- Email: [email protected]
Salmonella serotype assignment by sequencing analysis of intergenic regions of ribosomal RNA operons
Salmonella serotype assignment by sequencing analysis of intergenic regions of ribosomal RNA operons
∗
Laborat´ orio de Diagn´ ostico Molecular, Universidade Luterana do Brasil (ULBRA), Canoas, Rio Grande do Sul, aria, Universidade Luterana do Brasil (ULBRA), Canoas, Rio 92425-900, Brazil; † Curso de Medicina Veterin´ orio de Virologia Veterin´ aria, Universidade Federal do Rio Grande do Grande do Sul, 92425-900, Brazil; ‡ Laborat´ Sul, Porto Alegre, Rio Grande do Sul, 91501-970, Brazil; and § Simbios Biotecnologia, Cachoeirinha, Rio Grande do Sul, 94940-030, Brazil ABSTRACT Salmonella laboratorial detection is usually carried out by bacteriological culture and serological methods. Salmonella isolates are then classified into more than 2,650 serotypes with different somatic (O) and flagellar (H) antigenic combinations. More recently, DNA analysis methods were developed and applied for the identification of Salmonella serotypes, including intergenic spacer regions (ISRs) that separates DNA-encoding ribosomal subunits (rRNA gene) in Salmonella genomes. The present study aimed to evaluate the nucleotide diversity of the ISRs in 2 rRNA operons (rrnB and rrnH) for the assignment of Salmonella serotypes. A total of 63 Salmonella isolates (bacterial cultures) from 21 serotypes were obtained in the period of 2014 to 2017. DNA was extracted, and PCRs were used to detect the genus Salmonella and 4 important serotypes: Enteritidis, Gallinarum, Hei-
delberg, and Typhimurium. ISRs of the operons rrnB and rrnH were amplified by PCR and then sequenced. All sequence results were submitted to BLASTn search and were aligned in comparison to 72 Salmonella reference nucleotide sequences. The results demonstrated that 60 (95.2%) samples returned a sequence of the same serotype (determined by the traditional serological procedure) after searching in BLASTn and/or in the alignment with the reference sequences for both operons (rrnB and rrnH). These PCR-sequencing procedures had a general agreement index of 0.792 based on the Kappa analysis, 98.7% sensitivity value, 100% specificity, and 98.4% accuracy. Three different phylogenetic trees were generated from the alignments with the sequences of rrnH, rrnB, and rrnH plus rrnB and isolates clustered in specific branches according to the serotypes.
Key words: Salmonella, serotyping, molecular identification 2019 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pez285
INTRODUCTION
denominated according the Kauffmann-White-Le Minor (KWL) scheme. Somatic O antigens are designated by numbers and flagellar H antigens by letters/numbers (phase 1) and numbers (phase 2) in the antigenic formulas (Grimont and Weill, 2007). The Salmonella genome has from 4.6 to 5.1 megabases, and it is organized into several operons (Marcus et al., 2000; Porwollik et al., 2002; Dhanani et al., 2015). The pathogenicity of each Salmonella serotype is determined by a set of genes associated to the bacteria’s ability to colonize mucosa of the intestinal tract, to invade host cells, to replicate within them, and to survive by destroying the phagocytic components. These genes are organized into 23 different pathogenicity islands with a variable distribution in Salmonella species and serotypes, defining specific virulence characteristics and host adaptation (Suez et al., 2013; Elder et al., 2016). In addition, there are several housekeeping genes, highlighting 7 similar operons with genes for ribosomal and transporter RNAs (rRNAs and tRNAs)
Salmonella is a bacterium associated with poultry diseases and human infections transmitted by chicken meat and eggs. Taxonomically, the genus Salmonella belongs to the family Enterobacteriaceae. There are only 2 species: Salmonella enterica (subdivided into the 6 subspecies enterica, salamae, arizonae, diarizonae, houtenae, and indica) and Salmonella bongori (Grimont and Weill, 2007). Salmonella isolates are also classified into more than 2,650 serotypes with different somatic (O) and flagellar (H) antigenic combinations (Grimont and Weill, 2007; Guibourdenche et al., 2010; IssenhuthJeanjean et al., 2014). Salmonella serotyping is performed with several different antisera, and serotypes are C 2019 Poultry Science Association Inc. Received October 6, 2018. Accepted May 3, 2019. 1 Corresponding author: [email protected]
1
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Di´essy Kipper,∗ Rafaella Martins Hellfeldt,† Silvia De Carli,∗,‡ Fernanda Kieling Moreira Lehmann,∗ Andr´e Salvador Kazantzi Fonseca,§ Nilo Ikuta,∗,†,§ and Vagner Ricardo Lunge∗,†,§,1
2
KIPPER ET AL.
be highly variable with the possibility to achieve a high discrimination power among lineages and strains (Chiu et al., 2005). ISRs have been used even to detect serotypes in a genetic level (Tilsala-Timisjarvi and Alatossava, 2001; Herpers et al., 2003; Laursen et al., 2005). Previous studies described the use of the 23S-5S and 5S-aspU ISRs of rrnH gene to discriminate Salmonella serotypes, including isolates from poultry samples (Morales et al., 2006; Guard et al; 2012, Pulido-Land´ınez et al., 2013). The present study aimed to validate the use of another rRNA operon (rrnB) and to compare the discriminatory power of the 2 ISRs (in the rrnB and rrnH operons) for the assignment of Salmonella serotype.
MATERIALS AND METHODS Bacterial Isolates A total of 63 Salmonella isolates (bacterial cultures), including 48 from poultry farms obtained in routine veterinary laboratories and 15 from other sources (human and food) obtained in the Central Laboratory of the Rio Grande do Sul state (Laborat´ orio Central – RS; LACEN-RS), were used in the present study. All isolates had been previously serotyped by the complete KWL method (Table 1).
DNA Extraction DNA was extracted using commercial reagents (NewGene, Simbios Biotecnologia, Cachoeirinha, RS). One Salmonella colony in agar plates was picked into a microtube with 0.4 mL of the NewGene Prep solution and incubated at 60◦ C for 10 min. After centrifugation (10,000 g for 1 min), supernatant was transferred to a tube containing 20 μL of silica suspension. After stirring and centrifugation (10,000 g, 1 min), the pellet was washed twice with 150 μL of wash solution A (5 M guanidine isothiocyanate, 0.1 M Tris-HCl [pH 6.4]), twice with 150 μL of wash solution B (80% ethanol), and once with 150 μL of wash solution C (96% ethanol). After drying the silica, DNA was dissolved with 50 μL of the elution solution (10 mM Tris-HCl [pH 8.0] mM EDTA).
Real-time PCR for Detection of Salmonella and Specific Serotypes A real-time PCR was used to detect the genus Salmonella as previously described (Hoorfar et al., 2000). In addition, 4 real-time PCRs (SEAmp, STAmp, SHAmp, and SGAmp) were used for the specific detection of the serotypes Typhimurium, Enteritidis, Heidelberg, and Gallinarum according to the instructions of the manufacturer (Simbios Biotecnologia, Cachoeirinha, Brazil). All real-time PCRs were carried out in the StepOnePlus Real-Time PCR Systems (Thermo Fisher
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
synthesis in all Salmonella species: rrnA, rrnB, rrnC, rrnD, rrnE, rrnG, and rrnH (Liu and Sanderson, 1998; Helm et al., 2004). Intergenic sequence regions (ISRs) in these operons have a higher diversity than in any other genomic regions as a consequence of recombination and mutation events (Chenoll et al., 2003). Salmonella laboratorial detection is traditionally carried out by bacteriological methods, with a previous pre-enrichment of the biological sample (food, feed, drag swabs, animal tissues, etc.) to assist isolation. Buffered peptone water or brain heart infusion broths are mostly used in this initial step. Next, a selective enrichment procedure is performed with different media (such as tetrathionate, M¨ uller–Kauffmann broth, selenite cystine, brilliant green broth, or Rappaport– Vassiliadis broth), followed by selective platting (with xylose lysine deoxycholate, desoxycholate-citrate agar, brilliant green agar, or bismuth-sulfite agar) to permit differential growth to varying degrees. Suspect colonies are then subcultured onto selective and non-selective agars to ensure the absence of possible contaminants and should be tested by slide agglutination with polyvalent Salmonella-typing antisera (OIE, 2018). Salmonella typical colonies are then submitted to serological characterization, usually by agglutination in slides using several antisera for O somatic and H flagellar antigens. The complete analysis provides the antigenic formula of each isolate to define the serotype (such as Enteritidis, Typhimurium, Typhi, etc.). Currently, this method employs more than 250 O and H antisera for the complete characterization of all Salmonella serotypes (Grimont and Weill, 2007; Issenhuth-Jeanjean et al., 2014). DNA analysis methods have also been developed and increasingly used for the identification of Salmonella since the end of the past century. First, Salmonella was characterized by pulsed-field gel electrophoresis (Swaminathan et al., 2001) and amplified fragment length polymorphism (Liebana, 2002). Later, several other techniques were also used for this same objective, such as multiple-locus variable-number tandem repeats (Lindstedt et al., 2004), ribotyping (Liebana et al., 2001), and DNA–DNA microarray hybridization (Morales et al., 2005). In the beginning of the current decade, multi-locus sequence-based typing (MLST) and the classification of the Salmonella in sequence types (STs) were proposed, since it provides the genetic background of each bacterial isolate with the analysis of the DNA sequences of informative genes (Stepan et al., 2011; Achtman et al., 2012). More recently, whole-genome sequencing (WGS) improved even more Salmonella genetic analysis, making it possible to determine the complete bacterial genome of each isolate and to compare the results with large gene databases (Matthews et al., 2010; Deng et al., 2015). However, these methods are still expensive and require detailed and complex analysis of the results. In WGS studies, ISRs separating DNA-encoding ribosomal subunits (rRNA gene) were demonstrated to
3
RAPID SALMONELLA SEROTYPE ASSIGNMENT Table 1. Salmonella serotypes used in the study. Serotype (n)
Serotype (n)
Origin
Poultry Poultry Poultry Poultry Poultry Poultry/human/food Food Poultry Food Human Poultry
Infantis (3) Livingstone (1) Mbandaka (1) Minnesota (5) Panama (1) Rissen (1) Schwarzengrund (2) Teneessee (1) Typhimurium (12) O:6,7 (1)
Food Poultry Poultry Poultry Food Poultry Poultry Poultry Poultry/human/food Food
Table 2. Primers used in the study. Primer name
Orientation
ITR 1–2 NF ITR 3 NR ITRB FN2 ITRB RN2
Forward Reverse Forward Reverse
Primer sequence (5 to 3 ) CGATGCGTTGAGCTAACCGG CAGAAGCGATAACCACGTCGTC GATGCGTTGAGCTAACCG GT AACAACTACTGAGCGCCTGG
Scientific, Waltham, MA), while conventional PCRs were carried out on the Veriti 96 Well Thermal Cycler (Applied Biosystems, Carlsbad CA). Negative and positive controls were added in all PCRs. The evaluation was performed directly on the equipment by the occurrence of amplification curves and the determination of the respective Ct (cycle threshold).
