reperfusion-induced neuronal injury in rats via regulation of TLR4 and C5aR1 signaling pathways

Accepted Manuscript Schisantherin A Attenuates Ischemia/Reperfusion-induced Neuronal Injury in Rats via Regulation of TLR4 and C5aR1 Signaling Pathways Yun Wei Shi, Xiao Chuan Zhang, Chen Chen, Miao Tang, Zhi Wei Wang, Xin Miao Liang, Fei Ding, Cai Ping Wang PII: DOI: Reference:

S0889-1591(17)30211-8 http://dx.doi.org/10.1016/j.bbi.2017.07.004 YBRBI 3179

To appear in:

Brain, Behavior, and Immunity

Received Date: Revised Date: Accepted Date:

8 February 2017 25 June 2017 5 July 2017

Please cite this article as: Wei Shi, Y., Chuan Zhang, X., Chen, C., Tang, M., Wei Wang, Z., Miao Liang, X., Ding, F., Ping Wang, C., Schisantherin A Attenuates Ischemia/Reperfusion-induced Neuronal Injury in Rats via Regulation of TLR4 and C5aR1 Signaling Pathways, Brain, Behavior, and Immunity (2017), doi: http://dx.doi.org/ 10.1016/j.bbi.2017.07.004

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Schisantherin A Attenuates Ischemia/Reperfusion-induced Neuronal Injury in Rats via Regulation of TLR4 and C5aR1 Signaling Pathways

Yun Wei Shia,b,1, Xiao Chuan Zhang a,b,1, Chen Chen a,b,1, Miao Tanga,b, Zhi Wei Wanga,b,c, Xin Miao Lianga,b,d,*, Fei Ding a,b,*, Cai Ping Wang a,b,*

a

, Key laboratory of neuroregeneration of Jiangsu and Ministry of Education, Nantong University,

Nantong, Jiangsu 226001, PRC b

c

, Co-innovation Center of Neuroregeneration, Nantong University, Nantong, Jiangsu 226001, PRC

, Department of Pharmacology, University of California, Irvine, CA 92697, USA

d

, Dalian Institute of Chemical Physics, Chinese Academy of Sciences, Dalian, Liaoning 116023,

PRC

*Correspondence: CP Wang, Key laboratory of neuroregeneration of Jiangsu and Ministry of Education, Nantong University, No. 19, Qixiu Road, Nantong 226001, P. R. China. Tel.: 86-513-85051595; Fax: 86-513- 85511585; E-mail: [email protected] *Correspondence: F Ding, Key laboratory of neuroregeneration of Jiangsu and Ministry of Education, Nantong University, No. 19, Qixiu Road, Nantong 226001, P. R. China. Tel.: 86-513-85051802; Fax: 86-513- 85511585; E-mail: [email protected] *Correspondence: XM Liang, Dalian Institute of Chemical Physics, the Chinese Academy of Sciences, Dalian 116023, P. R. China. E-mail: [email protected]

1

These authors contributed equally to this work.

ABSTRACT

Toll-like receptor 4 (TLR4) and C5aR1 (CD88) have been recognized as potential therapeutic targets for the reduction of inflammation and secondary damage and improvement of outcome after ischemia and reperfusion (I/R). The inflammatory responses which induce cell apoptosis and necrosis after I/R brain injury lead to a limited process of neural repair. To further comprehend how these targets function in I/R state, we investigated the pathological changes and TLR4 and C5aR1 signaling pathways in vitro and in vivo models of I/R brain injury in this study. Meanwhile, we explored the roles of schisantherin A on I/R brain injury, and whether it exerted neuroprotective effects by regulating the TLR4 and C5aR1 signaling pathways or not. The results showed that schisantherin A significantly reduced the neuronal apoptosis induced by oxygen and glucose deprivation and reperfusion (OGD/R) injury in primary culture of rat cortical neurons. Also, schisantherin A alleviated neurological deficits, reduced infarct volume, attenuated oxidation stress, inflammation and apoptosis in ischemic parietal cortex of rats after middle cerebral artery occlusion and reperfusion (MCAO/R) injury. Moreover, the activated TLR4 and C5aR1 signaling pathways were inhibited by schisantherin A treatment. In conclusion, TLR4 and C5aR1 played a vital role during I/R brain injury in rats, and schisantherin A exhibited neuroprotective effects by TLR4 and C5aR1 signaling pathways. These findings also provided new insights that would aid in elucidating the effect of schisantherin A against cerebral I/R and support the development of schisantherin A as a potential treatment for ischemic stroke.

Key words: C5aR1; TLR4; Schisantherin A; Inflammation; Apoptosis; Neuroprotection

1. Introduction

Cerebral ischemic stroke is a major cause of morbidity and mortality, which is disastrous to the afflicted individual worldwide (Li et al, 2015; Ma et al, 2016). Although considerable advances have been achieved on cerebral ischemia treatment, timely restoration of blood flow and re-oxygenation is still the only globally approved method (Perez-de-Puig et al, 2015; Ma et al, 2016). However, the restoration of blood flow following cerebral ischemia initiates an inflammatory cascade that causes secondary neuronal injury which can have a significant impact on functional recovery (Adelson et al, 2012; Pundik et al, 2012). Resident cells, neutrophils, macrophages, platelets, cytokines, molecular oxygen, and complements play important roles in this inflammatory response which culminates in necrotic and apoptotic cell death (Pundik et al, 2012; Herz et al, 2015). This results in an initial area of neuronal death known as the core, and a surrounded area vulnerable to further damage known as the penumbra (Baskerville et al, 2016). Furthermore, neuronal apoptosis and necrosis in the penumbra can be viewed as primary causes of aggravated cerebral injury and functional impairment. There is thus a need for new and effective approaches to treat stroke. To reduce inflammation and secondary injury in penumbra are major therapeutic goals (Baskerville et al, 2016). Recent clinical and experimental studies have highlighted a complex role for the immune system in the pathophysiological changes that occur after acute stroke (Chamorro et al, 2012). Toll-like receptors (TLRs) are pivotal components in the innate immune system. Among TLRs, TLR4 can exert strong regulatory effects on post-ischemic inflammatory responses (García-Culebras et al, 2017). Nuclear factor-kappa B (NF-κB), as one of the most important downstream molecules in the TLR4 signaling pathway, is a transcriptional factor required for the

gene expression of many inflammatory mediators, such as interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6). In addition, the complement cascade is an important arm of the innate immune system. It has been recognized as a potential therapeutic target for the reduction of inflammation and secondary damage after stroke (Orsini et al, 2014; Alawieh et al, 2015). Furthermore, complement is involved in TLR-induced inflammation, and there is a strong interaction between TLRs and complement signaling in vivo to promote inflammation and modulate adaptive immunity. For example, complement may interact with TLR signaling through C5aR1, a receptor of complement peptide C5a, with the involvement of mitogen activated protein kinase (MAPK), extracellular signal-regulated kinase (ERK1/2), and the c-Jun NH2-terminal kinases (JNK) (Zhang et al, 2007; Maekawa et al, 2014; Merle et al, 2015). Studies have shown a crosstalk between TLR4 and C5aR1 (Zaal et al, 2013). It is known that TLR4 activation by LPS can induce C5aR1 up-regulation in hepatocytes (Koleva et al, 2002). Taken together, these data suggest that the complement receptor C5aR1 and TLR4 signaling are important in the production of inflammatory responses after ischemia and stroke. Previous studies demonstrated that schisantherin A (Figure 1D) exerted anti-inflammatory effects in microglia (Park et al, 2014), suppressed inflammation in human chondrocytes (Liao et al, 2016), protected against myocardial ischemia and reperfusion (I/R) injury in rats (Chang et al, 2013), protected against 6-OHDA-induced dopaminergic neuron damage in zebrafish (Zhang et al, 2015), protected against β-amyloid and Homocysteine Neurotoxicity in PC12 Cells (Song et al, 2011), recovered Aβ-induced neurodegeneration with cognitive decline in mice (Li X. et al, 2014). It has potential to be used as a new anti-Parkinson natural compound (Sa et al, 2015). In our previous study, we have found that schisantherin A exhibited anti-inflammatory, anti-apoptotic and neural protective effects against serum and glucose deprivation (SGD) injury in SH-SY5Y cells (E

