Schisandrin B exhibits anti-inflammatory activity through modulation of the redox-sensitive transcription factors Nrf2 and NF-κB

Free Radical Biology and Medicine 53 (2012) 1421–1430

Contents lists available at SciVerse ScienceDirect

Free Radical Biology and Medicine journal homepage: www.elsevier.com/locate/freeradbiomed

Original Contribution

Schisandrin B exhibits anti-inflammatory activity through modulation of the redox-sensitive transcription factors Nrf2 and NF-kB Rahul Checker a, Raghavendra S. Patwardhan a, Deepak Sharma a, Jisha Menon a, Maikho Thoh a, Hari N. Bhilwade a, Tetsuya Konishi b, Santosh K. Sandur a,n a b

Radiation Biology & Health Sciences Division, Bio-Medical Group, Bhabha Atomic Research Centre, Mumbai 400085, India Department of Functional and Analytical Food Sciences, Niigata University of Pharmacy & Applied Life Sciences, Niigata, Japan

a r t i c l e i n f o

abstract

Article history: Received 19 January 2012 Received in revised form 3 July 2012 Accepted 6 August 2012 Available online 11 August 2012

Schisandrin B (SB), a dibenzocyclooctadiene derivative isolated from Schisandra chinensis and used commonly in traditional Chinese medicine for the treatment of hepatitis and myocardial disorders, has been recently shown to modulate cellular redox balance. Since we have shown that cellular redox plays an important role in the modulation of immune responses, the present studies were undertaken to study the effects of SB on activation and effector functions of lymphocytes. SB altered the redox status of lymphocytes by enhancing the basal reactive oxygen species levels and altering the GSH/GSSG ratio in lymphocytes. It also induced nuclear translocation of redox sensitive transcription factor Nrf2 and increased the transcription of its dependent genes. SB inhibited mitogen-induced proliferation and cytokine secretion by lymphocytes. SB also significantly inhibited mitogen-induced upregulation of T cell costimulatory molecules and activation markers. It was observed that SB inhibited mitogeninduced phosphorylation of c-Raf, MEK, ERK, JNK, and p38. It suppressed IkBa degradation and nuclear translocation of NF-kB in activated lymphocytes. Anti-inflammatory effects of SB were significantly abrogated by the inhibitors of Nrf2 and HO-1, suggesting the involvement of this pathway. Similar antiinflammatory effects of SB on lymphocyte proliferation and cytokine secretion were also observed in vivo. To our knowledge, this is the first report showing that the anti-inflammatory effects of SB are mediated via modulation of Nrf2 and NF-kB in lymphocytes. & 2012 Elsevier Inc. All rights reserved.

Keywords: Reactive oxygen species Heme oxygenase-1 Glutathione Lymphocytes Cytokines Free radicals

Introduction Dysregulation of inflammatory processes leads to several undesirable outcomes including chronic infiltration of tissues by lymphocytes and leukocytes (granulomas), cytokine production, and oxidative stress [1,2]. The identification of novel antiinflammatory/immunosuppressive drugs is important for successful inhibition of chronic inflammation, which can otherwise contribute to a wide variety of diseases such as diabetes, arthritis, Alzheimer disease, pulmonary diseases, and autoimmune disorders [3]. Some of the clinically used immunosuppressive drugs are from natural sources, such as cyclosporin A from (the fungus Tolypocladium inflatum), tacrolimus (macrolide lactone from the bacterium Streptomyces tsukubaensis), rapamycin (initially isolated from the bacterium Streptomyces hygroscopicus), and some are synthetic molecules such as corticosteroids, azathioprine, and mycophenolate mofetil [4,5]. Long-term use of these immunosuppressive drugs for solid organ transplant or autoimmune disorders

n

Corresponding author. Fax: þ91 22 25505326. E-mail address: [email protected] (S.K. Sandur).

0891-5849/$ - see front matter & 2012 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.freeradbiomed.2012.08.006

is known to cause severe side effects. Therefore, there is a need to identify novel anti-inflammatory agents. Extensive research on the biological and medicinal properties of phytochemicals and plant extracts is being carried out in India. Schisandrin B (SB), isolated from the fruit of Schisandra chinensis, is used in traditional Chinese medicine for the treatment of hepatitis and myocardial disorders [6,7]. SB inhibited lipoperoxidative damage to the plasma membrane of rat liver in vitro [8]. Pretreatment with SB protected mouse liver against tumor necrosis factor a-induced apoptosis in a dose-dependent manner [9]. SB was shown to enhance doxorubicin-induced apoptosis in human hepatic and breast cancer cell lines through activation of the mitochondrial apoptotic pathway without any enhanced toxicity toward normal cells [10]. It was also shown to protect against carbon tetrachloride-induced liver damage and myocardial ischemia–reperfusion injury through removal of reactive oxygen species (ROS) by enhancing cellular glutathione antioxidant status [11]. The doses of SB used to protect against liver damage caused by carbon tetrachloride were as high as 1200 mg/kg in mice, indicating the nontoxic nature of this compound [12,13]. SB has been shown to protect against a variety of hepatotoxins in mice [14,15]. A recent report by Chiu et al. demonstrated that SB ameliorated hypoxia/reoxygenation-induced apoptosis in hepatocytes

1422

R. Checker et al. / Free Radical Biology and Medicine 53 (2012) 1421–1430

through activation of the nuclear factor-erythroid 2-related factor 2 (Nrf2) pathway [16]. Activation of Nrf2 and its dependent gene heme oxygenase-1 (HO-1) is known to induce anti-inflammatory responses. Several investigators have reported that HO-1 and its product carbon monoxide (CO) can reduce edema, leukocyte adhesion, migration, and production of cytokines [17–19]. HO-1 also stimulates the antiinflammatory molecule interleukin-10 [20,21]. Further, activation of Nrf2 has been shown to suppress proinflammatory transcription factor NF-kB. NF-kB and other members of the Rel family reside in the cytoplasm in an inactive state but are translocated to the nucleus upon activation. Activation of NF-kB induces a large number of genes, including inflammatory cytokines, adhesion molecules, and Rel proteins [22–25]. Dysregulation of NF-kB has been associated with various pathological conditions including toxic/septic shock, graftversus-host reaction, acute inflammatory conditions, acute-phase response, and cancer [26]. Based on these reports, we hypothesized that SB may suppress inflammatory responses through modulation of NF-kB via upregulation of the Nrf2 pathway. In this study experiments were carried out to understand the effects of SB on proinflammatory responses mounted by T lymphocytes and B lymphocytes. The molecular mechanism of action for the observed anti-inflammatory activity of SB was delineated by studying its effects on activation of mitogenactivated protein (MAP) kinases, NF-kB, and Nrf2.