Amplification of Operons rrnH and rrnB and Sequencing Primers ITR 1–2NF and ITR 3NR were used to amplify the intergenic region of the rrnH, covering the end of the gene 23S and at the beginning of the 2,5didehydrogluconate reductase B gene (dkgB). Further, primers ITRB FN2 and ITRB RN2 were used for the amplification of the rrnB intergenic region, covering the 23S and UDP-N acetylenol pyruvyl glucosamine reductase gene (murB) (Table 2). PCR amplification was carried out on the Veriti 96 Well Thermal Cycler (Applied Biosystems). Amplification conditions were as follows: 40 cycles of denaturation for 20 s at 95◦ C, annealing for 40 s at 60◦ C, and extension for 60 s at 72◦ C. PCR products were electrophoresed on polyacrylamide gel and stained with silver nitrate. Both strands of the PCR products were sequenced by Sanger method and furR ther assembled using Geneiousv11.1.5 (Biomasters, www.geneious.com).
using the “map to reference” tool of the software R v11.1.5 (Auckland, New Zealand). ISRs GENEIOUS of the rrnH and rrnB operons were aligned separately with the MAFFT alignment (Katoh and Standley, 2016). Finally, both sequences (rrnB and rrnH) of each serotype were concatenated to construct an alignment matrix with a larger genetic region.
Identity Analysis and Phylogenetic Tree of the ISRs rrnB and rrnH The nucleotide sequences of the ISRs of rrnB and rrnH were analyzed and edited separately. ISR sequences of the Salmonella isolates were first submitted to the BLASTn program (available from NCBI www.ncbi.nlm.nih.gov/BLAST). Nucleotide sequences were deposited in GenBank under the accession numbers MK000897 to MK001020. Afterwards all of them were included in the previous alignment matrices. Nucleotide sequences were evaluated comparatively for identity analysis. In addition, a phylogenetic tree was generated by the IQ-TREE online tool for maximum-likelihood analysis (Trifinopoulos et al., 2016) and observed using FigTree v1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/).
Statistical Analysis Comparative analysis between the identification by serotyping and the evaluation of the sequence of the operons rrnH and rrnB was performed by applying Cohen’s Kappa coefficient of agreement (Viera and Garrett, 2005).
RESULTS Genus and Serotypes Specific Detection
Construction of the Alignment Matrix A total of 126 sequences of the ISRs located in the rrnB and rrnH rRNA operons, from 72 different serotypes, were obtained from fully and partially sequenced Salmonella (available in the GenBank database). Incomplete genome sequences were assembled with a reference sequence of the specific serotype
All the 63 isolates were submitted to the invA real-time PCR and had positive result to the genus Salmonella. In addition, DNAs of all samples were submitted to SEAmp, STAmp, SHAmp, and SGAmp PCRs. The 9 isolates from serotype Enteritidis, the 12 isolates from serotype Gallinarum, and 11 of the 12 isolates from serotype Typhimurium had positive
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Agona (1) Anatum (2) Banana (1) Bareilly (1) Coeln (1) Enteritidis (9) Gafsa (1) Gallinarum (12) Give (1) Hadar (1) Heidelberg (5)
Origin
4
KIPPER ET AL.
Analysis of the ISR of the rrnH Operon All the 63 isolates had a positive result after the amplification with the primers ITR 1–2NF and ITR 3NR. The amplification products (amplicons) of these samples were first evaluated by polyacrylamide gel electrophoresis and had different lengths. The specific size of the rrnH amplified fragments (amplicons) ranged from 601 to 870 bp due to insertions and deletions in the whole ISR region. Of the 63 samples, 60 (95.2%) returned a sequence of the same serotype determined by the KWL procedure after searching in BLASTn (www.ncbi.nlm.nih.gov). A total of 56 of them had 100% of identity with a sequence of the same KWL serotype in this search. The 4 remaining samples ranged from 96 to 99% with sequences of the same serotype too, including 2 isolates belonging to Gallinarum biovar Pullorum with 98% of identity, 1 isolate of the Anatum serotype with 96% of identity, and 1 isolate of the Minnesota serotypes with 99% of identity (Supplementary Table S1). The overall comparison between DNA sequencing of the rrnH operon and KWL procedure demonstrated that all sequences of the isolates from the serotypes Agona, Enteritidis, Gafsa, Give, Hadar, Heidelberg, Infantis, Panama, Rissen, Livingstone, Teneessee, Mbandaka, Bareilly, Banana, and Coeln had concordant results. The 3 discordant results were as follows: 1 isolate of the serotype Schwarzengrund (sample ID 164) with 100% nucleotide identity with the Bredeney serotype; 1 isolate of the serotype Typhimurium (sample ID 200) with 100% nucleotide identity with the Heidelberg serotype; and 1 indeterminate isolate (sample ID 2560/13) with 100% nucleotide identity with the serotype Choleraesuis (Table 3). The general agreement index was 0.792 based on the Kappa analysis, 98.7% sensitivity value, 100% specificity, and 98.4% accuracy.
Analysis of the ISR of the rrnB Operon All the 63 isolates also had a positive result after the amplification with the primers ITRB FN2 and ITRB Table 3. Samples with discordant results between serotype and sequencing of the operons rrnH and rrnB. Serotype (n) O:6,7 (1) Infantis (1) Schwarzengrund (1) Typhimurium (1)
KWL
rrnH
rrnB
O:6,7 Infantis Schwarzengrund Typhimurium
Choleraesuis Infantis Bredeney Heidelberg
Choleraesuis Koessen Schwarzengrund Heidelberg
RN2. The amplicons sizes ranged from 534 to 873 bp due to insertions and deletions in the whole amplified region. Again 60 (95.2%) out of the 63 samples returned a sequence of the same serotype determined by the KWL procedure after searching in BLASTn. Fifty two of them had 100% of identity with the expected serotype. Among the remaining isolates, 7 returned 98 to 99% of identity with other sequences of the same KWL serotype, including 3 Typhimurium, 1 Enteritidis, 1 Heidelberg, 1 Gallinarum biovar Pullorum, and 1 Panama isolates. In addition, there was 1 Salmonella Anatum isolate with 92% of identity with the respective serotype (Supplementary Table S1). Isolates from the serotypes Agona, Gafsa, Give, Hadar, Scharzengrund, Rissen, Livingstone, Teneessee, Mbandaka, Bareilly, Banana, Minnesota, and Coeln had concordant results between DNA sequencing of the rrnB operon and traditional KWL serotyping procedure. There were also 3 discordant results: 1 isolate of the serotype Infantis (sample ID 171/12) with 100% nucleotide identity with a sequence of the Koessen serotype; 1 of the serotype Typhimurium (sample ID 200) with total identity with a sequence from Heidelberg serotype; 1 isolate with partial antigenic formula (sample ID 2560/13) with an identical sequence of an isolate of Choleraesuis serotype (Supplementary Table S1). The general agreement index was again 0.792 based on the Kappa analysis, 98.7% sensitivity value, 100% specificity, and 98.4% accuracy.