et al, 2015). In this context, schisantherin A might have potential to be used as a new choice during cerebral ischemia. With this background, we aimed to determine whether TLR4 and C5aR1 could modulate the inflammation after I/R brain injury in rats. We focused on whether post-ischemia neuroprotective and neurological repair functions of schisantherin A were via TLR4 and C5aR1 signaling pathways during the recovery phase of I/R brain injury. Both in vitro oxygen and glucose deprivation and reperfusion (OGD/R) model in primary culture of cortical neurons and in vivo middle cerebral artery occlusion and reperfusion (MCAO/R) model in rats were used to reveal the pathological mechanism after I/R brain injury. We also investigated whether schisantherin A’s activity in alleviating inflammation activation after cerebral I/R injury was through the TLR4 and C5aR1 signaling pathways. In addition, downstream pro-apoptotic factors involved in the TLR4 and C5aR1 signaling pathways triggered by I/R insult and schisantherin A treatment were studied.

2. Materials and Methods

2.1 Chemicals and reagents

Schisantherin A (≥ 98 %, HPLC), 1,3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2-tetrazolium bromide (MTT) and 2,3,5-triphenyltetrazolium chloride (TTC) were purchased from Sigma-Aldrich (Saint Louis, MO, USA). In situ cell death detection kit, TMR red (Roche, Mannheim, Germany) was used for Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin nick end labeling (TUNEL) assay. Lactate dehydrogenase (LDH)-Cytotoxic test kit was bought from Jiancheng Biotechnology (Nanjing, Jiangsu, China). Lipid peroxidation malondialdehyde (MDA) assay kit,

total superoxide dismutase (SOD) assay kit and BCA protein assay kit were from Beyotime Institute of Biotechnology (Beijing, China). IL-1β and IL-6 enzyme-linked immunosorbent assay (ELISA) kits were purchased from Signosis, Inc. (EA-1201, USA). C5aR1 RNAscope® Fluorescent Multiplex Kit was purchased from Advanced Cell Diagnostics, Inc. (Hayward, CA, USA). All standard culture reagents were obtained from Gibco (Grand Island, NY, USA). For Western blotting and immunohistochemistry (IHC) analyses, the antibodies used were listed in Table 1. Other chemical reagents were commercially available with analytical grade.

2.2 Cell culture

Primary cultures of rat cortical neurons were obtained from day 17-18 Sprague-Dawley (SD) rat embryos. Pregnant rats were obtained from the Experimental Animal Center of Nantong University (Nantong, Jiangsu, China). Cell culture procedure were carried out as described previously (Brewer et al, 1993; Wang et al, 2016).

2.3 OGD/R and schisantherin A treatment

The induction of OGD/R was based on the method previously reported (Wang et al, 2016). The working doses of schisantherin A were 1.25, 2.5 and 5 µg/ml in the culture medium. Control culture plates were always maintained in an incubator with 5 % CO2 at 37 °C, without exposure to OGD/R and schisantherin A treatment. In vehicle group, cells were exposed to 6 h OGD and 24 h reperfusion. The experiment in vitro was carried out according to the procedure in Figure 1A and B.

2.4 Cell viability assay and morphological analysis of cortical neurons

Cell viability was determined by MTT assay and LDH release assay. Morphological analysis of cortical neurons was performed by TUNEL assay according to the methods described by our previous report (Wang et al, 2014). Time-lapse analysis was performed to monitor the morphological changes during OGD/R and schisantherin A treatment as our previously reported (Wang et al, 2016).

2.5 xCELLigence assays

Experiments on the RTCA-MP xCELLigence system (ACEA Biosciences, San Diego, CA) were performed according to the instructions of the manufacturer. Primary culture of rat cortical neurons were seeded at 1×105 cells per well of the E-plate 96 (ACEA Biosciences) in 100 µl Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10 % fetal bovine serum (FBS). After 30 min equilibration at room temperature, the E-plate was placed in the RTCA-MP station. The RTCA-MP station was housed in a humidified cell culture incubator at 37 °C and 5 % CO2. Medium was replaced by 100 µl of neuronal culture medium after incubated for 4 h. Cell index, as determined by electrical impedance, was recorded at 25-min intervals. After 66 h incubation, the assay was paused, 10 µl medium was removed from each well, and cells were treated with 10 µl of schisantherin A solution to the final concentrations of 10, 20, 40, 80, 160 and 320 µg/ml. The assay was then resumed, taking impedance measurements every 25 min for another 24 h. All xCELLigence experiments were performed in triplicate.

2.6 Animals

Male SD rats, weighing 160-180 g, were provided by the Experimental Animal Center of Nantong University. Animals were kept on a 12 h light and dark cycle and housed individually with access to food and water ad libitum (20 ± 1 °C). All experimental and animal handling procedures were carried out in accordance with animal care guidelines and were approved by the administration committee for laboratory animals, Jiangsu Province, China.

2.7 Rat transient focal cerebral ischemia model and drug treatment

Transient MCAO/R was performed as described previously (Ortega et al, 2013; Wang et al, 2016). Rats were divided into sham-operated rats and MCAO/R rats. MCAO/R rats were subdivided into vehicle-treated rats and schisantherin A-treated rats. Two hours after MCAO, schisantherin A treated groups were administrated with three doses at 2.5, 5, and 10 mg/kg by gavage once a day for four consecutive days. Rats were sacrificed 96 h after MCAO/R injury. Schisantherin A was prepared in DMSO and diluted in 0.01 M PBS to final concentration (DMSO final concentration < 0.5 %). In vehicle-treated group, animals received MCAO for 2 h and reperfusion with oral administration of 1 ml normal saline and 0.5 % of DMSO for four consecutive days. The animal experiment was carried out according to the procedure in Figure 1A, B’ and C.

2.8 Neurological deficit scores and cerebral infarct assessment

The neuroscore assessment and infarct volume measure were performed as described

previously (Wang et al, 2016).

2.9 Measurement of MDA levels, SOD activity, and the levels of IL-1β and IL-6 in serum of rats

Serum samples were collected after MCAO/R and schisantherin A treatment. MDA levels, SOD activity, IL-1β and IL-6 levels were measured with commercial kits according to the manufacturer’s instructions.

2.10 TUNEL staining

TUNEL procedures were applied to paraffin-embedded brain sections (Figure 1C). Brain slices containing the whole parietal cortex were used for the in situ cell death detection according to the manufacturer’s protocol. Apoptotic (TUNEL-positive) cells were detected as localized bright red signals in a red background under a DMR fluorescence microscope (Leica Microsystems, Wetzlar, Germany). Data are expressed as the ratio of apoptotic cells to total cells.

2.11 Histopathology

Brain slices containing parietal cortex were used for hematoxylin and eosin (H&E) assay (Wang et al, 2016). At least six different ischemic zones of ipsilateral brain region in parietal cortex of the tissue sections were captured with microscope. The total number of normal and pathological neurons in the images were counted. The average number of viable neurons was calculated. The results were expressed as a percentage of the sham group (Nunez-Figueredo et al, 2014).

2.12 Immunohistochemistry staining

IHC detection of growth and differentiation factor 10 (GDF10), TLR4, NADPH oxidases 4 (NOX4), IL-1β and Caspase-3 was performed (Wang et al, 2016). The results were assessed in a double-blinded approach, and expressed according to the level of immunoreactivity. The weakest immunoreactivity was given a score of 1, whereas the highest immunoreactivity was 5.

