SCO4008, a Putative TetR Transcriptional Repressor from Streptomyces coelicolor A3(2), Regulates Transcription of sco4007 by Multidrug Recognition

Article

SCO4008, a Putative TetR Transcriptional Repressor from Streptomyces coelicolor A3(2), Regulates Transcription of sco4007 by Multidrug Recognition Takeshi Hayashi 1, 2 , Yoshikazu Tanaka 3 , Naoki Sakai 3 , Ui Okada 3 , Min Yao 3, 4 , Nobuhisa Watanabe 3, 4 , Tomohiro Tamura 5 and Isao Tanaka 3, 4 1 2 3 4 5

-

Department of Food and Fermentation Science, Faculty of Food and Nutrition, Beppu University, Beppu, Oita 874–8501, Japan Food Science and Nutrition, Graduate School of Food Science and Nutrition, Beppu University, Beppu, Oita 874–8501, Japan Faculty of Advanced Life Science, Hokkaido University, Sapporo 060–0810, Japan Division of Biological Sciences, Graduate School of Science, Hokkaido University, Sapporo 060–0810, Japan Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology, Sapporo 062-8517, Japan

Correspondence to Yoshikazu Tanaka: [email protected] http://dx.doi.org/10.1016/j.jmb.2013.06.013 Edited by M. Guss

Abstract SCO4008 from Streptomyces coelicolor A3(2) is a member of the TetR family. However, its precise function is not yet clear. In this study, the crystal structure of SCO4008 was determined at a resolution of 2.3 Å, and its DNA-binding properties were analyzed. Crystal structure analysis showed that SCO4008 forms an Ω-shaped homodimer in which the monomer is composed of an N-terminal DNA-binding domain containing a helix–turn– helix and a C-terminal dimerization and regulatory domain possessing a ligand-binding cavity. The genomic systematic evolution of ligands by exponential enrichment and electrophoretic mobility shift assay revealed that four SCO4008 dimers bind to the two operator regions located between sco4008 and sco4007, a secondary transporter belonging to the major facilitator superfamily. Ligand screening analysis showed that SCO4008 recognizes a wide range of structurally dissimilar cationic and hydrophobic compounds. These results suggested that SCO4008 is a transcriptional repressor of sco4007 responsible for the multidrug resistance system in S. coelicolor A3(2). © 2013 Elsevier Ltd. All rights reserved.

Introduction Soil actinomycetes of the Streptomyces genus are important for medical and commercial applications, as more than 70% of clinically useful antibiotics and many therapeutic agents, such as antihelminthics and anticancer agents, are produced by Streptomyces species [1]. Streptomyces coelicolor A3(2) is a genetically well understood model strain belonging to the Streptomyces genus. The complete nucleotide sequence of the linear chromosome was determined in 2002 [2], analyses of which indicated that it contains a larger number of genes than simple eukaryotes, for example, Saccharomyces cerevisiae (7825 predicted genes). Notably, the genome contains a remarkable number of transcriptional regulator genes (965 predicted genes). These transcriptional regulators predominantly play important roles in environmental accommodation and/or

controlling the production of antibiotics [3,4]. Thus, detailed knowledge about the transcriptional regulation mechanism of Streptomyces species would be beneficial for generating useful bacterial strains capable of overproducing commercially important compounds and gaining an improved understanding of the prokaryotic transcription system. Bacteria have diverse resistance mechanisms against toxic components, including drugs and antibiotics, which often emerge as major human health issues. One of the most important multidrug resistance mechanisms involves the overexpression of multidrug transporters. These transporters export diverse structurally dissimilar compounds from cells, thus preventing the accumulation of antimicrobials up to toxic levels [5,6]. The genome of S. coelicolor harbors more than 500 putative transporter genes†, possibly reflecting the many stresses in the complex soil environment. Most of these transporter genes

0022-2836/$ - see front matter © 2013 Elsevier Ltd. All rights reserved.

J. Mol. Biol. (2013) 425, 3289–3300

3290 can be divided into two families, that is, the major facilitator superfamily (MFS) [7] and the ATP-binding cassette family [8]. The MFS is known as a uniporter–symporter–antiporter family, which is composed of a large number of membrane-bound transport proteins [9]. These proteins are involved in a wide variety of cellular processes, including uptake of essential ions and/or nutrients, and the export of toxic compounds [8]. Multidrug transporters of MFS generally export compounds with a proton motive force, which is generated by the electrical proton gradient across the membrane. Multidrug transporter gene expression is often regulated by multidrug-binding transcriptional regulators [10]. One of the best-understood multidrug-binding transcriptional regulators is QacR of Staphylococcus aureus, which regulates transcription of the multidrug efflux transporter QacA [11]. QacR belongs to the TetR family of transcriptional repressors [12–14], which is one of the major prokaryotic regulator families [15]. QacR is involved in resistance to monovalent and bivalent cationic lipophilic compounds, such as quaternary ammonium compounds (Qac) [16]. QacR represses the transcription of qacA by binding specifically to an inverted repeat (IR) sequence located on the operator region of the qacA gene [17,18]. When cationic lipophilic drugs are bound at its large drug-binding pocket, QacR dissociates from the operator region, which consequently induces transcription of the qacA gene [19–22]. The sco4008 from S. coelicolor A3(2) encodes a putative TetR family transcriptional repressor. All proteins of this family consist of an N-terminal DNA-binding domain (N-DBD) with a helix–turn– helix (HTH) motif and a C-terminal dimerization and regulatory domain (C-DRD) [12,13]. The C-DRD is constructed from a conserved central triangle by three α-helices, which form the specific binding sites for signaling compounds [13]. In addition, the degree of amino acid sequence similarity of this domain is not high, with an average pairwise sequence identity of only 9% among members of this family [13]. When they recognize the signaling molecules at the ligandbinding sites, the affinity for DNA decreases and the repressors dissociate from the operator sequence of the target gene, resulting in activation of gene transcription [12,13]. An allosteric model was proposed as the mechanism underlying the change in DNA-binding affinity [13,23]. N-DBD in the apo form possesses sufficient flexibility to access the conformation required for DNA binding. However, once the signal molecule has bound, allosteric transition occurs to alter the flexible N-DBD to a much more rigid ligand-bound form in which the DNA-binding helices are held in a non-binding conformation. According to the S. coelicolor A3(2) genome database, the genome contains 122 genes encoding putative TetR family transcriptional regulators [2]. It