Phylogenetic Analysis Based on ISRs of rrnH and rrnB Sequences Three different phylogenetic trees were generated from the alignments with the sequences of rrnH, rrnB, and rrnH plus rrnB. In all trees, isolates usually clustered in specific branches according to the serotypes, except for the sequences with discordant results (Figure 1). The phylogenetic tree generated based on the alignment of the target region of the rrnH operon of all 63 sequenced isolates and 126 reference strains from 72 different serotypes is demonstrated in Figure 1A. All strains of each serotype clustered in the same specific branch. Interestingly, sequences from the serotypes Typhimurium and Gallinarum clustered in more than one specific branch of the phylogenetic tree (Figure 1A). In addition, the tree based on the alignment of the target region of the rrnB operon is demonstrated in Figure 1B. All strains of each serotype clustered in the same specific branch. Again sequences from the serotypes Typhimurium and Gallinarum resulted in more than one specific branch (11 and 3, respectively) (Figure 1B). The combined evaluation of both operons was performed by concatenating the nucleotide sequence of the rrnH and rrnB. The DNA fragment size ranged from 1,006 to 1,692 bp. In this phylogenetic tree, the
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
results with the SEAmp, SGAmp, and STAmp assays, respectively. One of the isolates from the serotype Typhimurium (sample ID 200) and the 5 isolates from the serotype Heidelberg had positive results with the SHAmp test. All isolates of the others serotypes had negative results in all of the 4 serotype-specific assays.
RAPID SALMONELLA SEROTYPE ASSIGNMENT
5
evaluation of 2 ISRs demonstrated that most serotypes clustered into specific branches. Noteworthy, DNA sequences of the isolates from the serotype Typhimurium were the more diverse occurring in 13 different branches
(including one together with serotype Mbandaka). Isolates from serotypes Gallinarum and Enteritidis also clustered in more than one branch (4 for Gallinarum and 2 for Enteritidis) (Figure 1C).
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Figure 1. Phylogenetic trees constructed from the alignments of the ISRs of the operons rrnH (A), rrnB (B), and rrnH plus rrnB (C).
KIPPER ET AL.
6
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Figure 1. continued
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Figure 1. continued
7 RAPID SALMONELLA SEROTYPE ASSIGNMENT
8
KIPPER ET AL.
DISCUSSION
SUPPLEMENTARY DATA Supplementary data are available at Poultry Science online.
REFERENCES Achtman, M., J. Wain, F. X. Weill, S. Nair, Z. Zhou, V. Sangal, M. G. Krauland, J. L. Hale, H. Harbottle, A. Uesbeck, G. Dougan, L. H. Harrison, S. Brisse, and S. Enterica MLST Study Group. 2012. Multilocus sequence typing as a replacement for serotyping in Salmonella enterica. PLoS Pathog. 8:e1002776. Arai, N., T. Sekizuka, Y. Tamamura, K. Tanaka, L. Barco, H. Izumiya, M. Kusumoto, A. Hinenoya, S. Yamasaki, T. Iwata, A. Watanabe, M. Kuroda, I. Uchida, and M. Akiba. 2018. Phylogenetic characterization of Salmonella enterica serovar Typhimurium and its monophasic variant isolated from food animals in Japan revealed replacement of major epidemic clones in the last 4 decades. J. Clin. Microbiol. 56:e01758–17. Chenoll, E., M. C. Maci´ an, and R. Aznar. 2003. Identification of Carnobacterium, Lactobacillus, Leuconostoc and Pediococcus by rDNA-based techniques. Syst. Appl. Microbiol. 26:546–556.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Since the 1990s, studies have demonstrated the use of the 16S-23S ISR to discriminate Salmonella serotypes (Lagatolla et al., 1996; Uzzau et al., 1999). The first reports showed the differentiation of some serotypes (such as Agona, Anatum, Derby, Enteritidis, Heidelberg, Infantis, London, and Typhimurium) based on distinct electrophoretic patterns of the PCR products due to the different amplicon sizes (ribotypes). Afterwards, a discrete region within all Salmonella serotypes located in the operon rrnH was shown to differentiate closely related serotypes (Guard et al., 2012). The region of interest spans from the end of a 23S ribosomal gene across a 5S gene, and includes the last base pair preceding a tRNA aspU ribosomal gene neighboring dkgB (previously yafB). DNA sequencing analysis of this region made possible to discriminate Salmonella serotypes, mainly isolates from poultry samples (Guard et al., 2012; Pulido-Land´ınez et al., 2013, 2014). More recently, the publication of the full nucleotide sequence of several Salmonella genomes has demonstrated that serotypes are highly variable in the other 6 ISRs of the rrn operons. In the present study, an in silico analysis of the rrnB operon was initially performed and it was observed that the respective ISR (spanning from the 23S gene up to the murB gene) has a high nucleotide sequence diversity, making it possible to discriminate Salmonella serotypes. The laboratorial evaluation of the Salmonella isolates described here demonstrated the effective differentiation of serotypes by the analysis of both rrn operons with the same discrimination power. Amplification and DNA sequencing resulted in samples with diverse DNA size fragments and different nucleotide sequences. Kappa agreement value obtained from the comparison between the KWL scheme and both rrn operons was the same (0.792), indicating a moderate to strong correlation, and with a slightly higher value than other studies (Guard et al., 2012; Pulido-Land´ınez et al., 2013, 2014). In addition, the different phylogenetic trees constructed with the ISRs data demonstrated the occurrence of specific clusters according to the serotypes. Combining the nucleotide sequences of the rrnH and rrnB of each isolate increased the number of branches, making it possible to discriminate isolates of some serotypes (as for example Typhimurium and Gallinarum). Interestingly, Typhimurium sequences were distributed in several different branches in the 3 phylogenetic trees. Previous reports have demonstrated the polyphyletic characteristic of Typhimurium serotype, presenting different STs and high diversity in whole genomes (Achtman et al., 2012; Arai et al., 2018). Enteritidis and Gallinarum also had an important diversity in the whole genome according to the origin of the isolates (Feasey et al., 2016; De Carli et al., 2017; Graham et al., 2018). However, there were 3 discordant results for both ISRs. Noteworthy sample ID 200 was Typhimurium
by KWL, while both ISRs reported it as Heidelberg serotype. In addition, this sample was negative in the specific PCR for Typhimurium and positive for Heidelberg (Supplementary Table S1). The antigenic formula of Heidelberg (1,4,[5]12:r:1,2) is also similar to Typhimurium (1,4,[5],12:i:1,2), so this could be due to an error in the analysis of the antigen “r” in the serotyping. Another discordance occurred for sample ID 2560/13 with the antigenic formulae O:6,7 but that resulted in 100% nucleotide identity with the serotype Choleraesuis (6,7:c:1,5) for both ISRs. This could be due to an isolate from Cholerasuis serotype that lacked flagellar antigens. ISR analyses can also not reflect the correct serotype since it is a DNA-based evaluation, while serotyping detects different Salmonella antigens coded for other genes. In this sense, in silico serotyping using WGS data is a more definitive DNA-based analysis to identify Salmonella serotypes (Yoshida et al., 2016; Ibrahim and Morin, 2018). DNA sequencing is an increasingly affordable tool for Salmonella analysis. Traditional sequencing (with Sanger technology) is still the most used DNA sequencing procedure in the veterinary laboratories. Molecular methods are also becoming user friendly and less labor intensive. Therefore, the analysis of 2 ISRs is a fast and practical way of evaluating Salmonella isolates. It is easier than performing MLST analysis (with the sequencing of 6 to 7 genes) or in silico analysis after WGS (Achtman et al., 2012; Feasey et al., 2016). This analysis could also evaluate the difference among lineages that circulate in the field. The whole methodology is suitable to be used as a diagnostic tool for monitoring Salmonella and the main concerning serotypes in a routine poultry laboratory. In summary, serotypes could be discriminated by the analysis of the ISRs in the operons rrnB and rrnH. Furthermore, the combined analysis increased the discriminatory power, making possible intraserotype characterization.
