- Email: [email protected]
Screening and identification of epithelial-to-mesenchymal transition-related circRNA and miRNA in prostate cancer
Pathology - Research and Practice xxx (xxxx) xxxx
Contents lists available at ScienceDirect
Pathology - Research and Practice journal homepage: www.elsevier.com/locate/prp
Screening and identification of epithelial-to-mesenchymal transition-related circRNA and miRNA in prostate cancer Zhijian Yan, Yiming Xiao, Yiyan Chen, Guangcheng Luo* Urology Department, Zhongshan Hospital Xiamen University, Xiamen, 361003, China
A R T I C LE I N FO
A B S T R A C T
Keywords: EMT Prostate cancer miRNAs circRNAs IFN-γ
Epithelial-to-mesenchymal transition (EMT) plays a vital role in the progression and metastasis of prostate cancer. However, the molecular mechanisms underlying prostate cancer metastasis are not fully demonstrated. In this study, EMT was induced by interferon-γ (IFN-γ) in PC-3M IE8 cells. High-throughput sequencing was used to screen the differentially expressed circular RNAs (circRNAs) and miRNAs in the cells with or without IFN-γ treatment. EMT-related circRNAs and miRNAs were further identified by quantitative real-time PCR (qPCR). In addition, the relationships among circRNAs, miRNAs, and mRNA were predicted. After cells were treated with IFN-γ, western blot analysis was conducted to detect the expression levels of EMT markers. E-cadherin expression levels were found to be downregulated, and Twist expression levels were found to be upregulated. Our results also found that IFN-γ promoted PC-3M IE8 cell migration and invasion, indicating that IFN-γ could induce EMT in PC-3M IE8 cells. Furthermore, high-throughput sequencing results revealed 827 upregulated and 1279 downregulated circRNAs and 39 upregulated and 2076 downregulated miRNAs in the IFN-γ group compared with the control group. KEGG analysis showed that both differentially expressed circRNAs and differentially expressed miRNAs were enriched in the MAPK signaling pathway related to EMT. Furthermore, the qPCR results revealed that the expression of hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001165, hsa-miR-196b-5p, and hsa-miR-187-3p in the IFN-γ group was consistent with the sequencing results. hsa_circ_0001165 and hsa_circ_0001085 were used to construct the network of circRNA-miRNA-mRNA. It was found that hsa_circ_0001165 may regulate TNF expression through hsa-miR-187-3p to induce EMT in prostate cancer cells. In addition, hsa_circ_0001085 may indirectly regulate the PI3K-Akt signaling and TGF-β signaling pathways through hsamiR-196b-5p and the MAPK signaling pathway through has-miR-451a, which played a regulatory role in prostate cancer cells in the EMT induction model. The results obtained in this study lay the foundation for future study.
1. Introduction Prostate cancer is a common malignant tumor of the male genitourinary system, and its incidence ranks is the highest among male malignancies. There were 1,276,106 new cases of prostate cancer in the United States in 2018, and the disease resulted in 358,989 deaths [1]. The incidence of prostate cancer in China is significantly lower than that in Western countries. However, with the changes in the lifestyle and the popularity of screening methods, the incidence and mortality of prostate cancer in China continues to rise [2]. Although treatments such as radical prostatectomy and radiation therapy exist, prostate cancer is still associated with problems such as frequent recurrence and poor prognosis [3]. An important reason for poor outcomes in patients with prostate cancer is its metastasis [4]. Cancer metastasis is a complex
⁎
process involving the separation of cancer cells from the primary tumor tissue, invasion of surrounding tissues, diffusion in the blood or lymph fluid, and proliferation at distant sites, forming metastases [3,4]. In cancer tissues, changes in regulatory genes result in the abnormal expression of target genes associated with metastasis, resulting in cell metastasis [5]. Therefore, the molecular mechanisms involved in prostate cancer metastasis to effectively treat and prevent cancer need to be studied immediately. Cancer cell metastasis is the leading cause of recurrence and death in most patients with cancer. Cancer metastasis is a multi-step, complex process that involving the interaction of different cell types and the surrounding environment [6,7]. Local infiltration is the first step in early metastasis. When cancer cells adhere to tumors in situ, local invasion and metastasis are unlikely to occur.However, when cancer cells
Corresponding author at: Urology Department, Zhongshan Hospital Xiamen University, 201-209 Hubin South Road, Siming District, Xiamen, 361003, China. E-mail address: [email protected] (G. Luo).
https://doi.org/10.1016/j.prp.2019.152784 Received 11 September 2019; Received in revised form 22 November 2019; Accepted 10 December 2019 0344-0338/ © 2019 Published by Elsevier GmbH.