2.13 Fluorescence In Situ Hybridization (FISH)

C5aR1 mRNA expressions in parietal cortex in rats after MCAO/R and schisantherin A treatment were determined by C5aR1 RNAscope® Fluorescent Multiplex Kit according to the supplier’s instruction. Positive red signals in parietal cortex were detected with a Pannoramic MIDI Digital Slide Scanner (3DHISTECH Ltd., Budapest, HUNGARY). Data are expressed by the fluorescence intensity score. Intensity of hybridization was scored as 0, no staining; 1, weak staining; 2, slightly strong staining; 3, medium strong staining; 4, strong staining. The extent of hybridization was assessed as focal (< 5 %) or multifocal/diffuse. Cases were considered negative if scored as 0 or 1 and focal; all ≥ 2 cases and cases scored as 1 and multifocal/diffuse were considered positive.

2.14 Quantitative Real-time PCR (qPCR)

qPCR was employed to evaluate the mRNA levels of C5aR1 in parietal cortex of ischemic brain of rats. Total RNA was extracted using Trizol (Invitrogen, Carlsbad, CA), and was reverse transcribed into cDNA using an Omniscript RT kit (Qiagen, Valencia, CA). qPCR was performed using Fast-Plus EvaGreen® qPCR Master Mix kit (Biotium, Hayward, CA). Relative expression level for C5aR1 was normalized to the housekeeping gene GAPDH. Each sample was tested in triplicate and the 2-∆∆CT method was used to analyze the relative transcription data (Rodrigues Hell et al, 2009). The following primers were used: C5aR1_fwd TACCACAGAACCCAGGAGGA, C5aR1_rev CGCTTCGGGAGGTGAATG, GAPDH_fwd TGAGGCCGGTGCTGAGTATGT, GAPDH_rev CAGTCTTCTGGGTGGCAGTGAT.

2.15 Western blot analysis

Total protein of parietal cortex was extracted, and the protein samples were subjected to protein quantification with a BCA protein assay kit. Western blot analysis was performed as described (Wang et al, 2016).

2.16 Statistical analysis

Data were expressed as mean ± SEM. GraphPad Prism 5.0 software (GraphPad Software Inc., USA) was used for statistical analysis. Comparisons among different groups were performed using a one-way analysis of variance (ANOVA) followed by Tukey post test. Prior ANOVA analysis, Shapiro-Wilk test was used to verify whether the data fulfilled Gaussian distribution. The Kaplan-Meier estimator/test was used to produce the survival curves, and the significance for the

survival percent was assessed using the log-rank test. Differences were considered statistically significant at p < 0.05.

3. Results

3.1 Schisantherin A treatment attenuated OGD/R-induced apoptosis and necrosis in primary culture of rat cortical neurons

To confirm OGD/R model worked well, cell viability was measured by both MTT and LDH release assays. It was observed that cell viability was significantly decreased and the level of LDH release was remarkably increased in vehicle group (Cell viability: p < 0.001, F = 406.9. LDH release: p < 0.001, F = 91.74. Figure 2A and B). TUNEL assay showed that OGD/R exposure induced about 53 % of cortical neurons displaying apoptotic morphological features characterized by nuclear shrinkage and formation of apoptotic bodies (p < 0.001, F = 61.45. Figure 2C and D). However, schisantherin A treatment at the doses of 2.5 and 5 µg/ml significantly increased cell viability, decreased LDH release, and inhibited the apoptosis in primary culture of cortical neurons (Cell viability: p < 0.01, F = 10.22; p < 0.01, F = 17.79. LDH release: p < 0.05, F = 6.49; p < 0.01, F = 14.33. TUNEL: p < 0.05, F = 6.57, p < 0.01, F = 11.07. Figure 2A-D). Moreover, its neuroprotective effects were also observed in OGD/R model through monitoring schisantherin A treated cortical neurons (Figure 3 and Supplementary Movies). We found that OGD/R induced a progressive apoptosis and necrosis in neurons, with some neurons losing their adhesion to substrate. Schisantherin A treatment partially improved OGD/R induced morphological degeneration. Schisantherin A treatment at 2.5 and 5 µg/ml improved cell survival (p < 0.01, F = 8.79; p < 0.01, F

= 10.31. Figure 3B) and promoted axonal growth (5 µg/ml at 24 h: p < 0.05, F = 11.41. Figure 3C). Overall, these results showed that OGD/R exposure induced cell apoptosis and necrosis and eventually death in primary culture of cortical neurons. Schisantherin A treatment at 2.5 and 5 µg/ml improved cell viability, reduced LDH release, and inhibited apoptosis. To visualize the changes of drug-induced cell morphology, effects of schisantherin A on cortical neurons were monitored by RTCA-MP xCELLigence system. After 24-h schisantherin A treatment at six different doses (0-320 µg/ml) on normal cortical neurons. No significant toxicity was found (p > 0.05. Supplementary Figure S1).

3.2 Schisantherin A treatment attenuated MCAO/R-induced brain injury, oxidative stress, inflammation and apoptosis signs in ischemic brain in rats

During MCAO/R injury and schisantherin A treatment, survival rate of rats was calculated daily, and a continuous drop of survival rate from day 1 till day 4 was observed in the vehicle-treated group (Figure 4A). MCAO/R resulted in significant infarct region in brain, severe neurological deficits (expressed as neurological scores) with severe paw flexion, decreased spontaneous movements, or circling movements (Infarct volume: p < 0.001, F = 196.64; Neurological score: p < 0.001, F = 85. Figure 4B-D). In agreement with previous reports (Chan, 2001; Chen et al, 2011), the increased serum MDA level and decreased serum SOD activity indicated MCAO/R exposure induced oxidative stress in the vehicle-treated rats (MDA levels: p < 0.001, F = 40.01; SOD activity: p < 0.001, F = 144.03. Figure 4E and F). Furthermore, cerebral ischemia and reperfusion exposure in vehicle-treated rats induced remarkably elevated inflammatory factors IL-1β and IL-6 levels in serum (Serum IL-1β: p < 0.001, F = 40.20; Serum

IL-6: p < 0.001, F = 38.01. Figure 4G and H). TUNEL staining (Figure 4I-N) demonstrated a loss of neurons and more pyknotic cells in the ischemic parietal cortex in vehicle-treated brain (Figure 4J). The number of TUNEL-positive cells in ischemic parietal cortex in vehicle-treated animals were significantly increased (p < 0.001, F = 110.65. Figure 4N). Notably, with schisantherin A treatment at 5 and 10 mg/kg, we observed that the neurological damage of MCAO/R rats were significantly improved. This was demonstrated by increased survival rate, reduced infarct volume (p < 0.05, F = 8.83; p < 0.001, F = 68.88), neurological scores (p < 0.05, F = 5.29; p < 0.001, F = 22.73), oxidative stress (MDA levels: p < 0.05, F = 8.23; p < 0.001, F = 26.76. SOD activity: p < 0.01, F = 17.51; p < 0.01, F = 10.62), and inflammatory cytokines secretion (Serum IL-1β: p < 0.05, F = 8.80; p < 0.01, F = 19.44. Serum IL-6: p < 0.05, F = 7.44; p < 0.01, F = 13.85). We also found schisantherin A at 5 and 10 mg/kg significantly inhibited neuronal apoptosis in ischemic parietal cortex (p < 0.01, F = 32.80; p < 0.001, F = 49.26. Figure 4K-N). H&E staining showed histological changes in ischemic parietal cortex of vehicle-treated rats compared with sham group. In infarcted core of parietal cortex of MCAO/R-treated rats, cells were shrunken with condensed and triangulated-pyknotic nuclei surrounded by swollen cellular process and cytoplasmic eosinophilia (Figure 5B′ and B′′). In contrast, normal tissue patterns were observed in the parietal cortex from sham rats (Figure 5A′ and A′′). The percentage of viable cortical neurons in ischemic parietal cortex significantly decreased compared with the sham group (p < 0.001, F = 82.41. Figure 5G). As shown in Figure 5F, the ischemic penumbra and infarcted zone occupied over 95 % area of the whole visual field in the vehicle-treated rats. In schisantherin A treated groups, especially at 5 and 10 mg/kg, we found ameliorated histological morphology (Figure 5C-C’’ and E-E’’’’) and significantly restored areas and increased viable cell ratios (Percentage of viable