Materials and methods Chemicals Schisandrin B was purchased from LKT Laboratories (USA). RPMI 1640, Hepes, EDTA, EGTA, phenylmethanesulfonyl fluoride, leupeptin, aprotinin, benzamidine, dithiothreitol (DTT), lipopolysaccharide (LPS), tin protoporphyrin (SnPP), all-trans-retinoic acid (ATRA), and dimethyl sulfoxide (DMSO) were purchased from Sigma Chemical Co. (USA). Fetal calf serum (FCS) was obtained from GIBCO BRL. Concanavalin A (Con A) was purchased from Calbiochem (USA). Carboxy fluorescein diacetate succinimidyl ester (CFSE) was procured from Molecular Probes. ELISA sets for the detection of cytokines (IL-2, IL-3, IL-4, IL-6, and IFN-g) and monoclonal antibodies against CD28, CD25, CD69, CD71, CD98, and CD54 labeled with phycoerythrin (PE) were procured from BD Pharmingen (USA). Antibodies against p-ERK, ERK, IkBa, p-MEK, p-c-Raf, p-JNK, JNK, and b-actin were obtained from Cell Signaling Technologies (USA). Animal maintenance Six- to eight-week-old Swiss male mice, weighing approximately 20–25 g, reared in the animal house of the Bhabha Atomic Research Centre were used. They were housed at constant temperature (23 1C) with a 12/12-h light/dark cycle and were given mouse chow and water ad libitum. The guidelines issued by the Institutional Animal Ethics Committee of Bhabha Atomic Research Centre, Government of India, regarding the maintenance and dissection of small animals were strictly followed. Treatment with SB A 50 mM solution of SB was prepared in dimethyl sulfoxide, stored as small aliquots at 20 1C, and diluted as needed in cell culture medium. In all in vitro experiments, cells were treated with various concentrations of SB for 4 h before the initiation of culture. DMSO was used as vehicle control in vitro. In all in vivo experiments, mice were injected intraperitoneally (ip) with SB

(80 mg/kg body wt) in 100 ml DMSO. The mice in the control group were treated with an equal volume of DMSO. Intracellular ROS measurements To detect intracellular ROS, lymphocytes were preincubated with 20 mM oxidation-sensitive dichlorodihydrofluorescein diacetate (H2DCF-DA) for 25 min at 37 1C and then treated with various concentrations of SB. The oxidized form of the dye (DCF) acts as a control for changes in uptake, ester cleavage, and efflux. After 1 h of incubation, the increase in fluorescence resulting from oxidation of H2DCF to DCF was measured using a spectrofluorimeter [27]. Determination of intracellular glutathione and glutathione disulfide levels The ratio of reduced to oxidized glutathione (GSH/GSSG) was estimated using the enzymatic recycling method [28]. Quantitative real-time RT-PCR Total RNA was isolated from the samples using Trizol reagent following the manufacturer’s instructions (Sigma). Total RNA (2 mg) was converted to cDNA by reverse transcription (cDNA synthesis kit) following the manufacturer’s instructions (Sigma). Quantitative PCR was carried out using a Rotor Gene 3000 (Corbett Research) machine. PCR was set up by mixing 10 SYBR green PCR mix (Sigma) with 5 ml cDNA, 10 pmol each of forward and reverse primers (for primer sequence see Table 1), and PCR-grade water in a 20-ml reaction system. The above reaction mixtures were amplified in the following steps: step 1, denaturation at 95 1C for 5 min; step 2, denaturation at 95 1C for 15 s; step 3, annealing at 57 1C for 15 s; step 4, extension at 72 1C for 20 s; step 5, melting curve analysis. Steps 2 to 4 were repeated for 40 cycles. The specificity of each amplicon was confirmed from the melting curve analysis. The amplification of each gene was carried out in triplicate for each group. The threshold cycle (the cycle at which the amplification enters into exponential phase) values obtained from the above runs were used for calculating the expression levels of genes by REST-384 version 2 software [29]. The expression of the genes was normalized against that of a housekeeping gene, b-actin, and plotted as relative change in expression with respect to control. Splenic lymphocyte preparation The spleen was aseptically removed from the mice and placed in a sterile petri dish containing RPMI 1640 medium. Single-cell suspensions were prepared by gently squeezing the spleen on a sterile wire mesh placed in the petri dish. The cell suspension was carefully transferred to 15-ml sterile tubes and centrifuged at 3000 rpm for 5 min. Red blood cells (RBCs) among the spleen cells Table 1 List of gene-specific primer sequences. Gene

Sequence

HO-1

Forward: AGGTACACATCCAAGCCGAGA Reverse: CCATCACCAGCTTAAAGCCTT Forward: GGGTCCTATGACTTCGACCTG Reverse: AGTCGGTGTGACAAAATCCAAG Forward: CTACCACGCAGTCAAGGACC Reverse: CCTCCATTCAGTAACAACTGGAC Forward: CTTTAGTCAGCGACAGAAGGAC Reverse: AGGCATCTTGTTTGGGAATGTG Forward: GCGGGAAATCGTGCGTGACATT Reverse: GATGGAGTTGAAGGTAGTTTCGTG

TrxR1 GCLC Nrf-2

b-Actin

R. Checker et al. / Free Radical Biology and Medicine 53 (2012) 1421–1430

were lysed by brief hypotonic shock using ice-cold water (5 ml, 10 s) followed by ice-cold 2 phosphate-buffered saline (PBS; 5 ml). The RBC membranes were allowed to pellet by centrifuging the tubes at 1000 rpm for 30 s and lymphocytes were carefully decanted into a fresh tube. The lymphocytes were further centrifuged at 3000 rpm for 5 min and the cell pellet was resuspended in RPMI 1640 medium containing 10% heat inactivated fetal bovine serum. Viable cells were counted on a hemocytometer after staining with trypan blue dye.

1423

in 5% fat-free milk, incubated overnight with the primary antibody specific to IkBa or p-c-Raf or p-MEK or p-ERK or p-JNK or p-p38 and washed three times with Tris-buffered saline containing 0.05% Tween 20 and further incubated with horseradish peroxidaselabeled secondary antibody for 1 h. The membranes were washed, and specific bands were visualized on X-ray films using an enhanced chemiluminescence kit (Roche, Germany). The membrane was stripped and reprobed with a-tubulin or ERK or JNK or p38 antibody. Electrophoretic mobility-shift assay (EMSA)

Proliferation assay

The concentration of IL-2, IL-3, IL-4, IL-6, and IFN-g in the supernatant of control unstimulated cells and cells stimulated with Con A or anti-CD3/CD28 antibodies for 24 h after SB pretreatment (4 h) was estimated using cytokine ELISA sets (BD Pharmingen, USA) [31].

Splenocytes were treated with SB (50 mM, 4 h) and were stimulated with Con A (5 mg/ml) for 1 h at 37 1C or treated with 50 mM SB for various time intervals. Nuclear extracts were prepared as described earlier [33]. EMSA for NF-kB (Con Astimulated samples in presence or absence of SB) or Nrf2 (SBtreated samples) was performed by incubating 10 mg of nuclear proteins with 16 fmol of 32P-end-labeled, double-stranded NF-kB oligonucleotides from the human immunodeficiency virus long terminal repeat (50 –TTGTTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGG-30 ; italic indicates NF-kB binding sites) or the antioxidant response element (ARE; 50 –CGGTCACCGTTACTCAGCACTTTG-30 ), respectively, in the presence of 0.5 mg of poly(20 -deoxyinosinic-20 -deoxycytidylic acid) in binding buffer (25 mM Hepes, pH 7.9, 0.5 mM EDTA, 0.5 mM DTT, 1% Nonidet P-40, 5% glycerol, and 50 mM NaCl) for 30 min at 37 1C. The DNA– protein complex was separated from free oligonucleotide on 6.6% native polyacrylamide gel using buffer containing 50 mM Tris, 200 mM glycine, and 1 mM EDTA, pH 8.5. The dried gel was exposed on a phosphorimage plate and the radioactive bands were visualized using a phosphorimage plate scanner (Amersham Biosciences, USA).