Please cite this article as: Zhijian Yan, et al., Pathology - Research and Practice, https://doi.org/10.1016/j.prp.2019.152784
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Table 1 The primer sequences used in this study. Name
Sequences (5′ to 3′)
Length (bp)
hsa_circ_0006832-J197-F hsa_circ_0006832-J197-R hsa_circ_0006832-line173-F hsa_circ_0006832-line173-R hsa_circ_0001085-J178-F hsa_circ_0001085-J178-R hsa_circ_0001085-line199-F hsa_circ_0001085-line199-R hsa_circ_0004916-C248-F hsa_circ_0004916-C248-R hsa_circ_0004916-line186-F hsa_circ_0004916-line186-R hsa_circ_0001414-J227-F hsa_circ_0001414-J227-R hsa_circ_0001414-line170-F hsa_circ_0001414-line170-R hsa_circ_0001165-C179-F hsa_circ_0001165-C179-R hsa_circ_0001165-line211-F hsa_circ_0001165-line211-R Hsa GAPDH convergent-185-F Hsa GAPDH convergent-185-R Hsa GAPDH divergent-F Hsa GAPDH divergent-R hsa-miR-548o–RT hsa-miR-548o–F hsa-miR-196b-5p–RT hsa-miR-196b-5p–F hsa-miR-20a-5p–RT hsa-miR-20a-5p–F hsa-miR-301b-3p–RT hsa-miR-301b-3p–F hsa-miR-187-3p–RT hsa-miR-187-3p–F U6-F U6-R Universe-R
CAAAGGTTCCTTTGGACAGTGTTATAG CATCTGTCCAGCCATCTGAA TAGTTTTGCCGCTGGACTCT CATCTGTCCAGCCATCTGAA GACTTCTACTTCCAGATGTGTTCAGA GAATTTGGCCAGTTGAGGAA TTCCTCAACTGGCCAAATTC AGTCCACTCGGCTCTTTTCC TTTCAAATGCTCCCAAGGTC TTCCAAGCCGTGAGGAATAC GAGGCAGCGTGATGATACAA AGATCCCATCACAAGCCAAG GGCAGCTAGAGAGAAAATATTTACACC TCATTAGTCCCAAGGCAAGC GCTTGCCTTGGGACTAATGA CCAGTTCCTCTTGACCCTCA ATGAGGCCTGGCTTTGAAGA GGCAGATATCAGCTCAGCCAA CTTCAGGCATTGGATGGTTT GGGTCTCATTTGTCCAGGAA GAGTCAACGGATTTGGTCGT GAGTCAACGGATTTGGTCGT TCCTCACAGTTGCCATGTAGACCC TGCGGGCTCAATTTATAGAAACCGGG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTTGGT TGGTGAAAATGTGTTGATT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCAAC TAGGTAGTTTCCTGTTGT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT TAAAGTGCTTATAGTGCAG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCTTTG CAGTGCAATGATATTGTCAA GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGGCT TCGTGTCTTGTGTTGCAG CGCTTCGGCAGCACATATAC CGAATTTGCGTGTCATCCTTG GTGCAGGGTCCGAGGT
197 173 178 199 248 186 227 170 179 211 185
the mechanism of circRNA in prostate cancer EMT regulation is still poorly understood. IFN-γ is reported to induce gastric cancer cell metastasis though the NF-κB signaling pathway [24]. In prostate cancer, IFN-γ has been shown to be an effective molecular mechanism in promoting EMT by upregulating the expression IFIT5 in specific miRNA turnover [25]. For this reason, we employed IFN-γ to induce EMT in PC-3M IE8 cells. High-throughput sequencing techniques were used to identify differentially expressed circRNAs and miRNAs in PC-3M IE8 cells with an EMT induction model. In addition, circRNAs and miRNAs associated with invasion and metastasis were screened and verified with quantitative real-time PCR (qPCR). The circRNAs and miRNAs screened in prostate cancer cells with the EMT induction model and target proteins that miRNA bind to were predicted to determine the possible signaling pathways for EMT regulation.
