Screening and genetic diagnosis of haemoglobin disorders

Screening and genetic diagnosis of haemoglobin disorders

Screening and genetic diagnosis of haemoglobin disorders J. M. Old Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, UK

Abstract The inherited haemoglobinopathies are large group of disorders that include the thalassaemias and sickle cell disease. Carrier detection methods must be able to detect a-, b- and db-thalassaemias, HPFH disorders and haemoglobin variants. Carrier diagnosis involves the accurate measurement of MCH, MCV, Hb A2 and Hb F values in combination with an understanding of the haematological characteristics of the different types of thalassaemia genes and their interactions. The majority of the common thalassaemia mutations and abnormal haemoglobins can be identified by PCR-based techniques. The main applications of molecular analysis for carrier diagnosis are: the analysis of a-thalassaemia mutations by gap-PCR to discriminate between heterozygous a-thalassaemia and homozygous a-thalassaemia; the identification of b-thalassaemia mutations for patients requiring prenatal diagnosis and for the prediction of the severity of the clinical phenotype of homozygous b-thalassaemia; to discriminate between db-thalassaemia and HPFH deletions by gap-PCR.
c 2003 Published by Elsevier Science Ltd. KEY WORDS: haemoglobinopathies; thalassaemia; carrier screening; mutation analysis

INTRODUCTION he haemoglobin disorders are a group of autosomal recessive disorders characterised by either the reduced synthesis of one or more normal globin chains (the thalassaemias), the synthesis of a structurally abnormal globin chain (the haemoglobin variants) or in a few cases by both phenotypes (the reduced synthesis of a Hb variant, e.g., Hb E). They are the commonest single-gene disorders known and approximately 1000 different mutant alleles have now been characterised at the molecular level. The mutations are regionally specific with each country having its own unique spectrum of abnormal haemoglobins and thalassaemia mutations. In countries located in malarious regions of the world, a few of the mutations have reached high gene frequencies because of the protection they provide against malaria. Detailed descriptions of these mutations, their gene frequencies and the DNA analysis methodologies used to for their diagnosis have been published in many reviews or books1–3 and will not be presented here. Similarly, comprehensive guidelines for the diagnosis of the haemoglobinopathies in the haematology laboratory have been published4;5 and the methods will not be detailed here. The aim of this article is to outline an empirical approach to the genetic diagnosis of all the haemoglobin disorders based on carrier screening and mutation analysis.

T

STRATEGY FOR GENETIC DIAGNOSIS The key to identifying the globin gene mutations in carriers and affected patients is an understanding of the genotype/ phenotype relationships of the various globin gene mutations and the effects of interaction when several mutations are coinherited. The commonest globin gene disorders and their clinical phenotypes in the homozygous and doubly heterozygous state are listed in Table 1. Often the quickest way to identify the mutations in an affected patient is to study the haematology of the patient’s parents and other family members and to screen them for single mutations. Carrier screening and mutation identific ation also forms one of the cornerstones of any prevention programme for the haemoglobin disorders. The strategy for carrier screening and mutation analysis is based on that fact that although heterozygotes are symptom free, they present specific haematologic characteristics that are useful for their identification.

DETERMINATION OF CARRIER PHENOTYPE The accurate determination of the carrier phenotype is essential for the selection of the appropriate molecular tests to determine the carrier genotype. The basic haematological tests required are the measurement of the mean corpuscular volume (MCV), the mean corpuscular haemoglobin (MCH) value and the quantity of Hb A2 and Hb F. In addition, the haemoglobin pattern needs to be examined, and traditionally, electrophoresis methods have been used for this purpose. However if high performance liquid chromatography (HPLC) is used to quantitate the Hb A2 and Hb F level, it will also detect most of the common, clinically relevant haemoglobin variants, such as Hb S, Hb C, Hb D-Punjab, Hb O-Arab and Hb E at the same time. A simplified flowchart based on the MCH, Hb A2 and Hb F values that can be used for carrier screening and mutation identification is described in Fig. 1. Testing for thalassaemia is usually carried out when the MCH is <27 pg, although in very rare instances individuals may have thalassaemia trait and a normal MCH, either due to a silent b-thalassaemia mutation or the co-inheritance of a- and bthalassaemia. The MCH value is more reliable for thalassaemia diagnosis than the MCV. In samples greater than 24 h old, the red cell indices can be misleading, as the MCV increases by up to 5 fl. Thus evaluation of blood count in old samples should be made with caution. The phenotype of a carrier usually fits one of the following categories for further molecular investigations: Raised Hb A 2 , reduced MCH When the MCH is below 27 pg and the Hb A2 is above 3.5%, a diagnosis of heterozygous b-thalassaemia is made. The majority of b-thalassaemia carriers, either with a b0 or severe bþ type mutation, are characterised by a markedly low MCH (19–23 pg) and an elevated Hb A2 level in the range of 4.0– 6.0%. The latter is the most phenotypic feature of b-thalassaemia trait, although there is also a slightly raised Hb F level (1–3%) in about 30% of cases. However some b-thalassaemia carriers have atypical Hb A2 levels. Some show unusually


c 2003 Published by Elsevier Science Ltd.

Blood Reviews (2003) 17, 43–53

doi:10.1016/S0268-960X(02)00061-9

43

Old Table 1 Phenotypes of thalassaemias, sickle cell disease and various thalassaemia interactions Type

Phenotype

1. Homozygous state a0 -Thalassaemia (–/–) aþ -Thalassaemia (–a/–a) aþ -Thalassaemia ðaT a=aT aÞ b-Thalassaemia: b0 or severe bþ mutation Mild bþ mutation db0 -Thalassemia HPFH Hb Lepore Hb S Hb C Hb D Hb E

Hb Bart’s hydrops fetalis No clinical problems, (same as –/aa) Hb H disease Thalassaemia Major Thalassaemia intermedia Thalassaemia intermedia No clinical problems Variable: intermedia to major Sickle cell disease No clinical problems No clinical problems No clinical problems