Surface and intracellular antibody staining

Statistical analysis

Surface staining with PE-labeled monoclonal antibodies (mAbs) was done as described earlier [32]. In brief, splenocytes were treated with SB (50 mM) and were further stimulated with Con A (5 mg/ml) or LPS (50 mg/ml) for 24 or 48 h. Staining with PEconjugated CD25 antibody or CD69 antibody was done with cells (1  106) obtained 24 h after Con A treatment, whereas staining with CD28, CD54, CD71, and CD98 was done with cells obtained 48 h after mitogenic stimulation. A total of 20,000 cells in each group were acquired on a Partec Cyflow flow cytometer and analyzed using Flomax software or FlowJo software (Treestar). For intracellular antibody staining, three million lymphocytes were cultured in the presence or absence of SB for 18 h at 37 1C. Cultured cells were fixed with 4% paraformaldehyde for 10 min at room temperature and excess paraformaldehyde was removed by washing once with wash buffer (PBS containing 1% bovine serum albumin). Before being stained with monoclonal antibody against HO-1, cells were permeabilized with PBS containing 0.02% Tween 20 three times for 5 min each at room temperature followed by two washes with wash buffer and then incubated with PE-labeled HO-1 mAbs for 30 min at room temperature, washed two times, and analyzed using a Partec Cyflow flow cytometer.

Data are presented as means 7 SEM. The statistical analysis was done with Microcal Origin 6.0 software using Student’s t test. p o 0.01 was considered significant.

Splenocytes were stained with CFSE (20 mM, 5 min, 37 1C) and washed three times using ice-cold RPMI medium containing 10% FCS, 100 IU/ml penicillin, and 100 mg/ml streptomycin. Two million splenocytes were treated with SB (10 to 50 mM, 4 h) and were stimulated with Con A (5 mg/ml) or anti-CD3/CD28 antibody or LPS (50 mg/ml) for 72 h at 37 1C in 2 ml RPMI with 10% FCS in a 95% air/5% CO2 atmosphere. Vehicle-treated cells served as a control. Cell proliferation was measured by dye dilution in a flow cytometer (Partec CyFlow). Cells that showed a decrease in CFSE fluorescence intensity were calculated using Flowmax software or FlowJo software (Treestar, Inc., USA) and were expressed as percentage daughter cells [30]. Measurement of cytokine secretion

Western blot analysis Splenocytes were pretreated with SB (50 mM) for 4 h and then stimulated with Con A (5 mg/ml) for 1 h at 37 1C. Cytosolic extracts or whole-cell extracts were prepared as described earlier [33]. Vehicletreated cells served as a control. Protein estimation was carried out using the Bradford method and Bio-Rad protein reagent. Equal amounts of protein (50 mg) were resolved by SDS–PAGE (10%) and transferred to nitrocellulose membrane. The membrane was blocked

Results SB modulates cellular redox status and activates Nrf2 and its dependent genes in lymphocytes Cellular redox status is well known to play an important role in modulating immune responses by altering the biological activity of key immune regulatory proteins and transcription factors [27]. It was observed that SB increased basal ROS levels and decreased GSH/GSSG ratio, indicating that it modulated the cellular redox status of lymphocytes (Figs. 1A and B). Because SB modulated cellular redox status, we examined its effects on the redox-sensitive transcription factor Nrf2 using EMSA. Addition of SB to lymphocytes increased nuclear Nrf2 levels at 1h but not at other time points used in our experiment (Fig. 1C). SB pretreatment led to a significant increase in relative mRNA copy number of Nrf2, HO-1, TrxR1, and GCLC over control (Figs. 1D and E). SB treatment also increased the protein levels of HO-1 in these cells (Fig. 1F). SB inhibited Con A-induced proliferation and cytokine secretion by lymphocytes in vitro Murine splenic lymphocytes were pretreated with various concentrations of SB for 4 h and stimulated with polyclonal mitogen Con A (5 mg/ml). Con A-stimulated cells showed

1424

R. Checker et al. / Free Radical Biology and Medicine 53 (2012) 1421–1430

Fig. 1. SB modulated cellular ROS levels and GSH/GSSG ratio. (A) SB increased basal levels of ROS in lymphocytes. Lymphocytes were stained with DCF-DA (20 mM, 30 min at 37 1C) and treated with SB (25 and 50 mM) for 1 h and fluorescence emission was measured at 535 nm. Bars indicate means 7 SEM from three replicates and two such independent experiments were carried out. np o 0.01, compared to vehicle-treated cells. (B) SB decreased cellular GSH/GSSG ratio. Lymphocytes were treated with SB for 4 h at 37 1C and GSH/GSSG ratio was estimated using the enzyme recycling method. Data points represent means 7 SEM from three replicates and two such independent experiments were carried out. np o 0.01, compared to vehicle-treated cells. (C) SB induced activation of Nrf2 and its dependent genes at the mRNA and protein levels in a time-dependent manner: Lymphocytes were pretreated with SB (50 mM) for the indicated time intervals. Cells were harvested, nuclear extracts were prepared, and electrophoretic mobility-shift assay was performed by incubating these nuclear extracts with the Nrf2 consensus sequence. (D) SB upregulated Nrf2 mRNA levels in timedependent manner. Lymphocytes were treated with SB for 12, 18, and 24h. Cells were harvested, and mRNA isolation and real-time RT-PCR were carried out. Graphs show relative mRNA copy number of Nrf2 over control. (E) SB upregulated the expression of Nrf2-dependent genes at the mRNA and protein levels. Lymphocytes were treated with SB (50 mM) for 18h and cells were harvested. RNA isolation and real-time RT-PCR were carried out for thioredoxin reductase (TrxR1), heme oxygenase-1 (HO-1), and glutamate–cysteine ligase catalytic subunit (GCLC). Graphs show relative mRNA copy number compared to control. (F) Heme oxygenase-1 protein level in SB-treated and control cells was measured by intracellular staining of cells with PE-conjugated anti-HO-1 monoclonal antibody and flow cytometry. Each bar shows the mean 7 SEM from three replicates and two such independent experiments were carried out. np o 0.01, compared to vehicle-treated cells.

significantly higher proliferation and cytokine secretion compared to vehicle-treated cells. SB pretreatment inhibited Con A-induced proliferation (Figs. 2A and B) and secretion of IL-2, IL-4, IL-6, and IFN-g cytokines (Fig. 2C) by lymphocytes in a dose-dependent manner. Complete inhibition of mitogen-induced lymphocyte proliferation and cytokine secretion was observed at a concentration of 50 mM SB. Anti-CD3/CD28 mAb-induced proliferation and cytokine secretion by T cells was inhibited by SB in vitro Lymphocytes were cultured in the presence of plate-bound antiCD3 and soluble anti-CD28 mAb in the presence of 25 or 50 mM SB. Cells stimulated with anti-CD3/CD28 mAb were monitored for proliferation by CFSE dye dilution using a flow cytometer. Secretion

of IL-2, IL-3, IL-4, IL-6, and IFN-g cytokines was measured in these culture supernatants. Prior incubation of lymphocytes with SB completely inhibited anti-CD3/CD28 mAb-induced lymphocyte proliferation (Supplementary Figs. S1A and S1B) and cytokine secretion (Fig. 2D). SB downregulated the expression of mitogen-induced T cell costimulatory and activation markers Stimulation of T cells with mitogen leads to upregulation of costimulatory and activation markers on their surface. These surface proteins function as amino acid transporters, coreceptors in cytokine signaling, or proliferation-associated receptors. Lymphocytes were stimulated with Con A in the presence or absence of 50 mM SB and cultured for 24 or 48 h. Expression of various activation markers was

