at 10 ng/ml (Prospec, Ness-Ziona, Israel), or 5% saliva for 24 h. All other experiments were performed with RAW 264.7 cells subjected to LPS, saliva alone or in combination with 25 mM of TAK242 (Merck Millipore, Billerica, MA), a TLR4 receptor inhibitor, and 10 mM BAY11-7082 (Sigma), a selective and irreversible inhibitor of the TNF-a-inducible phosphorylation of IkBa. After 24 h, the supernatant was harvested and RNA was isolated. Dose-response (5; 0.5; 0.05; 0.005% saliva for 24 h) and time-response (1, 3, 6 and 24 h with 5% saliva) curves of pooled saliva samples were prepared with RAW 264.7 cells. To simulate macrophages being entrapped in fibrin matrix, RAW 264.7 cells in 12-well plates were overlaid with 300 ml of 1% plasminogen-free fibrinogen (CoaChrom Diagnostica GmbH, Maria Enzersdorf, Austria) in serum-free medium and 3 units human thrombin (Sigma). RAW 264.7 cells were then exposed to 5% saliva for 24 h. 2.4. Reverse transcription polymerase chain reaction and immunoassay Total RNA was harvested with the RNA Isolation Kit (Jena Bioscience, Jena, Germany). Reverse transcription (RT) was performed with the SCRIPTcDNA Synthesis Kit (Jena Bioscience). RT-PCR was done with the Fast Start Universal SYBR Green Master using manufacturer’s instructions (Roche, Basel, Switzerland). Amplification was performed with the StepOnePlus Real-Time PCR System (Applied Biosystems, Life Technologies, Carlsbad, CA). Primer sequences were IL12p40 forw: TCAGAATCACAACCATCAGCA; rev: CGCCATTATGATTCAGAGACTG; IL-6 forw: GCTACCAAACTGGATATAATCAGGA; rev: CCAGGTAGCTATGGTACTCCAGAA; Arg-1 forw: GAATCTGCATGGGCAACC; rev: GAATCCTGGTACATCTGGGAAC; Ym1 forw: CACCATGGCCAAGCTCATTCTTGT; rev: TATTGGCCTGTCCTTAGCCCAACT (Tatano, Shimizu, & Tomioka, 2014); GAPDH forw: AACTTTGGCATTGTGGAAGG; rev: GGATGCAGGGATGATGTTCT (Tatano et al., 2014). Relative gene expression was calculated with the delta CT method. Reactions were run in triplicates. The supernatant was analyzed for IL-6 using an immunoassay assay according to the manufacturer’s instructions (R&D Systems, Minneapolis, MN). 2.5. Western blot RAW 264.7 macrophage-like cells were serum-starved overnight and then treated for 30 min as indicated. Cell extracts containing SDS buffer and protease inhibitors (PhosSTOP with cOmplete; Sigma, St. Louis, MO) were separated by SDS-PAGE and transferred onto nitrocellulose membranes (Whatman, GE Healthcare, General Electric Company, Fairfield, CT). Membranes were blocked and the binding of the first antibody (1000 dilution)