2. Compound-heterozygous state a0 -Thal=aþ -thal (–/–a) a0 -Thal=aþ -thal (–/aT a) b0 /severe bþ -thal Mild bþþ =b0 or severe bþ -thal db0 =b0 or severe bþ -thal db0 /mild bþþ -thal db0 /Hb Lepore aaa=b0 or severe bþ -thal Hb Lepore=b0 or severe bþ -thal Hb C/b0 or severe bþ -thal Hb C/mild bþþ -thal Hb D=b0 or severe bþ -thal Hb E/b0 or severe bþ -thal Hb O-Arab/b0 -thal Hb S/b0 or severe bþ -thal Hb S/mild bþþ -thal Hb S/db0 -thal Hb S/Hb C Hb S/Hb D-Punjab Hb S/Hb O-Arab Hb S/HPFH

Hb H disease Severe Hb H disease Thalassaemia major Variable: intermedia to major Variable: intermedia to major Mild thalassaemia intermedia Thalassaemia intermedia Mild thalassaemia intermedia Thalassaemia major Variable: b-thal trait to intermedia No clinical problems No clinical problems Variable: intermedia to major Severe thalassaemia intermedia Sickle cell disease Usually mild sickle cell disease Usually mild sickle cell disease Sickle cell disease, variable severity Sickle cell disease Sickle cell disease Sickle cell trait

high Hb A2 levels of 6.5–9.0% and a variable elevated Hb level of 3–15%. The molecular lesions in such cases are large deletions that remove the 50 promoter region of the b-globin gene.6 If the Hb A2 level lies between 3.5 and 4.0%, it usually indicates the carrier has a mild bþ -thalassaemia mutation. Such mutations include the Mediterranean mutation IVSI-6 T ! C, the Asian Indian mutation CAP + 1 A ! C, and the African mutation Poly A T!C. Note these mutations can also give rise to a Hb A2 slightly below 3.5%, and thus also feature in category 2. Some rare molecular lesions of the b-globin gene produce highly unstable b-chains that precipitate in bone marrow precursors. This results in ineffective erythropoiesis and a clinical phenotype of thalassaemia intermedia with a raised Hb A2 . Because of the precipitation in early red cell precursors, the b-chain variant is usually undetectable in peripheral 44

Blood Reviews (2003) 17, 43–53

DNA Diagnosis


c 2003 Published by Elsevier Science Ltd.

Gap-PCR or S. Blot Gap-PCR or S. Blot Gap-PCR or S. Blot PCR: ASO or ARMS PCR: ASO or ARMS Gap-PCR or S. Blot Gap-PCR or S. Blot Gap-PCR PCR: RE, ASO or ARMS PCR: ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, ASO or ARMS

Gap-PCR or S. Blot Gap-PCR or S. Blot PCR: ASO or ARMS PCR: ASO or ARMS PCR or S. Blot PCR or S. Blot Gap-PCR or S. Blot PCR or S. Blot PCR: Gap, ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, Gap or S. Blot PCR: RE, ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, ASO or ARMS PCR: RE, Gap or S. Blot

blood. These mutations, known as dominant b-thalassaemia alleles, are most commonly found in exon 3.7 Both the MCH and the Hb A2 level of b-thalassaemia carriers may be influenced by other factors. The co-inheritance of a-thalassaemia may result in a carrier having a nearly normal MCH value with a clearly raised Hb A2 level. A high frequency of both a- and b-thalassaemia is found in some countries in the Mediterranean area, the Middle East and the Far East, and therefore the relevant a0 -thalassaemia mutations should always be screened for in b-thalassaemia carriers from these regions. The presence of a d-chain variant will split the Hb A2 into two equal peaks on HPLC, whilst the presence of an a-chain variant will split the Hb A2 into two unequal peaks, the abnormal one being 25% of the normal one. Iron deficiency may reduce the Hb A2 level, although the typically raised values of heterozygous b-thalassaemia are not

Screening and genetic diagnosis of haemoglobin disorders

Fig. 1

usually lowered to below 3.5% unless a very severe anemia is present. However if the mutation is a mild bþ -thalassaemia type that normally gives a Hb A2 between 3.3 and 4.0% (as described above), iron deficiency may produce a falsely low level below 3.5%. Iron deficiency is excluded by the measurement of erythrocyte zinc protoporphyrin or the evaluation of transferrin saturation. Normal Hb A2 , reduced MCH When the MCH is below 27 pg, the Hb A2 is below 3.5% and the Hb F level normal, the diagnosis may be iron deficiency, a-thalassaemia, ðecdbÞ0 -thalassaemia, b- and d-thalassaemia or mild b-thalassaemia trait with a normal Hb A2 . After iron deficiency is excluded, the different thalassaemia determinants leading to this phenotype are identified by a-, d- and bglobin gene mutation analyses. Carriers of a0 -thalassaemia usually have a MCH below 25 pg unless they also have b-thalassaemia trait. However individuals with homozygous aþ -thalassaemia also have a MCH below 25 pg and the different forms of a-thalassaemia can only be differentiated reliably by gene analysis. Individuals with a0 -thalassaemia trait may have a few red cells with Hb H inclusions but their absence does not exclude this genotype. The detection of Hb H by electrophoresis or HPLC indicates Hb H disease, usually resulting from the combination of a0 -thalassaemia trait and aþ -thalassaemia trait. ðecdbÞ0 -Thalassaemia trait is a very rare condition described in just a few families. Newborns heterozygous for this condition are severely anemic but improve after 3 months and adults have a mild anemia with reduced MCH and MCV levels, a normal Hb F and a normal Hb A2 value. d-Tha-

lassaemia has mainly been described in individuals from Mediterranean countries and its co-inheritance with b-thalassaemia trait reduces the Hb A2 value to below 3.5%. There is no PCR test currently available for any of the ðecdbÞ0 -thalassaemia deletion mutations. A number of heterozygotes for b-thalassaemia that are carriers of a mild bþ -thalassaemia mutation may have reduced MCV and MCH values with a normal or slightly raised Hb A2 level ranging from 3.4 to 3.8%. The most common such mutations are the Asian Indian mutation CAP + 1 (A ! C) and the Mediterranean mutation IVS1-6 (T ! C).