R. Checker et al. / Free Radical Biology and Medicine 53 (2012) 1421–1430

1425

Fig. 2. SB inhibited Con A-induced proliferation and cytokine secretion by lymphocytes in vitro. (A) CFSE-labeled lymphocytes were treated with SB (10–50 mM) for 4 h and then stimulated with Con A (5 mg/ml) at 37 1C for 72h. Twenty thousand cells in each group were acquired in a flow cytometer. Vehicle-treated cells served as control. Percentage daughter cells was calculated from the decrease in mean fluorescence intensity as shown in the overlaid histogram. (B) Graph shows percentage of daughter cells in each treatment group. (C) SB inhibited Con A-induced secretion of IL-2, IL-4, IL-6, and IFN-g cytokines. Data points represent means 7 SEM from three replicates and two such independent experiments were carried out. np o 0.01, compared to vehicle-treated cells, and #p o 0.01, compared to Con A-stimulated cells. (D) SB inhibited anti-CD3/CD28 mAb-induced secretion of IL-2, IL-3, IL-4, IL-6, and IFN-g by T cells as estimated by ELISA. Each bar represents the mean 7 SEM from three replicates and two such independent experiments were carried out. np o 0.01, compared to vehicle-treated cells, and #p o 0.01, compared to anti-CD3/anti-CD28stimulated cells. (E) SB inhibited LPS-induced B cell proliferation. Lymphocytes were stained with CFSE and stimulated with LPS in the presence of SB (10–50 mM, 4h) for 24 h at 37 1C. Vehicle-treated cells served as control. Percentage daughter cells was calculated from the decrease in mean fluorescence intensity as shown in the overlaid histogram. (F) Graph shows percentage of daughter cells. Each bar indicates the mean 7 SEM from three replicates and two such independent experiments were carried out. np o 0.01, compared to vehicle-treated cells, and #p o 0.01, compared to LPS-stimulated cells.

analyzed by surface staining and flow cytometry. Activated lymphocytes showed a significantly higher expression of CD25, CD28, CD69, CD54, CD71, and CD98 compared to that in vehicle-treated cells.

However, pretreatment of cells with SB significantly inhibited the upregulation of CD28 (Supplementary Fig. S2A), CD69 (Supplementary Fig. S2B), CD25 (Supplementary Fig. S2C), CD54 (Supplementary

1426

R. Checker et al. / Free Radical Biology and Medicine 53 (2012) 1421–1430

Fig. S2D), CD71 (Supplementary Fig. S2E), and CD98 (Supplementary Fig. S2F) expression, suggesting that SB suppresses early as well as late events during T cell activation. SB inhibited LPS-induced B cell proliferation LPS-induced proliferation of B cells was monitored by CFSE dye dilution using a flow cytometer. Lymphocytes were stimulated with LPS in the presence or absence of 10–50 mM SB. Cells stimulated with LPS showed significantly higher proliferation as compared to vehicle-treated cells. SB pretreatment completely inhibited LPS-induced B cell proliferation as compared to activated vehicle-treated cells (Figs. 2E and F). SB inhibited mitogen-induced activation of MAP kinases and NF-kB in lymphocytes Fig. 3 shows the effect of SB on the activation of redoxsensitive proteins in lymphocytes. Cells stimulated with Con A showed increased phosphorylation of c-Raf, MEK, ERK, JNK, and p38. Treatment of lymphocytes with SB inhibited Con A-induced phosphorylation of ERK, JNK, and p38 (Fig. 3A). Upstream of ERK, SB also inhibited Con A-induced phosphorylation of c-Raf and MEK (Fig. 3A). Stimulation of lymphocytes with Con A for 1 h induced degradation of IkBa in the cytosolic fraction and NF-kB activation in the nuclear fraction compared to vehicle-treated cells (Fig. 3B). However, pretreatment of SB abrogated Con Ainduced IkBa degradation, thereby preventing the nuclear translocation of NF-kB (Fig. 3B). Inhibitors of the Nrf2/HO-1 pathway significantly abrogated the antiinflammatory effects of SB Experiments were carried out to investigate the role of the Nrf2/ HO-1 pathway in the observed anti-inflammatory effects of SB. Lymphocytes were pretreated with ATRA (Nrf2 inhibitor) or SnPP (HO-1 inhibitor) before incubation with SB. These cells were stimulated with Con A and the secretion of IL-2, IL-4, IL-6, and IFN-g cytokines was measured in the culture supernatant. SBmediated inhibition of IL-2, IL-6, and IFN-g but not IL-4 cytokine secretion by lymphocytes was significantly abrogated by pretreatment with SnPP (Figs. 3C–F). However, pretreatment with ATRA significantly prevented SB-mediated suppression of IL-2, IL-6, and IFN-g as well as IL-4 production by activated lymphocytes (Figs. 3C–F). Lymphocytes from SB-treated mice showed decreased responsiveness to Con A and anti-CD3/CD28 mAb stimulation Mice were injected with SB (80 mg/kg body wt, ip) or vehicle control and splenic lymphocytes were harvested from these mice 24h after injection. The cells were stimulated with Con A or platebound anti-CD3/soluble anti-CD28 mAbs to induce proliferation and cytokine secretion. Cells obtained from vehicle-injected mice and stimulated with Con A or anti-CD3/CD28 mAb showed significantly higher proliferation compared to unstimulated cells. However, lymphocytes obtained from SB-injected mice and stimulated with Con A (Figs. 4A and C) or anti-CD3/CD28 mAb (Figs. 4B and D) showed significantly less proliferation and secretion of the proinflammatory cytokines IL-2, IL-6, and IFN-g compared to cells obtained from vehicle-injected mice. Interestingly, secretion of IL-4 was higher in cells isolated from SB-injected mice stimulated with Con A or anti-CD3/CD28 mAb compared to lymphocytes isolated from control mice.

SB inhibited phytohemagglutinin (PHA)-induced cytokine secretion by Human T lymphoma cells To ascertain the effectiveness of SB in human T cells, Jurkat cells were incubated with SB (50 mM) before stimulation with PHA (5 mg/ml), and IL-2 secretion was estimated by ELISA. Treatment of Jurkat cells with SB completely inhibited PHAinduced secretion of IL-2 cytokine, indicating that SB is effective in human T cells (Fig. 4E).