Structural and Functional Analysis of SCO4008

has been suggested that these TetR family proteins control genes, the products of which are involved in biosynthesis of antibiotics, multidrug resistance, and coping with stresses. However, the functions of most of them are still unknown. In the present study, we determined the crystal structure of SCO4008 from S. coelicolor A3(2) and analyzed its function. The results of structural analysis and biochemical assays indicated that SCO4008 regulates the expression of a putative multidrug transporter located upstream of sco4008, that is, sco4007, by recognizing a wide range of cationic and hydrophobic compounds. These biochemical characteristics were compared to those of the QacA–QacR system reported previously, and the differences are discussed.

Results Overall structure of SCO4008 The final model contained two SCO4008 protomers, two tartrate molecules, and 154 water molecules. Two SCO4008 protomers showed high structural similarity, with an overall r.m.s.d. of 0.28 for 186 C α atoms with SSM (secondary-structure matching) of three-dimensional alignment of protein structures [24]. Due to poor electron density, the Nterminal six residues (Met1–Pro6) of protomer A and four residues (Met1–Arg4) of protomer B were not modeled. The monomer of SCO4008 was composed of 10 α-helices (α1: Thr9–His24; α2: Ile31–Ala38; α3: Lys42–Tyr49; α4: Lys52–Ser70; α5: Ile78– Ala91; α6: Glu94–Tyr106; α7: Glu114–Glu133; α8: Ala143–Val159; α9: Pro161–Val168; α10: Gly171– Val190) and was divided into two domains, that is, the N-DBD and C-DRD domains. The two protomers of SCO4008 in an asymmetric unit assembled a homodimer with an Ω-shaped structure, which is a structure typical of the TetR family of transcriptional regulators. The C-DRD dominantly contributed to dimer formation through hydrophobic interactions (Fig. 1). Structural similarity search with Dali [25] and SSM [24] showed that the structure of SCO4008 is similar to that of uncharacterized TetR family transcriptional regulators, such as SCO4942 (r.m.s.d.: 1.8 Å for 161 C α atoms), YcdC (2.5 Å for 180 C α atoms), Shew3104 (2.5 Å for 163 C α atoms), Maqu1417 (2.3 Å for 155 C α atoms), and TM1030 (2.3 Å for 165 C α atoms). QacR, a multidrug-binding regulatory protein, showed the highest degree of similarity among the previously characterized proteins. The crystal structure of QacR has been determined in complex with several cationic and lipophilic compounds, and these showed significant structural similarity with SCO4008, that is, in complex with

3291

Structural and Functional Analysis of SCO4008

between α6 and α7 and between α7 and α8. Residues in these two loops (i.e., Thr108, Ala109, Glu114, Thr138, and Ala140) formed polar contacts with the helix bundle of another protomer. Ligand-binding pocket

Fig. 1. (a) Ribbon diagram of a dimeric structure of SCO4008. The N-DBD is blue, and C-DRD is red. The ligand-binding cavities are shown in yellow. This figure and the following structural figures were generated using PyMOL (DeLano Scientific LLC).

ethidium (3.1 Å for 158 C α atoms) [19], malachite green (3.0 Å for 156 C α atoms) [19], proflavine (3.1 Å for 153 C α atoms) [20], diamidine hexamidine (3.1 Å for 157 C α atoms) [21], berberine (3.1 Å for 156 C α atoms) [19], and DB75 (3.1 Å for 160 C α atoms) [22], respectively. N-DBD consists of three helices (α1–α3) and the N-terminal part of α4 (Lys52–Leu60) (Fig. 1). The α2 and α3 form a typical HTH motif. The crystal structures of TetR and QacR in complex with their operator DNA showed that α3 recognizes the target DNA by packing into the major groove [18,26]. The α1 located at the interface between the HTH motif and C-DRD stabilized the orientation between NDBD and C-DRD. Residues well conserved among the TetR family proteins (i.e., Ile13, Phe14, Ala17, and Phe21 of α1; Ile45 of α3; and Leu55 of α4) participated in stabilization between the HTH motif and C-DRD by forming a hydrophobic core [12], as observed for TetR and QacR. C-DRD is composed of six helices (α5–α10) and the C-terminal half of α4 (Fig. 1). It contained the central triangle composed of α5, α6, and α7 conserved in the TetR family [13]. The α6, α7, α8, α9, and α10 were involved in dimer formation. The buried surface area between protomers was calculated as approximately 2300 Å 2. The protomers predominantly interacted through α8, α9, and α10, in which α9 and α10 formed a helix bundle with α8′ of another protomer. At the surface, Phe148, Ala152, Asn155, Trp156, Ala157, Val159, and Ile167 formed hydrophobic contacts. The α6 (Phe100, Trp101, Glu102, and Gly103) and α7 (Glu114 and Ala115) also interacted with the α8′ from another protomer. Additional contacts were provided by the loops