neurons: p < 0.05, F = 6.39; p < 0.05, F = 7.30. Figure 5F and G). I/R brain injury produces a limited process of neural repair. Axonal sprouting in cortex adjacent to the infarct is part of this recovery process. GDF10 has been reported to be a stroke-induced signal for axonal sprouting and functional recovery. Knocking down GDF10 blocked axonal sprouting and reduced recovery (Li et al, 2015). GDF10 was significantly decreased in parietal cortex of rats after MCAO/R injury compared with sham rats (GDF10 protein levels: p < 0.01, F = 34.70. Figure 5H, J and J’). Schisantherin A at 5 and 10 mg/kg significantly increased GDF10 expressions in parietal cortex of rats (GDF10 protein levels: p < 0.05, F = 6.95; p < 0.05, F = 6.13. Figure 5H, K-M and K’-M’), and the IHC quantification was shown in Figure 5N (p < 0.05, F = 9.92; p < 0.01, F = 10.29). Schisantherin A at 5 and 10 mg/kg promoted brain functional recovery after MCAO/R injury in rats, demonstrated by remarkably increased survival rate, reduced infarct volume, neurological scores and oxidative stress, and decreased neuronal inflammation and apoptosis.

3.3 TLR4 signaling pathway participated in the oxidative stress and inflammation responses in parietal cortex after MCAO/R injury and schisantherin A treatment

TLR-induced reactive oxygen species (ROS) can exert deleterious effects by inducing oxidative stress and cytokine overproduction leading to damage in ischemic brain stroke. In case of sterile infections, where danger-associated molecular patterns (DAMPs) activate TLRs, the released ROS may be detrimental to host tissues. Moreover, TLR4 activation induced NF-κB to generate the release of inflammatory cytokines such as IL-1β, IL-6, etc.. In addition, Members of MAPK family are important mediators of signal transduction pathways that serve to coordinate the cellular

response to a variety of extracellular stimuli. Activated MAPKs phosphorylate their specific substrates on serine and/or threonine residues, ultimately leading to activation of various transcription factors and control of a vast array of physiological processes, including cell survival and death. Furthermore, activated MAPKs could crosstalk with NF-κB, resulting in the inflammation and apoptosis responses after stroke. Therefore, we analyzed TLR4, NF-κB, MAPKs and their downstream related protein changes in parietal cortex of rats after MCAO/R and schisantherin A treatment (Figure 6). TLR4 protein expression was activated significantly after MCAO/R injury in parietal cortex of rats shown by IHC (p < 0.001, F = 38.57. Figure 6A-F and A’-E’) and Western blot assays (p < 0.01, F = 19.93. Figure 6G). The expressions of p-IκBα, NF-κB, p-ERK, p-JNK, p-p38, IL-1β, IL-6, p-CREB and cleaved Caspase-3 in parietal cortex of MCAO/R treated rats were remarkably activated (p-IκBα: p < 0.01, F = 18.00; NF-κB: p < 0.01, F = 20.45; p-ERK: p < 0.05, F = 10.24; p-JNK: p < 0.05, F = 13.66; p-p38: p < 0.01, F = 18.76; IL-1β: p < 0.01, F = 25.35; IL-6: p < 0.05, F = 13.05; p-CREB: p < 0.01, F = 21.16; cleaved Caspase-3: p < 0.01, F = 23.48. Figure 6H-P). The same results on changes of IL-1β and Caspase-3 expressions after MCAO/R and schisantherin A treatment in parietal cortex of rats were also detected by IHC (p < 0.001, F = 75.63, Figure 7; p < 0.001, F = 151.25, Supplementary Figure S2). NOX4 protein expression (p < 0.01, F = 22.82, Figure 6Q) was significantly activated, while thioredoxin 1 (Trx1) and peroxiredoxin 2 (Prx2) protein expressions were remarkably inhibited after MCAO/R injury (Trx1: p < 0.05, F = 10.40; Prx2: p < 0.05, F = 13.56. Figure 6R-S). NOX4 expression after MCAO/R injury and schisantherin A treatment was also detected by IHC (p < 0.001, F = 44.02, Supplementary Figure S3). These expression changes in parietal cortex of rats after MCAO/R injury were consistent with the oxidative stress, inflammation responses and cell apoptosis in ischemic brain of rats. Schisantherin A treatment at 5 and 10 mg/kg induced a significant change in these

protein expressions as compared with vehicle-treated rats (p-IκBα: p < 0.05, F = 6.22; p < 0.01, F = 15.00. NF-κB: p < 0.05, F = 6.72; p < 0.01, F = 15.82. p-ERK: p < 0.05, F = 10.82; p < 0.05, F = 13.12. p-JNK: p < 0.05, F = 6.26; p < 0.05, F = 8.50. p-p38: p < 0.05, F = 6.00; p < 0.05, F = 9.29. IL-1β: p < 0.05, F = 10.32; p < 0.05, F = 13.22. IL-6: p < 0.05, F = 6.98; p < 0.05, F = 10.05. p-CREB: p < 0.05, F = 13.30; p < 0.05, F = 10.91. cleaved Caspase-3: p < 0.05, F = 7.70; p < 0.05, F = 8.34. NOX4: p < 0.05, F = 7.95; p < 0.01, F = 19.51. Trx1: p < 0.05, F = 7.33; p < 0.05, F = 10.63. Prx2: p < 0.05, F = 10.25; p < 0.05, F = 9.44. Figure 6H-S).

3.4 C5aR1 participated in pathological mechanism of parietal cortex after MCAO/R injury and schisantherin A treatment

The expression of C5aR1 was assessed at transcriptional levels. C5aR1 mRNAs were detected by qPCR in parietal cortex of rats after MCAO/R injury and schisantherin A treatment. As shown in Figure 8G, C5aR1 mRNA expression in parietal cortex of vehicle-treated group was remarkably increased compared with sham group (p < 0.01, F = 34.05). The cellular presence of the receptor in parietal cortex after MCAO/R injury and schisantherin A treatment was assayed by FISH (Figure 8A-F and A’-E’’’). C5aR1 was present along the membrane in cortical neurons, and C5aR1 presence in parietal cortex of vehicle-treated group was remarkably increased compared with sham group (p < 0.001, F = 53.57). These results were consistent with the qPCR results. The increase in C5aR1 expression in parietal cortex of rats were remarkably down-regulated by schisantherin A treatment at 5 and 10 mg/kg (qPCR: p < 0.05, F = 14.24; p < 0.01, F = 25.93. FISH: p < 0.05, F = 7.5; p < 0.05, F = 8.45. Figure 8C-G). Based on the results that MCAO/R injury induced C5aR1 up-regulated mRNA expression and

activation of TLR4, NF-κB, ERK1/2, JNK1/2, p38, IL-1β and IL-6 in rats, we concluded that C5aR1 participated in pathological mechanism after I/R brain injury, and C5aR1 might interact with TLR4, via NF-κB and MAPKs pathway. Schisantherin A might have neuroprotective effects via TLR4 and C5aR1 signaling pathways inhibiting oxidative stress, inflammatory responses and cell apoptosis in rats after I/R brain injury.

