Salvianolic acid B protects against chronic alcoholic liver injury via SIRT1-mediated inhibition of CRP and ChREBP in rats

Accepted Manuscript Title: Salvianolic acid B protects against chronic alcoholic liver injury via SIRT1-mediated inhibition of CRP and ChREBP in rats Author: Ning Zhang Yan Hu Chunchun Ding Wenjing Zeng Wen Shan Hui Fan Yan Zhao Xue Shi Lili Gao Ting Xu Ruiwen Wang Dongyan Gao Jihong Yao PII: DOI: Reference:

S0378-4274(16)33344-6 http://dx.doi.org/doi:10.1016/j.toxlet.2016.12.010 TOXLET 9663

To appear in:

Toxicology Letters

Received date: Revised date: Accepted date:

11-8-2016 8-12-2016 13-12-2016

Please cite this article as: Zhang, Ning, Hu, Yan, Ding, Chunchun, Zeng, Wenjing, Shan, Wen, Fan, Hui, Zhao, Yan, Shi, Xue, Gao, Lili, Xu, Ting, Wang, Ruiwen, Gao, Dongyan, Yao, Jihong, Salvianolic acid B protects against chronic alcoholic liver injury via SIRT1-mediated inhibition of CRP and ChREBP in rats.Toxicology Letters http://dx.doi.org/10.1016/j.toxlet.2016.12.010 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Title Page

Salvianolic acid B protects against chronic alcoholic liver injury via SIRT1-mediated inhibition of CRP and ChREBP in rats

Ning Zhang1,2, Yan Hu2, Chunchun Ding1, Wenjing Zeng1, Wen Shan1, Hui Fan2, Yan Zhao1, Xue Shi1, Lili Gao1, Ting Xu1, Ruiwen Wang1, Dongyan Gao1, Jihong Yao1*

1Department of Pharmacology, Dalian Medical University, Dalian, 116044, China 2Department of Pharmacy, The Second Hospital of Dalian Medical University, Dalian, 116027, China

*Correspondence: Professor Jihong Yao Department of Pharmacology Dalian Medical University, 9 West Section, Lvshun South Road Dalian 116044, P.R. China Fax: +86-411-86110408 E-mail: [email protected]

3

Salvianolic acid B protects against chronic alcoholic liver injury via SIRT1-mediated inhibition of CRP and ChREBP in rats

Research Highlights 

This is the first report demonstrating that SalB ameliorates ALD in rats.



SalB alleviates ALD involved SIRT1-mediated inhibition of CRP and ChREBP.



HNF-1α is involved in SIRT1-mediated inhibition of CRP expression.

Abstract Salvianolic acid B (SalB), a water-soluble polyphenol extracted from Radix Salvia miltiorrhiza, has been reported to possess many pharmacological activities. This study investigated the hepatoprotective effects of SalB in chronic alcoholic liver disease (ALD) and explored the related signaling mechanisms. In vivo, SalB treatment significantly attenuated ethanol-induced liver injury by blocking the elevation of serum aminotransferase activities and markedly decreased hepatic lipid accumulation by reducing serum and liver triglyceride (TG) and total cholesterol (TC) levels. Moreover, SalB treatment ameliorated ethanol-induced hepatic inflammation by decreasing the levels of hepatotoxic cytokines such as tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6). Importantly, SalB pretreatment significantly increased the expression of SIRT1 and downregulated the expression of inflammatory mediator C-reactive protein (CRP) and lipoprotein carbohydrate response element-binding protein (ChREBP). In vitro, SalB significantly reversed ethanol-induced down-regulation of SIRT1 and increased CRP and ChREBP expression. Interestingly, the effects of SalB on SIRT1, CRP and ChREBP were mostly abolished by treatment 4

with either SIRT1 siRNA or EX527, a specific inhibitor of SIRT1, indicating that SalB decreased CRP and ChREBP expression by activating SIRT1. SalB exerted anti-steatotic and anti-inflammatory effects against alcoholic liver injury by inducing SIRT1-mediated inhibition of CRP and ChREBP expression.

Keywords: Salvianolic acid B; SIRT1; Alcoholic liver injury; ChREBP; CRP

1. Introduction Alcohol abuse is common worldwide and has been recognized as a major cause of chronic alcoholic liver disease (ALD), which has become one of the most significant health problems in recent decades due to its high morbidity and mortality (Liangpunsakul and Crabb, 2016; Rehm et al., 2013). ALD encompasses a disease spectrum ranging from minimal abnormalities, such as steatosis, to more severe liver disease associated with inflammation, including alcoholic hepatitis (AH), advanced fibrosis, and cirrhosis (Pavlov et al., 2016; Szabo, 2015; Thiele et al., 2016). Inflammation, which is caused by a “second hit” combined with lipid accumulation, the “first hit” that primarily triggers steatosis, plays a critical role in the pathogenesis of ALD (Gao et al., 2016; Mantena et al., 2008). Therefore, a thorough understanding of the mechanisms that regulate hepatic steatosis and inflammation may be clinically relevant for preventing and treating ALD. In recent years, the use of plant extracts and poly-herbal formulations to treat various liver diseases has been documented in various traditional systems of medicine (Jadeja et al., 2014; Rodriguez-Ramiro et al., 2016). Salvianolic acid B (SalB) (Fig. 1) is a major water-soluble 5

component extracted from Radix Salvia miltiorrhiza and has been widely used for treating many types of illnesses, including hepatic, lung and renal diseases (Li et al., 2014; Yu et al., 2015). SalB has beneficial effects against hepatic fibrosis in animal models and has been shown to possess cardioprotective and neuroprotective activity via anti-oxidative and anti-inflammatory actions (Lee et al., 2013; Tang et al., 2016). Our previous studies have found that SalB plays a role in both acute ethanol-induced liver injury and non-alcoholic fatty liver disease (Li et al., 2014; Zeng et al., 2015). However, the role of SalB in preventing the onset and progression of chronic alcoholic liver injury remains unknown. SalB is a natural compound that activates mammalian sirtuins 1 (SIRT1), an NAD-dependent class III histone deacetylase (HDAC) that plays important roles in several physiological processes, including gene transcription, senescence, energy metabolism, oxidative stress and inflammation (Li et al., 2014; Lv et al., 2015; Zeng et al., 2015). Hepatic nuclear factor-1α (HNF-1α) is a homeodomain transcription factor that interacts with a complex network of transcription factors to regulate gene expression in the liver and kidney as well as in pancreatic β-cells (Nishikawa et al., 2015; Shih et al., 2001). It has been reported that HNF-1α binds directly to the promoter of the gene encoding C-reactive protein (CRP) to modulate its expression (Grimm et al., 2011; Kyithar et al., 2013). CRP is primarily synthesized in the liver and is involved in many chronic diseases (Zhao et al., 2016). CRP levels correlate closely with changes in inflammation/disease activity, radiological damage and progression, and functional disability. Along with its role as an inflammatory marker, CRP also promotes inflammation through complement activation (Warren et al., 2015; Wiese et al., 2016). Previous studies have demonstrated that SIRT1 inhibits HNF-1α-mediated transcriptional activation of the CRP promoter by deacetylating lysine 16 of 6