adhere to epithelial cells, local invasion and metastasis occurs [8]. Epithelial-to-mesenchymal transition (EMT) plays a crucial role in the progression and metastasis of prostate cancer [9–11]. EMT refers to the process in which epithelial cells transform into stromal cells under specific physiological or pathological conditions. EMT involves morphological changes in epithelial cells, decreased or absent cell adhesion, and altered levels of marker protein expression. Its primary role is the removal of cancer cells from the in situ process, which is the initial step in cancer metastasis [12,13]. During tumor development, tumor cells interact with the local microenvironment. In EMT, a series of changes occur, including changes in polarity, increases in the mobility, and invasiveness of tumor cells, leading to cancer metastasis [14]. Circular RNA (circRNA) is a class of non-coding RNAs with a closed loop structure. CircRNA has significant unique characteristics, including an abundant presence in eukaryotic cells; high conservation; structural stability; and specificity of organization, timing, and disease [15,16]. Previous studies have shown that circRNA plays an important role in gene expression regulation, including acting as an miRNA sponge, interacting with RNA-binding proteins, and regulating gene transcription [14,17–19]. For example, ciRS-7 is a competitive endogenous RNA (ceRNA) that inhibits miR-7 activity and competes with miR-7 for binding to other RNAs to regulate expression of the target gene [20]. Exon-intron circular RNAs (EIciRNAs) bind to U1 snRNA to form an EIciRNA–U1 snRNP complex, which interacts with the RNA polymerase II transcription complex on the parental gene promoter to enhance transcription of the parental gene [21]. CircRNA circ0005276 can increase migration and proliferation in prostate cancer [22]. Silencing circRNA circZNF609 can inhibit invasion and migration in prostate cancer through upregulating miRNA-186-5p [23]. However,
2. Methods and materials 2.1. Cell culture PC-3M IE8 cells were obtained from National Infrastructure of Cell Line Resource and maintained in RPMI 1640 with 10 % (v/v) fetal bovine serum (Invitrogen, Carlsbad, CA). Cell lines were maintained in a humidified chamber at 5 % CO2 at 37 °C. Cells between two and three passages were used in the experiments. All PC-3 M IE8 cells were randomly divided into three different subgroups: Control group (PC-3M IE8 without treatment for 48 h culture), 10 ng/ml group (PC-3M IE8 with 10 ng/ml IFN-γ treatment for 48 h culture), and 20 ng/ml group (PC-3M IE8 with 20 ng/ml IFN-γ treatment for 48 h culture). IFN-γ was 2
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
was used to construct the libraries. A 2 × 150 bp paired-end sequencing strategy was also carried out on the Illumina Hiseq4000 platform. Differentially expressed circRNAs and miRNAs were obtained using the same method [27]. Enrichr (http://amp.pharm.mssm.edu/Enrichr/) was used to analyze Gene Ontology (GO) terms enriched in differentially expressed genes [28]. KOBAS software was used to test the statistical enrichment of differential genes in KEGG pathways [29].
obtained from peprotech (300-02, USA). 2.2. qPCR PC-3M IE8 cells were treated with 20 ng/ml IFN-γ in 100 μl final volume with 400 ng total RNA. Total RNA was extracted with the TaKaRaMiniBEST Universal RNA Extraction Kit (TaKaRa, Japan) based on the manufacturer's instructions. Reactions were performed in 50 μl volumes containing SYBR Green PCR master mix (Perkin-Elmer Biosystems). qPCR was performed using a BioRad C1000system (BioRad, USA) in 96-well optical plates. Thermal cycling conditions were as follows: 2 min at 50 °C and 10 min at 95 °C, followed by 40 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 2 min. RNA expression level was calculated based on a relative standard curve with the 2−ΔΔct method. PCR productions were analyzed by 1.5 % agarose gel electrophoresis. The circRNA and miRNA primer sequences in this study are shown in Table 1.
2.6. Construction of circRNA-miRNA-mRNA network miRanda software was used to predict miRNA binding to circRNA. By inputting the human mature miRNA sequence and circRNA sequence, we could predict the miRNA that circRNA might combine with and filter out the miRNA that was differentially expressed in sequencing. miRNA target genes were downloaded in miRTarbase and miRNA target genes related to migration and invasion were screened out. A regulatory network of circRNA-miRNA-mRNA was constructed using Cytoscape ver. 3.5.1.
2.3. Western blot analysis 2.7. Statistical analysis Total cellular protein from PC-3M IE8 cells treated with different conditions was isolated with the addition of 1 % phenylmethanesulfonyl fluoride and RIPA lysis buffer (50 mM Tris-HCl with pH 7.4, 150 mM NaCl, 1 % NP-40, 0.1 % sodium dodecylsulfate). After boiling with sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDSPAGE) sample buffer for 5 min, the samples were assessed for SDSPAGE. The proteins were transferred onto a polyvinylidene difluoride membrane (Millipore, USA). After blocking for 1 h at room temperature, the membrane was incubated with a 1 : 1000 dilution of rabbit polyclonal anti-mouse E-cadherin, Twist, and GAPDH (ABGENT, USA) overnight. The proteins were incubated with the corresponding secondary antibody for 1 h at room temperature and analyzed with an ECL chemiluminescence detection kit (Advansta, USA). The bands were obtained using GeneGnome 5 (Synoptics Ltd., UK).