Normal Hb A2 , reduced MCH and raised Hb F In rare instances where a low MCH and normal (or reduced) Hb A2 level is observed in combination with an raised Hb F level of 2–30%, db-thalassaemia trait or HPFH should be suspected. It is important to differentiate db-thalassaemia from hereditary persistence of foetal haemoglobin (HPFH) for genetic counselling because compound heterozygotes for HPFH and b-thalassaemia have a silent or very mild phenotype in contrast to the combination of db-thalassaemia and b thalassaemia which may result in b-thalassaemia major. Although HPFH is associated with normal red cell indices, individuals with HPFH trait may also have a-thalassaemia and thus the MCH is not a reliable parameter for the differentiation between HPFH and db-thalassaemia. The distinction may be made haematologically by analysing the red blood cell distribution of Hb F. Hb F is usually heterogeneously distributed in db-thalassaemia trait in contrast to HPFH trait in which it is homogenously distributed. However a definitive


c 2003 Published by Elsevier Science Ltd.

Blood Reviews (2003) 17, 43–53

45

Old diagnosis can only be made by identification of the deletion mutation by DNA analysis. Normal Hb A 2 , normal MCH This is the phenotype of a silent b-thalassaemia allele, such as the Mediterranean mutation-101 (C ! T)8 and also of the triplicated a-gene allele. Silent b-thalassaemia mutations are associated with Hb A2 levels below 3.5% and a minimal deficiency of b-globin production, resulting in an extremely mild b-thalassaemia phenotype. They are very uncommon and result in the condition of mild thalassaemia intermedia in the homozygous state or in combination with a severe bþ or b0 -thalassaemia mutation. Carriers may escape identification in population screening, and identification is usually retrospective, by analysis of parent(s) of patients with mild thalassaemia intermedia. Abnormal haemoglobins The most common clinically relevant abnormal haemoglobins (Hb S, C, D-Punjab, O-Arab and E) can all be characterised by haemoglobin electrophoresis or HPLC. The electrophoresis method usually performed is cellulose acetate electrophoresis at alkaline pH. However alternative methods may be used, such as isoelectric focussing (IEF). Although not the cheapest method, IEF offers the best resolution identification of abnormal haemoglobins by haemoglobin electrophoresis. HPLC is accurate, fast and quantitates the variant, providing an elution time for variant identification. However it must be pointed out that a specific elution time at HPLC or specific band position at electrophoresis does not give a precise identification of the variant. This can only be achieved by more complex methods such as DNA analysis (sequencing, restriction enzyme analysis, dot blotting or ARMS-PCR) or amino acid analysis (mass spectrometry). The only exception is Hb S and analogous variants (Hb C Harlem, S Antilles, S Oman, S Providence, S Travis and C Ziquinchor) that can be identified more simply by the sickling test. Note that the Hb A2 level in Hb AS individuals is often slightly raised above the normal level (3.5–4.0%), but this never signifies the presence of a co-inherited b-thalassaemia gene unless the amount of Hb S is greater than 50%. When this is the case, the genotype may be Hb S/b-thalassaemia, Hb S/db -thalassaemia, Hb S/HPFH or Hb SS. DNA studies and/or haematological analysis of the patient’s parents are required to identify the correct genotype. Some b-chain variants, e.g., Hb S and Hb E, are subject to a reduced expression in heterozygotes with co-inherited a-thalassaemia. For sickle cell trait, normal individuals have 35–40% Hb S, those with aþ -thalassaemia trait have 29–34% and those with homozygous aþ -thalassaemia have 24–28%.

DETERMINATION OF GENOTYPE A variety of techniques based on the amplification of DNA by the polymerase chain reaction (PCR) have been developed to identify the globin gene mutations. These techniques include dot-blot analysis, reverse dot-blot analysis, the amplification refractory mutation system (ARMS), denaturing gradient gel 46

Blood Reviews (2003) 17, 43–53


c 2003 Published by Elsevier Science Ltd.

electrophoresis, mutagenically separated PCR, gap-PCR and restriction endonuclease analysis. Each method has its own advantages and disadvantages and all are recommended for use in best practice guidelines.9 The particular ones chosen by a laboratory depends not only on the technical expertise available in the diagnostic laboratory but also on the type and variety of the mutations likely to be encountered in the individuals being screened. b-Thalassaemia More than 170 different b-thalassaemia have now been characterised, the majority of which are point mutations or deletions/insertions of just one or two nucleotides.10 An updated list can be accessed on the internet at http:// www.globin.cse.psu.edu/. These are diagnosed in most laboratories by two main PCR-based approaches: allele-specific oligonucleotide hybridisation or allele-specific priming. The small number of large deletion mutations may be diagnosed by gap-PCR. All of the mutations are regionally specific and the spectrum of mutations has now been determined for most at risk populations.2 The strategy for identifying b-thalassaemia mutations is usually based on the knowledge of the common and rare mutations in the ethnic group of the individual being screened. Most populations have been found to have just a few of the common mutations together with a larger and more variable number of rare ones. The common mutations (alleles at a relative gene frequency of greater than 1%) are listed in Table 2. Usually the common ones are analysed first using a PCR technique that allows the detection of multiple mutations simultaneously. This approach will identify the mutation in more than 90% of cases. If the mutation remains unidentified, a further screening for the possible rare mutation will identify the defect in most cases. Mutations remaining unknown after the screen for rare mutations are characterised by direct DNA sequence analysis. Before sequencing, some laboratories localise of the site of the mutation by the application of a nonspecific detection method such as denaturing gradient gel electrophoresis (DGGE).11 However using the latest capillarybased sequencers, the whole b-globin gene may be sequenced directly in just three sequencing runs, eliminating the need for DGGE.12 Allele-specific oligonucleotide hybridisation Mutation detection by the hybridisation of allele-specific oligonucleotide probes (ASO’s) was the first PCR method to be developed. For mutation screening, a panel of ASO probes is required that will detect mutations found in the ethnic group of the individual being screened. For genotyping homozygous patients and for prenatal diagnosis, two oligonucleotide probes are required for each mutation, one complimentary to the mutant DNA sequence and the other complimentary to the normal b-gene sequence at the same position. Usually the two probes differ in sequence by only one nucleotide. The genotype of the DNA sample is determined by analysis of the presence or absence of the hybridisation signal of both the mutation specific and normal probe. The dot-blotting approach requires the amplified target DNA to be fixed to a nylon membrane. The filter-bound DNA dot is then hybridised to ASO probes that are 50 end-labelled

Screening and genetic diagnosis of haemoglobin disorders Table 2 The distribution of the common b-thalassaemia mutations expressed as percentage gene frequencies of the total number of thalassaemia chromosomes studied Mutation