histone H4 around proximal HNF-1α binding sites in response to nutrient restriction (Grimm et al., 2011). Because inflammation has been recognized as a vital causative factor in the development of ALD (Mantena et al., 2008), we hypothesized that targeting the SIRT1/CRP pathway with SalB may represent a potential anti-inflammatory therapy for ALD. Carbohydrate response element-binding protein (ChREBP), a glucose-responsive transcription factor, has an important role in ALD (Liangpunsakul et al., 2013). Mice carrying a liver-specific SIRT1 null mutation were shown to exhibit increased ChREBP expression and liver steatosis (Wang et al., 2010). Our recent study found that carnosic acid (CA) alleviates chronic alcoholic liver injury by regulating the SIRT1/ChREBP pathway in rats (Gao et al., 2016). CA and SalB share similar chemical structures with their phenolic hydroxyl groups, which may lead to similar pharmacological activities. However, it is unknown whether SalB exerts its protective effects against ALD through the SIRT1/ChREBP pathway. The purposes of the present study were to explore whether SalB has beneficial effects against ALD and, if so, whether SalB exerts these protective effects against ALD through targeting SIRT1-mediated CRP and ChREBP inhibition.

2. Material and methods 2.1 Animal treatment and experimental design Male Sprague-Dawley (SD, SCXK 2008-0002) rats weighing 180-220 g were obtained from the Animal Center of Dalian Medical University (Dalian, China). All animal procedures were performed according to the guidelines of the Institutional Animal Ethics Committee and were approved by the Institutional Animal Committee of Dalian Medical University. The rats were 7

housed under standard laboratory conditions for approximately one week before experimentation. Fifty rats were randomly separated into five groups: 1) control, 2) control + SalB (30 mg/kg/d), 3) ethanol, 4) ethanol + SalB (15 mg/kg/d), and 5) ethanol + SalB (30 mg/kg/d). The doses of SalB were determined based on our preliminary previous study (Zeng et al., 2015)with modifications. Liquid diets were based on the Lieber-DeCarli formulation, and the ethanol content in the liquid diet was gradually increased from 5% in the first six weeks to 8% in the final two weeks (Gao et al., 2016). All the liquid diets were freshly prepared before distribution. The SalB groups received an intragastric administration every day, whereas the control group was treated with an equal volume of saline. After eight weeks, all the rats were euthanized, and blood and liver tissues were harvested.

2.2 Reagents SalB (purity>98%) and resveratrol (RES) (98% purity) were purchased from Shanghai Winherb Medical Science Co., Ltd (Shanghai, China) and dissolved in distilled water for in vivo rat treatments and in vitro cell testing. Ethanol (purity >99%) and Ex527 (purity>98%) were obtained from Sigma Co., Ltd. (Sigma, USA). MEM and fetal bovine serum (FBS) are Invitrogen products that were purchased from Life Technologies (Carlsbad, CA, USA). Lipofectamine 3000 was purchased from Invitrogen (Karlsruhe, Germany).

2.3 Biochemical assays The levels of triglyceride (TG) and total cholesterol (TC) in the liver as well as the levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alcohol dehydrogenase (ADH), 8

TG and TC in the serum were determined using commercial kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Blood levels of ethanol were measured using a kit from BioVision Inc. (San Francisco, USA). All of the procedures were carried out according to the manufacturers’ instructions.

2.4 Liver histopathological study The middle lobe of the right liver was excised for histopathology. Liver tissues were cut into 3-mm-thick slices and fixed in 4% neutral buffered formalin for 24 h, paraffin embedded, sliced into 5 μm sections, and stained with hematoxylin-eosin (H&E) for histopathological examination.

2.5 Oil Red O staining To visualize hepatic lipid accumulation, rat livers were removed and immediately snap-frozen at -70°C. Then, 6-μm-thick cryostat sections were prepared on an APES-coated glass slide. Each section was washed with distilled water and then stained with Oil Red O reagent (Sigma Aldrich) for 5-10 min. After washing with 60% isopropyl alcohol, the sections were re-stained with hematoxylin.

2.6 Measurement of cytokine levels The levels of TNF-α and IL-6 in the liver were measured using commercially available ELISA kits from Cusabio Biotech Co., Ltd. (Wuhan, China) according to the manufacturer’s instructions.

2.7 Cell culture and treatment 9

The HepG2 human hepatoma cell line was cultured in MEM containing 10% (v/v) FBS. The cells were incubated at 37°C in humidified air with 5% CO2. HepG2 cells were seeded at a density of 1 × 105 cells per well and grown for 24 h. After this, the cells were treated with 8μM SalB for 3 h or 10 mM Ex527 or RES for 6 h. Then, the cells were exposed to 100 mM ethanol for 48 h. The experimental details were as previously described (Gao et al., 2016; Zeng et al., 2015).

2.8 MTT assay Cell viability and survival was determined using the MTT (Sigma) assay. Briefly, 1 × 105 cells were plated in 96-well microtiter plates and treated with different concentrations of the compounds for 6 h. The HepG2 cells were exposed to 100 mM ethanol for 48 h. Meanwhile, the ethanol-exposed HepG2 cells were pre-treated, co-treated or post-treated with SalB (2, 4 or 8μM) for 3h, respectively. Then, the medium was removed and replaced with 100μL/well of fresh medium and 10μL of MTT (final concentration 0.5 mg/mL) was added to each well. The plates were incubated at 37℃ for 4 h, allowing viable cells to reduce the yellow tetrazolium salt into dark blue formazan crystals. After incubation, MTT solubilization solution (10% sodium dodecyl sulfate, 0.1 N HCL in anhydrous isopropanol) was added to the wells to dissolve formazan crystals. Finally, the absorbance of each individual well was determined at 570 nm.

2.9 Nile Red staining Nile Red is a selective fluorescent stain for intracellular lipid droplets. Cells were fixed in 4% paraformaldehyde and stained with Nile Red solution (1 μg/mL) in the dark for 10 min at 37°C. Lipid-bound Nile Red was observed with a fluorescence microscope. 10

2.10 Western blot analysis Equal amounts of protein were separated by 10–15% SDS-PAGE and transferred to PVDF membranes (Millipore, Bedford, MA, USA). After blocking, the membranes were immunoblotted with primary antibodies specific for SIRT1, ChREBP (both from Abcam Ltd., Cambridge, UK), HNF-1α (BD Biosciences, USA), CYP2E1 (Nanjing Jiancheng Bioengineering Institute), CRP (Bioworld Technology, Inc. Biogot Biotechnology Co., Ltd, USA) and β-actin (ZSGB-BIO, Beijing, China). After washing, the membranes were incubated with the appropriate secondary antibodies. The membranes were then exposed to enhanced chemiluminescence-plus reagents (Beyotime Institute of Biotechnology, Hangzhou, China). The emitted light was captured by a BioSpectrum 410 multispectral imaging system with a Chemi 410 HR camera and analyzed using Gel-Pro Analyzer Version 4.0 (Media Cybernetics, MD, USA).