4. Discussion

Cerebral I/R injury is a public health problem because of high mortality and disability. Effective therapeutic strategy is very limited, and no available treatment has shown promising benefits after cerebral I/R injury (Perez-de-Puig et al, 2015; Ma et al, 2016). In this study, schisantherin A was introduced to explore its potential role in alleviating I/R injury by monitoring neuron damage and repair in parietal cortex in rats after I/R injury. The parietal brain cortex was chosen as a region of interest because it represented the brain areas irrigated by I/R damage. In particular, the parietal cortex is a region includes the ischemic core and the ischemic penumbra after I/R. In primary culture of rat cortical neurons, OGD/R induced significant neuron apoptosis indicated by remarkably reduced cell viability, elevated LDH release and TUNEL positive signals. Schisantherin A at doses of 2.5 and 5 µg/ml modulated these changes (Figure 2). It significantly promoted neuron repair characterized by elevated cell survival and average length of the longest neurites of neuron (Figure 3 and Supplementary Movies). Importantly, real-time assay by xCELLigence indicated that schisantherin A did not affect normal neurons at the concentration as high as 320 µg/ml (Supplementary Figure S1). In rats after MCAO/R, we found cell apoptosis,

inflammation and oxidative stress in ischemic parietal cortex of brain. After schisantherin A treatment, ischemic lesions were improved in a dose-dependent manner compared with vehicle-treated group. Animals had higher survival rate, smaller infarct volumes, less severe neurological deficits, and weaker inflammation and apoptosis responses in parietal cortex. Moreover, schisantherin A treatment decreased the serum levels of MDA, IL-1β and IL-6, and increased serum SOD activity and neuron GDF10 protein expressions in rat parietal cortex of ischemic hemisphere (Figures 4 and 5). Significant increased IL-1β expressions in parietal cortex of ischemic hemisphere in rats after MCAO/R were also observed with IHC assay. It was significantly decreased by schisantherin A treatment (Figure 7). These results showed that schisantherin A promoted neuron repair by inhibiting oxidative stress and inflammatory responses. Schisantherin A also had significant effects on apoptotic and necrotic cell deposition from H＆E staining and TUNEL assay in parietal cortex of rats (Figures 4 and 5). The significant neuroprotective effects of schisantherin A on MCAO/R brain injury in rats warranted our further study on the underlying mechanisms. The immune system plays an important role in the regulation of inflammation after cerebral I/R injury, and evidence suggests that blockage of TLRs and complement activation attenuate inflammatory response and cortical neurogenesis following cerebral ischemia injury (Van Beek et al, 2000; Moraga et al, 2014). Therefore, identification of the specific TLRs and complement subcomponents which contributed to post-ischemia damage might provide promising therapeutic targets after cerebral I/R injury. TLR4 and C5aR1 have been reported to be participant in the inflammatory responses after cerebral ischemia. In this study, the expressions of TLR4 in parietal cortex of rats were found to be significantly altered after MCAO/R and schisantherin A treatement (Figure 6). Accompanied with increased TLR4 expressions after MCAO/R injury, C5aR1 was

activated (Figure 8). The increased expressions of TLR4 and C5aR1 correlated with neurological damage in rats after MCAO/R. Accordingly, the IκBα/NF-κB/MAPK/IL-1β signaling pathways were activated, and the downstream CREB and Caspase-3 were activated (Figure 6). Elevated cleaved Caspase-3 expressions after MCAO/R in parietal cortex of rats were also shown in Supplementary Figure S2. The transcription factor NF-κB plays a key role in the transcriptional regulation of many proteins involved in ischemic stroke. CREB is also a transcription factor that regulates diverse cellular responses and is induced by a variety of inflammatory signals and it mediates gene transcription. Pharmacological studies have shown that MAPKs are essential for NF-κB transactivation in response to an inflammatory response. Our data showed that CREB and MAPK companied with NF-κB activation in ischemic parietal cortex resulted in inflammation and apoptosis modulation during MCAO/R and schisantherin A treatement in rats. To sum up, it was found that TLR4 and C5aR1 regulated neuron inflammation and apoptosis in experimental models of MCAO/R injury in rats, through the IκBα/NF-κB/MAPK/IL-1β/CREB/Caspase-3 pathways. Moreover, schisantherin A improved brain function after MCAO/R injury in rats by modulating TLR4 and C5aR1 via regulating IκBα/NF-κB /MAPK/IL-1β/CREB/Caspase-3 signaling pathways. The pathophysiological process of ischemia followed by reperfusion generates oxidative stress, which is also a key contributor to the critical damage to brain tissue and neurological functions that can occur in focal ischemia. In recent years, cerebral ischemia-induced excessive production of ROS has been shown to be a main mechanism contributing to ischemic stroke and NADPH oxidases are the primary source of ROS following ischemic stroke (Kahles et al, 2007; Beske et al, 2015). ROS overproduction induced MAPK phosphorylation can further activate NF-κB leading to inflammatory responses. NOX4, one of 7 NADPH oxidase family members is a highly expressed isoform in cortical neurons after stroke (Kleinschnitz et al, 2010; Nayernia et al, 2014). In this

study, we observed increased serum MDA levels and decreased serum SOD levels, and increased NOX4 protein expression in parietal cortex of rats after MCAO/R injury, all of which were remarkably attenuated by schisantherin A treatment (Figures 4E, F and 6Q, and Supplementary Figure S3). Aside from NOX4, the thioredoxin-peroxiredoxin pathway is an important antioxidant system. In particular, Trx1-Prx2 is extremely abundant in the brain. The Trx1-Prx2 system detoxifies peroxides by transferring reducing equivalents from NADPH to peroxides via Trx reductase, Trx1, and finally Prx2 (Satoh et al, 2011). MCAO/R injury in rats induced NOX4 activation and Trx1-Prx2 inhibition in parietal cortex of ischemic region (Figure 6). This study indicated that schisantherin A treatment exerted antioxidative effects via inhibiting NOX4 activation and promoting Trx1-Prx2 pathway after MCAO/R brain injury. In addition, there is a crosstalk between TLR4 and oxidative stress signaling in regulating inflammatory responses. It was shown that inhibiting TLR4 reduced NOX4 expression, leading to suppression of oxidative/nitrative stress and of neuronal apoptosis in transient focal ischemia (Suzuki et al, 2012). Our data showed that schisantherin A exerted neuroprotective effects against MCAO/R injury, by inhibiting oxidative stress and inflammation responses via inhibiting TLR4 and NOX4 activation, and promoting Trx1-Prx2 pathway that was dependent on TLR4/NOX4/Trx1/Prx2 pathway. Overall, our results in this study suggested that inhibiting TLR4 and C5aR1 were crucial signal factor that mediating activation of oxidative stress, inflammation and apoptosis in ischemic parietal cortex of rats after MCAO/R injury. Consistent with our results, schisantherin A has been demonstrated to ameliorate oxidative/nitrosative stress, attenuate inflammatory state, and reduced cell apoptosis in liver after I/R injury via inhibition of MAPK pathway in C57BL/6 male mice (Zheng et al, 2017). Also, schisantherin A has been shown significant anti-inflammatory effects in LPS-exposed mice by blocking the activation of NF-κB/MAPK/IL-1β pathway (Zhou et al, 2014). In addition,

schisantherin A exhibited protective role against myocardial I/R injury in rats via inhibiting cardiomyocyte apoptosis by decreasing Caspase-3 activity in the myocardium (Chang et al, 2013). In conclusion, the translational potential of results obtained in vitro and in vivo models of I/R brain injury in rats in our study suggested that TLR4 and C5aR1 signaling pathways played an important role in disrupting the homeostasis through different cascades including oxidative stress, inflammation and apoptosis leading to ischemic brain impairment. Importantly, schisantherin A exhibited potent neuroprotective effects against I/R injury in vitro and in vivo by modulating TLR4 and C5aR1 signaling pathways. Our study highlighted that blocking of TLR4 and C5aR1 signaling pathways would retain the protective functions to alleviate the symptoms of ischemic stroke. Moreover, schisantherin A might be a potent neuroprotective agent thorough anti-oxidative, anti-inflammatory and anti-apoptotic effects against ischemia and related diseases.