Data were presented as mean ± standard deviation and the graphs were made using GraphPad Prism software. Differences between two groups’ mean values were analyzed using analysis of variance, and comparisons between means were performed with a 2-tailed Student’s ttest by SPSS software. The statistical significance between two groups was defined as P-value of < 0.05 and < 0.01. 3. Results 3.1. EMT induction To construct the EMT induction model in prostatic cancer cells, we employed different concentrations of IFN-γ (0, 10, and 20 ng/ml) to treat PC-3M IE8 cells for 48 h. Western blot analysis was used to determine the effect of EMT induction in prostate cancer cells. The results showed that E-cadherin protein in PC-3M IE8 cells treated with 20 ng/ ml IFN-γ was significantly lower than in the control group (P < 0.05). Twist protein in PC-3M IE8 cells treated with 20 ng/ml IFN-γ was significantly higher than in the control group (P < 0.01) (Fig. 1A and B). To identify the effect of IFN-γ on prostate cancer cell behavior, transwell chambers were used to assess the in vitro migration potential of PC3M IE8 cells. In cell migration analysis, the number of migration cells in the 20 ng/ml IFN-γ treatment group was significantly higher than in the control group (P < 0.01) (Fig. 1C). In the cell invasion analysis, the number of invasion cells in both the 20 ng/ml IFN-γ treatment group and 10 ng/ml IFN-γ treatment group was significantly higher than in the control group (P < 0.01) (Fig. 1D). These results showed that the EMT induction model in PC-3 M IE8 cells was constructed successfully, and that 20 ng/ml IFN-γ treatment was an effective dosage for the EMT model in PC-3M IE8 cells.
2.4. Migration and invasion assay The cell migration assay was carried out using Transwell Permeable Support (Corning Incorporated, Corning, NY, USA). Cells with different treatments were carefully transferred into the top chamber of each transwell apparatus at a density of 1 × 106 per ml (100 μl per chamber). Cells were allowed to migrate for 48 h at 37 °C. Cells that penetrated into the bottom side of the membrane were then fixed in methanol, stained using hematoxylin, and counted under a microscope. Cell invasion was analyzed using the Cultrex 24-well BME Cell Invasion Assay (Trevigen Inc., Gaithersburg, MD, USA) according to standard procedures. Briefly, 1 × 103 cells under different conditions were seeded in 100 μl serum-free media into the upper wells previously coated with the Matrigel basement extract, and 500 μl of media were added to the bottom wells. After 48 h of CO2 incubation at 37 °C, the non-invasive cells on the upper surface were removed, and the cells that had migrated to the lower surface were fixed in 500 μl of Cell Dissociation Solution/Calcein-AM, incubated at 37 °C in a CO2 incubator for 1 h and quantified by fluorimetric analysis (485 nm excitation, 520 nm emission).
3.2. Differentially expressed circRNA identification To obtain the differentially expressed circRNA, we performed highthroughput sequencing to identify the differentially expressed circRNAs in the 20 ng/ml IFN-γ treatment group and the control group. The results showed that 4788 circRNA molecules with over two back-splicing reads were identified in this study in the IFN-γ treatment group and control group (Supplement Fig. 1A). The 4788 circRNA molecules were mainly derived from exon (Supplement Fig. 1B). Most of circRNAs were less than 1000bp in length (Supplement Fig. 1C), and the first three chromosomes with the largest distribution of detected circular molecules were chromosome 1, chromosome 2, and chromosome 3 in the IFN-γ treatment group and control group (Supplement Fig. 1D). Heatmap and volcano maps showed that 827 differentially expressed
2.5. High-throughput sequencing The Ribo-Zero Gold Kit (Epicentre, USA) was used to remove ribosomal RNA of 8 μg total RNA. The total RNA without ribosomal RNA was incubated with 10 U/μg RNase R (Epicentre, Madison, WI) at 37 °C for 1 h. A mRNA-Seq sample preparation kit was used to construct cDNA libraries according to the manufacturer’s instructions (Illumina, USA). A 2 × 150 bp paired-end sequencing strategy was carried out on the Illumina Hiseq4000 platform. Differential expressions of circRNAs were identified [26]. The Illumina® TruSeqsmall RNA Library Prep Kit 3
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 1. IFN-γ promoted EMT in PC-3 M IE8 cells. (A) Western blot analysis of EMT-related biomarkers in PC-3 M IE8 cells under different treatment conditions. (B) Semi-quantitative results of graph A. (C) Cell migration analysis of PC-3 M IE8 cells under different treatment conditions. (D) Cell invasion analysis of PC-3 M IE8 cells under different treatment conditions. *P < 0.05 and **P < 0.01 represent significant difference compared with the control group.
differentially expressed miRNAs were enriched in the PI3K-Akt and MAPK signaling pathways related to EMT (Fig. 3D).