S. Pourgonabadi et al. / Archives of Oral Biology 73 (2017) 295–301

raised against phospho-p38, phospho-JNK, phospho-p65 (Cell Signaling Technology, Danvers, MA, USA), phospho-ERK, and betaactin (Santa Cruz Biotechnology, Santa Cruz, CA) was detected with the appropriate secondary antibody directly labeled with nearinfrared dyes (LI-COR Biosciences, Lincoln, NE) and visualized with the appropriate imaging system (LI-COR Biosciences). 2.6. Statistical analysis Primary culture experiments were performed twice. RAW264.7 experiments were repeated three times. Bars show the mean and standard deviation of the cumulative data from all experiments. Statistical analysis was based on paired t-tests with p < 0.05. 3. Results 3.1. Bone marrow-derived macrophages develop a M1 phenotype with saliva First, we determined the impact of saliva on polarization of primary macrophages from murine bone marrow. Exposure of the cells for 24 h with 5% saliva and with LPS, but not with IL-4, caused characteristic phenotypical changes; cells appear larger and with more granules compared to the respective controls (Fig. 1). The changes were accompanied by a strong increase of pro-inflammatory marker genes IL-12 and IL-6 (Fig. 2). Dose-response curves revealed that 0.05% saliva exposure for 24 h is sufficient to provoke IL-6 expression (data not shown). Time-response curves indicate that a 1-h exposure of cells to 5% saliva can cause the M1 response ( data not shown). Only IL-4, but not saliva led to an increase of arginase 1 (ARG1) and YM1, typical for M2 polarization (Fig. 2). Thus, saliva pushes bone marrow macrophages toward a proinflammatory phenotype. 3.2. RAW264.7 cells develop a M1 phenotype with saliva We then asked if the RAW264.7 cell line represents the findings observed with the primary bone marrow macrophages. RAW264.7 cell develop the typical granular appearance of M1 macrophages in the presence of saliva (Fig. 3). Consistent with the morphological changes, RAW264.7 cells exposed to saliva or LPS considerably increased the M1 marker genes IL-12 and IL-6 (Fig. 4). Dose- and time-response curves indicate that 0.05% saliva and an exposure time of one hour increased IL-6, also IL-12 expression (Tables 1 and 2, ). 0.5% saliva was sufficient to cause a maximal cell response, and the 24-h exposure caused a stronger response than the 6 h or less. Saliva also increased the production of IL-6 at the protein level (Table 3). Moreover, saliva can penetrate a fibrin matrix causing a 12.3  1.7-fold increase in IL-6 expression, similar to 10.7  3.2-fold with saliva alone. Again, IL-4 exposure of RAW264.7 cells led to increased ARG1 and YM1 levels, but saliva does not (Fig. 3). Thus, RAW264.7 serves as an alternative to bone marrow macrophages

297

to investigate the effects of saliva on macrophage polarization in vitro. 3.3. RAW264.7 cells require TLR4 and NFkB signaling to develop a M1 phenotype with saliva Recent findings with oral fibroblasts (Muller et al., 2016a; Muller et al., 2016b) and osteoclasts (Muller et al., 2016a; Muller et al., 2016b) suggest that saliva effects involve TLR4 and NFkB signaling. We, therefore, included a series of experiments with the pharmacological inhibitors TAK-242 and BAY11-7082, respectively. In support of the recent findings, TAK-242 and BAY11-7082 both inhibited the expression of IL-12 and IL-6 (Fig. 4). Also at the protein level, TAK-242 greatly inhibited the release of IL-6 into the supernatant of RAW264.7 cells exposed to saliva (Table 3). In line with these findings, Western blot analysis showed phosphorylation of MAPK and p65, as well as a visible decrease of phosphorylation signals in the presence of TAK-242 (Fig. 5). BAY11-7082 presumably acts downstream of MAPK because signals were almost unchanged (Fig. 5) (Fig. 6). 3.4. Autoclaving lowers the potential of saliva to push RAW264.7 cells toward an M1 phenotype Limulus test revealed >2500 Endotoxin Units/ml pooled sterilefiltered saliva. Based on the observations that endotoxins are thermolabile (Fujii et al., 2002), we performed experiments with saliva heated to 95  C and to 120  C. We report here that saliva at 95  C remained almost unchanged in its capacity to provoke M1 polarization (Fig. 7). At 120  C, however, saliva greatly lost its respective activity (Fig. 7). In line with the gene expression data are IL-6 protein levels that went up with saliva treated at 95  C but less at 120  C (Table 3). These data show that at least a part of the salivary activity driving RAW264.7 cells toward an M1 phenotype is sensitive to autoclaving. 4. Discussion The main finding of the present study was that saliva provoked the polarization of primary macrophages and RAW 264.7 macrophage-like cells toward the proinflammatory M1 phenotype. We also found that saliva requires TLR4 and downstream signaling via NFkB to exert its activity on IL-12 and IL-6 expression. The proinflammatory component of saliva was at least partially sensitive to autoclaving. These findings are consistent with reports that saliva holds a fraction that provokes an inflammatory response in oral fibroblasts (Cvikl et al., 2015a; Cvikl et al., 2015b). Also in support of the current findings are observations that murine bone marrow cells respond to saliva; in this setting, it was the inhibition of osteoclastogenesis (Caballe-Serrano et al., 2015). Based on our data, it is reasonable to assume that osteoclastogenesis was