The TetR family proteins commonly have ligandbinding cavities in their regulatory domains [12,13]. Analysis of the crystal structure indicated that SCO4008 also has cavities surrounded by a conserved central triangle composed of α5, α6, and α7 inside the C-DRD. Each protomer possessed a large cavity, which was separated into two distinct regions, that is, upper and lower cavities (Figs. 1 and 2a). The volumes of these cavities were calculated as approximately 924 Å 3 for protomer A and 1137 Å 3 for protomer B. In protomer B, the upper and lower cavities were connected by a narrow tunnel, whereas those of protomer A were separated from each other by the side chains of Met64 and Leu95. Superposition of the C-DRD of SCO4008 with that of QacR indicated that both upper and lower cavities overlapped with the ligand-binding pocket of QacR [19–22]. Thus, both cavities are likely to act as ligand-binding pockets of SCO4008. Indeed, both were exposed to bulk solvent (Fig. 2b). Furthermore, tartrate ions derived from crystallization buffer were captured in the upper cavity of both protomers (Fig. 2a). The tartrate molecules were recognized mainly by polar contacts, in which Lys124 and Asn155 formed hydrogen bonds with tartrate and Met64 and Lys124 interacted via water molecules. Identification of the genomic DNA-binding region of SCO4008 Most TetR family members are transcriptional repressors, and they regulate transcription of the target genes by binding specifically to the operator sites in the genomic DNA. Structural characteristics such as the Ω-shaped dimeric structure and deduced ligand-binding pocket strongly suggest that SCO4008 acts as a transcriptional repressor. To identify the target gene of SCO4008, we carried out a genomic systematic evolution of ligands by exponential enrichment (SELEX) experiment using a genomic library of S. coelicolor A3(2). After three cycles of selection, a DNA fragment that bound specifically with SCO4008 (SELEX fragment) was obtained. The obtained SELEX fragment corresponded to a 167-bp sequence located in the intergenic region between sco4007 and sco4008 (4401494–4401660 of the genome map) (Fig. 3a). Next, an electrophoretic mobility shift assay (EMSA) was performed using the fluorescein isothiocyanate (FITC)-labeled SELEX fragment titrated by increasing amount of SCO4008 (Fig. 3b). With the increase in amount of added protein, four ladder bands of

3292

Structural and Functional Analysis of SCO4008

Fig. 2. (a) Residues forming the ligand-binding cavities of protomers A and B (yellow, carbon; red, oxygen; blue, nitrogen). The ligand-binding cavities are shown in gray. Tartrate ions derived from crystallization buffer are shown in green (carbon) and red (oxygen). The orientation of views is the same as that in Fig. 1. (b) Views of entrances of bulk solvent side. The surfaces representations of promoters are viewed after 45° (a) and − 45° (b) of rotation from Fig. 1. N-DBD is blue and C-DRD is red. The entrances of upper and lower cavities are indicated by yellow and green circles, respectively.

DNA–protein complex appeared (1st, 2nd, 3rd, and 4th DNA–protein complexes in Fig. 3b), suggesting that four dimers of SCO4008 bind specifically to the sco4007–sco4008 intergenic region. Identification of operator sites of SCO4008 Figure 4a shows the DNA sequence of the SELEX fragment. This region contains a putative translational start site and −10 and − 35 promoter elements for sco4007 and sco4008 genes. In addition, three imperfect IR sequences [IR1: 4401558 TTCGAG CGCGCACTAA 4401573 (16 bp); IR2: 4401574CAACT AACTGGTTGGTTG 4401591 (18 bp); IR3: 4401617CAA CCAAATAGTTGGTTA 4401634 (18 bp)] were identified in this region. IR2 and IR3 showed 78% sequence homology. Transcription factors possessing symmetri-

cal dimeric structures generally recognize DNA with a palindromic sequence [15]. Indeed, the TetR family members bind to the IR sequences [12,13]. EMSA was performed using the FITC-labeled synthetic oligonucleotides corresponding to the three IR sequences (Fig. 4b). SCO4008 bound with IR2 and IR3, but not with IR1. As shown in Fig. 3b, four dimers of SCO4008 bound with the sco4007–sco4008 intergenic region. According to previous studies, most TetR family members bind as solo dimers to ~ 15-bp operator sites [12,13], although two QacR dimers bind to a 28-bp operator sequence [18]. The EMSA experiments were performed using extended IR2 (exIR2) and IR3 (exIR3) fragments [exIR2 (28 bp): 4401569ACTAACAACTAACTGGTTGGTTGG AAGT 4401596; exIR3 (28 bp): 4401612TGTGTCAACC

Structural and Functional Analysis of SCO4008

3293

Fig. 3. (a) Schematic representation of the gene structures of sco4007 and sco4008. The DNA region of the SELEX fragment is shown in a gray box. (b) EMSA of SCO4008 with the SELEX fragment. The concentration-dependent binding of SCO4008 is shown with 1 pmol FITC-labeled SELEX fragment, which was prepared by PCR using FITC-labeled primer. EMSA analysis was performed using nondenaturing 5% polyacrylamide gels.

AAATAGTTGGTTACCTCG 4401639]. Each DNA fragment showed two types of DNA–protein complex (1st and 2nd complexes) with titration of SCO4008 (Fig. 4c). To evaluate the specificity of these DNA– SCO4008 interactions, we performed the competition assay (Fig. 4d). SCO4008 was gradually dissociated from the 4th complex with increasing amount of unlabeled exIR2 and exIR3 fragments (Fig. 4d). The exIR2 and exIR3 regions notably overlapped with the predicted RNA polymerase-binding sites (− 10 and − 35 elements) of sco4008 and sco4007, respectively (Fig. 3a). Taken together, it was suggested that SCO4008 regulates transcription of its own gene and the adjacent sco4007 gene by binding specifically to exIR2 and exIR3 sequences (Fig. 4a). Hereafter, they are designated as operator 1 (OP1) and OP2, respectively (Fig. 4a). In Fig. 4c, the 2nd complex of OP1 appeared in the lane of 2.5 pmol SCO4008, but 10 pmol for OP2. Moreover, 5 pmol of OP1 caused the disappearance of the 4th complex to free DNA, although more than 10 pmol was necessary for OP2 (Fig. 4d). These observations indicated that SCO4008 binds to OP1 with higher affinity than OP2. Screening for ligands of SCO4008 by EMSA Recent comparative genomic analyses of transporters showed that SCO4007 would be a secondary transporter belonging to the MFS (TransportDB‡).