2.11 Transient transfection of siRNA HepG2 cells were seeded on 6-well plates at a density of 1× 105 cells/well. When the cells were 50–60% confluent, they were transfected with 100 nM of SIRT1-specific siRNA, HNF-1α siRNA or a non-binding control siRNA using Lipofectamine 3000 (Invitrogen, Karlsruhe, Germany) according to the manufacturer’s instructions. The siRNA sequences were as follows: SIRT1 sense, 5'-CCCUGUAAAGCUUUCAGAAdtdt-3'

and

antisense,

5'-UUCUGAAAGCUUUACAGGGdtdt-3'; HNF-1α sense 5-AGAAGAAGCCUUCCGGCACtt-3 and antisense 5-ttUCUUCUUCGGAA GGCCGUG-3 (Genepharma, Shanghai, China).

11

2.12 RNA isolation and RT-PCR Total RNA was isolated using TRIzol reagent (TaKaRa, Dalian, China) according to the manufacturer's instructions. The quantity and purity of the obtained total RNA samples were determined by UV spectroscopy (NanoDrop 2000 Spectrophotometer, Thermo Fisher Scientific, Waltham, MA, USA). The sequences of the primers used for the RT-PCR assay are shown in Table 1. Two-step RT-PCR was performed as described in the TransScript® All-in-One First-Strand cDNA Synthesis SuperMix for qPCR protocol. The reverse transcription conditions were as follows: 42°C for 15 min followed by 5 s at 85°C to inactivate the polymerase. qPCR was performed using the following conditions: 30 s at 94°C for denaturation, 5 s at 94°C for annealing, and 30 s at 60°C for extension.

2.13 Statistical analysis All data were analyzed using SPSS 19.0 (Chicago, IL, USA). The results are reported as the mean ± standard deviation (SD). Comparisons of two groups were conducted using Student's t-test, and multi-group comparisons were conducted using the Student-Newman-Keuls method. Differences were considered statistically significant at p<0.05.

3. Results 3.1 Protective effects of SalB on chronic alcoholic liver injury We first explored whether SalB treatment protects rats from ethanol-induced liver injury. As shown in Fig. 2 (a, b), the body weight and liver weight in the chronic alcohol group were markedly greater than those in the control group, and SalB treatment reversed this trend. Moreover, the serum ALT and AST activities were higher in the chronic alcohol group compared with the 12

control group (Fig. 2 (c, d)). However, SalB treatment markedly decreased ALT and AST activity in a dose-dependent manner compared to ethanol alone, suggesting that SalB displays a protective effect against chronic alcoholic liver injury. In addition, we mimicked these conditions in vivo as previously described (Gao et al., 2016). SalB pre-treatment, co-treatment and post-treatment increased the viability of HepG2 cells exposed to ethanol in a dose-dependent manner (Fig. 2e). We further verified the protective effect of SalB by examining liver histopathology. As shown in Fig. 3 (a, b), H&E staining and Oil Red O staining of liver sections revealed that the vehicle produced no apparent abnormalities, whereas rats exposed to ethanol revealed nuclear pleomorphism, increased lipid accumulation and inflammatory cell infiltration. Nevertheless, hepatic lesions induced by ethanol were remarkably reduced upon pretreatment with SalB. Taken together, these results indicate that SalB is effective in protecting against chronic ethanol-induced liver injury.

3.2

SalB

enhanced

ethanol

metabolism

and

restored

the

activity

of

major

ethanol-metabolizing enzymes Ethanol is metabolized mainly in the liver through alcohol dehydrogenase (ADH) and cytochrome P450 2E1 (CYP2E1) (Zhong et al., 2015). We thus evaluated the effects of SalB on plasma ethanol and ADH levels as well as hepatic CYP2E1 expression. As show in Fig. 3 (c, d), compared with control rats, ethanol-exposed rats’ plasma ethanol levels were dramatically elevated and their plasma ADH levels were decreased, whereas SalB treatment reversed this trend. In agreement, compared with the control group, hepatic CYP2E1 expression was up-regulated in the ethanol-treated group, and SalB treatment significantly inhibited the expression of CYP2E1 (Fig. 3 e). Together, these results indicate that SalB enhanced ethanol metabolism and restored the activity of the major ethanol metabolizing enzymes during ALD. 3.3 SalB suppressed the release of pro-inflammatory cytokines We further evaluated the effects of SalB on inflammation in chronic alcoholic rats. Compared to the control group, ethanol exposure remarkably increased the TNF-α and IL-6 levels in the liver, however, treatment with SalB prevented these increases (Fig. 4). Consequently, the protective 13

effect of SalB on alcoholic liver injury involved inhibiting inflammation-based injury.

3.4 SalB-mediated protection involved activating SIRT1 and down-regulating CRP SIRT1 has been reported as a vital target of ethanol in the liver, and pharmacological activation of SIRT1 may constitute a potential therapeutic strategy (Gao et al., 2016; Li et al., 2014). Based on our previous study, we hypothesized that the protective effects of SalB against ethanol-induced chronic liver injury involved SIRT1 up-regulation. As shown in Fig. 5a, the hepatic SIRT1 protein levels were remarkably reduced in the ethanol group, and SalB reversed this trend in a dose-dependent manner. Moreover, SalB triggered an increase in SIRT1 expression in HepG2 cells, whereas SalB-mediated SIRT1 upregulation was mostly abrogated upon transfection with SIRT1 siRNA (Fig. 5d). Furthermore, SalB-mediated SIRT1 upregulation was also abrogated upon transfection of SIRT1 siRNA in ethanol-exposed HepG2 cells (Fig. 7c). C-reactive protein is synthesized during the acute phase of inflammation primarily in response to interleukin-6 (IL-6) (Cervoni et al., 2012). Moreover, CRP is a recognized surveillance marker of alcohol-induced fatty liver in rodent models (Liu et al., 2011). Thus, we investigated whether SalB-mediated protection against ALD involves CRP regulation. Our results showed that the levels of hepatic CRP protein and mRNA were remarkably increased in the ethanol group, and SalB reversed this trend in a dose-dependent manner (Fig. 5b, c). We next used HepG2 cells to further investigate whether there is an interaction between SIRT1 and CRP. As shown in Fig. 5d, SalB treatment markedly down-regulated CRP expression in HepG2 cells; however, this down-regulation was abrogated by SIRT1 siRNA transfection, suggesting an interaction between SIRT1 and CRP. To mimic ALD in vivo, an ethanol-induced cell model was established as 14

previously described (Gao et al., 2016). We used the SIRT1-specific antagonist Ex527 (Zeng et al., 2015) to confirm an interaction between SIRT1 and CRP in chronic liver injury. As shown in Fig. 5e, HepG2 cells exposed to ethanol for 48 h exhibited a decrease in SIRT1 expression and an increase in CRP expression. Furthermore, SalB treatment significantly upregulated SIRT1 and down-regulated CRP, whereas SalB-mediated protection was significantly blocked by Ex527. Together, these results suggest that the protection offered by SalB against ethanol-induced hepatic inflammation is partially mediated by activation of SIRT1 and downregulating of CRP.