Fig. 1. Primary macrophages develop a M1 phenotype with saliva. Exposure of the primary murine macrophages with 5% saliva and with 100 pg/ml LPS, but not with 10 ng/ml IL-4, cause characteristic changes of the phenotype; cells appear larger and with more granules than the respective controls.

298

S. Pourgonabadi et al. / Archives of Oral Biology 73 (2017) 295–301

Fig. 2. Primary macrophages express M1 marker genes with saliva. The phenotype changes were accompanied by a strong increase of pro-inflammatory (M1) marker genes IL-12 and IL-6. Only IL-4, but not saliva, led to a strong increase of arginase 1 (ARG1) and YM1, typical for the M2 phenotype. **p<0.01

Fig. 3. RAW264.7 cells develop a M1 phenotype with saliva. RAW264.7 cell develop the typical granular appearance of M1 macrophages in the presence of 5% saliva after 24 h of incubation.

Fig. 4. RAW264.7 cells express M1 marker genes with saliva. Consistent with the morphological changes, (A) RAW264.7 cells exposed to LPS responded with a considerably increase of the M1 marker genes IL-12 and IL-6. (B) IL-4 exposure caused RAW264.7 cells to increase ARG2 and YM1. (C) Saliva greatly stimulated IL-12 and IL-6 but not the M2 marker genes. **p<0.01

suppressed at the expense of M1 macrophages. In support of this concept, TAK-242 allowed osteoclastogenesis to occur in the presence of saliva (Muller et al., 2016a; Muller et al., 2016b). Also in line with the present research are data on blocking TLR4 signaling

Table 1 RAW 264.7 macrophage-like cells were exposed to various concentration of saliva for 24 h. Data show IL-6 expression in x-fold of untreated controls based on mean and standard deviation (SD) of two independent experiments.

Mean SD

5%

0.5%

0.05%

0.005%

8.3 4.6

8.4 4.3

1.9 0.4

0.9 0.1

in oral fibroblasts (Cvikl et al., 2015b; Muller et al., 2016a; Muller et al., 2016b). TLR4 requires CD14 to mediate the inflammatory response of the respective ligand, LPS. It might be thus relevant that soluble CD14 is present in human saliva, for example for the activation of CD14-negative cells, such as epithelial cells by LPS (Takayama et al., 2003). However, CD14 is characteristically present mainly on the surface of monocytes and macrophages (Haziot et al., 1988) as well as RAW264.7 cells (Lichtman, Wang, & Lemasters, 1998). Thus, M1 polarization by saliva likely occurs independently of soluble CD14. Taken together with the evidence that saliva holds endotoxins (Leenstra et al., 1996; Millns et al., 1999) as confirmed here, and the fundamental knowledge that LPS pushes M1 macrophage polarization (Mosser and Edwards, 2008),

S. Pourgonabadi et al. / Archives of Oral Biology 73 (2017) 295–301

299

Table 2 RAW 264.7 macrophage-like cells were exposed to 5% saliva for up to 24 h. Data show IL-6 expression in x-fold of untreated controls based on mean and standard deviation (SD) of two independent experiments.

Mean SD

24h

6h

3h

1h

30.7 20.5

9.4 2.8

11.0 3.0

4.3 1.5

Table 3 RAW 264.7 macrophage-like cells were exposed to the indicated treatments for 24 h. Supernatant was harvested and subjected to IL-6 ELISA measurement. Data represent three experiments and are indicated as ng/ml. Mean and standard deviation (SD).