Mediterranean Italy

)88 (C ! T) )87 (C ! G) )30 (T ! A) )29 (A ! G) )28 (A ! G) CAP + 1 (A ! C) CD5 (–CT) CD6 (–A) CD8 (–AA) CD8/9 (+G) CD15 (G ! A) CD16 (–C) CD17 (A ! T) CD24 (T ! A) CD30 (G ! A) CD30 (G ! C) CD39 (C ! T) CD41/42 (–TCTT) CD71/72 (+A) IVSI-1 (G ! A) IVSI-1 (G ! T) IVSI-5 (G ! C) IVSI-6 (T ! C) IVSI-110 (G ! A) IVSII-1 (G ! A) IVSII-654 (C ! T) IVSII-745 (C ! G) Six hundred and ninety bp deletion Others

Greece

Indian Turkey

Pakistan

Chinese India

China

African

Thailand

0.8 0.4

1.8

African– American 21.4

1.2 2.5 1.9 11.6

60.3 4.9

1.7 1.2 0.4

0.8 2.9 0.6

0.6 7.4 28.9 3.5 1.3

12.0 0.8 1.7

0.8 10.5

24.5 7.9

40.1

4.3

17.4

13.6

7.9

13.7

8.2 26.4

6.6 48.5

38.6 12.4

46.4 2.3

2.5

4.9

15.7

8.9

6.8

7.9

2.5

7.4 43.7 2.1

17.4 41.9 9.7

3.5

7.1

2.7

2.2

0.9

3.5

16.3 29.8 1.1

4.1

0.9 3.5

9.7

23.3

13.3

0.5

0.9

10.6

CD, codon; IVS, intervening sequence; bp, base pairs.

with either 32 P-labelled deoxynucleoside triphosphates, biotin or horseradish peroxidase. The technique has been applied in many laboratories with great success, especially for populations with just one common mutation and a small number of rare ones, such as the one in Sardinia.13 However when screening for a large number of different mutations the method becomes time consuming because of the need for separate hybridisation and washing steps for each mutation. The reverse dot-blotting technique was developed to allow multiple mutations to be tested for in one hybridisation reaction and the method is more suitable for the use of a nonisotopic labelling.14 In this method, unlabelled ASO probes complementary to the mutant and normal DNA sequences are fixed to a nylon membrane strips in the form of dots or slots and labelled amplified genomic DNA is then hybridised to the filter using a two-step procedure with one nylon strip for the common mutations and a second one for the rare mutations. It has described for diagnosis of Mediterranean,15 African–American16 and Thai b-thalassaemia mutations.17

Allele-specific priming methods These methods are based on the principle that a perfectly matched PCR primer is much more efficient in directing primer extension than a mismatched one. The mostly widely used technique is the amplification refractory mutation system (ARMS).18 In this method, the target genomic DNA is amplified using a common primer and an allele-specific primer complimentary to the targeted mutation (the mutant primer). The mutant primer mismatches with the normal sequence at the 30 terminal base and also has a second mismatch engineered at the second, third or fourth nucleotide to ensure it will not amplify normal DNA. As with the ASO approach, a panel of mutant-specific primers is required for mutation screening. Table 3 lists the ARMS primers developed in my laboratory for the detection of the common mutations. For genotyping homozygous patients and for prenatal diagnosis, an ARMS primer complimentary to the normal sequence at the mutation site being screened for is required in a separate reaction. The normal primer also has


c 2003 Published by Elsevier Science Ltd.

Blood Reviews (2003) 17, 43–53

47

Old Table 3 Primer sequences used for the detection of the common b-thalassaemia mutations by the allele-specific priming technique Mutation )88 (C ! T) )87 (C ! G) )30 (T ! A) )29 (A ! G) )28 (A ! G) CAP + 1 (A ! G) CD5 ()CT) CD6 ()A) CD8 ()AA) CD8/9 (+G) CD15 (G ! A) CD16 ()C) CD17 (A ! T) CD24 (T ! A) CD30 (G ! A) CD30 (G ! C) CD39 (C ! T) CD41/42 ()TCTT) CD71-72 (+A) IVSI-1 (G ! A) IVSI-1 (G ! T) IVSI-5 (G ! C) IVSI-6 (T ! C) IVSI-110 (G ! A) IVSII-1 (G ! A) IVSII-654 (C( ! T) IVSII-745 (C ! G) bS CD6 (A ! T) bC CD6 (G ! A) bE CD26 (G ! A)

Oligonucleotide sequence

Second primer

TCACTTAGACCTCACCCTGTGGAGCCTCAT CACTTAGACCTCACCCTGTGGAGCCACCCG GCAGGGAGGGCAGGAGCCAGGGCTGGGGAA CAGGGAGGGCAGGAGCCAGGGCTGGGTATG AGGGAGGGCAGGAGCCAGGGCTGGGCTTAG ATAAGTCAGGGCAGAGCCATCTATTGGTTC TCAAACAGACACCATGGTGCACCTGAGTCG CCCACAGGGCAGTAACGGCAGACTTCTGCC ACACCATGGTGCACCTGACTCCTGAGCAGG CCTTGCCCCACAGGGCAGTAACGGCACACC TGAGGAGAAGTCTGCCGTTACTGCCCAGTA TCACCACCAACTTCATCCACGTTCACGTTC CTCACCACCAACTTCAGCCACGTTCAGCTA CTTGATACCAACCTGCCCAGGGCCTCTCCT TAAACGTGTCTTGTAACCTTGATACCTACT TAAACCTGTCTTGTAACCTTGATACCTACG CAGATCCCCAAAGGACTCAAAGAACCTGTA GAGTGGACAGATCCCCAAAGGACTCAACCT CATGGCAAGAAAGTGCTCGGTGCCTTTAAG TTAAACCTGTCTTGTAACCTTGATACCGAT TTAAACCTGTCTTGTAACCTTGATACCGAAA CTCCTTAAACCTGTCTTGTAACCTTGTTAG TCTCCTTAAACCTGTCTTGTAACCTTCATG ACCAGCAGCCTAAGGGTGGGAAAATAGAGT AAGAAAACATCAAGGGTCCCATAGACTGAT GAATAACAGTGATAATTTCTGGGTTAACGT* TCATATTGCTAATAGCAGCTACAATCGAGG* CCCACAGGGCAGTAACGGCAGACTTCTGCA CCACAGGGCAGTAACGGCAGACTTCTCGTT TAACCTTGATACCAACCTGCCCAGGGCGTT