3.5 HNF-1α is involved in the inhibition of CRP expression by SIRT1 HNF-1α is a homeodomain-containing transcription factor important in the diverse metabolic functions of the liver, pancreatic islets, kidney, and intestines (Dong et al., 2015). Forced re-expression of HNF-1α can reverse terminal chronic hepatic failure (Grimm et al., 2011). We investigated whether the protective effects mediated by SalB involved the regulation of HNF-1α. As shown in Fig. 6a, hepatic HNF-1α protein levels were remarkably reduced in the ethanol group, and SalB reversed this trend in a dose-dependent manner. Furthermore, SalB triggered an increase in both HNF-1α mRNA levels and protein expression in ethanol-exposed HepG2 cells, whereas SalB-mediated HNF-1α upregulation was mostly abrogated upon HNF-1α siRNA transfection (Fig. 6b, c). These results suggest that SalB treatment induces HNF-1α upregulation during ALD. It has been reported that Sirt1 interacts with HNF-1α and suppresses HNF-1α transcriptional activity as well as the expression of one of its target genes, CRP, under conditions of nutrient restriction (Grimm et al., 2011). Therefore, we investigated whether HNF-1α was involved in SalB-mediated activation of SIRT1 and down-regulation of CRP during ALD. As shown in Fig. 6c, 15

SalB treatment increased SIRT1 expression and decreased CRP expression in ethanol-exposed HepG2 cells. SalB-mediated downregulation of CRP was abrogated by HNF-1α siRNA transfection, which had no effect on SIRT1 expression. Next, we used the SIRT1 agonist RES (Zeng et al., 2015)to further detect any associations between HNF-1α, SIRT1 and CRP. The results showed that RES treatment upregulated both SIRT1 and HNF-1α expression and down-regulated CRP expression in ethanol-exposed HepG2 cells, whereas HNF-1α siRNA transfection abrogated increases in HNF-1α expression and decreases in CRP expression and had no effects on SIRT1 expression (Fig. 6d). We have also performed experiments in normal HepG2 cells and the results showed the same tendency both under ethanol exposure and in normal conditions. (Supplementary Materials Fig. 1). Collectively, these results indicate that HNF-1α is involved in SIRT1-mediated inhibition of CRP expression, which partially contributed to the protective effects of SalB against ethanol-induced ALD.

3.6 SalB decreased ChREBP expression via SIRT1 activation ChREBP has a major role in the development of hepatic steatosis in mice (Liangpunsakul et al., 2013). Consistent with our previous studies, hepatic ChREBP protein and mRNA levels were markedly enhanced in ethanol-exposed rats; however, SalB treatment activated SIRT1 and considerably decreased ChREBP protein and mRNA levels (Fig. 7a, b). To further explore these results, we measured ChREBP protein expression levels in vitro after SIRT1 siRNA transfection. As shown in Fig. 6c, ChREBP protein levels increased significantly after ethanol exposure, and pretreatment with SalB inhibited the upregulation of ChREBP. However, the SalB-mediated inhibition was blocked by siRNA-mediated SIRT1 knockdown (Fig. 7c). Taken together, these in 16

vivo and in vitro results demonstrate that the protective effects mediated by SalB against ALD occur partially via regulation of the SIRT1/ChREBP pathway.

3.7 SalB prevented lipid accumulation in alcoholic liver injury. ChREBP is intimately involved in hepatic lipogenesis and activates several genes that encode lipogenic enzymes, such as acetyl CoA carboxylase (ACC) and fatty acid synthase (FAS) (Strable and Ntambi, 2010). We investigated whether SalB treatment ameliorates hepatic steatosis in ethanol-exposed rats. Accordingly, TG and TC levels in the serum and liver were analyzed. As shown in (Fig. 8a, b), ethanol-containing diets significantly increased, TG and TC levels in the serum and liver compared to the control diet. However, SalB treatment reversed these increases in a dose-dependent manner. In vitro, HepG2 cells were pretreated with SalB and/or Ex527 before exposure to ethanol. Nile Red staining showed an increase in lipid droplets in ethanol-treated HepG2 cells, and the number of these droplets decreased after SalB pretreatment. However, the SalB-mediated protection was significantly blocked by Ex527 (Fig. 8c). These results indicated that SalB mitigated the lipid metabolism disorder during chronic alcoholic liver injury, and this protection may have partially occurred through the SIRT1/ChREBP pathway.

4.Discussion Alcohol has been identified as a leading risk factor for death and is closely associated with various types of liver disease. Of the 60 types of diseases and injuries associated with alcohol consumption, ALD is the most common endpoint (Parry et al., 2011; Rehm et al., 2013). Furthermore, ALD incidence is increasing and ALD accelerates the progression of other liver 17

diseases,

including

hepatitis

C

virus

(HCV),

hepatocellular

carcinoma

(HCC)

and

hemochromatosis (Seth et al., 2011). A better understanding of the mechanisms underlying ALD is necessary for the identification of novel therapeutic targets. In this study, we successfully generated ethanol-induced models of ALD in vivo and in vitro, both of which exhibited liver injury and lipid accumulation (Fig. 2, Fig. 3, Fig. 8). We further focused on the mechanism by which SalB exerts its protective effects against ethanol-induced hepatic damage. The results showed for the first time that 1) SalB contributes protection against chronic alcoholic liver injury by regulating ethanol and lipid metabolism as well as inflammation injury, and 2) the protective effect of SalB is at least partly related to modulation of the SIRT1/CRP and SIRT1/ChREBP pathways. SalB is a hydrophilic component that can be isolated from the Chinese herb Salviae miltiorrhizae, which has been widely used for thousands of years in traditional Chinese medicine (Yu et al., 2015). Many studies have demonstrated the pharmacological activities of SalB in protecting against liver fibrosis (Wang et al., 2012; Yu et al., 2015), lipopolysaccharide- and D-galactosamine-induced hepatocyte apoptosis (Yan et al., 2010), obesity-associated metabolic disorders (Wang et al., 2014), cerebral ischemia/reperfusion injury (Wang et al., 2016)and the platelet-mediated inflammatory response in vascular endothelial cells (Xu et al., 2015a), as well as cigarette smoke-induced lung inflammation in mice (Zhang et al., 2015). To the best of our knowledge, the present study is the first to report that SalB exerts potent protective functions in a dietary rat model of ALD. We found that SalB reduced serum ALT and AST levels in rats with ethanol-induced ALD (Fig. 2c, d). Improvements in the ethanol-exposed rats’ body and liver weights, as well as their serum and liver TG and TC levels, were accompanied by a considerable 18

reduction in hepatic steatosis (Fig. 3a, b; Fig. 8a, b). Furthermore, prior studies have provided evidence that some polyphenol consumption could significantly enhance the hepatic metabolism of ethanol through the regulation of alcohol-metabolizing enzymes (Wang et al., 2015; Yamashita et al., 2015). Accordingly, our present results showed that SalB pretreatment increased the activity of ADH and inhibited CYP2E1 expression, which could accelerate ethanol clearance and restore the activity of the major ethanol metabolizing enzymes so as to alleviate alcohol-induced liver injury in rats (Fig. 3c, d, e; Fig. 4). These data allowed us to further elucidate the molecular mechanisms involved in the protective effects of SalB against ALD. The mammalian sirtuins are NAD+-dependent lysine histone deacetylases that play central roles in cell survival, inflammation, energy metabolism, and aging (Sinclair and Guarente, 2014). Our previous studies have demonstrated that SIRT1 plays a central role in the pathogenesis of ethanol-induced ALD (Gao et al., 2016); furthermore, SalB has been recognized as a potent activator of SIRT1 (Li et al., 2014; Zeng et al., 2015). In the present study, SIRT1 expression was significantly decreased in the livers of ethanol-exposed rats, whereas SalB enhanced the expression of SIRT1. Moreover, the SalB-induced effect on SIRT1 was significantly inhibited upon transfection of SIRT1 siRNA into ethanol-exposed HepG2 cells (Fig. 7c). Therefore, these results suggest that SIRT1 up-regulation by SalB results in an attenuation of ethanol-induced ALD. Furthermore, recent data have revealed a common mechanism of allosteric activation by natural and synthetic SIRT1-activating compounds (STACs) that involves the binding of a STAC to a conserved N-terminal domain in SIRT1 (Sinclair and Guarente, 2014). However, the exact mechanism of how SalB activates SIRT1 remains unknown and further studies are still needed. Hepatocyte nuclear factors (HNFs) are liver-enriched transcriptional factors that have been shown 19