Mean SD

w/o

saliva

saliva@121  C

saliva + TAK-242

0.04 0.02

1.61 0.11

0.60 0.54

0.12 0.03

it is reasonable to assume that salivary endotoxins drive the robust IL-12 and IL-6 expressions by primary macrophages and RAW 264.7 macrophage-like cells. Questions are arising on the possible capacity of saliva to contribute to oral innate immunity by targeting macrophages and causing them to develop a proinflammatory M1 phenotype. The overall hypothesis and the clinical rationale behind this research are that tooth extractions, cheek bites, oral surgeries and sites of impaired epithelial integrity can cause the exposure of potential target cells such as macrophages to saliva. In turn, saliva can support a local cellular response that, based on the present observations, involves the TLR4-dependent activation of macrophages. Our in vitro findings might be relevant in the context that the TLR4 response of macrophages is relevant for wound healing (Suga et al., 2014). Considering that wound healing leads to epithelialization, the contact of macrophages to saliva is transient thus, also the proinflammatory stimulus of saliva is temporary. The inflammatory response to saliva might support the overall concept that saliva can contribute to palate wound healing (Bodner et al., 1993) and tooth extraction socket healing (Bodner et al., 1991a; Mohn et al., 2015) in rodent models. Clearly, this theory remains to be proven. We also performed a time-course that simulates a wound situation, indicating that it only requires a one-hour exposure to change IL-6 expression in RAW264.7 cells. The inflammatory components of saliva can also penetrate a fibrin clot, supporting at

Fig. 5. RAW264.7 cells require TLR4 and NFkB to become M1 cells. TAK-242, a TLR4 receptor inhibitor, and BAY11-7082 (BAY), a selective and irreversible inhibitor of the TNF-a-inducible phosphorylation of IkBa both inhibited the expression of the M1 marker genes (A) IL-12 and (B) IL-6. Data are expressed as percent of cells exposed to saliva without the inhibitors. **p<0.01.

Fig. 6. Western blot analysis of RAW264.7 cells exposed to saliva. Saliva caused an increased phosphorylation of ERK, JNK and p38 MAPK as well as p65. TAK-242, a TLR4 receptor inhibitor, but not BAY11-7082 (BAY), a selective and irreversible inhibitor of NFkB signaling, blocked the impact of saliva on phosphorylation of MAPK and p65 in RAW264.7 cells.

least the theoretical possibility that saliva penetrating the blood clot can target immigrated macrophages. However, in a rat model, hyposalivation provoked a stronger inflammatory response than in the control group (Mohn et al., 2015). Hyposalivation also slows down the replacement of the clot by granulation tissue (Mohn et al., 2015). Overall these in vivo findings argue against our hypothesis that macrophages invade the blood clot and push an

Fig. 7. Autoclaving lowers the potential of saliva to cause a M1 response in RAW264.7 cells. RAW264.7 cells were exposed to heat-treated saliva. Saliva heated up to 120  C but to 95  C significantly lost the capacity to stimulate the expression of the M1 marker genes (A) IL-12 and (B) IL-6. Data are expressed as percent of cells exposed to unheated saliva. **p<0.01