A A A A A A A B A B A B B B B B B B C B B B B B B D D B B B

Product size (bp) 684 683 626 625 624 597 528 207 520 225 500 238 239 262 280 280 436 439 241 281 281 285 286 419 634 829 738 207 206 236

The above primers are coupled as indicated with primers A, B, C or D. A: CCCCTTCCTATGACATGAACTTAA; B: ACCTCACCCTGTGGAGCCAC; C: TTCGTCTGTTTCCCATTCTAAACT; or D: GAGTCAAGGCTGAGAGATGCAGGA. The control primers used for all the above mutation-specific ARMS primers except the two marked * are primers D plus E: CAATGTATCATGCCTCTTTGCACC. For IVSII-654 (C ! T) and IVSII-745 (C ! G), the Gc-HindIII RFLP primers (Forward: AGTGCTGCAAGAAGAACAACTACC; Reverse: CTCTGCATCATGGGCAGTGAGCTC) are used as control primers.

an additional mismatch to ensure specificity. An ARMS reaction also contains two extra primers complimentary to a different part of the b-globin gene are included in the PCR to provide an internal control. The method provides a quick and inexpensive screening method without need for labelled primers. More than one mutation may be screened for at the same time in a single PCR (multiplexing) provided the ARMS primers are coupled with the same common primer.19 Fluorescent labelling of the common primer allows the sizing of the amplification products on an automated DNA fragment analyser.19 If the normal and mutant ARMS primers for a specific mutation are co-amplified in the same reaction they compete with each other to amplify the target sequence. This technique, called competitive oligonucleotide priming, requires the two ARMS primers to be distinguishable in some manner. Fluorescent labels permit a diagnosis to be made by means of a colour complementation assay.20 However the simplest way is to use ARMS primers that differ in length and thus a 48

Blood Reviews (2003) 17, 43–53


c 2003 Published by Elsevier Science Ltd.

diagnosis can be made by analysis of the two product sizes. This technique, called mutagenetically separated polymerase chain reaction (MS-PCR), has been applied to the prenatal diagnosis of b-thalassaemia in Taiwan.21 Restriction enzyme analysis of amplified product This is a useful but limited technique because only approximately 40 b-thalassaemia mutations create or abolish a restriction endonuclease site (Table 4). The majority of these can be detected quickly by restriction endonuclease analysis of amplified DNA. The presence or absence of the enzyme recognition site is determined from the pattern of the digested fragments after agarose or polyacrylamide gel electrophoresis. Mutations that do not naturally create or abolish restriction sites may be diagnosed by the technique of amplification created restriction sites (ACRS). This method uses primers that are designed to insert new bases into the amplified product in order to create a restriction enzyme recognition site adjacent to the mutation sequence. This

Screening and genetic diagnosis of haemoglobin disorders Table 4 b-Thalassaemia mutations detectable by restriction enzyme digestion of amplified product Position )88 )87 )87 )87 )86 )86 )29 +43 to +40 Initiation CD Initiation CD Initiation CD CD5 CD6 CD15 CD17 CD26 CD26 CD27 CD29 CD30 CD30 IVSI-1 IVSI-1 IVSI-2 IVSI-2 IVSI-2 IVSI-5 IVSI-6 IVSI-116 IVSI-130 IVSI-130 CD35 CD37 CD38/39 CD37/8/9 CD39 CD43 CD47 CD61 CD74/75 CD121 IVSII-I IVSII-4,5 IVSII-745

Mutation C!T C!G C!T C!A C!G C!A A!G ()AAAC) T!C T!G A!G ()CT) ()A) ()T) A!T G!T G!A G!T C!T G!C G!A G!A G!T T!G T!C T!A G!A T!C T!G G!C G!A C!A G!A ()C) ()GACCCAG) C!T G!T (+A) A!T ()C) G!T G!A ()AG) C!G

technique has been applied to the detection of Mediterranean b-thalassaemia mutations.22 Gap-PCR The technique of gap-PCR is used to detect b-globin gene deletion mutations. Primers complimentary to the breakpoint sequences amplify a deletion-specific fragment the spans the deletion.23 For large deletions, the distance between the two primers is too great to amplify normal DNA and the normal allele may be detected by amplifying between sequences

Ethnic group African/Asian Indian Mediterranean Italian African/Yugoslavian Lebanese Italian African/Chinese Chinese Yugoslavian Chinese Japanese Mediterranean Mediterranean Asian Indian Chinese Thai Southeast Asian (Hb E) Mediterranean (Hb Knossos) Lebanese Tunisian/African Bulgarian Mediterranean Asian Indian/Chinese Tunisian African Algerian Mediterranean Mediterranean Mediterranean Turkish Egyptian Thai Saudi Arabian Czechoslovakian Turkish Mediterranean Chinese Surinamese African Turkish Polish, French, Japanese Mediterranean Portuguese Mediterranean

Affected site +FokI )AvrII )AvrII )AvrII )AvrII )AvrII +NlaIII +DdeI )NcoI )NcoI )NcoI )DdeI )DdeI +BglI +MaeI )MnlI )MnlI )Sau96I )BspMI )BspMI )BspMI )BspMI )BspMI )BspMI )BspMI )BspMI +EcoRV +Sfa NI +MaeI )DdeI )DdeI )AccI )AvaII )AvaII )AvaII +MaeI )HinfI )XhoI )HphI )HaeIII )EcoRI )HphI )HphI +RsaI

spanning one of the breakpoints.24 Eight b-thalassaemia deletions, ranging in size from 290 bp to 45 kb, can be diagnosed by gap-PCR, as listed in Table 2. PCR methods for unknown mutations A number of techniques have been applied for the detection of b-thalassaemia mutations without prior knowledge of the molecular defect. The most widely used of these methods is denaturing gradient gel electrophoresis (DGGE) which allows the separation of DNA fragments differing by a single


c 2003 Published by Elsevier Science Ltd.