Discussion In recent years, several investigators have provided substantial evidence implicating Nrf2, a redox-sensitive transcription factor, in inflammation and associated disorders [34,35]. In the presence of oxidative stress or electrophiles, Nrf2 induces the transcription of diverse proteins that include NAD(P)H:quinone oxidoreductase, glutathione S-transferase, HO-1, glutathione peroxidase, glutamate–cysteine ligase, and peroxiredoxin I. These enzymes play key roles in cellular defense by enhancing the removal of cytotoxic electrophiles or reactive oxygen species [36]. Among the enzymes upregulated by Nrf2, HO-1 has been shown to have pronounced anti-inflammatory as well as antioxidative properties through the actions of end products derived from heme degradation, bilirubin, and CO. CO was reported to attenuate LPS-induced production of ROS and nitric oxide (NO) and activation of NF-kB in endothelial cells [37]. Bilirubin suppressed experimentally induced autoimmune encephalomyelitis and autoimmune hepatitis [38]. Further, Nrf2/ARE-regulated genes contribute to protection against oxidative stress and potentiate antioxidant defense capacity in cells [39]. Modulation of Nrf2/ARE signaling may have profound effects on other redox-sensitive inflammationregulating transcription factors, such as NF-kB and AP-1. HO-1 upregulation has been reported to prevent inflammatory response in an endotoxic shock model [40], colon [41], and brain [42]. In addition, many natural and physiological molecules, including curcumin, sulforaphane, epigallocatechin gallate, resveratrol, and 15-deoxy-D-12,14-prostaglandin J2 have recently been reported to activate Nrf2 and simultaneously suppress the activation of the immunoregulatory transcription factors NF-kB and AP-1 [43–47]. These reports clearly suggest that Nrf2/ARE signaling may have considerable effects on the activation of these redox-sensitive inflammation-regulating proteins. Cytochrome P450-catalyzed metabolism of SB has been reported to increase ROS levels, which elicits glutathione antioxidant response leading to cardioprotection [48]. Another report by Leong et al. [49] showed that SB induced ERK/Nrf2 signaling in hepatocytes and protected against oxidant-induced apoptosis via cellular glutathione antioxidant response [16,49]. Based on these reports, we hypothesized that SB may elicit a similar kind of response in lymphocytes. Because Nrf2 activation is associated with modulation of NF-kB [50], we investigated if this Nrf2 activation by SB can lead to suppression of inflammatory responses in lymphocytes. In agreement with the earlier results, treatment of lymphocytes with SB significantly increased their basal ROS levels and reduced the GSH/GSSG ratio in these cells (Figs. 1A and B). Further experiments were carried out to identify the ability of SB to modulate the expression of the important redox-sensitive transcription factor Nrf2 in murine lymphocytes. SB increased the nuclear translocation (Fig. 1C) and expression of Nrf2 (Fig. 1D) and its dependent genes heme oxygenase-1, glutamate–cysteine ligase, and thioredoxin reductase in murine lymphocytes (Figs. 1E and F). Nrf2-deficient mice have been shown to express higher levels of NF-kB upon LPS or TNF-a stimulation [35]. Several Nrf2activating molecules such as curcumin have been shown to inhibit

R. Checker et al. / Free Radical Biology and Medicine 53 (2012) 1421–1430

1427

Fig. 3. SB suppressed Con A-induced MAP kinase and NF-kB activation. (A) Lymphocytes were incubated with SB (50 mM, 4 h) and stimulated with Con A (5 mg/ml) for 1 h. Whole-cell lysates were prepared, fractionated on 10% SDS–PAGE, and electrotransferred to nitrocellulose membrane. Western blot analysis was performed using antibodies specific for p-c-Raf, p-MEK, p-p38, p-ERK, p-JNK, ERK, JNK, p38, and a-tubulin. (B) Lymphocytes were pretreated with SB (50 mM, 4 h) and stimulated with Con A for 1 h. Cells were harvested, and cytosolic and nuclear extracts were prepared. Western blot analysis was performed using antibodies specific for IkBa and a-tubulin and electrophoretic mobility-shift assay was performed using nuclear extracts. A shift in the position of probe bound to NF-kB with respect to free probe was observed on the phosphorimage scanner. (C–F) Nrf2 and HO-1 inhibitors abrogated SB-mediated inhibition of cytokine secretion by Con A-stimulated lymphocytes. Lymphocytes were incubated with ATRA (5 mM), a Nrf2 inhibitor, or with SnPP (10 mM), a HO-1 inhibitor, for 2 h before incubation with SB (50 mM, 4 h) and stimulated with Con A for 24 h at 37 1C. Cytokine levels were measured in culture supernatant by ELISA. Each bar shows the mean 7 SEM from three replicates. Two such independent experiments were carried out. np o 0.01, compared to vehicle-treated cells; #p o 0.01, compared to Con A-stimulated cells; and $p o 0.01, compared to SB-treated and Con A-stimulated cells.

NF-kB. Sulforaphane, a well-known Nrf2 activator, also inhibited IKK/IkB phosphorylation and NF-kB nuclear translocation [51]. Nrf2 and heme oxygenase-1, an Nrf2-dependent protein, was shown to mediate potent anti-inflammatory properties [52,53]. Because Nrf2

and NF-kB regulate each other negatively, our results highlight the possibility that SB-mediated activation of Nrf2 may suppress NF-kB and this could lead to abrogation of inflammatory responses in leukocytes.

1428

R. Checker et al. / Free Radical Biology and Medicine 53 (2012) 1421–1430

Fig. 4. SB inhibited Con A- and anti-CD3/CD28 mAb-induced proliferation and cytokine secretion by lymphocytes ex vivo. (A–D) Mice were injected ip with SB (80 mg/kg body wt) or vehicle, and 24 h postinjection splenic lymphocytes were harvested. Cells harvested from control or SB-treated mice were stimulated with (A, C) Con A (5 mg/ml) or (B, D) plate-bound anti-CD3 and soluble anti-CD28 mAbs to assess proliferation and secretion of IL-2, IL-4, IL-6, and IFN-g cytokines ex vivo. Each bar shows the mean 7 SEM from three replicates. Two such independent experiments were carried out. np o 0.01 compared to vehicle-treated cells, #p o 0.01 compared to Con A-stimulated cells. (E) SB inhibited PHA-induced IL-2 secretion by human T cells. Human T cell lymphoma (Jurkat) cells were incubated with SB before stimulation with PHA (5 mg/ml) and IL-2 secretion was estimated in the culture supernatants. Each bar shows the mean 7 SEM from three replicates. Two such independent experiments were carried out. np o 0.01 compared to vehicle-treated cells, #p o 0.01 compared to PHA-stimulated cells.

It was indeed observed that SB inhibited the activation and nuclear translocation of NF-kB and degradation of IkBa (Fig. 3B). Further, we observed that SB is a potent inhibitor of T cell activation,

proliferation, and cytokine secretion. SB inhibited Con A- (Figs. 2A and B) and anti-CD3/CD28- (Supplementary Figs. S1A and S1B) induced lymphocyte proliferation in a dose-dependent manner.