300

S. Pourgonabadi et al. / Archives of Oral Biology 73 (2017) 295–301

inflammatory response. Nevertheless, there are beneficial effects of LPS on tissue regeneration. For example, bone-marrow macrophages exposed to LPS and IFN-y enhance functional muscle recovery after ischemia/reperfusion injury (Rybalko, Hsieh, Merscham-Banda, Suggs, & Farrar, 2015). In addition, LPS preconditioning promotes the polarization of macrophages toward an M2 phenotype thereby supporting the recovery of the injured spinal cord (Hayakawa et al., 2014). To understand the possible link between saliva and macrophages in oral wound healing, it requires a combined approach of hyposalivation models that are also depleted in macrophages. Extracellular vesicles or microparticles present in saliva have received attention as they carry proteins, messenger RNA and micro RNA, and facilitate coagulation when saliva directly makes contact with blood (Berckmans, Sturk, van Tienen, Schaap, & Nieuwland, 2011). It is, thus, possible that a part of the extracellular vesicles has a proinflammatory activity and carries endotoxins; hence, the possible role of extracellular vesicles requires attention. Considering that saliva has to pass a 0.22 nm sterile filter and that the size distribution of salivary extracellular vesicles is around 180 nm (Winck et al., 2015), our preparation presumably lacks considerable amounts of extracellular vesicles. Saliva pellets, however, even after repeated washing, induce a pro-inflammatory response involving the TLR4–NF-kB pathway in gingival fibroblasts (Muller et al., 2016a; Muller et al., 2016b). Thus, it would be interesting to determine the capacity of salivary extracellular vesicles or microparticles to activate the TLR4 system on macrophages but also in cells of the mesenchymal lineage. The study raises even more questions. For example, 1 ng/ml LPS can be heat-inactivated with boiling in a bioassay with macrophages (Fujii et al., 2002). Considering that one EU equals approximately 0.2 ng endotoxin/mL, our pooled saliva has >500 ng/ml, thus reaching maximal cell responses, even at high dilutions. This is also in line with an estimated 0–20 ng/ml mouth rinse (Leenstra et al., 1996; Millns et al., 1999). In support of this concept are the dose-response data showing that only 0.5% saliva causes a maximal IL-6 expression, and that even 0.05% was capable of inducing a weak response. Based on the findings of Fujii et al. it is possible that autoclaving inactivated most, but not all, of the salivary endotoxins, which would explain the remaining M1 activation activity observed with autoclaved saliva. Thus, it remains to be tested if all the proinflammatory activity of saliva is solely based on endotoxins, or if for example salivary heat shock proteins 27 and 70 can mediate inflammation via TLR4 (Jin et al., 2014; Zhang et al., 2013) and cause M1 polarization of macrophages. Taken together the data suggest that saliva holds molecules, including endotoxins, activating the TLR4 and thereby pushing macrophages toward the M1 phenotype.

Acknowledgements This study was supported by a Research Scholarship of the Osteology Foundation. We thank Martina Wiederstein for technical assistance. References Berckmans, R. J., Sturk, A., van Tienen, L. M., Schaap, M. C., & Nieuwland, R. (2011). Cell-derived vesicles exposing coagulant tissue factor in saliva. Blood, 117, 3172–3180. Biswas, S. K., & Mantovani, A. (2010). Macrophage plasticity and interaction with lymphocyte subsets: Cancer as a paradigm. Nature Immunology, 11, 889–896. Bodner, L., Dayan, D., Rothchild, D., & Hammel, I. (1991a). Extraction wound healing in desalivated rats. Journal of Oral Pathology and Medicine, 20, 176–178. Bodner, L., Knyszynski, A., Adler-Kunin, S., & Danon, D. (1991b). The effect of selective desalivation on wound healing in mice. Experimental Gerontology, 26, 357–363.