Blood Reviews (2003) 17, 43–53

49

Old base change according to their melting properties.11 Another approach is by heteroduplex analysis using non-denaturing gel electrophoresis.25 These techniques create a unique heteroduplex pattern for each mutation that can be used diagnostically to identify known mutations. However care is needed because of the additional presence of a b-globin gene framework polymorphism in the targeted fragment alters the heteroduplex pattern. DGGE is also used to localise the site of an unknown mutation to a particular region of the b-globin gene before identification by DNA sequencing. Sequencing can now be done very efficiently using an automated DNA sequencing machine utilising fluorescence detection technology. This technology allows the b-globin gene to be sequenced directly using just three amplified fragments and thus direct DNA sequencing will probably become the primary method of mutation detection in the future. db-Thalassaemia, Hb lepore and HPFH Gap-PCR is used to diagnose the db-thalassaemia, Hb Lepore and the HPFH deletion mutations. However it can only be used for the deletions in which both breakpoint DNA sequences have been characterised.26 These are six db-thalassaemia deletions (the Spanish, Sicilian, Vietnamese and Chinese deletions, and the Turkish and Indian inversion/ deletion mutations), the Hb Lepore deletion and three HPFH deletions (the African HPFH1 and 2 deletions, and the Indian

HPFH3 deletion), as listed in Table 5. The other db-thalassaemia and HPFH deletions can only be diagnosed by Southern blotting techniques at the moment. a-Thalassaemia a-Thalassaemia results from mutations affecting either one or both a-globin genes (aþ -thalassaemia or a0 -thalassaemia respectively).10 The majority of the mutations are gene deletions but a small number of point mutations within one of the two a-globin genes resulting in aþ -thalassaemia have been described and probably many more await discovery. The deletion breakpoints of seven deletions have been sequenced and these alleles can now be diagnosed by gap-PCR (Table 5). The seven deletions include the mutations that are the most common causes of aþ -thalassaemia and a0 -thalassaemia. The remainder of the deletion alleles are diagnosed by Southern blot analysis. a0 -Thalassaemia is found in patients of Mediterranean or Southeast Asian in origin. Although one or two mutations have been described in patients of Asian Indian or African origin, it is extremely uncommon and patients with the phenotype of a0 -thalassaemia trait usually have the genotype of homozygous aþ -thalassaemia. aþ -Thalassaemia can reach high gene frequencies in parts of Africa and Asia, with the a3:7 deletion being the predominant mutation in African, Mediterranean and Asian individuals and the a4:2 being more

Table 5 Globin gene deletion mutations which may be diagnosed by gap-PCR Disorder

Distribution

Reference

–SEA –MED ðaÞ20:5 –FIL –THAI

Southeast Asia Mediterranean Mediterranean Phillipines Thailand

38

a3:7 a4:2

Worldwide Worldwide

27

290 bp deletion 532 bp deletion 619 bp deletion 1393 bp deletion 1605 bp deletion 3.5 kb deletion 10.3 kb deletion 45 kb deletion

Turkey, Bulgaria African India, Pakistan African Croatia Thailand India Phillipines, Malaysia

23

Hb Lepore

Hb Lepore

Mediterranean, Brazil

26

ðdbÞ0 -Thalassaemia

Spanish Sicilian Vietnamese Macedonian/Turkish

Spain Mediterranean Vietnam Macedonia, Turkey

26

Indian Chinese

India, Bangladesh, Kuwait Southern China

26

HPFH1 HPFH2 HPFH3

Africa Ghana, Africa India

26

a0 -Thalassaemia

aþ -Thalassaemia b0 -Thalassaemia

ðA cdbÞ0 -Thalassaemia

HPFH

50

Blood Reviews (2003) 17, 43–53

Mutation


c 2003 Published by Elsevier Science Ltd.

38 38 30 31

27

39 18 12 10 40 41 24

26 26 26

26

26 26

Screening and genetic diagnosis of haemoglobin disorders common in Southeast Asian and the Pacific islands populations.2 The strategy for screening is based on ethnic origin of the individual, although PCR now makes it easy to screen for all the common deletion mutations in any individual. Gap-PCR Gap-PCR is used to diagnose the two common aþ -thalassaemia deletion genes, the a3:7 and a4:2 alleles, and five a0 thalassaemia deletion genes, the three Southeast Asian deletions (–SEA; –THAI and –FIL ) and two Mediterranean deletions (–MED and ðaÞ20:5 ).27–32 Although gap-PCR works extremely well for the amplification of deletions in the b-globin gene cluster, the amplification of deletions in the a-globin gene cluster has proved to be more difficult, possibly due to the high GC content of the a-globin gene cluster sequence. The first primer pairs to be developed were unreliable, resulting occasionally in unpredictable amplification failure due to allele drop out. However the recently published multiplex primers31;32 have been found to be more robust and give more reproducible results, with the addition of betaine to the reaction mixture and the use of ‘hot start’ amplification being a key feature of their success. The gap-PCR primers for a0 -thalassaemia deletions can be multiplexed to target the Mediterranean and Southeast Asian mutations in two separate reactions. In carriers where the ethnic group is not known or different, screening for both sets of mutations is recommended. Similarly the primers for a3:7 and a4:2 aþ -thalassaemia alleles can be multiplexed and thus it is recommended to screen every individual for both alleles routinely Southern blot analysis Southern blotting must be used to diagnose all the other a0 and aþ -thalassaemia deletion mutations.1;33 This approach also detects a-gene rearrangements (the triple and quadruple a-gene alleles). A combination of BamHI and BglII digestions hybridised to an a- and f-globin gene is used for the diagnosis the British a0 -thalassaemia deletion, ð–BRIT Þ, and the Asian Indian a0 -thalassaemia deletion, ð–SA Þ. The technique is also useful a second approach for confirmation of prenatal diagnosis results initially derived by gap-PCR. aþ -Thalassaemia point mutations The non-deletion aþ -thalassaemia mutations can be identified by PCR techniques allowing the selective amplification of the a-globin genes.32 Several of the non-deletion aþ -thalassaemia mutations create or destroy a restriction enzyme site and may be analysed for by restriction enzyme digestion of the amplified product. For example, Hb Constant Spring mutation can be diagnosed by MseI digestion.34 In theory any of the techniques used for the diagnosis of b-thalassaemia point mutations may be used for the diagnosis of the non-deletion aþ -thalassaemia mutations. However no simple strategy to diagnose all the known mutations has been developed. The only published approach to date is a complex strategy involving the combined application of the indirect detection methods of denaturing gradient gel electrophoresis (DGGE) and single strand conformation analysis (SSCA), followed by direct DNA sequencing.35