R. Checker et al. / Free Radical Biology and Medicine 53 (2012) 1421–1430

Activation of lymphocytes leads to secretion of cytokines (IL-2, IL-4, IL-3, IL-6, and IFN-g) and upregulation of costimulatory and activation markers. Cytokines secreted by various cells participating in the immune response play a critical role in successful clearance of pathogens. IL-2 and IFN-g are secreted by Th1-type cells and can activate macrophages and promote cell-mediated immune responses against invasive intracellular pathogens. Th2 (IL-4, IL-5, IL-6, IL-10, and IL-13) cytokines promote humoral immune responses against extracellular pathogens [54]. These cytokines and activation markers were used in our studies to evaluate the effect of SB on activation and effector functions of T cells (Th1 and Th2). Inhibition of these cytokines and activation markers by SB indicates the potent antiinflammatory activity of this compound. SB inhibited all the cytokines examined in our study in vitro (Figs. 2C and D). Similar suppressive effects of SB were seen on LPS-induced proliferation of B lymphocytes, which play an important role in adaptive immune responses (Figs. 2E and F). Further, we studied the effect of SB on mitogen-induced upregulation of T cell and B cell costimulatory and activation markers. The costimulatory molecules (CD80 and CD86) on antigen-presenting cells (APCs) bind to cognate receptors (CD28) on T cells and provide necessary signals for complete activation and survival of T cells [55]. T cells that recognize antigen in the absence of costimulation either fail to respond and die or enter a state of unresponsiveness known as T cell anergy [56,57]. SB significantly inhibited mitogen-induced upregulation of CD28 on T cells (Supplementary Fig. S2A). These results indicate that suppression of costimulatory signal and possible induction of anergy may also contribute to the observed anti-inflammatory effects of SB. Further it is well known that interaction of T cells with APCs via TCR and MHC in the presence of appropriate costimulatory stimuli enhances surface expression of several early and late activation markers. The inhibition of mitogen-induced early as well as late activation markers such as CD69 (early activation marker; Supplementary Fig. S2B), CD25 (IL-2 receptor-a; Supplementary Fig. S2C), CD54 (ICAM-1; Supplementary Fig. S2C), CD71 (transferring receptor; Supplementary Fig. S2D), and CD98 (Supplementary Fig. S2E) clearly indicates that SB suppresses early as well as late events during T cell activation [58–62]. T cell activation involves MAP kinase (JNK, p38 MAP kinase, and ERK) and NF-kB activation [22]. Pretreatment of lymphocytes with SB before stimulation significantly inhibited mitogen-induced phosphorylation of ERK, JNK, and p38 MAP kinases as well as their upstream regulatory kinases such as MEK and c-Raf (Fig. 3A). These results indicate that the MAP kinase pathway is one of the critical molecular targets during the observed anti-inflammatory effects of SB. To validate a hypothesis that there was a causal role of the Nrf2/HO-1 pathway in the observed anti-inflammatory effects of SB, we first pretreated lymphocytes with inhibitors of Nrf2 (ATRA) and HO-1 (SnPP) and then activated them in the presence of SB. Both ATRA and SnPP abrogated the anti-inflammatory effects of SB, indicating that activation of the Nrf2 pathway is crucial (Figs. 3C– F). Importantly, diminished proliferative capacity and decreased cytokine secretion by lymphocytes isolated from SB-treated mice proved its potent anti-inflammatory efficacy in vivo (Figs. 4A–D). Interestingly, it was observed that secretion of IL-4 was higher in lymphocytes isolated from SB-administered mice compared to cells from the vehicle-treated group (Figs. 4C and D). The increased IL-4 secretion by activated lymphocytes from SB-treated mice might also contribute to its anti-inflammatory effects in vivo [63–65]. The immunomodulatory effects of SB were also seen in PHA-activated human T cell lymphoma (Jurkat cells) (Fig. 4E).

Conclusions In conclusion, this study for the first time showed that SB is a potent suppressor of lymphocyte activation, proliferation, and

1429

cytokine secretion. Based on these results we propose the molecular mechanism of its anti-inflammatory action via alteration of cellular redox status leading to modulation of the redox-sensitive transcription factors Nrf2 and NF-kB. Author contributions S.K.S., D.S., and R.C. conceived and designed the experiments; R.C., M.T., J.M., D.S., and R.S.P. performed the experiments; S.K.S., D.S., and T.K. analyzed the data; H.N.B. and T.K. participated in the design of the study and contributed reagents/materials; R.C. and S.K.S. wrote the manuscript in consultation with the other authors.

Acknowledgments The authors acknowledge Dr. K.B. Sainis, Director, Bio-Medical Group, BARC, for his support and encouragement. We thank Mr. Nazir M. Khan for his help. The technical assistance provided by Mr. Deepak Kathole, Mr. Kashinath Munankar, and Ms. Punitha Bhupati is acknowledged. Financial support from the Department of Atomic Energy, Government of India, is gratefully acknowledged.

Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at http://dx.doi.org/10.1016/j.freerad biomed.2012.08.006.

References [1] Charles, P.; Elliott, M. J.; Davis, D.; Potter, A.; Kalden, J. R.; Antoni, C.; Breedveld, F. C.; Smolen, J. S.; Eberl, G.; deWoody, K.; Feldmann, M.; Maini, R. N. Regulation of cytokines, cytokine inhibitors, and acute-phase proteins following anti-TNF-alpha therapy in rheumatoid arthritis. J. Immunol. 163:1521–1528; 1999. [2] Locati, M.; Murphy, P. M. Chemokines and chemokine receptors: biology and clinical relevance in inflammation and AIDS. Annu. Rev. Med 50:425–440; 1999. [3] O’Byrne, K. J.; Dalgleish, A. G. Chronic immune activation and inflammation as the cause of malignancy. Br. J. Cancer 85:473–483; 2001. [4] Allison, A. C. Immunosuppressive drugs: the first 50 years and a glance forward. Immunopharmacology 47:63–83; 2000. [5] Halloran, P. F. Immunosuppressive drugs for kidney transplantation. N. Engl. J. Med. 351:2715–2729; 2004. [6] Liu, G. T. Pharmacological actions and clinical use of Fructus schizandrae. Chin. Med. J. (Engl.) 102:740–749; 1989. [7] Ko, R., Mak, D.H.F. Schisandrin B and other dibenzocyclooctadiene ligands. Herbal and Traditional Medicine: Molecular Aspects of Health. In: P. Lester, C. Ong, and B. Halliwell, Eds. Marcel Dekker, New York, NY, USA, 2004: 289–314. [8] Zhang, T. M.; Wang, B. E.; Liu, G. T. Effect of schisandrin B on lipoperoxidative damage to plasma membrane of rat liver in vitro. Zhongguo Yao Li Xue Bao 13:255–258; 1992. [9] Ip, S. P.; Che, C. T.; Kong, Y. C.; Ko, K. M. Effects of schisandrin B pretreatment on tumor necrosis factor-alpha induced apoptosis and Hsp70 expression in mouse liver. Cell Stress Chaperones 6:44–48; 2001. [10] Li, L.; Lu, Q.; Shen, Y.; Hu, X. Schisandrin B enhances doxorubicin-induced apoptosis of cancer cells but not normal cells. Biochem. Pharmacol. 71:584–595; 2006. [11] Chiu, P. Y.; Mak, D. H.; Poon, M. K.; Ko, K. M. Role of cytochrome P-450 in schisandrin B-induced antioxidant and heat shock responses in mouse liver. Life Sci. 77:2887–2895; 2005. [12] Ip, S. P.; Ko, K. M. The crucial antioxidant action of schisandrin B in protecting against carbon tetrachloride hepatotoxicity in mice: a comparative study with butylated hydroxytoluene. Biochem. Pharmacol 52:1687–1693; 1996. [13] Ip, S. P.; Poon, M. K.; Che, C. T.; Ng, K. H.; Kong, Y. C.; Ko, K. M. Schisandrin B protects against carbon tetrachloride toxicity by enhancing the mitochondrial glutathione redox status in mouse liver. Free Radic. Biol. Med. 21:709–712; 1996. [14] Ip, S. P.; Yiu, H. Y.; Ko, K. M. Differential effect of schisandrin B and dimethyl diphenyl bicarboxylate (DDB) on hepatic mitochondrial glutathione redox status in carbon tetrachloride intoxicated mice. Mol. Cell. Biochem 205:111–114; 2000.