to trans-activate the promoters of several genes related to metabolism (Hayashi et al., 1999). HNF-1α, a hepatocyte network transcription factor from the HNF family, can interact with at least 200 genes that regulate the important biological functions of hepatocytes, such as carbohydrate synthesis and storage, lipid metabolism, detoxification, and serum protein synthesis (Takayama et al., 2012; Zeng et al., 2011). It has been reported that forced re-expression of the transcription factor HNF-1α can reverse terminal chronic hepatic failure (Grimm et al., 2011). Moreover, lentiviral transfection of HNF-1α enhanced the activity of CYP3A4 in HepG2 cells, which may be a useful strategy for establishing an assay to more accurately study drug metabolism in vitro (Chiang et al., 2014). Although the genes transcriptionally regulated by HNF-1α have been well studied, less is known about the regulation of HNF-1α at the protein level. The current study is the first to provide evidence that hepatic HNF-1α protein levels are remarkably reduced following exposure to ethanol and that SalB treatment induces up-regulation of HNF-1α in ALD. However, the mechanism by which SalB up-regulates HNF-1α remains unknown, and more experiments are needed to explore the precise regulatory mechanism of SalB-mediated HNF-1α activation. According to the “double-hit” hypothesis, inflammation is a vital contributor to the development of ALD (Mantena et al., 2008). Suppression of inflammation via regulation of the signaling cascades implicated in hepatic inflammation would greatly contribute to ameliorating the effects of ALD (Szabo, 2015). CRP is an acute-phase liver protein that is rapidly synthesized in response to tissue injury and plays a crucial role in the progression of hepatic inflammation (Chang et al., 2015; Shah et al., 2014). Recent studies have shown that metformin decreases plasma levels of CRP and reduces inflammation through SIRT1 induction in patients with carotid artery atherosclerosis (Xu et al., 2015b). In the present study, our results showed that the mRNA and 20

protein levels of hepatic CRP were remarkably increased following exposure to ethanol, and SalB treatment reversed these increases. Moreover, SalB-mediated down-regulation of CRP was abrogated by transfection of SIRT1 siRNA into HepG2 cells, suggesting an interaction between SIRT1 and CRP. Furthermore, it has been reported that SIRT1 interacts with HNF-1α and suppresses both HNF-1α transcriptional activity and the expression of one of its target genes, CRP, under conditions of nutrient restriction (Grimm et al., 2011). Consistently, our results showed that SalB treatment increased SIRT1 expression and decreased CRP expression in ethanol-exposed HepG2 cells, whereas SalB-mediated down-regulation of CRP was abrogated by HNF-1α siRNA transfection; this siRNA had no effect on SIRT1 expression. Importantly, RES treatment up-regulated both SIRT1 and HNF-1α expression, and down-regulated CRP expression in ethanol-exposed HepG2 cells, whereas HNF-1α siRNA transfection abrogated these increases in HNF-1α expression and decreases in CRP expression without affecting SIRT1 expression (Fig. 6d). Taken together, these results indicate that SIRT1/HNF-1α/CRP singling is involved in the pathogenesis of ethanol-induced ALD, and this signaling at least partially contributes to the protective effects of SalB against ethanol-induced ALD. Hepatic steatosis plays an important role in the pathogenesis of ALD (Tan et al., 2012). It has been reported that hepatic steatosis is accompanied by increased expression of ChREBP, which has emerged as a key determinant in the control of lipid synthesis (Wang et al., 2010). Our recent study indicated that CA alleviates chronic alcoholic liver injury via regulation of the SIRT1/ChREBP pathway in rats (Gao et al., 2016). Consistently, our present data reinforced the critical role of SIRT1/ChREBP in SalB-mediated protection against lipid metabolism in ALD. Our results showed that the mRNA and protein levels of hepatic ChREBP were markedly enhanced in 21

ethanol-exposed rats, whereas SalB treatment activated SIRT1 and considerably decreased ChREBP protein and mRNA levels, which was accompanied by an improvement in lipid accumulation in the liver. Moreover, the SalB-mediated inhibition of ChREBP was blocked by siRNA-mediated SIRT1 knockdown in ethanol-exposed HepG2 cells. Therefore, our results suggest that SalB protects against ALD at least partially by regulating the SIRT1/ChREBP pathway. Furthermore, recent studies have reported that a close relationship exists between ChREBP and alcohol-metabolizing enzymes (Marmier et al., 2015). Nevertheless, our interpretation does not necessarily exclude that the relationship between SalB and alcohol-metabolizing enzymes is responsible for the beneficial effects of SalB against ALD. Whether this relationship (Fig. 3 C, D, E) interacted with SalB-mediated regulation of CRP/ChREBP pathways during ALD requires further study. In summary, the present study revealed for the first time that SalB has a protective effect against hepatic inflammation and steatosis in ALD. According to the “double-hit” hypothesis, hepatic steatosis and inflammation are vital contributors to the development of ALD. Alleviation of lipid accumulation and inflammation via regulation of the signaling cascades implicated in hepatic inflammation and lipid metabolism would greatly contribute to ameliorating the progression of ALD. The protective effect of SalB is specifically associated with increased expression of SIRT1, which is accompanied by down-regulation of CRP and ChREBP, resulting in profound improvements in inflammation injury as well as ethanol and lipid metabolism. These results demonstrate that SalB confers protection against ethanol-induced hepatic steatosis and inflammation, which occurs at least partially through SIRT1-mediated inhibition of CRP and ChREBP. Furthermore, our results show for the first time that the inflammation-associated protein 22

CRP and the lipogenesis-associated protein ChREBP could serve as potential therapeutic targets in the treatment of chronic alcohol-induced liver injury in rats, which to some extent would further confirm the "two hits" hypothesis of ALD. Both of these pathways may be potential avenues for the treatment of ALD, and SalB is a potential candidate for delivering such treatment.

Author Contributions JY and NZ conceived the study and designed the assays. NZ, YH, CD, WZ, WS, HF, YZ, XS, LG, TX, DG and RW performed the experiments and analyzed the data. NZ and JY wrote and edited the manuscript. All of the authors read and approved the final manuscript.

Conflicts of interest: The authors declare that there are no conflicts of interest.

Acknowledgments This work was financially supported by grants from the Chinese National Natural Science Foundation (No. 81473266, 81372037, and 81501699).