RAPID SALMONELLA SEROTYPE ASSIGNMENT
Katoh, K., and D. M. Standley. 2016. A simple method to control over-alignment in the MAFFT multiple sequence alignment program. Bioinformatics. 32:1933–1942. Lagatolla, C., L. Dolzani, E. Tonin, A. Lavenia, M. Di Michele, T. Tommasini, and C. Monti-Bragadin. 1996. PCR ribotyping for characterizing Salmonella isolates of different serotypes. J. Clin. Microbiol. 34:2440–2443. Laursen, B. S., H. P. Sorensen, K. K. Mortensen, and H. U. SperlingPetersen. 2005. Initiation of protein synthesis in bacteria. Microbiol. Mol. Biol. Rev. 69:101–123. Liebana, E. 2002. Molecular tools for epidemiological investigations of S. enterica subspecies enterica infections. Res. Vet. Sci. 72:169– 175. Liebana, E., L. Garcia-Migura, M. F. Breslin, R. H. Davies, and M. J. Woodward. 2001. Diversity of strains of Salmonella enterica serotype Enteritidis from English poultry farms assessed by multiple genetic fingerprinting. J. Clin. Microbiol. 39:154– 161. Lindstedt, B. A., T. Vardund, L. Aas, and G. Kapperud. 2004. Multiple-locus variable-number tandem-repeats analysis of Salmonella enterica subsp. enterica serovar Typhimurium using PCR multiplexing and multicolor capillary electrophoresis. J. Microbiol. Methods. 59:163–172. Liu, S. L., and K. E. Sanderson. 1998. Homologous recombination between rrn operons rearranges the chromosome in host-specialized species of Salmonella. FEMS Microbiol. Lett. 164:275–281. Marcus, S. L., F. H. Brumell, C. G. Pfeifeer, and B. B. Finlay. 2000. Salmonella pathogenicity islands: big virulence in small packages. Microbes Infect. 2:145–156. Matthews, T. D., R. Edwards, and S. Maloy. 2010. Chromosomal rearrangements formed by rrn recombination do not improve replichore balance in host-specific Salmonella enterica serovars. PLoS One. 5:e13503. Morales, C. A., R. Gast, and J. Guard-Bouldin. 2006. Linkage of avian and reproductive tract tropism with sequence divergence adjacent to the 5S ribossomal subunit rrfH of Salmonella enterica. FEMS Microbiol. Lett. 264:48–58. Morales, C. A., S. Porwollik, J. G. Frye, H. Kinde, M. McClelland, and J. Guard-Bouldin. 2005. Correlation of phenotype with the genotype of egg-contaminating Salmonella enterica serovar Enteritidis. Appl. Environ. Microbiol. 71:4388–4399. OIE (World Organization for Animal Health) 2018. Salmonellosis. OIE, Paris. Available at: OIE Terrestrial Manual 2018 – Chapter 3.9.8 Salmonellosis. Accessed 23 April 2019. http:// www.oie.int/standard-setting/terrestrial-manual/access-online/ Porwollik, S., R. M. Wong, and M. Mcclelland. 2002. Evolutionary genomics of Salmonella: gene acquisitions revealed by microarray analysis. Proc. Natl. Acad. Sci. USA 99:8956–8961. Pulido-Land´ınez, M., R. S´ anchez-Ingunza, J. Guard, and V. P. do Nascimento. 2013. Assignment of serotype to Salmonella enterica isolates obtained from poultry and their environment in Southern Brazil. Lett. App. Microbiol. 57:288–295. Pulido-Land´ınez, M., R. S´ anchez-Ingunza, J. Guard, and V. P. do Nascimento. 2014. Presence of Salmonella enteritidis and Salmonella gallinarum in commercial laying hens diagnosed with fowl typhoid disease in Colombia. Avian Dis. 58:165–170. Stepan, R. M., J. S. Sherwood, S. R. Petermann, and C. M. Logue. 2011. Molecular and comparative analysis of Salmonella enterica Senftenberg from humans and animals using PFGE, MLST and NARMS. BMC Microbiol. 11:153. Suez, J., S. Porwollik, A. Dagan, A. Marzel, Y. I. Schorr, P. T. Desai, V. Agmon, M. McClelland, G. Rahav, and O. Gal-Mor. 2013. Virulence gene profiling and pathogenicity characterization of non-typhoidal Salmonella accounted for invasive disease in humans. PLoS One. 8:e58449. Swaminathan, B., T. J. Barrett, S. B. Hunter, and R. V. Tauxe. 2001. Pulsenet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg. Infect. Dis. 7:382–389. Tilsala-Timisjarvi, A., and T. Alatossava. 2001. Characterization of the 16S–23S and 23S–5S rRNA intergenic spacer regions of dairy propionibacteria and their identification with species-specific primers by PCR. Int. J. Food Microbiol. 68:45– 52.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Chiu, T. H., T. R. Chen, W. Z. Hwang, and H. Y. Tsen. 2005. Sequencing of an internal transcribed spacer region of 16S– 23S rRNA gene and designing of PCR primers for the detection of Salmonella spp. in food. Int. J. Food Microbiol. 97:259– 265. De Carli, S., T. Gr¨ af, D. Kipper, F. K. M. Lehmann, N. Zanetti, F. M. Siqueira, S. Cibulski, A. S. K. Fonseca, N. Ikuta, and V. R. Lunge. 2017. Molecular and phylogenetic analyses of Salmonella Gallinarum trace the origin and diversification of recent outbreaks of fowl typhoid in poultry farms. Vet. Microbiol. 212:80– 86. Deng, X., N. Shariat, E. M. Driebe, C. C. Roe, B. Tolar, E. Trees, P. Keim, W. Zhang, E. G. Dudley, P. I. Fields, and D. M. Engelthaler. 2015. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. J. Clin. Microbiol. 53:212–218. Dhanani, A. S., G. Block, K. Dewar, V. Forgetta, E. Topp, R. G. Beiko, and M. S. Diarra. 2015. Genomic comparison of nontyphoidal Salmonella enterica serovars Typhimurium, Enteritidis, Heidelberg, Hadar and Kentucky isolates from broiler chickens. PLoS One. 10:e0128773. Elder, J. R., K. L. Chiok, N. C. Paul, G. Haldorson, J. Guard, and D. H. Shah. 2016. The Salmonella pathogenicity island 13 contributes to pathogenesis in streptomycin pre-treated mice but not in day-old chickens. Gut Pathog. 8:16. Feasey, N. A., J. Hadfield, K. H. Keddy, T. J. Dallman, J. Jacobs, X. Deng, P. Wigley, L. Barquist, G. C. Langridge, T. Feltwell, S. R. Harris, A. E. Mather, M. Fookes, M. Aslett, C. Msefula, S. Kariuki, C. A. Maclennan, R. S. Onsare, F. X. Weill, S. Le Hello, A. M. Smith, M. McClelland, P. Desai, C. M. Parry, J. Cheesbrough, N. French, J. Campos, J. A. Chabalgoity, L. Betancor, K. L. Hopkins, S. Nair, T. J. Humphrey, O. Lunguya, T. A. Cogan, M. D. Tapia, S. O. Sow, S. M. Tennant, K. Bornstein, M. M. Levine, L. Lacharme-Lora, D. B. Everett, R. A. Kingsley, J. Parkhill, R. S. Heyderman, G. Dougan, M. A. Gordon, and N. R. Thomson. 2016. Distinct Salmonella Enteritidis lineages associated with enterocolitis in high-income settings and invasive disease in low-income settings. Nat. Genet. 48:1211– 1217. Graham, R. M. A., L. Hiley, I. U. Rathnayake, and A. V. Jennison. 2018. Comparative genomics identifies distinct lineages of S. Enteritidis from Queensland, Australia, PLoS One. 13:e0191042. Grimont, P. A. D., and F. X. Weill. 2007. Antigenic formulae of the Salmonella serovars. 9th edn, World Health Organization Collaborating Center for Reference and Research on Salmonella, Institut Pasteur, Paris. Guard, J., R. Sanchez-Ingunza, C. Morales, T. Stewart, K. Liljebjelke, J. Van Kessel, K. Ingram, D. Jones, C. Jackson, P. FedorkaCray, J. Frye, R. Gast, and A. Hinton, Jr. 2012. Comparison of dkgB-linked intergenic sequence ribotyping to DNA microarray hybridization for assigning serotype to Salmonella enterica. FEMS Microbiol. Lett. 337:61–72. Guibourdenche, M., P. Roggentin, M. Mikoleit, P. I. Fields, J. Bockem¨ uhl, P. A. Grimont, and F. X. Weill. 2010. Supplement 2003–2007 (No. 47) to the White-Kauffmann-Le Minor scheme. Res. Microbiol. 161:26–29. Helm, R. A., S. Porwollik, A. E. Stanley, S. Maloy, M. McClelland, W. Rabsch, and A. Eisenstark. 2004. Pigeon-associated strains of Salmonella enterica serovar Typhimurium phage type DT2 have genomic rearrangements at rRNA operons. Infect. Immun. 72:7338–7341. Herpers, B. L., B. M. de Jongh, K. van der Zwaluw, and E. J. van Hannen. 2003. Real-time PCR assay targets the 23S-5S spacer for direct detection and differentiation of Legionella spp. and Legionella pneumophila. J. Clin. Microbiol. 41:4815–4816. Hoorfar, J., P. Ahrens, and P. Rˆ adstr¨ om. 2000. Automated 5 nuclease PCR assay for identification of Salmonella enterica. J. Clin. Microbiol. 38:3429–3435. Ibrahim, G. M., and P. M. Morin. 2018. Salmonella Serotyping using whole genome sequencing. Front. Microbiol. 9:2993. Issenhuth-Jeanjean, S., P. Roggentin, M. Mikoleit, M. Guibourdenche, E. de Pinna, S. Nair, P. I. Fields, and F. X. Weill. 2014. Supplement 2008–2010 (no. 48) to the White Kauffmann-Le Minor scheme. Res. Microbiol. 165:526–530.
9
10
KIPPER ET AL. Viera, A. J., and J. M. Garrett. 2005. Understanding interobserver agr´ement: the kappa statistic. Fam. Med. 37:360– 363. Yoshida, C. E., P. Kruczkiewicz, C. R. Laing, E. J. Lingohr, V. P. Gannon, J. H. Nash, and E. N. Taboada. 2016. The Salmonella in silico typing resource (SISTR): an open web-accessible tool for rapidly typing and subtyping draft Salmonella Genome Assemblies. PLoS One. 11:e0147101.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Trifinopoulos, J., L. T. Nguyen, A. von Haeseler, and B. Q. Minh. 2016. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic. Acids Res. 44:W232–W235. Uzzau, S., M. Hovi, and B. A. Stocker. 1999. Application of ribotyping and IS200 fingerprinting to distinguish the five Salmonella serotype O6,7:c:1,5 groups: Choleraesuis sensu stricto, Choleraesuis var. Kunzendorf, Choleraesuis var. Decatur, Paratyphi C, and Typhisuis. Epidemiol. Infect. 123:37–46.