1430

R. Checker et al. / Free Radical Biology and Medicine 53 (2012) 1421–1430

[15] Ip, S. P.; Yiu, H. Y.; Ko, K. M. Schisandrin B protects against menadioneinduced hepatotoxicity by enhancing DT-diaphorase activity. Mol. Cell. Biochem. 208:151–155; 2000. [16] Chiu, P. Y.; Luk, K. F.; Leung, H. Y.; Ng, K. M.; Ko, K. M. Schisandrin B stereoisomers protect against hypoxia/reoxygenation-induced apoptosis and associated changes in the Ca2 þ -induced mitochondrial permeability transition and mitochondrial membrane potential in AML12 hepatocytes. Phytother. Res 23:1592–1602; 2009. [17] Otterbein, L. E.; Bach, F. H.; Alam, J.; Soares, M.; Tao, Lu, H.; Wysk, M.; Davis, R. J.; Flavell, R. A.; Choi, A. M. Carbon monoxide has anti-inflammatory effects involving the mitogen-activated protein kinase pathway. Nat. Med 6:422–428; 2000. [18] Otterbein, L. E.; Soares, M. P.; Yamashita, K.; Bach, F. H. Heme oxygenase-1: unleashing the protective properties of heme. Trends Immunol. 24:449–455; 2003. [19] Willis, D.; Moore, A. R.; Frederick, R.; Willoughby, D. A. Heme oxygenase: a novel target for the modulation of the inflammatory response. Nat. Med 2:87–90; 1996. [20] Lee, T. S.; Chau, L. Y. Heme oxygenase-1 mediates the anti-inflammatory effect of interleukin-10 in mice. Nat. Med 8:240–246; 2002. [21] Wagener, F. A.; Volk, H. D.; Willis, D.; Abraham, N. G.; Soares, M. P.; Adema, G. J.; Figdor, C. G. Different faces of the heme–heme oxygenase system in inflammation. Pharmacol. Rev. 55:551–571; 2003. [22] Dong, C.; Davis, R. J.; Flavell, R. A. MAP kinases in the immune response. Annu. Rev. Immunol. 20:55–72; 2002. [23] Sun, Z.; Andersson, R. NF-kappaB activation and inhibition: a review. Shock 18:99–106; 2002. [24] Wegener, E.; Krappmann, D. Dynamic protein complexes regulate NF-kappa B signaling. Handb. Exp. Pharmacol 186:237–259; 2008. [25] Baeuerle, P. A. The inducible transcription activator NF-kappa B: regulation by distinct protein subunits. Biochim. Biophys. Acta 1072:63–80; 1991. [26] Siebenlist, U.; Franzoso, G.; Brown, K. Structure, regulation and function of NF-kappa B. Annu. Rev. Cell Biol. 10:405–455; 1994. [27] Checker, R.; Sharma, D.; Sandur, S. K.; Subrahmanyam, G.; Krishnan, S.; Poduval, T. B.; Sainis, K. B. Plumbagin inhibits proliferative and inflammatory responses of T cells independent of ROS generation but by modulating intracellular thiols. J. Cell. Biochem. 110:1082–1093; 2010. [28] Rahman, I.; Kode, A.; Biswas, S. K. Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method. Nat. Protoc. 1:3159–3165; 2006. [29] Pfaffl, M. W.; Horgan, G. W.; Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30:e36; 2002. [30] Checker, R.; Sharma, D.; Sandur, S. K.; Khan, N. M.; Patwardhan, R. S.; Kohli, V.; Sainis, K. B. Vitamin K3 suppressed inflammatory and immune responses in a redox-dependent manner. Free Radic. Res. 45:975–985; 2011. [31] Checker, R.; Sharma, D.; Sandur, S. K.; Khanam, S.; Poduval, T. B. Antiinflammatory effects of plumbagin are mediated by inhibition of NF-kappaB activation in lymphocytes. Int. Immunopharmacol. 9:949–958; 2009. [32] Patwardhan, R. S.; Checker, R.; Sharma, D.; Kohli, V.; Priyadarsini, K. I.; Sandur, S. K. Dimethoxycurcumin, a metabolically stable analogue of curcumin, exhibits anti-inflammatory activities in murine and human lymphocytes. Biochem. Pharmacol. 82:642–657; 2011. [33] Wilankar, C.; Sharma, D.; Checker, R.; Khan, N. M.; Patwardhan, R.; Patil, A.; Sandur, S. K.; Devasagayam, T. P. Role of immunoregulatory transcription factors in differential immunomodulatory effects of tocotrienols. Free Radic. Biol. Med. 51:129–143; 2011. [34] Ma, Q.; Battelli, L.; Hubbs, A. F. Multiorgan autoimmune inflammation, enhanced lymphoproliferation, and impaired homeostasis of reactive oxygen species in mice lacking the antioxidant-activated transcription factor Nrf2. Am. J. Pathol. 168:1960–1974; 2006. [35] Thimmulappa, R. K.; Lee, H.; Rangasamy, T.; Reddy, S. P.; Yamamoto, M.; Kensler, T. W.; Biswal, S. Nrf2 is a critical regulator of the innate immune response and survival during experimental sepsis. J. Clin. Invest. 116:984–995; 2006. [36] Lee, J. M.; Johnson, J. A. An important role of Nrf2–ARE pathway in the cellular defense mechanism. J. Biochem. Mol. Biol. 37:139–143; 2004. [37] Sun, B.; Zou, X.; Chen, Y.; Zhang, P.; Shi, G. Preconditioning of carbon monoxide releasing molecule-derived CO attenuates LPS-induced activation of HUVEC. Int. J. Biol. Sci. 4:270–278; 2008. [38] Liu, Y.; Zhu, B.; Wang, X.; Luo, L.; Li, P.; Paty, D. W.; Cynader, M. S. Bilirubin as a potent antioxidant suppresses experimental autoimmune encephalomyelitis: implications for the role of oxidative stress in the development of multiple sclerosis. J. Neuroimmunol. 139:27–35; 2003. [39] Khan, N. M.; Sandur, S. K.; Checker, R.; Sharma, D.; Poduval, T. B.; Sainis, K. B. Pro-oxidants ameliorate radiation-induced apoptosis through activation of the calcium–ERK1/2–Nrf2 pathway. Free Radic. Biol. Med. 51:115–128; 2011. [40] Tamion, F.; Richard, V.; Renet, S.; Thuillez, C. Intestinal preconditioning prevents inflammatory response by modulating heme oxygenase-1 expression in endotoxic shock model. Am. J. Physiol. Gastrointest. Liver Physiol. 293:G1308–1314; 2007. [41] Horvath, K.; Varga, C.; Berko, A.; Posa, A.; Laszlo, F.; Whittle, B. J. The involvement of heme oxygenase-1 activity in the therapeutic actions of 5-aminosalicylic acid in rat colitis. Eur. J. Pharmacol. 581:315–323; 2008.