Bodner, L., Dayan, D., Pinto, Y., & Hammel, I. (1993). Characteristics of palatal wound healing in desalivated rats. Archives of Oral Biology, 38, 17–21. Caballe-Serrano, J., Cvikl, B., Bosshardt, D. D., Buser, D., Lussi, A., & Gruber, R. (2015). Saliva suppresses osteoclastogenesis in murine bone marrow cultures. Journal of Dental Research, 94, 192–200. Cvikl, B., Lussi, A., Moritz, A., Sawada, K., & Gruber, R. (2015a). Differential inflammatory response of dental pulp explants and fibroblasts to saliva. International Endodontic Journal. Cvikl, B., Lussi, A., Moritz, A., Sculean, A., & Gruber, R. (2015b). Sterile-filtered saliva is a strong inducer of IL-6 and IL-8 in oral fibroblasts. Clinical Oral Investigations, 19, 385–399. Dawes, C., Pedersen, A. M., Villa, A., Ekstrom, J., Proctor, G. B., Vissink, A., et al. (2015). The functions of human saliva: A review sponsored by the World Workshop on Oral Medicine VI. Archives of Oral Biology, 60, 863–874. Ferrante, C. J., & Leibovich, S. J. (2012). Regulation of macrophage polarization and wound healing. Advances in Wound Care (New Rochelle), 1, 10–16. Fujii, S., Takai, M., & Maki, T. (2002). Wet heat inactivation of lipopolysaccharide from E: Coli serotype 055:B5. PDA Journal of Pharmaceutical Science and Technology, 56, 220–227. Goren, I., Allmann, N., Yogev, N., Schurmann, C., Linke, A., Holdener, M., et al. (2009). A transgenic mouse model of inducible macrophage depletion: Effects of diphtheria toxin-driven lysozyme M-specific cell lineage ablation on wound inflammatory, angiogenic and contractive processes. The American Journal of Pathology, 175, 132–147. Hayakawa, K., Okazaki, R., Morioka, K., Nakamura, K., Tanaka, S., & Ogata, T. (2014). Lipopolysaccharide preconditioning facilitates M2 activation of resident microglia after spinal cord injury. Journal of Neuroscience Research, 92, 1647–1658. Haziot, A., Chen, S., Ferrero, E., Low, M. G., Silber, R., & Goyert, S. M. (1988). The monocyte differentiation antigen, CD14: is anchored to the cell membrane by a phosphatidylinositol linkage. The Journal of Immunology, 141, 547–552. Ii, M., Matsunaga, N., Hazeki, K., Nakamura, K., Takashima, K., Seya, T., et al. (2006). A novel cyclohexene derivative, ethyl (6R)-6-[N-(2-Chloro-4-fluorophenyl) sulfamoyl]cyclohex-1-ene-1-carboxylate (TAK-242), selectively inhibits tolllike receptor 4-mediated cytokine production through suppression of intracellular signaling. Molecular Pharmacology, 69, 1288–1295. Jin, C., Cleveland, J. C., Ao, L., Li, J., Zeng, Q., Fullerton, D. A., et al. (2014). Human myocardium releases heat shock protein 27 (HSP27) after global ischemia: The proinflammatory effect of extracellular HSP27 through toll-like receptor (TLR)2 and TLR4. Molecular Medicine, 20, 280–289. Leenstra, T. S., van Saene, J. J., van Saene, H. K., & Martin, M. V. (1996). Oral endotoxin in healthy adults. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and Endodontics, 82, 637–643. Leibovich, S. J., & Ross, R. (1975). The role of the macrophage in wound repair: A study with hydrocortisone and antimacrophage serum. The American Journal of Pathology, 78, 71–100. Lichtman, S. N., Wang, J., & Lemasters, J. J. (1998). LPS receptor CD14 participates in release of TNF-alpha in RAW 264.7 and peritoneal cells but not in kupffer cells. American Journal of Physiology, 275, G39–G46. Matsunaga, N., Tsuchimori, N., Matsumoto, T., & Ii, M. (2011). TAK-242 (resatorvid), a small-molecule inhibitor of Toll-like receptor (TLR) 4 signaling: Binds selectively to TLR4 and interferes with interactions between TLR4 and its adaptor molecules. Molecular Pharmacology, 79, 34–41. Millns, B., Martin, M. V., & Williams, M. C. (1999). Raised salivary endotoxin concentration as a predictor of infection in pediatric leukemia patients. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology and Endodontics, 88, 50–55. Mirza, R., DiPietro, L. A., & Koh, T. J. (2009). Selective and specific macrophage ablation is detrimental to wound healing in mice. The American Journal of Pathology, 175, 2454–2462. Mohn, C. E., Steimetz, T., Surkin, P. N., Fernandez-Solari, J., Elverdin, J. C., & Guglielmotti, M. B. (2015). Effects of saliva on early post-tooth extraction tissue repair in rats. Wound Repair and Regeneration, 23, 241–250. Mosser, D. M., & Edwards, J. P. (2008). Exploring the full spectrum of macrophage activation. Nature Reviews Immunology, 8, 958–969. Muller, H. D., Caballé-Serrano, J., Lussi, A., & Gruber, R. (2016a). Inhibitory effect of saliva on osteoclastogenesis in vitro requires toll-like receptor 4 signaling. Clinical Oral Investigations [IN REVISION]. Muller, H. D., Cvikl, B., Lussi, A., & Gruber, R. (2016b). Salivary pellets induce a proinflammatory response involving the TLR4 NF-kB pathway in gingival fibroblasts. BMC Oral Health, 8(July (1)), 15. Noguchi, S., Ohba, Y., & Oka, T. (1991). Effect of salivary epidermal growth factor on wound healing of tongue in mice. American Journal of Physiology, 260, E620–E625. Novak, M. L., & Koh, T. J. (2013). Macrophage phenotypes during tissue repair. Journal of Leukocyte Biology, 93, 875–881. Oudhoff, M. J., Bolscher, J. G., Nazmi, K., Kalay, H., van ‘t Hof, W., Amerongen, A. V., et al. (2008). Histatins are the major wound-closure stimulating factors in human saliva as identified in a cell culture assay. FASEB Journal, 22, 3805–3812. Park, B. S., & Lee, J. O. (2013). Recognition of lipopolysaccharide pattern by TLR4 complexes. Experimental and Molecular Medicine, 45, e66. Presland, R. B., & Jurevic, R. J. (2002). Making sense of the epithelial barrier: What molecular biology and genetics tell us about the functions of oral mucosal and epidermal tissues. Journal of Dental Education, 66, 564–574. Rybalko, V., Hsieh, P. L., Merscham-Banda, M., Suggs, L. J., & Farrar, R. P. (2015). The development of macrophage-mediated cell therapy to improve skeletal muscle function after injury. PLoS One, 10, e0145550. Squier, C. A., & Kremer, M. J. (2001). Biology of oral mucosa and esophagus. Journal of the National Cancer Institute Monographs7–15.