∗
Laborat´ orio de Diagn´ ostico Molecular, Universidade Luterana do Brasil (ULBRA), Canoas, Rio Grande do Sul, aria, Universidade Luterana do Brasil (ULBRA), Canoas, Rio 92425-900, Brazil; † Curso de Medicina Veterin´ orio de Virologia Veterin´ aria, Universidade Federal do Rio Grande do Grande do Sul, 92425-900, Brazil; ‡ Laborat´ Sul, Porto Alegre, Rio Grande do Sul, 91501-970, Brazil; and § Simbios Biotecnologia, Cachoeirinha, Rio Grande do Sul, 94940-030, Brazil ABSTRACT Salmonella laboratorial detection is usually carried out by bacteriological culture and serological methods. Salmonella isolates are then classified into more than 2,650 serotypes with different somatic (O) and flagellar (H) antigenic combinations. More recently, DNA analysis methods were developed and applied for the identification of Salmonella serotypes, including intergenic spacer regions (ISRs) that separates DNA-encoding ribosomal subunits (rRNA gene) in Salmonella genomes. The present study aimed to evaluate the nucleotide diversity of the ISRs in 2 rRNA operons (rrnB and rrnH) for the assignment of Salmonella serotypes. A total of 63 Salmonella isolates (bacterial cultures) from 21 serotypes were obtained in the period of 2014 to 2017. DNA was extracted, and PCRs were used to detect the genus Salmonella and 4 important serotypes: Enteritidis, Gallinarum, Hei-
delberg, and Typhimurium. ISRs of the operons rrnB and rrnH were amplified by PCR and then sequenced. All sequence results were submitted to BLASTn search and were aligned in comparison to 72 Salmonella reference nucleotide sequences. The results demonstrated that 60 (95.2%) samples returned a sequence of the same serotype (determined by the traditional serological procedure) after searching in BLASTn and/or in the alignment with the reference sequences for both operons (rrnB and rrnH). These PCR-sequencing procedures had a general agreement index of 0.792 based on the Kappa analysis, 98.7% sensitivity value, 100% specificity, and 98.4% accuracy. Three different phylogenetic trees were generated from the alignments with the sequences of rrnH, rrnB, and rrnH plus rrnB and isolates clustered in specific branches according to the serotypes.
Key words: Salmonella, serotyping, molecular identification 2019 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pez285
INTRODUCTION
denominated according the Kauffmann-White-Le Minor (KWL) scheme. Somatic O antigens are designated by numbers and flagellar H antigens by letters/numbers (phase 1) and numbers (phase 2) in the antigenic formulas (Grimont and Weill, 2007). The Salmonella genome has from 4.6 to 5.1 megabases, and it is organized into several operons (Marcus et al., 2000; Porwollik et al., 2002; Dhanani et al., 2015). The pathogenicity of each Salmonella serotype is determined by a set of genes associated to the bacteria’s ability to colonize mucosa of the intestinal tract, to invade host cells, to replicate within them, and to survive by destroying the phagocytic components. These genes are organized into 23 different pathogenicity islands with a variable distribution in Salmonella species and serotypes, defining specific virulence characteristics and host adaptation (Suez et al., 2013; Elder et al., 2016). In addition, there are several housekeeping genes, highlighting 7 similar operons with genes for ribosomal and transporter RNAs (rRNAs and tRNAs)
Salmonella is a bacterium associated with poultry diseases and human infections transmitted by chicken meat and eggs. Taxonomically, the genus Salmonella belongs to the family Enterobacteriaceae. There are only 2 species: Salmonella enterica (subdivided into the 6 subspecies enterica, salamae, arizonae, diarizonae, houtenae, and indica) and Salmonella bongori (Grimont and Weill, 2007). Salmonella isolates are also classified into more than 2,650 serotypes with different somatic (O) and flagellar (H) antigenic combinations (Grimont and Weill, 2007; Guibourdenche et al., 2010; IssenhuthJeanjean et al., 2014). Salmonella serotyping is performed with several different antisera, and serotypes are C 2019 Poultry Science Association Inc. Received October 6, 2018. Accepted May 3, 2019. 1 Corresponding author: [email protected]
1
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Di´essy Kipper,∗ Rafaella Martins Hellfeldt,† Silvia De Carli,∗,‡ Fernanda Kieling Moreira Lehmann,∗ Andr´e Salvador Kazantzi Fonseca,§ Nilo Ikuta,∗,†,§ and Vagner Ricardo Lunge∗,†,§,1
2
KIPPER ET AL.
be highly variable with the possibility to achieve a high discrimination power among lineages and strains (Chiu et al., 2005). ISRs have been used even to detect serotypes in a genetic level (Tilsala-Timisjarvi and Alatossava, 2001; Herpers et al., 2003; Laursen et al., 2005). Previous studies described the use of the 23S-5S and 5S-aspU ISRs of rrnH gene to discriminate Salmonella serotypes, including isolates from poultry samples (Morales et al., 2006; Guard et al; 2012, Pulido-Land´ınez et al., 2013). The present study aimed to validate the use of another rRNA operon (rrnB) and to compare the discriminatory power of the 2 ISRs (in the rrnB and rrnH operons) for the assignment of Salmonella serotype.
MATERIALS AND METHODS Bacterial Isolates A total of 63 Salmonella isolates (bacterial cultures), including 48 from poultry farms obtained in routine veterinary laboratories and 15 from other sources (human and food) obtained in the Central Laboratory of the Rio Grande do Sul state (Laborat´ orio Central – RS; LACEN-RS), were used in the present study. All isolates had been previously serotyped by the complete KWL method (Table 1).
DNA Extraction DNA was extracted using commercial reagents (NewGene, Simbios Biotecnologia, Cachoeirinha, RS). One Salmonella colony in agar plates was picked into a microtube with 0.4 mL of the NewGene Prep solution and incubated at 60◦ C for 10 min. After centrifugation (10,000 g for 1 min), supernatant was transferred to a tube containing 20 μL of silica suspension. After stirring and centrifugation (10,000 g, 1 min), the pellet was washed twice with 150 μL of wash solution A (5 M guanidine isothiocyanate, 0.1 M Tris-HCl [pH 6.4]), twice with 150 μL of wash solution B (80% ethanol), and once with 150 μL of wash solution C (96% ethanol). After drying the silica, DNA was dissolved with 50 μL of the elution solution (10 mM Tris-HCl [pH 8.0] mM EDTA).
Real-time PCR for Detection of Salmonella and Specific Serotypes A real-time PCR was used to detect the genus Salmonella as previously described (Hoorfar et al., 2000). In addition, 4 real-time PCRs (SEAmp, STAmp, SHAmp, and SGAmp) were used for the specific detection of the serotypes Typhimurium, Enteritidis, Heidelberg, and Gallinarum according to the instructions of the manufacturer (Simbios Biotecnologia, Cachoeirinha, Brazil). All real-time PCRs were carried out in the StepOnePlus Real-Time PCR Systems (Thermo Fisher
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
synthesis in all Salmonella species: rrnA, rrnB, rrnC, rrnD, rrnE, rrnG, and rrnH (Liu and Sanderson, 1998; Helm et al., 2004). Intergenic sequence regions (ISRs) in these operons have a higher diversity than in any other genomic regions as a consequence of recombination and mutation events (Chenoll et al., 2003). Salmonella laboratorial detection is traditionally carried out by bacteriological methods, with a previous pre-enrichment of the biological sample (food, feed, drag swabs, animal tissues, etc.) to assist isolation. Buffered peptone water or brain heart infusion broths are mostly used in this initial step. Next, a selective enrichment procedure is performed with different media (such as tetrathionate, M¨ uller–Kauffmann broth, selenite cystine, brilliant green broth, or Rappaport– Vassiliadis broth), followed by selective platting (with xylose lysine deoxycholate, desoxycholate-citrate agar, brilliant green agar, or bismuth-sulfite agar) to permit differential growth to varying degrees. Suspect colonies are then subcultured onto selective and non-selective agars to ensure the absence of possible contaminants and should be tested by slide agglutination with polyvalent Salmonella-typing antisera (OIE, 2018). Salmonella typical colonies are then submitted to serological characterization, usually by agglutination in slides using several antisera for O somatic and H flagellar antigens. The complete analysis provides the antigenic formula of each isolate to define the serotype (such as Enteritidis, Typhimurium, Typhi, etc.). Currently, this method employs more than 250 O and H antisera for the complete characterization of all Salmonella serotypes (Grimont and Weill, 2007; Issenhuth-Jeanjean et al., 2014). DNA analysis methods have also been developed and increasingly used for the identification of Salmonella since the end of the past century. First, Salmonella was characterized by pulsed-field gel electrophoresis (Swaminathan et al., 2001) and amplified fragment length polymorphism (Liebana, 2002). Later, several other techniques were also used for this same objective, such as multiple-locus variable-number tandem repeats (Lindstedt et al., 2004), ribotyping (Liebana et al., 2001), and DNA–DNA microarray hybridization (Morales et al., 2005). In the beginning of the current decade, multi-locus sequence-based typing (MLST) and the classification of the Salmonella in sequence types (STs) were proposed, since it provides the genetic background of each bacterial isolate with the analysis of the DNA sequences of informative genes (Stepan et al., 2011; Achtman et al., 2012). More recently, whole-genome sequencing (WGS) improved even more Salmonella genetic analysis, making it possible to determine the complete bacterial genome of each isolate and to compare the results with large gene databases (Matthews et al., 2010; Deng et al., 2015). However, these methods are still expensive and require detailed and complex analysis of the results. In WGS studies, ISRs separating DNA-encoding ribosomal subunits (rRNA gene) were demonstrated to
3
RAPID SALMONELLA SEROTYPE ASSIGNMENT Table 1. Salmonella serotypes used in the study. Serotype (n)
Serotype (n)
Origin
Poultry Poultry Poultry Poultry Poultry Poultry/human/food Food Poultry Food Human Poultry
Infantis (3) Livingstone (1) Mbandaka (1) Minnesota (5) Panama (1) Rissen (1) Schwarzengrund (2) Teneessee (1) Typhimurium (12) O:6,7 (1)
Food Poultry Poultry Poultry Food Poultry Poultry Poultry Poultry/human/food Food
Table 2. Primers used in the study. Primer name
Orientation
ITR 1–2 NF ITR 3 NR ITRB FN2 ITRB RN2
Forward Reverse Forward Reverse
Primer sequence (5 to 3 ) CGATGCGTTGAGCTAACCGG CAGAAGCGATAACCACGTCGTC GATGCGTTGAGCTAACCG GT AACAACTACTGAGCGCCTGG
Scientific, Waltham, MA), while conventional PCRs were carried out on the Veriti 96 Well Thermal Cycler (Applied Biosystems, Carlsbad CA). Negative and positive controls were added in all PCRs. The evaluation was performed directly on the equipment by the occurrence of amplification curves and the determination of the respective Ct (cycle threshold).