Conflict of interest statement The authors have no conflicts of interest to declare. Acknowledgments

This study was supported by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD), National Natural Science Foundation of China (Grant Nos. 81501142 and 81371389) and Postgraduate Scientific and Technological Innovation Projects of Nantong University (Grant Nos. 13200185).

References

Adelson JD, Barreto GE, Xu L, Kim T, Brott BK, Ouyang YB et al (2012). Neuroprotection from stroke in the absence of MHCI or PirB. Neuron 73: 1100-1107. Alawieh A, Elvington A & Tomlinson S (2015). Complement in the Homeostatic and Ischemic Brain. Front Immunol 6: 417. Baskerville TA, Macrae IM, Holmes WM & McCabe C (2016). The influence of gender on 'tissue at risk' in acute stroke: A diffusion-weighted magnetic resonance imaging study in a rat model of focal cerebral ischaemia. J Cerebr Blood F Met 36: 381-386. Beske PH, Byrnes NM, Astruc-Diaz F & Jackson DA (2015). Identification of NADPH oxidase as a key mediator in the post-ischemia-induced sequestration and degradation of the GluA2 AMPA receptor subunit. J Neurochem 132: 504-519. Brewer GJ, Torricelli JR, Evege EK & Price PJ (1993). Optimized survival of hippocampal neurons in B27-supplemented Neurobasal, a new serum-free medium combination. J Neurosci Res 35: 567-576. Chamorro A, Meisel A, Planas AM, Urra X, van de Beek D & Veltkamp R (2012). The immunology of acute stroke. Nat Rev Neurol 8: 401-410. Chan PH (2001). Reactive oxygen radicals in signaling and damage in the ischemic brain. J Cereb Blood Flow Metab 21: 2-14. Chang R, Li Y, Yang X, Yue Y, Dou L, Wang Y et al (2013). Protective role of deoxyschizandrin and schisantherin A against myocardial ischemia-reperfusion injury in rats. Plos One 8: e61590. Chen H, Yoshioka H, Kim GS, Jung JE, Okami N, Sakata H et al (2011). Oxidative stress in ischemic brain damage: mechanisms of cell death and potential molecular targets for neuroprotection. Antioxid Redox Signal 14: 1505-1517.

E Q, Tang M, Zhang X, Shi Y, Wang D, Gu Y et al (2015). Protection of seven dibenzocyclooctadiene lignans from Schisandra chinensis against serum and glucose deprivation injury in SH-SY5Y cells. Cell Biol Int 39: 1418-1424. García-Culebras A, Palma-Tortosa S, Moraga A, García-Yébenes I, Durán-Laforet V, Cuartero MI et al (2017). Toll-Like Receptor 4 Mediates Hemorrhagic Transformation After Delayed Tissue Plasminogen Activator Administration in In Situ Thromboembolic Stroke. Stroke 48:1695-1699. Herz J, Sabellek P, Lane TE, Gunzer M, Hermann DM & Doeppner TR (2015). Role of Neutrophils in Exacerbation of Brain Injury After Focal Cerebral Ischemia in Hyperlipidemic Mice. Stroke 46: 2916-2925. Kahles T, Luedike P, Endres M, Galla HJ, Steinmetz H, Busse R et al (2007). NADPH oxidase plays a central role in blood-brain barrier damage in experimental stroke. Stroke 38: 3000-3006. Kleinschnitz C, Grund H, Wingler K, Armitage ME, Jones E, Mittal M et al (2010). Post-Stroke Inhibition of Induced NADPH Oxidase Type 4 Prevents Oxidative Stress and Neurodegeneration. Plos Biology 8. Koleva M, Schlaf G, Landmann R, Gotze O, Jungermann K & Schieferdecker HL (2002). Induction of anaphylatoxin C5a receptors in rat hepatocytes by lipopolysaccharide in vivo: mediation by interleukin-6 from Kupffer cells. Gastroenterology 122: 697-708. Li S, Nie EH, Yin YQ, Benowitz LI, Tung S, Vinters HV et al (2015). GDF10 is a signal for axonal sprouting and functional recovery after stroke. Nat Neurosci 18: 1737-1745. Li X, Zhao X, Xu X, Mao X, Liu Z, Li H et al (2014). Schisantherin A recovers Abeta-induced neurodegeneration with cognitive decline in mice. Physiol Behav 132: 10-16.

Liao S, Zhou K, Li D, Xie X, Jun F & Wang J (2016). Schisantherin A suppresses interleukin-1beta-induced inflammation in human chondrocytes via inhibition of NF-kappaB and MAPKs activation. European journal of pharmacology 780: 65-70. Ma F, Martinez-San Segundo P, Barcelo V, Morancho A, Gabriel-Salazar M, Giralt D et al (2016). Matrix metalloproteinase-13 participates in neuroprotection and neurorepair after cerebral ischemia in mice. Neurobiol Dis 91: 236-246. Maekawa T, Krauss JL, Abe T, Jotwani R, Triantafilou M, Triantafilou K et al (2014). Porphyromonas gingivalis manipulates complement and TLR signaling to uncouple bacterial clearance from inflammation and promote dysbiosis. Cell Host Microbe 15: 768-778. Merle NS, Noe R, Halbwachs-Mecarelli L, Fremeaux-Bacchi V & Roumenina LT (2015). Complement System Part II: Role in Immunity. Front Immunol 6: 257. Moraga A, Pradillo JM, Cuartero MI, Hernandez-Jimenez M, Oses M, Moro MA et al (2014). Toll-like receptor 4 modulates cell migration and cortical neurogenesis after focal cerebral ischemia. FASEB J 28: 4710-4718. Nayernia Z, Jaquet V & Krause KH (2014). New Insights on NOX Enzymes in the Central Nervous System. Antioxid Redox Sign 20: 2815-2837. Nunez-Figueredo Y, Ramirez-Sanchez J, Hansel G, Pires ENS, Merino N, Valdes O et al (2014). A novel multi-target ligand (JM-20) protects mitochondrial integrity, inhibits brain excitatory amino acid release and reduces cerebral ischemia injury in vitro and in vivo. Neuropharmacology 85: 517-527. Orsini F, De Blasio D, Zangari R, Zanier ER & De Simoni MG (2014). Versatility of the complement system in neuroinflammation, neurodegeneration and brain homeostasis. Front