23

References Cervoni, J.P., Thévenot, T., Weil, D., Muel, E., Barbot, O., Sheppard, F., Monnet, E., Di Martino, V., 2012. C-reactive protein predicts short-term mortality in patients with cirrhosis. J. Hepatol. 56, 1299-1304. Chang, C.C., Wu, C.L., Su, W.W., Shih, K.L., Tarng, D.C., Chou, C.T., Chen, T.Y., Kor, C.T., Wu, H.M., 2015. Interferon gamma-induced protein 10 is associated with insulin resistance and incident diabetes in patients with nonalcoholic fatty liver disease. Sci. Rep. 5, 10096. Chiang, T.S., Yang, K.C., Chiou, L.L., Huang, G.T., Lee, H.S., 2014. Enhancement of CYP3A4 activity in Hep G2 cells by lentiviral transfection of hepatocyte nuclear factor-1 alpha. PLOS ONE 9, e94885. Dong, B., Li, H., Singh, A.B., Cao, A., Liu, J., 2015. Inhibition of PCSK9 transcription by berberine involves down-regulation of hepatic HNF1alpha protein expression through the ubiquitin-proteasome degradation pathway. J. Biol. Chem. 290, 4047-4058. Gao, L., Shan, W., Zeng, W., Hu, Y., Wang, G., Tian, X., Zhang, N., Shi, X., Zhao, Y., Ding, C., Zhang, F., Liu, K., Yao, J., 2016. Carnosic acid alleviates chronic alcoholic liver injury by regulating the SIRT1/ChREBP and SIRT1/p66shc pathways in rats. Mol. Nutr. Food Res. 60, 1902–1911. Grimm, A.A., Brace, C.S., Wang, T., Stormo, G.D., Imai, S., 2011. A nutrient-sensitive interaction between Sirt1 and HNF-1alpha regulates Crp expression. Aging Cell 10, 305-317. Hayashi, Y., Wang, W., Ninomiya, T., Nagano, H., Ohta, K., Itoh, H., 1999. Liver enriched transcription factors and differentiation of hepatocellular carcinoma. Mol. Pathol. 52, 19-24. 24

Jadeja, R., Devkar, R.V., Nammi, S., 2014. Herbal medicines for the treatment of nonalcoholic steatohepatitis: current scenario and future prospects. Evid. Based Complement. Alternat. Med. 2014, 648308. Kyithar, M.P., Bonner, C., Bacon, S., Kilbride, S.M., Schmid, J., Graf, R., Prehn, J.H., Byrne, M.M., 2013. Effects of hepatocyte nuclear factor-1A and -4A on pancreatic stone protein/regenerating protein and C-reactive protein gene expression: implications for maturity-onset diabetes of the young. J. Transl. Med. 11, 156. Lee, Y.W., Kim, D.H., Jeon, S.J., Park, S.J., Kim, J.M., Jung, J.M., Lee, H.E., Bae, S.G., Oh, H.K., Son, K.H., Ho Son, K.H., Ryu, J.H., 2013. Neuroprotective effects of salvianolic acid B on an Abeta25-35 peptide-induced mouse model of Alzheimer's disease. Eur. J. Pharmacol. 704, 70-77. Li, M., Lu, Y., Hu, Y., Zhai, X., Xu, W., Jing, H., Tian, X., Lin, Y., Gao, D., Yao, J., 2014. Salvianolic acid B protects against acute ethanol-induced liver injury through SIRT1-mediated deacetylation of p53 in rats. Toxicol. Lett. 228, 67-74. Liangpunsakul, S., Crabb, D.W., 2016. Early detection of alcoholic liver disease: are we a step closer? Gastroenterology 150, 29-31. Liangpunsakul, S., Ross, R.A., Crabb, D.W., 2013. Activation of carbohydrate response element-binding protein by ethanol. J. Investig. Med. 61, 270-277. Liu, S.L., Cheng, C.C., Chang, C.C., Mai, F.D., Wang, C.C., Lee, S.C., Ho, A.S., Chen, L.Y., Chang, J., 2011. Discovery of serum biomarkers of alcoholic fatty liver in a rodent model: C-reactive protein. J. Biomed. Sci. 18, 52. Lv, H., Wang, L., Shen, J., Hao, S., Ming, A., Wang, X., Su, F., Zhang, Z., 2015. Salvianolic acid 25

B attenuates apoptosis and inflammation via SIRT1 activation in experimental stroke rats. Brain Res. Bull. 115, 30-36. Liu Z, Zheng X, Guo Y, Qin W, Hua L, Yang Y. Quantitatively metabolic profiles of salvianolic acids in rats after gastric-administration of Salvia miltiorrhiza extract. Fitoterapia. 2016 Sep; 113:27-34. Mantena, S.K., King, A.L., Andringa, K.K., Eccleston, H.B., Bailey, S.M., 2008. Mitochondrial dysfunction and oxidative stress in the pathogenesis of alcohol- and obesity-induced fatty liver diseases. Free Radic. Biol. Med. 44, 1259-1272. Marmier, S., Dentin, R., Daujat-Chavanieu, M., Guillou, H., Bertrand-Michel, J., Gerbal-Chaloin, S., Girard, J., Lotersztajn, S., Postic, C., 2015. Novel role for carbohydrate responsive element binding protein in the controlof ethanol metabolism and susceptibility to binge drinking. Hepatology 62, 1086–1100. Nishikawa, T., Bell, A., Brooks, J.M., Setoyama, K., Melis, M., Han, B., Fukumitsu, K., Handa, K., Tian, J., Kaestner, K.H., Vodovotz, Y., Locker, J., Soto-Gutierrez, A., Fox, I.J., 2015. Resetting the transcription factor network reverses terminal chronic hepatic failure. J. Clin. Invest. 125, 1533-1544. Parry, C.D., Patra, J., Rehm, J., 2011. Alcohol consumption and non-communicable diseases: epidemiology and policy implications. Addiction 106, 1718-1724. Pavlov, C.S., Casazza, G., Semenistaia, M., Nikolova, D., Tsochatzis, E., Liusina, E., Ivashkin, V.T., Gluud, C., 2016. Ultrasonography for diagnosis of alcoholic cirrhosis in people with alcoholic liver disease. Cochrane Database Syst. Rev. 3, CD011602. Rehm, J., Samokhvalov, A.V., Shield, K.D., 2013. Global burden of alcoholic liver diseases. J. 26