circRNAs were significantly upregulated and 1279 differentially expressed circRNAs were significantly downregulated in the IFN-γ group compared with the control group (Fig. 2A and B). GO annotation of all 2106 differentially expressed circRNA target genes was carried out using KOBAS software (http://kobas.cbi.pku.edu.cn/home.do) (Fig. 2C). The GO annotation results indicated that biological processes, cellular process, single organism process in biological processes; cell, cell part, and organelle in the cellular component; and binding and catalytic activities in the molecular function were the main biological processes related to EMT in PC-3M IE8 cells. KEGG analysis showed that the mTOR, Wnt, and MAPK signaling pathways related to EMT were functional enrichment pathways (Fig. 2D).
3.4. CircRNA identification To further analyze circRNAs and miRNAs associated with tumor metastasis, we further screened the differentially expressed molecules in this study: five downregulated expression circRNAs, three upregulated expression circRNAs, and the corresponding miRNAs related with EMT, according to bioinformatic analyses (Table 2). To confirm the sequencing result, we identified the expression levels of preselected hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001414, and hsa_circ_0001165 with the qPCR method. The amplification productions were analyzed with agarose gel electrophoresis and the Sanger sequencing method (Fig. 4A and B). Agarose gel electrophoresis showed both ring and linear primers could amplify a single band in the cDNA, while only linear primers could amplify a single band in the gDNA, suggesting that four circRNAs had bands of expected sizes in cDNA in the IFN-γ treatment group (Fig. 4A). Sanger sequencing showed that hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001414, and hsa_circ_0001165 could form rings (Fig. 4B). We identified the expressions of hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001414, hsa_circ_0001165, hsa-miR-196b-5p, hsa-miR-187-3p, hsa-miR-20a-5p, and hsa-miR-301-3p in normal and 20 ng/ml IFN-γ treated PC-3M IE8 cells and PC3 cells with qPCR (Fig. 4C). The results revealed that the expressions of hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001165 in
3.3. Differentially expressed miRNAs identification To obtain the differentially expressed miRNA, the differentially expressed miRNAs were identified in the IFN-γ treatment group and the control group. Heatmap and volcano maps showed that 39 differentially expressed miRNAs were significantly upregulated and 2,076 differentially expressed miRNAs were significantly downregulated in the IFN-γ treatment group compared with the control group (Fig. 3A and B). GO annotation showed the differentially expressed miRNAs were mainly concentrated in biological processes, followed by cellular components, which was consistent with the functional enrichment of differentially expressed circRNAs (Fig. 3C). KEGG analysis showed that pathways in cancer were the top enriched terms. Moreover, 4
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 2. Function analysis of differentially expressed circRNAs between the two groups. (A) Volcano map of differentially expressed circRNAs between the two groups. (B) Heatmap analysis of differentially expressed circRNAs between the two groups. (C) Gene Ontology (GO) analysis of differentially expressed circRNAs. (D) KEGG analysis of differentially expressed circRNAs.
Memczak et al. identified approximately 2000 human circRNAs, 1900 mouse circRNAs, and 700 nematode circRNAs using RNA sequencing [33]. Previous study have shown that circRNA is involved in a variety of diseases and plays an important role in tumors [34]. However, there is little evidence regarding the role of circRNA in prostate cancer. In this study, we employed high-throughput sequencing to examine the potential effects of circRNA in prostate cancer cells with an EMT induction model. Four differentially expressed circRNAs and miRNAs that were related to EMT were identified by a qPCR approach in prostate cancer cells with an EMT induction model. The potential relationship of the four circRNAs, miRNAs, and the EMT-related genes was studied. During tumor development, the surrounding microenvironment stimulates tumor cells to induce EMT. The characteristics of EMT in tumor cells include changes in cell polarity and enhanced cell migration, which in turn promotes the migration, invasion, and metastasis of cells [35]. To explore the relevance of circRNA and EMT in prostate cancer, we employed IFN-γ to induce EMT in PC-3M IE8 cells. The study of invasion and migration suggested that 20 ng/ml IFN-γ could effectively induce EMT in PC-3M IE8 cells, which was further verified by western blot analysis of EMT-related biomarkers (E-cadherin and Twist). E-cadherin belongs to the family of cadherins and is a transmembrane glycoprotein that is highly sensitive to calcium ions. This molecule can mediate adhesion between epithelial cells and maintain tissue integrity and polarity [36]. Many factors influence the expression of E-cadherin, and downregulated expression can lead to a decrease in adhesion between cells. For this reason, this molecule is considered an
PC-3M IE8 cells treated with IFN-γ were consistent with the highthroughput sequencing results. Meanwhile, the expression of the three molecules mentioned above in PC-3 cells was similar to in PC-3M IE8 cells. The expression of hsa-miR-20a-5p and hsa-miR-301b-3p in the 20 ng/ml IFN-γ treatment group was consistent with the high-throughput sequencing results (Fig. 4D). Based on the expression and sequence results, we selected hsa_circ_0001165 and hsa_circ_0001085 to construct the network of circRNA-miRNA-mRNA. Fig. 5 shows that hsa_circ_0001165 may regulate TNF expression through hsa-miR-187-3p to induce EMT in prostatic cancer cells. Hsa_circ_0001085 may indirectly regulate AKT1 and PIK3CG protein expression levels through the PI3KAkt signaling pathway, TGFBR2 protein expression level through the TGF-β signaling pathway through hsa-miR-196b-5p, and MAPK1 protein expression level through the MAPK signaling pathway through hsamiR-451a, which played a regulatory role in prostate cancer cells in the EMT induction model. 4. Discussion CircRNA is a type of non-coding RNA that is widely found in eukaryotes. The molecule has a variety of unique features, including structural stability, tissue specificity, and species evolutionary conservation. CircRNA has been studied for many years [30]. Nigro et al. observed that the exon of the DCC gene is reversely linked to form circRNA in human cells [31]. Jeck et al. detected more than 25,000 circRNAs in human fibroblasts by high-throughput sequencing [32]. 5
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 3. Function analysis of differentially expressed miRNAs between the two groups. (A) Volcano map of differentially expressed miRNAs between the two groups. (B) Heatmap analysis of differentially expressed miRNAs between the two groups. (C) Gene Ontology (GO) analysis of differentially expressed miRNAs. (D) KEGG analysis of differentially expressed miRNAs.
undifferentiated tissue [38]. Studies have confirmed that Twist is involved in the development of EMT in epithelial-derived tumor cells, which promotes tumor invasion and metastasis [35]. In this study, the expression of Twist was significantly higher in PC-3 M IE8 cells in the
important marker of EMT development [37]. Meanwhile, Twist is an alkaline helix-loop-helix (bHLH) transcription factor present in flies, mice, humans, and other organisms. It is mainly expressed in the placenta, embryonic mesoderm or in adult mesoderm-derived
Table 2 EMT related circRNA and miRNA identified in this study. circRNA Up-Down-Regulation (IFN-γ/Con)
circRNA
miRNA Up-Down-Regulation (IFN-γ/Con)
miRNA combined with circRNA
Down Down
hsa_circ_0006832 hsa_circ_0001085
Down Down Down Up
hsa_circ_0004916 hsa_circ_0008301 hsa_circ_0001414 hsa_circ_0001326
Up
hsa_circ_0001165
Up
hsa_circ_0008210
Up Up Up Up Up Up Up Down Down Down Down Down Down Down Down Down Down Down
hsa-miR-548o-3p hsa-miR-96-5p hsa-miR-196b-5p hsa-miR-548o-3p hsa-miR-20a-5p hsa-miR-486-5p hsa-miR-301b-3p hsa-miR-141-5p hsa-miR-608 hsa-miR-146a-3p hsa-miR-96-3p hsa-miR-187-3p hsa-miR-141-5p hsa-miR-146a-3p hsa-miR-96-3p hsa-miR-216b-5p hsa-miR-187-3p hsa-miR-608
6
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 4. CircRNA verification and expression analysis. (A) Head-to-tail splicing of three circRNAs was confirmed by the Sanger sequencing method. (B) Four circRNAs were amplified using divergent and convergent primers with cDNA and gDNA of both the groups. CircRNAs could only be amplified in the cDNA template. M: DNA molecular markers. The sizes of two bands are 200 and 100 bp. (C) qPCR analysis of expressions of four circRNAs in PC-3 M IE8 and PC-3 cells with or without 20 ng/ ml IFN-γ treatment. * P < 0.05, **P < 0.01.