[42] Syapin, P. J. Regulation of haeme oxygenase-1 for treatment of neuroinflammation and brain disorders. Br. J. Pharmacol 155:623–640; 2008. [43] Heiss, E.; Herhaus, C.; Klimo, K.; Bartsch, H.; Gerhauser, C. Nuclear factor kappa B is a molecular target for sulforaphane-mediated anti-inflammatory mechanisms. J. Biol. Chem. 276:32008–32015; 2001. [44] Manna, S. K.; Mukhopadhyay, A.; Aggarwal, B. B. Resveratrol suppresses TNFinduced activation of nuclear transcription factors NF-kappa B, activator protein-1, and apoptosis: potential role of reactive oxygen intermediates and lipid peroxidation. J. Immunol 164:6509–6519; 2000. [45] Gopalakrishnan, A.; Tony Kong, A. N. Anticarcinogenesis by dietary phytochemicals: cytoprotection by Nrf2 in normal cells and cytotoxicity by modulation of transcription factors NF-kappa B and AP-1 in abnormal cancer cells. Food Chem. Toxicol 46:1257–1270; 2008. [46] Zhu, M.; Zhang, Y.; Cooper, S.; Sikorski, E.; Rohwer, J.; Bowden, G. T. Phase II enzyme inducer, sulforaphane, inhibits UVB-induced AP-1 activation in human keratinocytes by a novel mechanism. Mol. Carcinog. 41:179–186; 2004. [47] Kim, E. H.; Surh, Y. J. 15-Deoxy-Delta12,14-prostaglandin J2 as a potential endogenous regulator of redox-sensitive transcription factors. Biochem. Pharmacol. 72:1516–1528; 2006. [48] Chen, N.; Ko, M. Schisandrin B-induced glutathione antioxidant response and cardioprotection are mediated by reactive oxidant species production in rat hearts. Biol. Pharm. Bull 33:825–829; 2010. [49] Leong, P. K.; Chiu, P. Y.; Chen, N.; Leung, H.; Ko, K. M. Schisandrin B elicits a glutathione antioxidant response and protects against apoptosis via the redox-sensitive ERK/Nrf2 pathway in AML12 hepatocytes. Free Radic. Res. 45:483–495; 2011. [50] Kim, J. E.; You, D. J.; Lee, C.; Ahn, C.; Seong, J. Y.; Hwang, J. I. Suppression of NF-kappa B signaling by KEAP1 regulation of IKKbeta activity through autophagic degradation and inhibition of phosphorylation. Cell. Signaling 22:1645–1654; 2010. [51] Xu, C.; Shen, G.; Chen, C.; Gelinas, C.; Kong, A. N. Suppression of NF-kappaB and NF-kappaB-regulated gene expression by sulforaphane and PEITC through IkappaBalpha, IKK pathway in human prostate cancer PC-3 cells. Oncogene 24:4486–4495; 2005. [52] Chen, X. L.; Kunsch, C. Induction of cytoprotective genes through Nrf2/ antioxidant response element pathway: a new therapeutic approach for the treatment of inflammatory diseases. Curr. Pharm. Des 10:879–891; 2004. [53] Lee, S. H.; Sohn, D. H.; Jin, X. Y.; Kim, S. W.; Choi, S. C.; Seo, G. S. 20 ,40 , 60 -Tris(methoxymethoxy) chalcone protects against trinitrobenzene sulfonic acid-induced colitis and blocks tumor necrosis factor-alpha-induced intestinal epithelial inflammation via heme oxygenase 1-dependent and independent pathways. Biochem. Pharmacol. 74:870–880; 2007. [54] Opal, S. M.; DePalo, V. A. Anti-inflammatory cytokines. Chest 117:1162–1172; 2000. [55] Sharpe, A. H.; Freeman, G. J. The B7-CD28 superfamily. Nat. Rev. Immunol. 2:116–126; 2002. [56] Reynolds, J.; Tam, F. W.; Chandraker, A.; Smith, J.; Karkar, A. M.; Cross, J.; Peach, R.; Sayegh, M. H.; Pusey, C. D. CD28-B7 blockade prevents the development of experimental autoimmune glomerulonephritis. J. Clin. Invest. 105:643–651; 2000. [57] Zhu, Y.; Ljunggren, H.; Mix, E.; Li, H. L.; van der Meide, P.; Elhassan, A. M.; Winblad, B.; Zhu, J. CD28-B7 costimulation: a critical role for initiation and development of experimental autoimmune neuritis in C57BL/6 mice. J. Neuroimmunol. 114:114–121; 2001. [58] Lopez-Cabrera, M.; Santis, A. G.; Fernandez-Ruiz, E.; Blacher, R.; Esch, F.; Sanchez-Mateos, P.; Sanchez-Madrid, F. Molecular cloning, expression, and chromosomal localization of the human earliest lymphocyte activation antigen AIM/CD69, a new member of the C-type animal lectin superfamily of signal-transmitting receptors. J. Exp. Med 178:537–547; 1993. [59] Salmon, M.; Bacon, P. A.; Symmons, D. P.; Walton, K. W. Transferrin receptor expression by stimulated cells in mixed lymphocyte culture. Immunology 54:559–564; 1985. [60] Haynes, B. F.; Hemler, M. E.; Mann, D. L.; Eisenbarth, G. S.; Shelhamer, J.; Mostowski, H. S.; Thomas, C. A.; Strominger, J. L.; Fauci, A. S. Characterization of a monoclonal antibody (4F2) that binds to human monocytes and to a subset of activated lymphocytes. J. Immunol. 126:1409–1414; 1981. [61] Komada, H.; Imai, A.; Hattori, E.; Ito, M.; Tsumura, H.; Onoda, T.; Kuramochi, M.; Tani, M.; Yamamoto, K.; Yamane, M.; Kawano, M.; Nishio, M.; Yuasa, K.; O’Brien, M.; Yamamoto, H.; Uematsu, J.; Tsurudome, M.; Ito, Y. Possible activation of murine T lymphocyte through CD98 is independent of interleukin 2/interleukin 2 receptor system. Biomed. Res. 27:61–67; 2006. [62] Zheng, Y.; Collins, S. L.; Lutz, M. A.; Allen, A. N.; Kole, T. P.; Zarek, P. E.; Powell, J. D. A role for mammalian target of rapamycin in regulating T cell activation versus anergy. J. Immunol. 178:2163–2170; 2007. [63] Zhao, W.; Xie, W.; Xiao, Q.; Beers, D. R.; Appel, S. H. Protective effects of an anti-inflammatory cytokine, interleukin-4, on motoneuron toxicity induced by activated microglia. J. Neurochem. 99:1176–1187; 2006. [64] Ehrlich, L. C.; Hu, S.; Sheng, W. S.; Sutton, R. L.; Rockswold, G. L.; Peterson, P. K.; Chao, C. C. Cytokine regulation of human microglial cell IL-8 production. J. Immunol. 160:1944–1948; 1998. [65] Ledeboer, A.; Breve, J. J.; Poole, S.; Tilders, F. J.; Van Dam, A. M. Interleukin-10, interleukin-4, and transforming growth factor-beta differentially regulate lipopolysaccharide-induced production of pro-inflammatory cytokines and nitric oxide in co-cultures of rat astroglial and microglial cells. Glia 30:134–142; 2000.