Hepatol. 59, 160-168. Rodriguez-Ramiro, I., Vauzour, D., Minihane, A.M., 2016. Polyphenols and non-alcoholic fatty liver disease: impact and mechanisms. Proc. Nutr. Soc. 75, 47-60. Seth, D., Haber, P.S., Syn, W.K., Diehl, A.M., Day, C.P., 2011. Pathogenesis of alcohol-induced liver disease: classical concepts and recent advances. J. Gastroenterol. Hepatol. 26, 1089-1105. Shah, N., Thanabalasingham, G., Owen, K.R., James, T.J., 2014. Comparability of high-sensitivity CRP methods to detect maturity-onset diabetes of the young due to HNF1A mutations. Br. J. Biomed. Sci. 71, 84-85. Shih, D.Q., Bussen, M., Sehayek, E., Ananthanarayanan, M., Shneider, B.L., Suchy, F.J., Shefer, S., Bollileni, J.S., Gonzalez, F.J., Breslow, J.L., Stoffel, M., 2001. Hepatocyte nuclear factor-1alpha is an essential regulator of bile acid and plasma cholesterol metabolism. Nat. Genet. 27, 375-382. Sinclair, D.A., Guarente, L., 2014. Small-molecule allosteric activators of sirtuins. Annu. Rev. Pharmacol. Toxicol. 54, 363-380. Strable, M.S., Ntambi, J.M., 2010. Genetic control of de novo lipogenesis: role in diet-induced obesity. Crit. Rev. Biochem. Mol. Biol. 45, 199-214. Szabo, G., 2015. Gut-liver axis in alcoholic liver disease. Gastroenterology 148, 30-36. Takayama, K., Inamura, M., Kawabata, K., Sugawara, M., Kikuchi, K., Higuchi, M., Nagamoto, Y., Watanabe, H., Tashiro, K., Sakurai, F., Hayakawa, T., Furue, M.K., Mizuguchi, H., 2012. Generation of metabolically functioning hepatocytes from human pluripotent stem cells by FOXA2 and HNF1alpha transduction. J. Hepatol. 57, 628-636. 27

Tan, X., Sun, X., Li, Q., Zhao, Y., Zhong, W., Sun, X., Jia, W., McClain, C.J., Zhou, Z., 2012. Leptin deficiency contributes to the pathogenesis of alcoholic fatty liver disease in mice. Am. J. Pathol. 181, 1279-1286. Tang, Y., Huang, D., Zhang, M.H., Zhang, W.S., Tang, Y.X., Shi, Z.X., Deng, L., Zhou, D.H., Lu, X.Y., 2016. Salvianolic acid B inhibits Abeta generation by modulating BACE1 activity in SH-SY5Y-APPsw cells. Nutrients. 2016 Jun 1;8(6). Thiele, M., Detlefsen, S., Sevelsted Møller, L., Madsen, B.S., Fuglsang Hansen, J., Fialla, A.D., Trebicka, J., Krag, A., 2016. Transient and 2-dimensional shear-wave Elastography provide comparable assessment of alcoholic liver fibrosis and cirrhosis. Gastroenterology 150, 123-133. Wang, P., Xu, S., Li, W., Wang, F., Yang, Z., Jiang, L., Wang, Q., Huang, M., Zhou, P., 2014. Salvianolic acid B inhibited PPARgamma expression and attenuated weight gain in mice with high-fat diet-induced obesity. Cell. Physiol. Biochem. 34, 288-298. Wang, R.H., Li, C., Deng, C.X., 2010. Liver steatosis and increased ChREBP expression in mice carrying a liver specific SIRT1 null mutation under a normal feeding condition. Int. J. Biol. Sci. 6, 682-690. Wang, R., Yu, X.Y., Guo, Z.Y., Wang, Y.J., Wu, Y., Yuan, Y.F., 2012. Inhibitory effects of salvianolic acid B on CCl(4)-induced hepatic fibrosis through regulating NF-κB/IκBα signaling. J. Ethnopharmacol. 144, 592-598. Wang, Y., Chen, G., Yu, X., Li, Y., Zhang, L., He, Z., Zhang, N., Yang, X., Zhao, Y., Li, N., Qiu, H., 2016. Salvianolic acid B ameliorates cerebral ischemia/reperfusion injury through inhibiting TLR4/MyD88 signaling pathway. Inflammation 39, 1503-1513. 28

Wang, Y., Jiang, Y., Fan, X., Tan, H., Zeng, H., Wang, Y., Chen, P., Huang, M., Bi, H., 2015. Hepato-protective effect of resveratrol against acetaminophen-induced liver injury is associated with inhibition of CYP-mediated bioactivation and regulation of SIRT1-p53 signaling pathways. Toxicol. Lett. 236, 82-89. Warren, M.S., Hughes, S.G., Singleton, W., Yamashita, M., Genovese, M.C., 2015. Results of a proof of concept, double-blind, randomized trial of a second generation antisense oligonucleotide targeting high-sensitivity C-reactive protein (hs-CRP) in rheumatoid arthritis. Arthritis Res. Ther. 17, 80. Wiese, D., Kampe, K., Waldmann, J., Heverhagen, A.E., Bartsch, D.K., Fendrich, V., 2016. C-reactive protein as a new prognostic factor for survival in patients with pancreatic neuroendocrine neoplasia. J Clin Endocrinol Metab. 2016 Mar;101(3):937-44. Xu, S., Zhong, A., Bu, X., Ma, H., Li, W., Xu, X., Zhang, J., 2015a. Salvianolic acid B inhibits platelets-mediated inflammatory response in vascular endothelial cells. Thromb. Res. 135, 137-145. Xu, W., Deng, Y.Y., Yang, L., Zhao, S., Liu, J., Zhao, Z., Wang, L., Maharjan, P., Gao, S., Tian, Y., Zhuo, X., Zhao, Y., Zhou, J., Yuan, Z., Wu, Y., 2015b. Metformin ameliorates the proinflammatory state in patients with carotid artery atherosclerosis through sirtuin 1 induction. Transl. Res. 166, 451-458. Yamashita, H., Goto, M., Matsui-Yuasa, I., Kojima-Yuasa, A., 2015. Ecklonia cava polyphenol Has a protective effect against ethanol-induced Liver injury in a cyclic AMP-dependent Manner. Mar. Drugs 13, 3877-3891. Yan, X., Zhou, T., Tao, Y., Wang, Q., Liu, P., Liu, C., 2010. Salvianolic acid B attenuates 29

hepatocyte apoptosis by regulating mediators in death receptor and mitochondrial pathways. Exp. Biol. Med. (Maywood) 235, 623-632. Yu, F., Lu, Z., Chen, B., Wu, X., Dong, P., Zheng, J., 2015. Salvianolic acid B-induced microRNA-152 inhibits liver fibrosis by attenuating DNMT1-mediated Patched1 methylation. J. Cell. Mol. Med. 19, 2617-2632. Zeng, W., Shan, W., Gao, L., Gao, D., Hu, Y., Wang, G., Zhang, N., Li, Z., Tian, X., Xu, W., Peng, J., Ma, X., Yao, J., 2015. Inhibition of HMGB1 release via salvianolic acid B-mediated SIRT1 up-regulation protects rats against non-alcoholic fatty liver disease. Sci. Rep. 5, 16013. Zeng, X., Lin, Y., Yin, C., Zhang, X., Ning, B.F., Zhang, Q., Zhang, J.P., Qiu, L., Qin, X.R., Chen, Y.X., Xie, W.F., 2011. Recombinant adenovirus carrying the hepatocyte nuclear factor-1alpha gene inhibits hepatocellular carcinoma xenograft growth in mice. Hepatology 54, 2036-2047. Zhang, D.F., Zhang, J., Li, R., 2015. Salvianolic acid B attenuates lung inflammation induced by cigarette smoke in mice. Eur. J. Pharmacol. 761, 174-179. Zhao, J., Liu, J., Pang, X., Zhang, X., Wang, S., Wu, D., 2016. Rosiglitazone attenuates angiotensin II-induced C-reactive protein expression in

hepatocytes via inhibiting

AT1/ROS/MAPK signal pathway. Int. Immunopharmacol. 31, 178-185. Zhong, W., Zhang, W., Li, Q., Xie, G., Sun, Q., Sun, X., Tan, X., Sun, X., Jia, W., Zhou, Z., 2015. Pharmacological activation of aldehyde dehydrogenase 2 by Alda-1 reverses alcohol-induced hepatic steatosis and cell death in mice. J. Hepatol. 62, 1375-1381.