miRNAs, circRNAs and target genes was predicted. The results suggested that hsa_circ_0001165 may regulate TNF expression through hsamiR-187-3p to induce EMT in prostatic cancer cells. Hsa_circ_0001085 may indirectly regulate AKT1 and PIK3CG protein expression levels through the PI3K-Akt signaling pathway, TGFBR2 protein expression level through the TGF-β signaling pathway through hsa-miR-196b-5p, and MAPK1 protein expression level through the MAPK signaling pathway through hsa-miR-451a, which played a regulatory role in prostate cancer cells in the EMT induction model. TGF-β has been shown to promote EMT progression by activating kinase-dependent signaling processes. Inhibition of the TGF-βor receptor may inhibit tumor invasion and metastasis [42]. Meanwhile, The PI3K/Akt signaling pathway has been shown to be involved in the induction of EMT in cancer cells. Activated PI3K produces a second messenger, PIP3, that activates downstream Akt, which in turn activates or inhibits downstream target proteins by phosphorylation. This cascade reaction can regulate the survival, proliferation, and differentiation of the cytoskeleton and induce EMT. Therefore, activation of the PI3K/Akt signaling
EMT induction model, which is consistent with the results of previous studies. Our results indicated that 20 ng/ml IFN-γ was an effective dosage for EMT induction in PC-3M IE8 cells. High-throughput sequencing was performed to screen the differentially expressed circRNAs and miRNAs in prostate cancer cells with the EMT induction model. miRNA is a group of endogenous non-coding protein single-stranded RNAs that binds to the 3′non-coding region (3′UTR) of the target mRNA, resulting in mRNA cleavage degradation at post-transcriptional levels. Therefore, this molecule can indirectly regulate gene expression [39]. miRNA is widely involved in many biological processes such as cell differentiation, proliferation, apoptosis, stress, and immunity, and also plays an important role in tumors [40]. An increasing amount of evidence suggests that miRNAs has a regulatory effect on prostate cancer EMT and can affect the transmission of the EMT signaling pathway and the expression of downstream genes [41]. In this study, we employed a PCR method to identify the sequencing results of four miRNAs and circRNAs. The relationship between the four 7
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 5. Regulatory network analysis of hsa_circ_0001165 and hsa_circ_0001085.
Appendix A. Supplementary data
pathway increases the invasiveness and metastasis of tumor cells [43,44]. At the same time, research shows that snail transcription factor may induce EMT in prostate cancer cells through the MAPK pathway [45] and Let-7a also promotes the invasion and metastasis of prostate cancer cells via the MAPK pathway [46]. The RAS/MAPK pathway has been shown to be significantly activated in a prostate cancer metastasis model [47]. These findings are consistent with the results of our research.
Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.prp.2019.152784. References [1] P. Rawla, Epidemiology of prostate Cancer, World J. Oncol. 10 (2) (2019) 63–89. [2] D.W. Ye, Y. Zhu, Prostate cancer and prostatic diseases best of China, 2018, Prostate Cancer Prostatic Dis. 22 (1) (2019) 1–2. [3] M. van Son, et al., Focal salvage treatment of radiorecurrent prostate Cancer: a narrative review of current strategies and future perspectives, Cancers (Basel) 10 (12) (2018). [4] S. Ziaee, et al., Prostate cancer metastasis: roles of recruitment and reprogramming, cell signal network and three-dimensional growth characteristics, Transl. Androl. Urol. 4 (4) (2015) 438–454. [5] I.J. Fidler, The pathogenesis of cancer metastasis: the’ seed and soil’ hypothesis revisited, Nat. Rev. Cancer 3 (6) (2003) 453–458. [6] L. Dong, et al., Metastatic prostate cancer remains incurable, why? Asian J. Urol. 6 (1) (2019) 26–41. [7] Y. Liao, K. Xu, Epigenetic regulation of prostate cancer: the theories and the clinical implications, Asian J. Androl. 21 (3) (2019) 279–290. [8] T.N. Seyfried, L.C. Huysentruyt, On the origin of cancer metastasis, Crit. Rev. Oncog. 18 (1–2) (2013) 43–73. [9] A.W. Lambert, D.R. Pattabiraman, R.A. Weinberg, Emerging biological principles of metastasis, Cell 168 (4) (2017) 670–691. [10] W. Yu, et al., Cadherin signaling in Cancer: its functions and role as a therapeutic target, Front. Oncol. 9 (2019) 989. [11] K.A. Cheaito, et al., EMT markers in locally-advanced prostate Cancer: predicting recurrence? Front. Oncol. 9 (2019) 131. [12] S. Figiel, et al., Clinical significance of epithelial-mesenchymal transition markers in prostate cancer, Hum. Pathol. 61 (2017) 26–32. [13] H. Dicken, P.J. Hensley, N. Kyprianou, Prostate tumor neuroendocrine differentiation via EMT: the road less traveled, Asian J. Urol. 6 (1) (2019) 82–90. [14] S.P. Barrett, J. Salzman, Circular RNAs: analysis, expression and potential functions, Development 143 (11) (2016) 1838–1847. [15] S. Lamouille, J. Xu, R. Derynck, Molecular mechanisms of epithelial-mesenchymal transition, Nat. Rev. Mol. Cell Biol. 15 (3) (2014) 178–196. [16] G.W. Pearson, Control of invasion by epithelial-to-mesenchymal transition programs during metastasis, J. Clin. Med. 8 (5) (2019). [17] L.M. Holdt, A. Kohlmaier, D. Teupser, Molecular roles and function of circular RNAs in eukaryotic cells, Cell. Mol. Life Sci. 75 (6) (2018) 1071–1098. [18] M. Paolillo, S. Schinelli, Extracellular matrix alterations in metastatic processes, Int. J. Mol. Sci. 20 (19) (2019).