Amplification of Operons rrnH and rrnB and Sequencing Primers ITR 1–2NF and ITR 3NR were used to amplify the intergenic region of the rrnH, covering the end of the gene 23S and at the beginning of the 2,5didehydrogluconate reductase B gene (dkgB). Further, primers ITRB FN2 and ITRB RN2 were used for the amplification of the rrnB intergenic region, covering the 23S and UDP-N acetylenol pyruvyl glucosamine reductase gene (murB) (Table 2). PCR amplification was carried out on the Veriti 96 Well Thermal Cycler (Applied Biosystems). Amplification conditions were as follows: 40 cycles of denaturation for 20 s at 95◦ C, annealing for 40 s at 60◦ C, and extension for 60 s at 72◦ C. PCR products were electrophoresed on polyacrylamide gel and stained with silver nitrate. Both strands of the PCR products were sequenced by Sanger method and furR ther assembled using Geneiousv11.1.5 (Biomasters, www.geneious.com).
using the “map to reference” tool of the software R v11.1.5 (Auckland, New Zealand). ISRs GENEIOUS of the rrnH and rrnB operons were aligned separately with the MAFFT alignment (Katoh and Standley, 2016). Finally, both sequences (rrnB and rrnH) of each serotype were concatenated to construct an alignment matrix with a larger genetic region.
Identity Analysis and Phylogenetic Tree of the ISRs rrnB and rrnH The nucleotide sequences of the ISRs of rrnB and rrnH were analyzed and edited separately. ISR sequences of the Salmonella isolates were first submitted to the BLASTn program (available from NCBI www.ncbi.nlm.nih.gov/BLAST). Nucleotide sequences were deposited in GenBank under the accession numbers MK000897 to MK001020. Afterwards all of them were included in the previous alignment matrices. Nucleotide sequences were evaluated comparatively for identity analysis. In addition, a phylogenetic tree was generated by the IQ-TREE online tool for maximum-likelihood analysis (Trifinopoulos et al., 2016) and observed using FigTree v1.3.1 (http://tree.bio.ed.ac.uk/software/figtree/).
Statistical Analysis Comparative analysis between the identification by serotyping and the evaluation of the sequence of the operons rrnH and rrnB was performed by applying Cohen’s Kappa coefficient of agreement (Viera and Garrett, 2005).
RESULTS Genus and Serotypes Specific Detection
Construction of the Alignment Matrix A total of 126 sequences of the ISRs located in the rrnB and rrnH rRNA operons, from 72 different serotypes, were obtained from fully and partially sequenced Salmonella (available in the GenBank database). Incomplete genome sequences were assembled with a reference sequence of the specific serotype
All the 63 isolates were submitted to the invA real-time PCR and had positive result to the genus Salmonella. In addition, DNAs of all samples were submitted to SEAmp, STAmp, SHAmp, and SGAmp PCRs. The 9 isolates from serotype Enteritidis, the 12 isolates from serotype Gallinarum, and 11 of the 12 isolates from serotype Typhimurium had positive
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Agona (1) Anatum (2) Banana (1) Bareilly (1) Coeln (1) Enteritidis (9) Gafsa (1) Gallinarum (12) Give (1) Hadar (1) Heidelberg (5)
Origin
4
KIPPER ET AL.
Analysis of the ISR of the rrnH Operon All the 63 isolates had a positive result after the amplification with the primers ITR 1–2NF and ITR 3NR. The amplification products (amplicons) of these samples were first evaluated by polyacrylamide gel electrophoresis and had different lengths. The specific size of the rrnH amplified fragments (amplicons) ranged from 601 to 870 bp due to insertions and deletions in the whole ISR region. Of the 63 samples, 60 (95.2%) returned a sequence of the same serotype determined by the KWL procedure after searching in BLASTn (www.ncbi.nlm.nih.gov). A total of 56 of them had 100% of identity with a sequence of the same KWL serotype in this search. The 4 remaining samples ranged from 96 to 99% with sequences of the same serotype too, including 2 isolates belonging to Gallinarum biovar Pullorum with 98% of identity, 1 isolate of the Anatum serotype with 96% of identity, and 1 isolate of the Minnesota serotypes with 99% of identity (Supplementary Table S1). The overall comparison between DNA sequencing of the rrnH operon and KWL procedure demonstrated that all sequences of the isolates from the serotypes Agona, Enteritidis, Gafsa, Give, Hadar, Heidelberg, Infantis, Panama, Rissen, Livingstone, Teneessee, Mbandaka, Bareilly, Banana, and Coeln had concordant results. The 3 discordant results were as follows: 1 isolate of the serotype Schwarzengrund (sample ID 164) with 100% nucleotide identity with the Bredeney serotype; 1 isolate of the serotype Typhimurium (sample ID 200) with 100% nucleotide identity with the Heidelberg serotype; and 1 indeterminate isolate (sample ID 2560/13) with 100% nucleotide identity with the serotype Choleraesuis (Table 3). The general agreement index was 0.792 based on the Kappa analysis, 98.7% sensitivity value, 100% specificity, and 98.4% accuracy.
Analysis of the ISR of the rrnB Operon All the 63 isolates also had a positive result after the amplification with the primers ITRB FN2 and ITRB Table 3. Samples with discordant results between serotype and sequencing of the operons rrnH and rrnB. Serotype (n) O:6,7 (1) Infantis (1) Schwarzengrund (1) Typhimurium (1)
KWL
rrnH
rrnB
O:6,7 Infantis Schwarzengrund Typhimurium
Choleraesuis Infantis Bredeney Heidelberg
Choleraesuis Koessen Schwarzengrund Heidelberg
RN2. The amplicons sizes ranged from 534 to 873 bp due to insertions and deletions in the whole amplified region. Again 60 (95.2%) out of the 63 samples returned a sequence of the same serotype determined by the KWL procedure after searching in BLASTn. Fifty two of them had 100% of identity with the expected serotype. Among the remaining isolates, 7 returned 98 to 99% of identity with other sequences of the same KWL serotype, including 3 Typhimurium, 1 Enteritidis, 1 Heidelberg, 1 Gallinarum biovar Pullorum, and 1 Panama isolates. In addition, there was 1 Salmonella Anatum isolate with 92% of identity with the respective serotype (Supplementary Table S1). Isolates from the serotypes Agona, Gafsa, Give, Hadar, Scharzengrund, Rissen, Livingstone, Teneessee, Mbandaka, Bareilly, Banana, Minnesota, and Coeln had concordant results between DNA sequencing of the rrnB operon and traditional KWL serotyping procedure. There were also 3 discordant results: 1 isolate of the serotype Infantis (sample ID 171/12) with 100% nucleotide identity with a sequence of the Koessen serotype; 1 of the serotype Typhimurium (sample ID 200) with total identity with a sequence from Heidelberg serotype; 1 isolate with partial antigenic formula (sample ID 2560/13) with an identical sequence of an isolate of Choleraesuis serotype (Supplementary Table S1). The general agreement index was again 0.792 based on the Kappa analysis, 98.7% sensitivity value, 100% specificity, and 98.4% accuracy.