The experiments described above showed that SCO4008 is likely to regulate the transcription of sco4007. According to previous studies of transporter– regulator systems, such as QacA–QacR [11,12] and TetA–TetR [12], the regulator protein recognizes low-molecular-weight compounds exported by the transporter as signaling molecules, and ligand binding causes a marked decrease in DNA binding of regulator, which triggers transcription of the transporter gene. In addition to these transporter–regulator systems, SCO4008 is likely to recognize small molecules for transcriptional regulation of sco4007. To identify the signal molecules for SCO4008, we evaluated 20 candidates (Supplementary Fig. S1). As the ligand-binding cavity of SCO4008 is formed by a number of hydrophobic and aromatic residues, as observed for QacR [14,16,17,19–21], it is plausible that SCO4008 recognizes hydrophobic ligand molecules. The affinity of SCO4008 with the SELEX fragment was evaluated by EMSA in the presence of various concentrations of seven cationic hydrophobic compounds, eight anionic hydrophobic compounds, and five antibiotics (Fig. 5 and Table 1). All cationic hydrophobic compounds, except for thiamine, clearly decreased the affinity for the SELEX fragment. In contrast, anionic compounds and antibiotics did not affect the DNA-binding activity of SCO4008, although eriochrome black T did show an effect. Tartrate showed no effect on the DNA-binding

3294

Structural and Functional Analysis of SCO4008

Fig. 4. (a) DNA sequence of the SELEX fragment. The positions of putative − 35 and − 10 elements of sco4007 and sco4008 promoters are labeled. The opposing two arrows indicate the half-site of the IRs. OP1 (exIR2) and OP2 (exIR3) are shown by two thick opposing arrows (IRs) and broken lines (extended sequence of IR). The bent arrow indicates the translational start site of sco4008. (b) EMSA for identification of DNA-binding sites of SCO4008. The synthesized FITC-conjugated oligonucleotide IR1 (16 bp), IR2 (18 bp), and IR3 (18 bp) (all 3 pmol) were incubated with SCO4008 (6 pmol). This and subsequent EMSA analysis using the FITC-conjugated oligonucleotide were performed using nondenaturing 7.5% polyacrylamide gels. (c) EMSA for estimation of DNA-binding ability of SCO4008 with OP1 and OP2 sequences. The concentration-dependent binding of SCO4008 is shown with 2 pmol synthesized FITC-conjugated oligonucleotides of IR2 and IR3 sequences. (d) Competition assays to evaluate the DNA-binding specificity of SCO4008 with OP1 and OP2 sites. Unlabeled OP1 and OP2 oligonucleotides were titrated with the fully formed complex of FITC-label ed SE LEX frag m ent wi th SCO4008. c, 100 pmol of irrelevant DNA fragment including imperfect I R s e q u e n c e ( 5′ - CC TC G G A TAGCGCCACTATCTAAGC-3′) was titrated to the SCO4008–SELEX fragment complex.

Structural and Functional Analysis of SCO4008

3295

Fig. 5. Ligand screening of SCO4008 by EMSA. The SCO4008 (5 pmol) was pre-incubated for 2 min with various components (Supplementary Fig. S1), and then FITC-labeled DNA fragment (0.1 pmol) was added. EMSA analysis was performed using non-denaturing 5% polyacrylamide gels.

activity, although it was captured in the ligand-binding cavity in the crystal structure. These results indicated that the ligands of SCO4008 would be a wide variety of cationic hydrophobic compounds. Among these cationic hydrophilic compounds, ethidium bromide, crystal violet, safranin O, benzalkonium chloride, and cetyltrimethylammonium were also reported as ligands of QacR [11]. These results suggest that SCO4008 may control transcription of sco4007 in a manner similar to QacR.

Discussion The DNA-binding affinity of TetR family transcriptional regulators is allosterically controlled by rigidification of the DNA-binding domain caused by ligand binding [13,23]. As the crystal structure, DNA-binding properties, and ligand-binding properties of SCO4008 were similar to those of QacR, the

allosteric conformational change is expected to be similar to that of QacR. The crystal structure of QacR has been determined in three different forms, that is, DNA-bound form, ligand-bound form, and ligandfree form. Among them, the present structure of SCO4008 showed the most significant similarity with the ligand-free form (DNA-bound form: r.m.s.d., 3.3 Å for 167 C α atoms; ligand-bound form: 3.0– 3.1 Å for 153–159 C α atoms; ligand-free form: 2.6– 2.8 Å for 160–166 C α atoms), although a tartrate molecule was captured in the ligand-binding cavity. This suggests that binding with an appropriate molecule is necessary for rigidification of the N-DBD, which is consistent with the observation that tartrate did not affect the affinity for DNA (Fig. 5 and Table 1). SCO4008 has two distinct cavities, that is, an upper cavity and a lower cavity. In addition, QacR possesses two drug-binding pockets (1st and 2nd drugbinding pockets). Superposition of the C-DRD of

3296

Structural and Functional Analysis of SCO4008

Table 1. The compounds tested for the potential ligands of SCO4008

Compound Cationic compound Ethidium Crystal violet Safranin O Methylene blue Benzalkonium Cetyltrimethylammonium Thiamine Anionic compound New coccine Tartrazine Indigo carmine Brilliant blue FCF Eriochrome black T Fluorescein Salicylic acid Tartrate Antibiotic Gentamicin Kanamycin Tetracycline Ampicillin Chloramphenicol

Class of compound

Maximum concentration tested for the ligand screening (μM)