Abnormal haemoglobins More than 700 haemoglobin variants have been described to date36 (an updated list can be accessed on the internet at http://www.globin.cse.psu.edu/), of which the clinically most important ones requiring routine diagnosis by DNA analysis methods are Hb S, Hb C, Hb E , Hb D-Punjab and Hb O-Arab. The techniques used for the molecular diagnosis of these are described below. The majority of the other abnormal variants are not clinically important and are usually given a probable identity based on their electrophoretic position or HPLC retention time. However some many have the same electrophoretic positions or retention times and the only definitive means of identification is by DNA sequencing or mass spectroscopy. Hb S The Hb S mutation, CD6 (A ! T) destroys the recognition site of the restriction enzyme DdeI at codon 6. Diagnosis of the mutation by DdeI digestion of amplified globin gene fragment is the method of choice.33 This test also gives a positive signal for the two b-thalassaemia mutations CD6 (–C) and CD5 (–CT). Thus care must be taken when analysing the genotypes of patients with possible Hb S=b-thalassaemia. Care is also required in analysing patients with possible Hb S/HPFH or Hb S/db-thalassaemia phenotypes as they appear to have a Hb SS genotype by DdeI analysis. A family study of the parental phyenotypes is usually essential before investigation of gentypes of patients with sickle cell disease. Other PCR-based techniques such as dot blotting or ARMS are also used for confirmation of the Hb S mutation in carriers. Hb C The Hb C mutation, CD6 (G ! A), unfortunately does not destroy the DdeI site at codon 6. Thus ARMS or Aso dot blotting must be used to detect the Hb C mutation.33 Hb D-Punjab and Hb O-Arab The Hb D-Punjab mutation, CD121 (G ! C), and the Hb OArab mutation, CD121 (G ! A), destroy an EcoRI site at codon 121. Diagnosis is carried by EcoRI digestion of amplified globin gene fragment.33 This does not distinguish between the two variants and the result must be combined with HPLC or electrophoresis data to identify each variant in carriers. Hb E The Hb E mutation, CD26 (G ! A), abolishes an MnlI site and may be diagnosed by PCR amplification and restriction enzyme analysis of the product.37 However the digestion products are quite small in size due to nearby MnlI sites and the Hb E mutation is better diagnosed by the use of ASO probes or ARMS primers.

Correspondence to: Dr. J.M. Old, National Haemoglobinopathy Reference Laboratory, Oxford Haemophilia Centre, The Churchill Hospital, Oxford OX3 7LJ, UK. Tel.: +44(0)1865 225329; E-mail: [email protected].


c 2003 Published by Elsevier Science Ltd.

Blood Reviews (2003) 17, 43–53

51

Old References 1. Weatherall DJ, Clegg JB. The thalassaemia syndrome. Oxford: Blackwell Scientific; 2001. 2. Flint J, Harding RM, Boyce AJ et al. The population genetics of the haemoglobinopoathies. In: Rodgers GP, ed. Sickle cell disease and thalassaemia, vol. 11. London: Bailliere Tindall; 1998: 1. 3. Tuzmen S, Schecter AN. Genetics diseases of hemogloibn: diagnostic methods for elucidating b-thalassaemia mutations. Blood Rev 2001; 15: 19. 4. The Thalassaemia Working Party of the BCSH General Haematology Task Force: Guidelines for the investigation of the a- and b-thalassaemia traits. J Clin Pathol 1994; 47: 289. 5. The Thalassaemia Working Party of the BCSH General Haematology Task Force: Guidelines for the Laboratory Diagnosis of Haemoglobinopathies. Brit J Haemat 1998; 101: 783. 6. Thein SL. b-Thalassaemia, (eds): Baillieres clinical haematology, vol 11. 1998, p. 91. 7. Thein SL, Hesketh C, Taylor P, Temperley IJ, Hutchinson RM, Old JM, Wood WG, Clegg JB, Weatherall DJ. Molecular basis for dominantly inherited inclusion body b-thalassaemia. Proc Natl Acad Sci USA 1990; 87: 3924. 8. Gonzalez-Redondo JM, Stoming TA, Kutlar A, Kutlar F, Lanclos KD, Howard EF, Fei YJ, Askoy M, Altay C, Gurgey A, Basak AN, Efremov GD, Petrov G, Huisman THJ. A C ; T substitution at nt-101 in a conserved DNA sequence of the promoter region of the b globin gene in association with ‘silent’ b thalassaemia. Blood 1989; 73: 1705. 9. Globin Gene Disorder Working Party of the BCSH General Haematology Task Force: Guidelines for the fetal diagnosis of globin gene disorders. J Clin Pathol 1994; 47: 199. 10. Dimovski AJ, Efremove DG, Jankovic L, Plaseska D, Juricic D, Efremov GD. A b0 thalassaemia due to a 1605 bp deletion of the 5’ b-globin gene region. Brit J Haemat 1993; 85: 143. 11. Losekoot M, Fodde R, Harteveld CL, Van Heeren H, Giordano PC, Bernini LF. Denaturing gradient gel electrophoresis and direct sequencing of PCR amplified genomic DNA: a rapid and reliable diagnostic approach to beta thalassaemia. Brit J Haemat 1991; 76: 269. 12. Thein SL, Hesketh C, Brown KM, Anstey AV, Weatherall DJ. Molecular characterisation of a high A2 b thalassaemia by direct sequencing of single strand enriched amplified genomic DNA. Blood 1989; 73: 924. 13. Ristaldi MS, Pirastu M, Rosatelli C, Cao A. Prenatal diagnosis of b-thalassaemia in Mediterranean populations by dot blot analysis with DNA amplification and allele specific oligonucleotide probes. Prenat Diag 1989; 9: 629. 14. Saiki RK, Walsh PS, Levenson CH, Erlich HA. Genetic analysis of amplified DNA with immobilized sequence-specific oligonucleotide probes. Proc Natl Acad Sci USA 1989; 86: 6230. 15. Maggio A, Giambona A, Cai SP, Wall J, Kan YW, Chehabb FF. Rapid and simultaneous typing of hemoglobin S, hemoglobin C and seven Mediterranean b-thalassaemia mutations by covalent reverse dot-blot analysis: application to prenatal diagnosis in Sicily. Blood 1993; 81: 239. 16. Sutcharitchan P, Saiki R, Huisman THJ, Kutlar A, McKie V, Embury SH. Reverse dot-blot detection of the African–American b-thalassaemia mutations. Blood 1995; 86: 1580. 17. Sutcharitchan P, Saiki R, Fucharoen S, Winichagoon P, Erlich H, Embury SH. Reverse dot-blot detection of Thai b-thalassaemia mutations. Brit J Haemat 1995; 90: 809.