Phylogenetic Analysis Based on ISRs of rrnH and rrnB Sequences Three different phylogenetic trees were generated from the alignments with the sequences of rrnH, rrnB, and rrnH plus rrnB. In all trees, isolates usually clustered in specific branches according to the serotypes, except for the sequences with discordant results (Figure 1). The phylogenetic tree generated based on the alignment of the target region of the rrnH operon of all 63 sequenced isolates and 126 reference strains from 72 different serotypes is demonstrated in Figure 1A. All strains of each serotype clustered in the same specific branch. Interestingly, sequences from the serotypes Typhimurium and Gallinarum clustered in more than one specific branch of the phylogenetic tree (Figure 1A). In addition, the tree based on the alignment of the target region of the rrnB operon is demonstrated in Figure 1B. All strains of each serotype clustered in the same specific branch. Again sequences from the serotypes Typhimurium and Gallinarum resulted in more than one specific branch (11 and 3, respectively) (Figure 1B). The combined evaluation of both operons was performed by concatenating the nucleotide sequence of the rrnH and rrnB. The DNA fragment size ranged from 1,006 to 1,692 bp. In this phylogenetic tree, the
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
results with the SEAmp, SGAmp, and STAmp assays, respectively. One of the isolates from the serotype Typhimurium (sample ID 200) and the 5 isolates from the serotype Heidelberg had positive results with the SHAmp test. All isolates of the others serotypes had negative results in all of the 4 serotype-specific assays.
RAPID SALMONELLA SEROTYPE ASSIGNMENT
5
evaluation of 2 ISRs demonstrated that most serotypes clustered into specific branches. Noteworthy, DNA sequences of the isolates from the serotype Typhimurium were the more diverse occurring in 13 different branches
(including one together with serotype Mbandaka). Isolates from serotypes Gallinarum and Enteritidis also clustered in more than one branch (4 for Gallinarum and 2 for Enteritidis) (Figure 1C).
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Figure 1. Phylogenetic trees constructed from the alignments of the ISRs of the operons rrnH (A), rrnB (B), and rrnH plus rrnB (C).
KIPPER ET AL.
6
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Figure 1. continued
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Figure 1. continued
7 RAPID SALMONELLA SEROTYPE ASSIGNMENT
8
KIPPER ET AL.
DISCUSSION
SUPPLEMENTARY DATA Supplementary data are available at Poultry Science online.
REFERENCES Achtman, M., J. Wain, F. X. Weill, S. Nair, Z. Zhou, V. Sangal, M. G. Krauland, J. L. Hale, H. Harbottle, A. Uesbeck, G. Dougan, L. H. Harrison, S. Brisse, and S. Enterica MLST Study Group. 2012. Multilocus sequence typing as a replacement for serotyping in Salmonella enterica. PLoS Pathog. 8:e1002776. Arai, N., T. Sekizuka, Y. Tamamura, K. Tanaka, L. Barco, H. Izumiya, M. Kusumoto, A. Hinenoya, S. Yamasaki, T. Iwata, A. Watanabe, M. Kuroda, I. Uchida, and M. Akiba. 2018. Phylogenetic characterization of Salmonella enterica serovar Typhimurium and its monophasic variant isolated from food animals in Japan revealed replacement of major epidemic clones in the last 4 decades. J. Clin. Microbiol. 56:e01758–17. Chenoll, E., M. C. Maci´ an, and R. Aznar. 2003. Identification of Carnobacterium, Lactobacillus, Leuconostoc and Pediococcus by rDNA-based techniques. Syst. Appl. Microbiol. 26:546–556.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Since the 1990s, studies have demonstrated the use of the 16S-23S ISR to discriminate Salmonella serotypes (Lagatolla et al., 1996; Uzzau et al., 1999). The first reports showed the differentiation of some serotypes (such as Agona, Anatum, Derby, Enteritidis, Heidelberg, Infantis, London, and Typhimurium) based on distinct electrophoretic patterns of the PCR products due to the different amplicon sizes (ribotypes). Afterwards, a discrete region within all Salmonella serotypes located in the operon rrnH was shown to differentiate closely related serotypes (Guard et al., 2012). The region of interest spans from the end of a 23S ribosomal gene across a 5S gene, and includes the last base pair preceding a tRNA aspU ribosomal gene neighboring dkgB (previously yafB). DNA sequencing analysis of this region made possible to discriminate Salmonella serotypes, mainly isolates from poultry samples (Guard et al., 2012; Pulido-Land´ınez et al., 2013, 2014). More recently, the publication of the full nucleotide sequence of several Salmonella genomes has demonstrated that serotypes are highly variable in the other 6 ISRs of the rrn operons. In the present study, an in silico analysis of the rrnB operon was initially performed and it was observed that the respective ISR (spanning from the 23S gene up to the murB gene) has a high nucleotide sequence diversity, making it possible to discriminate Salmonella serotypes. The laboratorial evaluation of the Salmonella isolates described here demonstrated the effective differentiation of serotypes by the analysis of both rrn operons with the same discrimination power. Amplification and DNA sequencing resulted in samples with diverse DNA size fragments and different nucleotide sequences. Kappa agreement value obtained from the comparison between the KWL scheme and both rrn operons was the same (0.792), indicating a moderate to strong correlation, and with a slightly higher value than other studies (Guard et al., 2012; Pulido-Land´ınez et al., 2013, 2014). In addition, the different phylogenetic trees constructed with the ISRs data demonstrated the occurrence of specific clusters according to the serotypes. Combining the nucleotide sequences of the rrnH and rrnB of each isolate increased the number of branches, making it possible to discriminate isolates of some serotypes (as for example Typhimurium and Gallinarum). Interestingly, Typhimurium sequences were distributed in several different branches in the 3 phylogenetic trees. Previous reports have demonstrated the polyphyletic characteristic of Typhimurium serotype, presenting different STs and high diversity in whole genomes (Achtman et al., 2012; Arai et al., 2018). Enteritidis and Gallinarum also had an important diversity in the whole genome according to the origin of the isolates (Feasey et al., 2016; De Carli et al., 2017; Graham et al., 2018). However, there were 3 discordant results for both ISRs. Noteworthy sample ID 200 was Typhimurium
by KWL, while both ISRs reported it as Heidelberg serotype. In addition, this sample was negative in the specific PCR for Typhimurium and positive for Heidelberg (Supplementary Table S1). The antigenic formula of Heidelberg (1,4,[5]12:r:1,2) is also similar to Typhimurium (1,4,[5],12:i:1,2), so this could be due to an error in the analysis of the antigen “r” in the serotyping. Another discordance occurred for sample ID 2560/13 with the antigenic formulae O:6,7 but that resulted in 100% nucleotide identity with the serotype Choleraesuis (6,7:c:1,5) for both ISRs. This could be due to an isolate from Cholerasuis serotype that lacked flagellar antigens. ISR analyses can also not reflect the correct serotype since it is a DNA-based evaluation, while serotyping detects different Salmonella antigens coded for other genes. In this sense, in silico serotyping using WGS data is a more definitive DNA-based analysis to identify Salmonella serotypes (Yoshida et al., 2016; Ibrahim and Morin, 2018). DNA sequencing is an increasingly affordable tool for Salmonella analysis. Traditional sequencing (with Sanger technology) is still the most used DNA sequencing procedure in the veterinary laboratories. Molecular methods are also becoming user friendly and less labor intensive. Therefore, the analysis of 2 ISRs is a fast and practical way of evaluating Salmonella isolates. It is easier than performing MLST analysis (with the sequencing of 6 to 7 genes) or in silico analysis after WGS (Achtman et al., 2012; Feasey et al., 2016). This analysis could also evaluate the difference among lineages that circulate in the field. The whole methodology is suitable to be used as a diagnostic tool for monitoring Salmonella and the main concerning serotypes in a routine poultry laboratory. In summary, serotypes could be discriminated by the analysis of the ISRs in the operons rrnB and rrnH. Furthermore, the combined analysis increased the discriminatory power, making possible intraserotype characterization.