Cell Neurosci 8: 380. Ortega FJ, Jolkkonen J, Mahy N & Rodriguez MJ (2013). Glibenclamide enhances neurogenesis and improves long-term functional recovery after transient focal cerebral ischemia. J Cerebr Blood F Met 33: 356-364. Park SY, Bae YS, Ko MJ, Lee SJ & Choi YW (2014). Comparison of anti-inflammatory potential of four different dibenzocyclooctadiene lignans in microglia; action via activation of PKA and Nrf-2 signaling and inhibition of MAPK/STAT/NF-kappaB pathways. Mol Nutr Food Res 58: 738-748. Perez-de-Puig I, Miro-Mur F, Ferrer-Ferrer M, Gelpi E, Pedragosa J, Justicia C et al (2015). Neutrophil recruitment to the brain in mouse and human ischemic stroke. Acta Neuropathol 129: 239-257. Pundik S, Xu K & Sundararajan S (2012). Reperfusion brain injury Focus on cellular bioenergetics. Neurology 79: S44-S51. Rodrigues Hell RC, Silva Costa MM, Goes AM & Oliveira AL (2009). Local injection of BDNF producing mesenchymal stem cells increases neuronal survival and synaptic stability following ventral root avulsion. Neurobiol Dis 33: 290-300. Sa F, Guo BJ, Li S, Zhang ZJ, Chan HM, Zheng Y et al (2015). Pharmacokinetic Study and Optimal Formulation of New Anti-Parkinson Natural Compound Schisantherin A. Parkinson's disease 2015: 951361. Satoh T, Rezaie T, Seki M, Sunico CR, Tabuchi T, Kitagawa T et al (2011). Dual neuroprotective pathways of a pro-electrophilic compound via HSF-1-activated heat-shock proteins and Nrf2-activated phase 2 antioxidant response enzymes. J Neurochem 119: 569-578. Song JX, Lin X, Wong RN, Sze SC, Tong Y, Shaw PC et al (2011). Protective effects of

dibenzocyclooctadiene lignans from Schisandra chinensis against beta-amyloid and homocysteine neurotoxicity in PC12 cells. Phytother Res 25: 435-443. Suzuki Y, Hattori K, Hamanaka J, Murase T, Egashira Y, Mishiro K et al (2012). Pharmacological inhibition of TLR4-NOX4 signal protects against neuronal death in transient focal ischemia. Sci Rep 2: 896. Van Beek J, Bernaudin M, Petit E, Gasque P, Nouvelot A, MacKenzie ET et al (2000). Expression of receptors for complement anaphylatoxins C3a and C5a following permanent focal cerebral ischemia in the mouse. Exp Neurol 161: 373-382. Wang CP, Shi YW, Tang M, Zhang XC, Gu Y, Liang XM et al (2016). Isoquercetin Ameliorates Cerebral Impairment in Focal Ischemia Through Anti-Oxidative, Anti-Inflammatory, and Anti-Apoptotic Effects in Primary Culture of Rat Hippocampal Neurons and Hippocampal CA1 Region of Rats. Mol Neurobiol. Wang CP, Zhang LZ, Li GC, Shi YW, Li JL, Zhang XC et al (2014). Mulberroside A protects against ischemic impairment in primary culture of rat cortical neurons after oxygen-glucose deprivation followed by reperfusion. J Neurosci Res 92: 944-954. Zaal A, Lissenberg-Thunnissen SN, van Schijndel G, Wouters D, van Ham SM & ten Brinke A (2013). Crosstalk between Toll like receptors and C5a receptor in human monocyte derived DCs suppress inflammatory cytokine production. Immunobiology 218: 175-180. Zhang LQ, Sa F, Chong CM, Wang Y, Zhou ZY, Chang RC et al (2015). Schisantherin A protects against 6-OHDA-induced dopaminergic neuron damage in zebrafish and cytotoxicity in SH-SY5Y cells through the ROS/NO and AKT/GSK3beta pathways. J Ethnopharmacol 170: 8-15. Zhang X, Kimura Y, Fang C, Zhou L, Sfyroera G, Lambris JD et al (2007). Regulation of Toll-like

receptor-mediated inflammatory response by complement in vivo. Blood 110: 228-236. Zheng N, Liu F, Lu H, Zhan Y, Zhang M, Guo W et al (2017). Schisantherin A protects against liver ischemia-reperfusion injury via inhibition of mitogen-activated protein kinase pathway. Int Immunopharmacol doi: 10.1016/j.intimp.2017.03.019. Zhou E, Li Y, Wei Z, Fu Y, Lei H, Zhang N et al (2014). Schisantherin A protects lipopolysaccharide-induced acute respiratory distress syndrome in mice through inhibiting NF-κB and MAPKs signaling pathways. Int Immunopharmacol 22:133-140.

Figure and table legends

Figure 1 Scheme of the experimental protocol in primary culture of rat cortical neurons and rats. A, In vitro OGD/R model and schisantherin A treatment (1.25, 2.5 and 5 µg/ml) in primary culture of rat cortical neurons; and in vivo MCAO/R model and schisantherin A treatment (2.5, 5 and 10 mg/kg/day) in rats. B, The assays done in primary culture of rat cortical neurons. B’, The assays done in rats. C, The observed region of the brain of rats. D, Chemical structure of schisantherin A.

Figure 2 Effects of schisantherin A on OGD/R-induced neuron apoptosis in primary culture of rat cortical neurons. A, Cell viability. Bars represent mean values ± SEM (n = 8). B, LDH release. Bars represent mean values ± SEM (n = 8). C, Representative fluorescence micrographs of TUNEL staining. D, The resulting histogram showing the percentage of apoptotic cells (featured by bright red signals) in cell population after different cell treatments as indicated. Bars represent mean values ± SEM (n = 4). ###p < 0.001 versus control, *p < 0.05 and **p < 0.01 versus vehicle group.

Figure 3 Cell morphological changes of primary culture of rat cortical neurons after OGD/R and schisantherin A treatment (1.25, 2.5 and 5 µg/ml). A, The photographs by time-lapse imaging at different time points in 24 h after OGD/R and schisantherin A treatment. B, The cell survival at 24 h after schisantherin A treatment. Bars represent mean values ± SEM (n = 4). C, The average length of the longest neuritis of neurons at 24 h after schisantherin A treatment. Bars represent mean values ± SEM (n = 4). #p < 0.05, ##p < 0.01 and ###p < 0.001 versus control, *p < 0.05 and **p < 0.01 versus vehicle group.

Figure 4 Effects of schisantherin A in rats following MCAO/R. Schisantherin A (2.5, 5, and 10 mg/kg/day) was orally administered after 2 h MCAO for four consecutive days. A, The survival percent of rats after MCAO/R and schisantherin A treatment. B, Representative coronal brain sections (2-mm thick, measured in six serial coronal sections arranged from cranial to caudal regions and corrected for edema) from sham-operated, vehicle- or schisantherin A (2.5, 5, and 10 mg/kg/day)-treated rats stained with 2 % TTC after MCAO/R. Red colored regions in the TTC-stained sections are non-ischemic regions, and pale-colored regions indicate the ischemic portions of the brain. C, Quantitative analyses of infarct volumes using image analysis software. Bars represent mean values ± SEM (n = 8). D, Neurological deficit scores after MCAO/R and orally administration of different schisantherin A doses. Bars represent mean values ± SEM (n = 8). E, Serum MDA levels. Bars represent mean values ± SEM (n = 8). F, Serum SOD activity. Bars represent mean values ± SEM (n = 8). G, Serum IL-1β levels. Bars represent mean values ± SEM (n = 8). H, Serum IL-6 levels. Bars represent mean values ± SEM (n = 8). I-M, Representative fluorescence micrographs of TUNEL staining of parietal cortex of rats after MCAO/R and schisantherin A treatment. N, The resulting histogram showing the percentage of apoptotic cells

(featured by bright red signals) in cell population after different treatments as indicated. Bars represent mean values ± SEM (n = 4). The neurological score and infarct volume from sham groups treated with vehicle were all equal to zero. The possible influence of edema on infarct volume was corrected by standard methods (volume of contralateral hemisphere-volume of nonischemic ipsilateral hemisphere), with infarcted volume expressed as a percentage of the contralateral hemisphere. ###p < 0.001 versus sham group, *p < 0.05, **p < 0.01 and ***p < 0.001 versus vehicle-treated group.