52

Blood Reviews (2003) 17, 43–53


c 2003 Published by Elsevier Science Ltd.

18. Old JM, Varawalla NY, Weatherall DJ. The rapid detection and prenatal diagnosis of b thalassaemia in the Asian Indian and Cypriot populations in the UK. Lancet 1990; 336: 834. 19. Tan JAMA, Tay JSH, Lin LI, Kham SKY, Chia JN, Chin TM, Norkamov BT, Aziz AOB, Wong HB. The amplification refractory mutation system (ARMS): a rapid and direct prenatal diagnostic techniques for b-thalassaemia in Singapore. Prenat Diag 1994; 14: 1077. 20. Chehab FF, Kan YW. Detection of specific DNA sequence by fluorescence amplification: a colour complementation assay. Proc Natl Acad Sci USA 1989; 86: 9178. 21. Chang JG, Lu JM, Huang JM, Chen JT, Liu HJ, Chang CP. Rapid diagnosis of b-thalassaemia by mutagenically separated polymerase chain reaction (MS-PCR) and its application to prenatal diagnosis. Brit J Haemat 1995; 91: 602. 22. Linderman R, Hu SP, Volpato F, Trent RJ. Polymerase chain reaction (PCR) mutagenesis enabling rapid non-radioactive detection of common b-thalassaemia mutations in Mediterraneans. Brit J Haemat 1991; 78: 100. 23. Faa V, Rosatelli MC, Sardu R, Meloni A, Toffoli C, Cao A. A simple electrophoretic procedure for fetal diagnosis of b-thalassaemia due to short deletions. Prenat Diag 1992; 12: 903. 24. Waye JS, Eng B, Hunt JA et al. Filipino b-thalassaemia due to a large deletion: identification of the deletion endpoints and polymerase chain reaction (PCR)-based diagnosis. Hum Genet 1994; 94: 530. 25. Savage DA, Wood NAP, Bidwell JL, Fitches A, Old JM, Hui KM. Detection of b-thalassaemia mutations using DNA heteroduplex generator molecules. Brit J Haemat 1995; 90: 564. 26. Craig JE, Barnetson RA, Prior J, Raven JL, Thein SL. Rapid detection of deletions causing db thalassemia and hereditary persistence of fetal hemoglobin by enzymatic amplification. Blood 1994; 83: 1673. 27. Baysal E, Huisman THJ. Detection of common deletional a-thalassaemia-2 determinants by PCR. Am J Hematol 1994; 46: 208. 28. Bowden DK, Vickers MA, Higgs DR. A PCR-based strategy to detect the common severe determinants of a-thalassaemia. Brit J Haemat 1992; 81: 104. 29. Dode C, Krishnamoorthy R, Lamb J, Rochette J. Rapid analysis of a3:7 thalassaemia and aaaanti3:7 triplication by enzymatic amplification analysis. Brit J Haemat 1992; 82: 105. 30. Ko T-M, Li S-F. Molecular characterization of the FIL determinant of alpha-thalassaemia. Am J Hematol 1999; 60: 173. 31. Liu YT, Old JM, Fisher CA, Weatherall DJ, Clegg JB. Rapid detection of a-thalassaemia deletions and a-globin gene triplication by multiplex polymerase chain reactions. Brit J Haemat 1999; 108: 295. 32. Chong SS, Boehm CD, Higgs DR, Cutting GR. Single-tube multiplex-PCR screen for common deletional determinants of a-thalassaemia. Blood 2000; 95: 360. 33. Old JM. Prenatal diagnosis of the hemoglobinopathies. In: Milunsky A, ed. Genetic disorders and the fetus. vol Baltimore and London: The Johns Hopkins University Press; 1998: 581. 34. Ko TM, Tseng LH, Hsieh FJ, Lee TY. Prenatal diagnosis of HbH disease due to compound heterozygosity for south-east Asian deletion and Hb Constant Spring by polymerase chain reaction. Prenat Diag 1993; 13: 143. 35. Hartveld KL, Heister AJGAM, Giordano PC, Losekoot M, Bernini LF. Rapid detection of point mutations and polymorphisms of the a-globin genes by DGGE and SSCA. Hum Mut 1996; 7: 114. 36. Huisman THJ, Carver MFH. International hemoglobin information centre variant list. Hemoglobin 1997; 21: 505. 37. Thein SL, Lynch JR, Old JM, Weatherall DJ. Direct detection of haemoglobin E with Mnl I. J Med Genet 1987; 24: 110.

Screening and genetic diagnosis of haemoglobin disorders 38. Molchanova TP, Pobedimskaya DD, Postnikov YV. A simplified procedure for sequencing amplified DNA containing the a-2 or a-1 globin gene. Hemoglobin 1994; 18: 251. 39. Waye JS, Cai S-P, Eng B, Clark C, Adams III JG, Chui DHK, Steinberg MH. High haemoglobin A2 b0 thalassaemia due to a 532 bp deletion of the 50 b-globin gene region. Blood 1991; 77: 1100.

40. Lynch JR, Brown JM, Best S, Jennings MW, Weatherall DJ. Characterisation of the breakpoint of a 3.5 kb deletion of the bglobin gene. Genomics 1991; 10: 509. 41. Craig JE, Kelly SJ, Barnetson R, Thein SL. Molecular characterisation of a novel 10.3 kb deletion causing b-thalassaemia with unusually high Hb A2 . Brit J Haemat 1992; 82: 735.


c 2003 Published by Elsevier Science Ltd.

Blood Reviews (2003) 17, 43–53

53