Reduction of operator DNA-binding activity

Dye Dye Dye Dye Qac Qac Vitamin

0.3 1 3 6 1 1 1000

+ + + + + + −

Food dye Food dye Food dye Food dye Indicator for metal titration Dye Low molecule organic compound Low molecule organic compound

100 100 100 100 6

− − − − +

100 100

− −

1000

−

100

−

300

−

100 1000 100

− − −

Aminoglycoside antibiotic Aminoglycoside antibiotic Polyketide antibiotic β-Lactam antibiotic Chloramphenicol antibiotic

SCO4008 with that of QacR indicated that the upper and lower cavities of SCO4008 correspond to the 1st and 2nd drug-binding pockets of QacR, respectively. The ligand molecules were captured and the cationic charges were recognized by acidic amino acid residues in the 2nd drug-binding pocket in the crystal structures of QacR in complex with ligands [19–22], which induced rigidification of the N-DBD. In contrast, the present structure of SCO4008 was still in the ligand-free form despite capture of tartrate in the upper cavity (1st pocket in QacR). It is possible that occupation of the lower cavity (2nd pocket in QacR) by a signal molecule triggers rigidification. The results of ligand screening (Fig. 5 and Table 1) showed that SCO4008 is a multidrug regulator. The upper cavity may be for a large molecule. Our data showed that SCO4008 preferentially recognizes a range of cationic hydrophobic compounds as ligands (Fig. 5 and Table 1), which is a similar tendency to QacR. QacR recognizes cationic drugs using four acidic residues (i.e., Glu57, Glu58, Glu90, and Glu120), as well as hydrophobic residues located around the cavity [19]. In SCO4008, there are only two acidic residues (Glu61 and Glu66) in the ligand-binding cavity (Supplementary Fig. S2), suggesting that the precise manner of ligand

recognition is different between SCO4008 and QacR. SCO4008 recognizes eriochrome black T as a ligand even though it is an anionic compound (Fig. 5 and Table 1), whereas QacR has not been reported to recognize anionic compounds. The difference in number of acidic residues in the ligand-binding cavity would affect the preference. SCO4008 may be able to recognize an anionic compound if it passes some threshold required for recognition. The high degree of structural similarity of N-DBD of the TetR family members suggests a similar mode of interaction with DNAs. Most members, including TetR [26], bind to their ~ 15-bp IR sequence as a dimer, whereas it was reported for several TetR members such as QacR [18] and CgmR [27] that two dimers bind to the ~ 28-bp long DNA. Based on these crystal structures of TetR members in complex with operator DNA [18,26,27], it was previously proposed that TetR members possessing a highly conserved Tyr residue in the α3 commonly recognize adenine– thymine (A–T) separation pairs of the operator sequence, 5′-A-Xn-T-3′ (n = 7 or 8) [28]. In the revealed structure, SCO4008 had the conserved Tyr46 in the α3, suggesting that SCO4008 also recognizes A–T separation pairs. Furthermore, it has

3297

Structural and Functional Analysis of SCO4008

been shown that the operator region recognized by two dimers possesses two A–T separation pairs [18,27]. Results of EMSA showed that two SCO4008 dimers are bound to each operator site (OP1 and OP2) (Fig. 4c and d), and both OP1 and OP2 contain two A–T patterns (Fig. 6). Taken together, it is plausible that two SCO4008 dimers would recognize two A–T separation pairs in OP1 and OP2 independently, resulting in the binding of four dimers with the SELEX fragment containing OP1 and OP2 (Fig. 3b). For some TetR families, although it was reported that two dimers are bound with the intergenic region [12,13], it is rare for such a large number of dimers to bind at the operator region. To our knowledge, Aur1R, a TetR family transcriptional regulator from Streptomyces aureofaciens [29], is the only example reported to date. However, the DNA-binding manner of Aur1R was different from that of SCO4008. That is, four dimers of Aur1 bound closely in a narrow region (~ 57 bp) of the aur1PR3p promoter and regulated aur1PR3 only. The numbers of operator sites and of the dimers bound there are markedly different between SCO4008 and QacR. That is, four dimers of SCO4008 bind to two operator sites in the sco4007– sco4008 intergenic region, whereas two dimers of QacR bind to a single operator site in the QacA–QacR intergenic region. Notably, Fig. 4c and d shows that SCO4008 binds to OP1 more strongly than OP2, suggesting that SCO4008 may suppress expression of its own gene more strongly than sco4007, a putative multidrug transporter. Taken together, it is likely that gene expression of the sco4007–sco4008 multidrug transporter system is more strictly regulated than the QacA–QacR system. These differences may be due to the habitat of the host bacterium; that, soil actinomycetes require a rigorous multidrug transporter gene regulation system to survive severe stresses in the complex soil environment in contrast to the endogenous bacterium S. aureus. In conclusion, structural and biochemical analyses of SCO4008 are consistent with it repressing the transcription of sco4007 encoding a putative secondary transporter and/or itself. Four SCO4008 dimers bind to the intergenic region of sco4007

and sco4008 and regulate the transcription of these genes by recognizing a range of hydrophobic compounds. The SCO4007–SCO4008 protein pair is likely to be a new member of the QacA–QacR type multidrug transporter system. Additional experiments, such as gene disruption experiments of sco4008 and sco4007 or functional analysis of SCO4007, are necessary in order to gain further understanding of the regulatory role of SCO4008 on the expression of sco4007 and the significance of the differences in gene regulation between SCO4008 and QacR.