RAPID SALMONELLA SEROTYPE ASSIGNMENT
Katoh, K., and D. M. Standley. 2016. A simple method to control over-alignment in the MAFFT multiple sequence alignment program. Bioinformatics. 32:1933–1942. Lagatolla, C., L. Dolzani, E. Tonin, A. Lavenia, M. Di Michele, T. Tommasini, and C. Monti-Bragadin. 1996. PCR ribotyping for characterizing Salmonella isolates of different serotypes. J. Clin. Microbiol. 34:2440–2443. Laursen, B. S., H. P. Sorensen, K. K. Mortensen, and H. U. SperlingPetersen. 2005. Initiation of protein synthesis in bacteria. Microbiol. Mol. Biol. Rev. 69:101–123. Liebana, E. 2002. Molecular tools for epidemiological investigations of S. enterica subspecies enterica infections. Res. Vet. Sci. 72:169– 175. Liebana, E., L. Garcia-Migura, M. F. Breslin, R. H. Davies, and M. J. Woodward. 2001. Diversity of strains of Salmonella enterica serotype Enteritidis from English poultry farms assessed by multiple genetic fingerprinting. J. Clin. Microbiol. 39:154– 161. Lindstedt, B. A., T. Vardund, L. Aas, and G. Kapperud. 2004. Multiple-locus variable-number tandem-repeats analysis of Salmonella enterica subsp. enterica serovar Typhimurium using PCR multiplexing and multicolor capillary electrophoresis. J. Microbiol. Methods. 59:163–172. Liu, S. L., and K. E. Sanderson. 1998. Homologous recombination between rrn operons rearranges the chromosome in host-specialized species of Salmonella. FEMS Microbiol. Lett. 164:275–281. Marcus, S. L., F. H. Brumell, C. G. Pfeifeer, and B. B. Finlay. 2000. Salmonella pathogenicity islands: big virulence in small packages. Microbes Infect. 2:145–156. Matthews, T. D., R. Edwards, and S. Maloy. 2010. Chromosomal rearrangements formed by rrn recombination do not improve replichore balance in host-specific Salmonella enterica serovars. PLoS One. 5:e13503. Morales, C. A., R. Gast, and J. Guard-Bouldin. 2006. Linkage of avian and reproductive tract tropism with sequence divergence adjacent to the 5S ribossomal subunit rrfH of Salmonella enterica. FEMS Microbiol. Lett. 264:48–58. Morales, C. A., S. Porwollik, J. G. Frye, H. Kinde, M. McClelland, and J. Guard-Bouldin. 2005. Correlation of phenotype with the genotype of egg-contaminating Salmonella enterica serovar Enteritidis. Appl. Environ. Microbiol. 71:4388–4399. OIE (World Organization for Animal Health) 2018. Salmonellosis. OIE, Paris. Available at: OIE Terrestrial Manual 2018 – Chapter 3.9.8 Salmonellosis. Accessed 23 April 2019. http:// www.oie.int/standard-setting/terrestrial-manual/access-online/ Porwollik, S., R. M. Wong, and M. Mcclelland. 2002. Evolutionary genomics of Salmonella: gene acquisitions revealed by microarray analysis. Proc. Natl. Acad. Sci. USA 99:8956–8961. Pulido-Land´ınez, M., R. S´ anchez-Ingunza, J. Guard, and V. P. do Nascimento. 2013. Assignment of serotype to Salmonella enterica isolates obtained from poultry and their environment in Southern Brazil. Lett. App. Microbiol. 57:288–295. Pulido-Land´ınez, M., R. S´ anchez-Ingunza, J. Guard, and V. P. do Nascimento. 2014. Presence of Salmonella enteritidis and Salmonella gallinarum in commercial laying hens diagnosed with fowl typhoid disease in Colombia. Avian Dis. 58:165–170. Stepan, R. M., J. S. Sherwood, S. R. Petermann, and C. M. Logue. 2011. Molecular and comparative analysis of Salmonella enterica Senftenberg from humans and animals using PFGE, MLST and NARMS. BMC Microbiol. 11:153. Suez, J., S. Porwollik, A. Dagan, A. Marzel, Y. I. Schorr, P. T. Desai, V. Agmon, M. McClelland, G. Rahav, and O. Gal-Mor. 2013. Virulence gene profiling and pathogenicity characterization of non-typhoidal Salmonella accounted for invasive disease in humans. PLoS One. 8:e58449. Swaminathan, B., T. J. Barrett, S. B. Hunter, and R. V. Tauxe. 2001. Pulsenet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg. Infect. Dis. 7:382–389. Tilsala-Timisjarvi, A., and T. Alatossava. 2001. Characterization of the 16S–23S and 23S–5S rRNA intergenic spacer regions of dairy propionibacteria and their identification with species-specific primers by PCR. Int. J. Food Microbiol. 68:45– 52.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Chiu, T. H., T. R. Chen, W. Z. Hwang, and H. Y. Tsen. 2005. Sequencing of an internal transcribed spacer region of 16S– 23S rRNA gene and designing of PCR primers for the detection of Salmonella spp. in food. Int. J. Food Microbiol. 97:259– 265. De Carli, S., T. Gr¨ af, D. Kipper, F. K. M. Lehmann, N. Zanetti, F. M. Siqueira, S. Cibulski, A. S. K. Fonseca, N. Ikuta, and V. R. Lunge. 2017. Molecular and phylogenetic analyses of Salmonella Gallinarum trace the origin and diversification of recent outbreaks of fowl typhoid in poultry farms. Vet. Microbiol. 212:80– 86. Deng, X., N. Shariat, E. M. Driebe, C. C. Roe, B. Tolar, E. Trees, P. Keim, W. Zhang, E. G. Dudley, P. I. Fields, and D. M. Engelthaler. 2015. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. J. Clin. Microbiol. 53:212–218. Dhanani, A. S., G. Block, K. Dewar, V. Forgetta, E. Topp, R. G. Beiko, and M. S. Diarra. 2015. Genomic comparison of nontyphoidal Salmonella enterica serovars Typhimurium, Enteritidis, Heidelberg, Hadar and Kentucky isolates from broiler chickens. PLoS One. 10:e0128773. Elder, J. R., K. L. Chiok, N. C. Paul, G. Haldorson, J. Guard, and D. H. Shah. 2016. The Salmonella pathogenicity island 13 contributes to pathogenesis in streptomycin pre-treated mice but not in day-old chickens. Gut Pathog. 8:16. Feasey, N. A., J. Hadfield, K. H. Keddy, T. J. Dallman, J. Jacobs, X. Deng, P. Wigley, L. Barquist, G. C. Langridge, T. Feltwell, S. R. Harris, A. E. Mather, M. Fookes, M. Aslett, C. Msefula, S. Kariuki, C. A. Maclennan, R. S. Onsare, F. X. Weill, S. Le Hello, A. M. Smith, M. McClelland, P. Desai, C. M. Parry, J. Cheesbrough, N. French, J. Campos, J. A. Chabalgoity, L. Betancor, K. L. Hopkins, S. Nair, T. J. Humphrey, O. Lunguya, T. A. Cogan, M. D. Tapia, S. O. Sow, S. M. Tennant, K. Bornstein, M. M. Levine, L. Lacharme-Lora, D. B. Everett, R. A. Kingsley, J. Parkhill, R. S. Heyderman, G. Dougan, M. A. Gordon, and N. R. Thomson. 2016. Distinct Salmonella Enteritidis lineages associated with enterocolitis in high-income settings and invasive disease in low-income settings. Nat. Genet. 48:1211– 1217. Graham, R. M. A., L. Hiley, I. U. Rathnayake, and A. V. Jennison. 2018. Comparative genomics identifies distinct lineages of S. Enteritidis from Queensland, Australia, PLoS One. 13:e0191042. Grimont, P. A. D., and F. X. Weill. 2007. Antigenic formulae of the Salmonella serovars. 9th edn, World Health Organization Collaborating Center for Reference and Research on Salmonella, Institut Pasteur, Paris. Guard, J., R. Sanchez-Ingunza, C. Morales, T. Stewart, K. Liljebjelke, J. Van Kessel, K. Ingram, D. Jones, C. Jackson, P. FedorkaCray, J. Frye, R. Gast, and A. Hinton, Jr. 2012. Comparison of dkgB-linked intergenic sequence ribotyping to DNA microarray hybridization for assigning serotype to Salmonella enterica. FEMS Microbiol. Lett. 337:61–72. Guibourdenche, M., P. Roggentin, M. Mikoleit, P. I. Fields, J. Bockem¨ uhl, P. A. Grimont, and F. X. Weill. 2010. Supplement 2003–2007 (No. 47) to the White-Kauffmann-Le Minor scheme. Res. Microbiol. 161:26–29. Helm, R. A., S. Porwollik, A. E. Stanley, S. Maloy, M. McClelland, W. Rabsch, and A. Eisenstark. 2004. Pigeon-associated strains of Salmonella enterica serovar Typhimurium phage type DT2 have genomic rearrangements at rRNA operons. Infect. Immun. 72:7338–7341. Herpers, B. L., B. M. de Jongh, K. van der Zwaluw, and E. J. van Hannen. 2003. Real-time PCR assay targets the 23S-5S spacer for direct detection and differentiation of Legionella spp. and Legionella pneumophila. J. Clin. Microbiol. 41:4815–4816. Hoorfar, J., P. Ahrens, and P. Rˆ adstr¨ om. 2000. Automated 5 nuclease PCR assay for identification of Salmonella enterica. J. Clin. Microbiol. 38:3429–3435. Ibrahim, G. M., and P. M. Morin. 2018. Salmonella Serotyping using whole genome sequencing. Front. Microbiol. 9:2993. Issenhuth-Jeanjean, S., P. Roggentin, M. Mikoleit, M. Guibourdenche, E. de Pinna, S. Nair, P. I. Fields, and F. X. Weill. 2014. Supplement 2008–2010 (no. 48) to the White Kauffmann-Le Minor scheme. Res. Microbiol. 165:526–530.
9
10
KIPPER ET AL. Viera, A. J., and J. M. Garrett. 2005. Understanding interobserver agr´ement: the kappa statistic. Fam. Med. 37:360– 363. Yoshida, C. E., P. Kruczkiewicz, C. R. Laing, E. J. Lingohr, V. P. Gannon, J. H. Nash, and E. N. Taboada. 2016. The Salmonella in silico typing resource (SISTR): an open web-accessible tool for rapidly typing and subtyping draft Salmonella Genome Assemblies. PLoS One. 11:e0147101.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez285/5499126 by Nottingham Trent University user on 29 July 2019
Trifinopoulos, J., L. T. Nguyen, A. von Haeseler, and B. Q. Minh. 2016. W-IQ-TREE: a fast online phylogenetic tool for maximum likelihood analysis. Nucleic. Acids Res. 44:W232–W235. Uzzau, S., M. Hovi, and B. A. Stocker. 1999. Application of ribotyping and IS200 fingerprinting to distinguish the five Salmonella serotype O6,7:c:1,5 groups: Choleraesuis sensu stricto, Choleraesuis var. Kunzendorf, Choleraesuis var. Decatur, Paratyphi C, and Typhisuis. Epidemiol. Infect. 123:37–46.