S. Pourgonabadi et al. / Archives of Oral Biology 73 (2017) 295–301 Suga, H., Sugaya, M., Fujita, H., Asano, Y., Tada, Y., Kadono, T., et al. (2014). TLR4, rather than TLR2: regulates wound healing through TGF-beta and CCL5 expression. Journal of Dermatological Science, 73, 117–124. Takayama, A., Satoh, A., Ngai, T., Nishimura, T., Ikawa, K., Matsuyama, T., et al. (2003). Augmentation of Actinobacillus actinomycetemcomitans invasion of human oral epithelial cells and up-regulation of interleukin-8 production by saliva CD14. Infection and Immunity, 71, 5598–5604. Tatano, Y., Shimizu, T., & Tomioka, H. (2014). Unique macrophages different from M1/M2 macrophages inhibit T cell mitogenesis while upregulating Th17 polarization. Scientific Reports, 4, 4146. Winck, F. V., Ribeiro, P., Ramos Domingues, A. C., Ling, R., Riano-Pachon, L. Y., Rivera, D. M., et al. (2015). Insights into immune responses in oral cancer through proteomic analysis of saliva and salivary extracellular vesicles. Scientific Reports, 5, 16305.

301

Wong, J. W., Gallant-Behm, C., Wiebe, C., Mak, K., Hart, D. A., Larjava, H., et al. (2009). Wound healing in oral mucosa results in reduced scar formation as compared with skin: Evidence from the red Duroc pig model and humans. Wound Repair and Regeneration, 17, 717–729. Ying, W., Cheruku, P. S., Bazer, F. W., Safe, S. H., & Zhou, B. (2013). Investigation of macrophage polarization using bone marrow derived macrophages. Journal of Visualized Experiments, 23(June (76)) . Zacharski, L. R., & Rosenstein, R. (1979). Reduction of salivary tissue factor (thromboplastin) activity by warfarin therapy. Blood, 53, 366–374. Zelles, T., Purushotham, K. R., Macauley, S. P., Oxford, G. E., & Humphreys-Beher, M. G. (1995). Saliva and growth factors: The fountain of youth resides in us all. Journal of Dental Research, 74, 1826–1832. Zhang, Y., Zhang, X., Shan, P., Hunt, C. R., Pandita, T. K., & Lee, P. J. (2013). A protective Hsp70-TLR4 pathway in lethal oxidant lung injury. The Journal of Immunology, 191, 1393–1403.