Materials and Methods Protein preparation Recombinant SCO4008 was prepared using the Rhodococcus erythropolis expression system [30]. The sco4008 was amplified by polymerase chain reaction (PCR) using S. coelicolor A3(2) genomic DNA as the template and was inserted into the BamHI/XhoI restriction enzyme sites of the pTip-QC2 expression vector [31]. A His-tag was attached to the C-terminus of the target gene. Recombinant proteins were expressed in R. erythropolis strain L-88 [32]. The cells were grown at 303 K in LB medium containing 34 μg ml − 1 chloramphenicol. Thiostrepton was added to a final concentration of 1 μg ml − 1 to induce expression of SCO4008, and the cells were cultured at 303 K for 18 h with shaking. The selenomethionine (Se-Met) derivative was expressed in M9 medium supplemented with 1 mM Se-Met. The cells were harvested by centrifugation at 277 K and 4500g for 10 min, washed with buffer A [50 mM sodium phosphate (pH 8.0) and 300 mM NaCl], and then resuspended in the same buffer. The cells were disrupted by sonication, followed by centrifugation at 20,000g for 30 min at 277 K. The supernatant of the cell extract was loaded onto a Hi-Trap chelating HP column (GE Healthcare, Waukesha, WI) charged with NiSO4 and pre-equilibrated with buffer B [50 mM sodium phosphate (pH 8.0), 300 mM NaCl, and 10 mM imidazole]. SCO4008 was eluted with a linear gradient of 0–100% (v/v) buffer C [50 mM sodium phosphate (pH 8.0), 300 mM NaCl, and 400 mM imidazole]. The fractions containing SCO4008 were desalted with a HiPrep desalting 26/10 column (GE Healthcare) preequilibrated with buffer D [20 mM Tris–HCl (pH 8.0) and 300 mM NaCl] and then applied to a HiLoad 26/60 Superdex 200 prep-grade column (GE Healthcare) preequilibrated with the same buffer. The purification procedure of Se-Met derivative was essentially the same as that of native protein. Crystallization

Fig. 6. Nucleotide sequences of OP1 and OP2. Conserved adenine–thymine separation pairs (5′-A-X8-T3′) are indicated.

SCO4008 was dialyzed overnight at 277 K against 20 mM Tris–HCl (pH 8.0) and then concentrated to 5.0 mg ml − 1 using Amicon Ultra centrifugal filter units (Millipore, Billerica, MA). Crystallization trials were carried out by the sitting-drop vapor diffusion method in 96-well

3298 trays using Crystal Screen kits, PEG (polyethylene glycol)/Ion Screen kits, Index kits (Hampton Research, Aliso Viejo, CA), and Wizard kits (Emerald BioSystems, Bainbridge Island, WA). Initial crystals were grown from a buffer containing 0.2 M di-ammonium tartrate and 20% PEG 3350. Crystals of Se-Met derivative were grown from a buffer containing 420 mM di-ammonium tartrate and 16% PEG 3350 with the hanging-drop vapor diffusion method in which 1.0 μl of protein solution was mixed with 1.0 μl of reservoir solution. The crystals were grown to 0.2 mm × 0.2 mm × 0.2 mm in 1 week at 293 K. Data collection and structure determination Single-wavelength anomalous diffraction data of Se-Met SCO4008 were collected to 2.3 Å resolution using a wavelength of 0.9789 Å at BL44B2 in SPring-8 (Harima, Japan) under cryogenic conditions (100 K). Crystals were mounted after being soaked in crystallization buffer containing 26% (v/v) glycerol. The diffraction data were indexed, integrated, scaled, and merged using the HKL2000 program package [33]. The crystal of Se-Met SCO4008 belongs to the space group P212121 with the cell dimensions a = 44.6 Å, b = 47.3 Å, and c = 190.7 Å. An asymmetric unit contains two SCO4008 protomers. The structure was solved by the single-wavelength anomalous diffraction method using Se as scattering atoms [34]. The program SOLVE/RESOLVE [35,36] was used for phasing and initial model building. Structure refinement was carried out with the program CNS [37] through the automated refinement program LAFIRE [38]. The stereochemical quality of the final refined model was analyzed with the programs PROCHECK [39] and WHATIF [40]. Finally, 374 residues, 2 tartrate molecules, and 154 water molecules were placed in the structure of Se-SCO4008 with crystallographic R and Rfree values of 20.7% and 25.9%, respectively. Crystallographic data and refinement statistics are summarized in Table 2. Genomic systemic evolution of ligands by exponential enrichment (genomic SELEX) Genomic DNA of S. coelicolor A3(2) was digested with HaeIII (Takara Bio Inc., Otsu, Shiga, Japan) and inserted into the EcoRV site of the pBR322 vector (New England Biolabs, Ipswich, MA) using T4 DNA ligase (Takara Bio), followed by transformation into Escherichia coli XL-1 blue (Stratagene, La Jolla, CA). More than 2 × 10 5 clones were collected as a genomic DNA library, which was of sufficient variety to cover the whole genome. The DNA fragment library for genomic SELEX experiments was amplified by PCR using the genomic DNA library prepared above as the template and the following primer set: gSF (5′CTTGGTTATGCCGGTACTGC-3′) and gSR (5′GCGATGCTGTCGGAATGGAC-3′). The DNA library was mixed with Ni 2+-nitrilotriacetic acid resin (Novagen, Madison, WI) pre-adsorbed with 25 μg of purified SCO4008 in binding buffer [20 mM Tris–HCl (pH 8.0), 750 mM NaCl, and 10 mM imidazole]. After incubation for 5 min at room temperature, the mixture was washed with binding buffer, and then the SCO4008–DNA complex was eluted with elution buffer [20 mM Tris–HCl

Structural and Functional Analysis of SCO4008

Table 2. X-ray data collection and refinement statistics Data collection Resolution (Å)a Wavelength (Å) Rsym (%)a,b Completeness (%)a Unique reflections Averaged I/σ(I) Average redundancya Refinement and model quality Resolution range (Å) No. of reflections in working set R-factorc Rfreed Total protein atoms Total ligand atoms Total water atoms Average B-factor (Å2) All Protein Ligand Water r.m.s.d. bond lengths (Å) r.m.s.d. bond angles (°)

50–2.3 (2.38–2.3) 0.9789 6.0 (24.7) 99.0 (95.6) 18,542 15.1 5.6 (4.5) 19.9–2.3 16,873 0.207 0.259 2926 20 154 39.9 39.6 44.4 50.6 0.006 1.1

a The values in parentheses refer to data in the highestresolution shell. b Rsym = ∑h∑i|Ih,i − 〈Ih〉|/∑h∑i|Ih,i|, where 〈Ih〉 is the mean intensity of a set of equivalent reflections. c R-factor = ∑|Fobs − Fcalc|/∑ Fobs, where Fobs and Fcalc are observed and calculated structure factor amplitudes, respectively. d Rfree was calculated for R-factor, with a random 10% subset from all reflections.