Figure 5 Effects of schisantherin A on parietal cortex of rats following MCAO/R by H&E staining and IHC staining of GDF10. A-E’’’’, Representative micrographs of H&E staining of parietal cortex of rats after MCAO/R and schisantherin A treatment (2.5, 5, and 10 mg/kg/day). F, Morphometric analysis of the area present of ischemic penumbra area and infarct area in the parietal cortex of rats after MCAO/R and schisantherin A treatment (2.5, 5, and 10 mg/kg/day). G, Morphometric analysis of the percent of viable cells in the parietal cortex of brain tissue in rats after MCAO/R and schisantherin A treatment. Bars represent mean values ± SEM (n = 4). H, The protein level of GDF10 in parietal cortex of rats was assayed by western blot analysis after MCAO/R injury and schisantherin A treatment (2.5, 5, and 10 mg/kg/day). Results are expressed as SEM values as % of control (mean ± SEM, n = 4). β-actin was served as control. I-M’, Representative micrographs of IHC staining of GDF10 in parietal cortex of rats after MCAO/R and schisantherin A treatment (2.5, 5, and 10 mg/kg/day). N, Immunoreactivity and IHC score of GDF10 in parietal cortex of rats. Bars represent mean values ± SEM (n = 4). ##p < 0.01 and ###p < 0.001 versus sham group, *p < 0.05 and **p < 0.01 versus vehicle-treated group.

Figure 6 Effects of schisantherin A on levels of proteins associated with oxidative stress and inflammation responses in parietal cortex of rats after MCAO/R injury. A-E’, Representative micrographs of TLR4 by IHC staining in parietal cortex of rats after MCAO/R and schisantherin A treatment (2.5, 5, and 10 mg/kg/day). F, IHC score of TLR4 in parietal cortex of rats. Bars represent mean values ± SEM (n = 4). The protein levels of TLR4 (G), IκBα (H), NF-κB (I), ERK1/2 (J), JNK1/2 (K), p38 (L), IL-1β (M), IL-6 (N), CREB (O), Cleaved Caspase-3 (P), NOX4 (Q), Trx1 (R), Prx2 (S) in parietal cortex of rats were assayed by western blot analysis after MCAO/R injury and schisantherin A treatment (2.5, 5, and 10 mg/kg/day). Results are expressed as SEM values as % of control (mean ± SEM, n = 4). β-actin was served as control. #p < 0.05 and ##p < 0.01 versus sham group, *p < 0.05 and **p < 0.01 versus vehicle-treated group.

Figure 7 The effects of schisantherin A on expression of IL-1β in parietal cortex of rats after MCAO/R. A-E’, Representative micrographs of IHC staining of IL-1β in parietal cortex of rats after MCAO/R and schisantherin A treatment (2.5, 5, and 10 mg/kg/day). F, Immunoreactivity and IHC score of IL-1β in parietal cortex of rats. Bars represent mean values ± SEM (n = 4). ###p < 0.001 versus sham group, *p < 0.05 and **p < 0.01 versus vehicle-treated group.

Figure 8 Expression profile of C5aR1 in rat parietal cortex following focal cerebral ischemia. The expression profile of C5aR1 was detected by FISH and qPCR. A-E’’’’, Representative micrographs of C5aR1 in parietal cortex of rats by FISH after MCAO/R and schisantherin A treatment. F, The fluorescent intensity score of C5aR1. Bars represent mean values ± SEM (n = 4). G, The expression levels of C5aR1 of parietal cortex in rats after MCAO/R and schisantherin A treatment by qPCR. Bars represent mean values ± SEM (n = 4). Data are shown as mean ± SEM. ##p < 0.01 and ###p <

0.001 versus sham group, *p < 0.05 and **p < 0.01 versus vehicle-treated group.

Figure S1 The effects of different concentrations of schisantherin A (0-320 µg/ml) for 24 h on the primary culture of rat cortical neurons by RTCA-MP xCELLigence system.

Figure S2 The effects of schisantherin A on expression of Caspase-3 in parietal cortex of rats after MCAO/R. A-E’, Representative micrographs of IHC staining of Caspase-3 in parietal cortex of rats after MCAO/R and schisantherin A treatment (2.5, 5, and 10 mg/kg/day). F, Immunoreactivity and IHC score of Caspase-3 in parietal cortex of rats. Bars represent mean values ± SEM (n = 4). ###p < 0.001 versus sham group, **p < 0.01 and ***p < 0.001 versus vehicle-treated group.

Figure S3 The effects of schisantherin A on expression of NOX4 in parietal cortex of rats after MCAO/R. A-E’, Representative micrographs of IHC staining of NOX4 in parietal cortex of rats after MCAO/R and schisantherin A treatment (2.5, 5, and 10 mg/kg/day). F, Immunoreactivity and IHC score of NOX4 in parietal cortex of rats. Bars represent mean values ± SEM (n = 4). ###p < 0.001 versus sham group, *p < 0.05 and **p < 0.01 versus vehicle-treated group.

Table 1. Antibodies used for western blot and immunohistochemistry analyses.

Supplementary Movies

The movies of cell morphological changes of primary culture of rat cortical neurons after OGD/R

and schisantherin A treatment (1.25, 2.5 and 5 µg/ml) by time-lapse imaging. Movie 1, Control group. Movie 2, OGD/R group. Movie 3, OGD/R and 1.25µg/ml schisantherin A-treated group. Movie 4, OGD/R and 2.5 µg/ml schisantherin A-treated group. Movie 5, OGD/R and 5 µg/ml schisantherin A-treated group.

Table 1. Antibodies used for western blot and immunohistochemistry analyses.

Company

Description Catalog number

Cell Signaling Technology, Inc. (Boston, MA, USA)

Mouse monoclonal CREB antibody

#9104 Mouse monoclonal phospho-IκBα (Ser32/36)(5A5) antibody

#9246

Polyclonal Thioredoxin 1 Antibody (Mouse/Rat Preferred)

#2298

Rabbit monoclonal Cleaved Caspase-3 (Asp175) (5A1E) antibody #9664 Rabbit monoclonal phospho-IκBα (Ser32) (14D4) antibody

#2859

Rabbit polyclonal p44/42 MAPK (Erk1/2) antibody

#9102 Rabbit polyclonal p38 MAPK antibody #9212 Rabbit monoclonal phospho-CREB (Ser133) (87G3) antibody

#9198

Rabbit polyclonal phospho-SAPK/JNK (Thr183/Tyr185) antibody#9251 Rabbit monoclonal phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E) XP® antibody

#4370

Rabbit monoclonal phospho-p38 MAPK (Thr180/Tyr182) (D3F9) XP® antibody #4511

Polyclonal SAPK/JNK Antibody #9252 Abcam (Hong Kong), Ltd .

Mouse monoclonal TLR4 antibody

ab22048 Rabbit monoclonal IκBα antibody ab32518 Rabbit polyclonal IL6 antibody ab6672 Rabbit polyclonal IL1 beta antibody ab9722 Novus Biologicals, LLC (Littleton, USA)

Rabbit polyclonal NOX4 Antibody

NB110-58851 Proteintech Group, Inc. (CA, USA)

Mouse monoclonal beta Actin antibody

60008-1-Ig Mouse monoclonal GAPDH antibody 60004-1-Ig Mouse monoclonal GDF10 antibody 66371-1-Ig Rabbit polyclonal NF-κB (p65) antibody 10745-1-AP Rabbit polyclonal peroxiredoxin 2 antibody HRP-goat anti-rabbit IgG (H + L) 00001-1 HRP-goat anti-mouse IgG (H + L) 00001-2 Maixin Biotech. Co. Ltd. (Fuzhou, P. R. China) KIT-5020

HRP, horseradish peroxidase; IgG, immunoglobulin G.

HRP-Polymer anti-Mouse/Rabbit IHC Kit

Highlights

• I/R induces oxidative stress, inflammation and apoptosis in parietal cortex of rats • TLR4 and C5aR1 signaling pathways play a vital role during I/R brain injury in rats • Schisantherin A modulates neuron injury in parietal cortex of rats after I/R • Schisantherin A protects brain impairment by regulating TLR4 and C5aR1 after I/R