30

Figure 1 Chemical structure of salvianolic acid B.

31

Figure 2 Protective effects of SalB on chronic alcoholic liver injury. (A) Body weight. (B) Liver weight. (C) Serum levels of alanine aminotransferase (ALT). (D) Serum levels of aspartate aminotransferase (AST). The results are presented as the mean ± SD (n=8), *P<0.05, **P<0.01 vs. the control group; #P<0.05, ##P<0.01 vs. the ethanol group. (E) HepG2 cells were exposed to 100 mM ethanol for 48 h, meanwhile, the ethanol-exposed HepG2 cells were pre-treated, co-treated or post-treated with SalB (2, 4, or 8 μM) for 3 h, respectively. Then, the number of viable cells was determined using an MTT reduction assay. The data are expressed as the means ± SD. ** P<0.01 vs. the control group, ## P<0.01 vs. the ethanol group (n=8).

32

Figure 3 Effects of SalB on liver injury and ethanol consumption in rats. (A) H&E staining of liver sections and (B) Oil Red O staining of liver sections from the experimental groups: a, control; b, control + SalB (30 mg/kg); c, ethanol; d, ethanol + SalB (15 mg/kg/d) and e, ethanol + SalB (30 mg/kg/d). The images were photographed at 200×magnification. (C) Serum levels of ethanol. (D) Serum levels of ethanol dehydrogenase (ADH). The results are presented as the mean ± SD (n=8), *P<0.05, **P<0.01 vs. the control group; #P<0.05, ##P<0.01 vs. the ethanol group. (E) CYP2E1 protein levels in the liver were determined by Western blotting (n=3). The results are presented as the mean ± SD (n=3), **P<0.01 vs. the control group; ##P<0.01 vs. the ethanol group.

33

Figure 4 SalB suppresses the release of pro-inflammatory cytokines. (A) Liver tumor necrosis factor-α (TNF-α). (B) Liver interleukin-6 (IL-6). The results are presented as the mean ± SD (n= 5), **P<0.01 vs. the control group, ##P<0.01 vs. the ethanol group.

34

Figure 5 SalB activates the SIRT1/CRP pathway in rat liver and HepG2 cells. (A, B) SIRT1 and CRP protein levels in the liver were determined by Western blotting (n=3). (C) Hepatic mRNA levels of CRP were analyzed by RT-PCR (n=4). The results are presented as the mean ± SD. ** P<0.01 vs. the control group; ## P<0.01 vs. the ethanol group. (D) HepG2 cells were transfected with either control siRNA or SIRT1 siRNA for 48 h. The transfected cells were then treated with SalB (8 μM) for 3 h, and SIRT1 and CRP protein levels in cellular lysates were measured by Western blotting. The data are expressed as the mean ± SD (n=3). * P<0.05, ** P<0.01 vs. the si-Con group. (E) HepG2 cells were treated with 10 μM EX527 for 6 h, 8 μM SalB for 3 h, and/or 100 mM ethanol for 48 h. SIRT1 and CRP protein levels were evaluated by Western blotting (n=3). The data are expressed as the mean ± SD (n=3). **p<0.01 vs. the control group, #p<0.05, ##p<0.01 vs. the ethanol group.

35

Figure 6 HNF-1α is involved in the SIRT1-mediated inhibition of CRP expression. (A) Hepatic HNF-1α protein levels were determined by Western blotting (n=3). HepG2 cells were transfected with either control siRNA or HNF-1α siRNA for 48 h. Then, the transfected cells were treated with SalB (8 μM) for 3 h. (B) Cellular mRNA levels of HNF-1α were analyzed by RT-PCR (n=4). (C) SIRT1, HNF-1α and CRP protein levels in cellular lysate were measured by Western blotting (n=3). The data are expressed as the mean ± SD. * P<0.05, ** P<0.01 vs. the si-Con group; ## P<0.01 vs. the si-Con+ SalB group. && P<0.01 vs. the si-HNF-1α + SalB group. (D) HepG2 cells were transfected with either control siRNA or HNF-1α siRNA for 48 h. Then, the transfected cells were treated with RES (10 μM) for 6 h, and exposed to 100 mM ethanol for 48 h. SIRT1, HNF-1α and CRP protein levels in the cellular lysate were measured by Western blotting (n=3). The data are expressed as the mean ± SD. ** P<0.01 vs. the ethanol group. ## P<0.01 vs. the ethanol + RES group. && P<0.01 vs. the si-HNF-1α group. 36

Figure 7 SalB decreases ChREBP expression through SIRT1 activation. (A) ChREBP protein levels in the liver were determined by Western blotting (n=3). (B) Hepatic mRNA levels of ChREBP were analyzed by qRT-PCR (n=4). The results are presented as the mean ± SD. ** P<0.01 vs. the control group; # P<0.05, ## P<0.01 vs. the ethanol group. (C) HepG2 cells were transfected with either control siRNA or SIRT1 siRNA for 48 h. Then, the transfected cells were treated with SalB (8 μM) for 3 h and exposed to 100 mM ethanol for 48 h. SIRT1 and ChREBP protein levels in cellular lysate were measured by Western blotting. The data are expressed as the mean ± SD (n=3). * P<0.05, ** P<0.01 vs. the si-Con group; # P<0.05, ## P<0.01 vs. the ethanol + si-Con group; && P<0.01 vs. the ethanol + si-Con + SalB group.

37

Figure 8 SalB prevents lipid accumulation in ethanol-induced chronic liver injury. (A, B) Serum and hepatic levels of total cholesterol (TC) and triglyceride (TG). The results are presented as the mean ± SD (n=8). **P<0.01 vs. the control group. #P<0.05, ##P<0.01 vs. the ethanol group. (C) HepG2 cells were pretreated with SalB (8 μM) for 3 h and/or 10 μM Ex527 for 6 h before exposure to 100 mM ethanol for 48 h. Intracellular lipid accumulation was measured by Nile Red staining (400×). The experimental groups are as follows: control group; ethanol group; ethanol + SalB group; ethanol + Ex527 group; ethanol + Ex527 + SalB group.

38

Table 1 Primers for the RT-PCR assay

Rat CRP Rat ChREBP Human HNF-1α Rat β-actin Human β-actin

39

Sequence F: TGTCTCTATGCCCACGCTGATG R: GGCCCACCTACTGCAATACTAAAC F: GCATCCTCATCCGACCTTTA R: GATGCTTGTGGAAGTGCTGA F: TACACCTGGTACGTCCGCAA R: CACTTGAAACGGTTCCTCCG F: GGAAATCGTGCGTGACATTAAAG R: CGGCAGTGGCCATCTCTT F: AGTACTCCGTGTGGATCGGC R: GCTGATCCACATCTGCTGGA