(pH 8.0), 500 mM NaCl, and 500 mM imidazole]. The DNA fragments were extracted from the protein–DNA complex by MagExtractor (Toyobo, Osaka, Japan). The extracted DNA fragments were amplified by PCR using the gSF and gSR primers, and the PCR products were used as the DNA pool for the subsequent cycles of selection. This process was repeated three times. Selected DNA fragments were cloned into the pGEM-T Easy Vector (Promega, Madison, WI), and the sequence of the inserted DNA fragment was analyzed using a DNA sequencer (CEQ 2000; Beckman Coulter, Brea, CA). Electrophoretic mobility shift assay FITC-labeled DNA fragments (Hokkaido System Science Co., Ltd, Sapporo, Japan) were mixed with an appropriate amount of purified SCO4008 and 1 μg of poly(dI-dC) × poly(dI-dC) in a total volume of 15 μl of binding buffer [20 mM Tris–HCl (pH 8.0) and 300 mM NaCl]. After incubation for 10 min at 298 K, 5% (v/v) glycerol and 0.005% (w/v) bromophenol blue were added, and the mixture was immediately loaded onto a nondenaturing 5–7.5% acrylamide:bis-acrylamide (37.5:1) gel in 40 mM Tris–HCl (pH 8.0), 20 mM acetic acid, and 1 mM ethylenediaminetetraacetic acid at room temperature. The protein–DNA complexes in the gel were visualized directly with a fluorescence imager (Typhoon Trio +; GE Healthcare). The effects of potential ligands on DNA-binding activity of SCO4008 were evaluated by pre-incubation with various compounds for 2 min prior to adding the FITC-

Structural and Functional Analysis of SCO4008

labeled DNA fragments. After incubation for a further 10 min at room temperature, the sample was loaded onto a polyacrylamide gel as described above. Protein Data Bank accession code The atomic coordinates and structure factors have been deposited in the Protein Data Bank with ID 2d6y. Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.jmb.2013.06.013

Acknowledgements We thank Ms. T. Onodera and K. Hatakeyama for help in protein expression and purification. We also thank the staff of beamline BL44B2, SPring-8, Japan, for their help with data collection. This work was supported by the National Project on Protein Structural and Functional Analyses from the Ministry of Education, Culture, Sports, Science, and Technology, Japan. Received 23 April 2013; Received in revised form 13 June 2013; Accepted 14 June 2013 Available online 2 July 2013 Keywords: TetR family; transcriptional repressor; helix–turn–helix; multidrug binding; genomic SELEX † http://www.sanger.ac.uk/Projects/S_coelicolor/ ‡ http://www.membranetransport.org/ Abbreviations used: HTH, helix–turn–helix; Se-Met, selenomethionine; SELEX, systematic evolution of ligands by exponential enrichment; FITC, fluorescein isothiocyanate; EMSA, electrophoretic mobility shift assay; IR, inverted repeat; N-DBD, N-terminal DNA-binding domain; C-DRD, C-terminal dimerization and regulatory domain; MFS, major facilitator superfamily.

References [1] Challis GL, Hopwood DA. Synergy and contingency as driving forces for the evolution of multiple secondary metabolite production by Streptomyces species. Proc Natl Acad Sci USA 2003;100:14555–61. [2] Bentley SD, Chater KF, Cerdeno-Tarraga AM, Challis GL, Thomson NR, James KD, et al. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 2002;417:141–7. [3] Davies J. Inactivation of antibiotics and the dissemination of resistance genes. Science 1994;264:375–82.

3299 [4] Donadio S, Sosio M, Lancini G. Impact of the first Streptomyces genome sequence on the discovery and production of bioactive substances. Appl Microbiol Biotechnol 2002;60:377–80. [5] Levy SB. Antibiotic resistance: consequences of inaction. Clin Infect Dis 2001;33:S124–9. [6] McKeegan KS, Borges-Walmsley MI, Walmsley AR. The structure and function of drug pumps: an update. Trends Microbiol 2003;11:21–9. [7] Pao SS, Paulsen IT, Saier MH. Major facilitator superfamily. Microbiol Mol Biol Rev 1998;62:1–34. [8] Higgins CF. ABC transporters: from microorganisms to man. Annu Rev Cell Biol 1992;8:67–113. [9] Marger MD, Saier MH. A major superfamily of transmembrane facilitators that catalyse uniporter, symporter and antiporter. Trends Biochem Sci 1993;18:13–20. [10] Schumacher MA, Brennan RG. Structural mechanisms of multidrug recognition and regulation by bacterial multidrug transcription factors. Mol Microbiol 2002;45:885–93. [11] Grkovic S, Brown MH, Roberts NJ, Paulsen IT, Skurray RA. QacR is a repressor protein that regulates expression of the Staphylococcus aureus multidrug efflux pump QacA. J Biol Chem 1998;273:18665–73. [12] Ramos JL, Martinez-Bueno M, Molina-Henares AJ, Teran W, Watanabe K, Zhang X, et al. The TetR family of transcriptional repressors. Microbiol Mol Biol Rev 2005;69: 326–56. [13] Yu Z, Reichheld SE, Savchenko A, Parkinson J, Davidson AR. A comprehensive analysis of structural and sequence conservation in the TetR family transcriptional regulators. J Mol Biol 2010;400:847–64. [14] Schumacher MA, Brennan RG. Deciphering the molecular basis of multidrug recognition: crystal structures of the Staphylococcus aureus multidrug binding transcription regulator QacR. Res Microbiol 2003;154:69–77. [15] Huffman JL, Brennan RG. Prokaryotic transcription regulators: more than just the helix–turn–helix motif. Curr Opin Struct Biol 2002;12:98–106. [16] Grkovic S, Hardie KM, Brown MH, Skurray RA. Interactions of the QacR multidrug-binding protein with structurally diverse ligands: implications for the evolution of the binding pocket. Biochemistry 2003;42:15226–36. [17] Grkovic S, Brown MH, Schumacher MA, Brennan RG, Skurray RA. The staphylococcal QacR multidrug regulator binds a correctly spaced operator as a pair of dimers. J Bacteriol 2001;183:7102–9. [18] Schumacher MA, Miller MC, Grkovic S, Brown MH, Skurray RA, Brennan RG. Structural basis for cooperative DNA binding by two dimers of the multidrug-binding protein QacR. EMBO J 2002;21:1210–8. [19] Schumacher MA, Miller MC, Grkovic S, Brown MH, Skurray RA, Brennan RG. Structural mechanisms of QacR induction and multidrug recognition. Science 2001;294:2158–63. [20] Schumacher MA, Miller MC, Brennan RG. Structural mechanism of the simultaneous binding of two drugs to a multidrug-binding protein. EMBO J 2004;23:2923–30. [21] Murray DS, Schumacher MA, Brennan RG. Crystal structures of QacR-diamidine complexes reveal additional multidrug-binding modes and a novel mechanism of drug charge neutralization. J Biol Chem 2004;279:14365–71. [22] Brooks BE, Piro KM, Brennan RG. Multidrug-binding transcription factor QacR binds the bivalent aromatic diamidines DB75 and DB359 in multiple positions. J Am Chem Soc 2007;129:8389–95.

3300 [23] Reichheld SE, Yu Z, Davidson AR. The induction of folding cooperativity by ligand binding drives the allosteric response of tetracycline repressor. Proc Natl Acad Sci USA 2009;106: 22263–8. [24] Krissinel E, Henrick K. Secondary-structure matching (SSM), a new tool for fast protein structure alignment in three dimensions. Acta Crystallogr Sect D Biol Crystallogr 2004;60:2256–68. [25] Holm L, Sander C. Mapping the protein universe. Science 1996;273:595–603. [26] Orth P, Schnappinger D, Hillen W, Saenger W, Hinrichs W. Structural basis of gene regulation by the tetracycline inducible Tet repressor-operator system. Nat Struct Biol 2000;7:215–9. [27] Itou H, Watanabe N, Yao M, Shirakihara Y, Tanaka I. Crystal structures of the multidrug binding repressor Corynebacterium glutamicum CgmR in complex with inducers and with an operator. J Mol Biol 2010;403:174–84. [28] Okada U, Kondo K, Hayashi T, Watanabe N, Yao M, Tamura T, et al. Structural and functional analysis of the TetR-family transcriptional regulator SCO0332 from Streptomyces coelicolor. Acta Crystallogr Sect D Biol Crystallogr 2008;64: 198–205. [29] Li M, Gu R, Su CC, Routh MD, Harris KC, Jewell ES, et al. Crystal structure of the transcriptional regulator AcrR from Escherichia coli. J Mol Biol 2007;374:591–603. [30] Nakashima N, Tamura T. A novel system for expressing recombinant proteins over a wide temperature range from 4 to 35 °C. Biotechnol Bioeng 2004;86:136–48. [31] Nakashima N, Tamura T. Isolation and characterization of a rolling-cycle-type plasmid from Rhodococcus erythropolis and

Structural and Functional Analysis of SCO4008

[32]

[33]

[34]

[35]

[36] [37]

[38]

[39]

[40]

application of the plasmid to multiple-recombinant-protein expression. Appl Microbiol Biotechnol 2004;70:5557–68. Mitani Y, Meng XY, Kamagata Y, Tamura T. Characterization of LtsA from Rhodococcus erythropolis, an enzyme with glutamine amdotransferase activity. J Bacteriol 2005;187: 2582–91. Otwinowski Z, Minor W. Processing of X-ray diffraction data collected in oscillation mode. Methods Enzymol 1997;276: 307–26. Hendrickson WA. Determination of macromolecular structures from anomalous diffraction of synchrotron radiation. Science 1991;254:51–8. Terwilliger TC, Berendzen J. Evaluation of macromolecular electron-density map quality using the correlation of local r.m.s. density. Acta Crystallogr Sect D Biol Crystallogr 1999;55:1872–7. Terwilliger TC. Maximum-likelihood density modification. Acta Crystallogr Sect D Biol Crystallogr 2000;56:965–72. Brunger AT, Adams PD, Clore GM, DeLano WL, Gros P, Grosse-Kunstleve RW, et al. Crystallography & NMR system: a new software suite for macromolecular structure determination. Acta Crystallogr Sect D Biol Crystallogr 1998;54:905–21. Yao M, Zhou Y, Tanaka I. LAFIRE: software for automating the refinement process of protein-structure analysis. Acta Crystallogr Sect D Biol Crystallogr 2006;62:189–96. Laskowski RA, Macarthur MW, Moss DS, Thornton JM. PROCHECK: a program to check the stereochemical quality of protein structures. J Appl Crystallogr 1993;26:283–91. Vriend G. WHAT IF: a molecular modeling and drug design program. J Mol Graphics 1990;8:52–6.