5. Conclusion hsa_circ_0001165 may regulate TNF expression through hsa-miR187-3p to induce the EMT in prostate cancer cells. hsa_circ_0001085 may indirectly regulate the PI3K-Akt signaling pathway and TGF-β signaling pathway through hsa-miR-196b-5p, and the MAPK signaling pathway through has-miR-451a. The results obtained in this study lay the foundations for further in-depth research. Author statement Zhijian Yan and Guangcheng Luo were responsible for the study design. Zhijian Yan, Yiming Xiao, Yiyan Chen, and Guangcheng Luo were responsible for the experimental studies. Declaration of Competing Interest The authors declare no competing financial interest. Acknowledgment This research was supported by the Project of Science and Technology Bureau of Xiamen,China in(3502Z20174077 and 3502Z20184033) for financial support. 8
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
10 (1) (2017) 2. [35] D.S. Micalizzi, S.M. Farabaugh, H.L. Ford, Epithelial-mesenchymal transition in cancer: parallels between normal development and tumor progression, J. Mammary Gland Biol. Neoplasia 15 (2) (2010) 117–134. [36] L. Li, S.A. Bennett, L. Wang, Role of E-cadherin and other cell adhesion molecules in survival and differentiation of human pluripotent stem cells, Cell Adh. Migr. 6 (1) (2012) 59–70. [37] T.T. Onder, et al., Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways, Cancer Res. 68 (10) (2008) 3645–3654. [38] S. Ansieau, et al., TWISTing an embryonic transcription factor into an oncoprotein, Oncogene 29 (22) (2010) 3173–3184. [39] E.J. Tokar, MicroRNAs: small molecules with big effects, Toxicol. Appl. Pharmacol. 312 (2016) 1–2. [40] P. Gandellini, E. Giovannetti, F. Nicassio, MicroRNAs in Cancer management: big challenges for small molecules, Biomed Res. Int. 2015 (2015) 982156. [41] J. Liu, et al., MicroRNAs, an active and versatile group in cancers, Int. J. Oral Sci. 3 (4) (2011) 165–175. [42] J. Zavadil, E.P. Bottinger, TGF-beta and epithelial-to-mesenchymal transitions, Oncogene 24 (37) (2005) 5764–5774. [43] S.J. Grille, et al., The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness of squamous cell carcinoma lines, Cancer Res. 63 (9) (2003) 2172–2178. [44] W. Yan, et al., PI3 kinase/Akt signaling mediates epithelial-mesenchymal transition in hypoxic hepatocellular carcinoma cells, Biochem. Biophys. Res. Commun. 382 (3) (2009) 631–636. [45] C.L. Neal, D. McKeithen, V.A. Odero-Marah, Snail negatively regulates cell adhesion to extracellular matrix and integrin expression via the MAPK pathway in prostate cancer cells, Cell Adh. Migr. 5 (3) (2011) 249–257. [46] G. Tang, et al., MiRNALet-7a mediates prostate cancer PC-3 cell invasion, migration by inducing epithelial-mesenchymal transition through CCR7/MAPK pathway, J. Cell. Biochem. 119 (4) (2018) 3725–3731. [47] D.J. Mulholland, et al., Pten loss and RAS/MAPK activation cooperate to promote EMT and metastasis initiated from prostate cancer stem/progenitor cells, Cancer Res. 72 (7) (2012) 1878–1889.
[19] S. Qu, et al., Circular RNA: a new star of noncoding RNAs, Cancer Lett. 365 (2) (2015) 141–148. [20] F. Wang, A.J. Nazarali, S. Ji, Circular RNAs as potential biomarkers for cancer diagnosis and therapy, Am. J. Cancer Res. 6 (6) (2016) 1167–1176. [21] S. Qu, et al., The emerging landscape of circular RNA in life processes, RNA Biol. 14 (8) (2017) 992–999. [22] Y. Feng, et al., Circular RNA circ0005276 promotes the proliferation and migration of prostate cancer cells by interacting with FUS to transcriptionally activate XIAP, Cell Death Dis. 10 (11) (2019) 792. [23] C. Jin, et al., Silencing circular RNA circZNF609 restrains growth, migration and invasion by up-regulating microRNA-186-5p in prostate cancer, Artif. Cells Nanomed. Biotechnol. 47 (1) (2019) 3350–3358. [24] Y.H. Xu, Z.L. Li, S.F. Qiu, IFN-gamma induces gastric Cancer cell proliferation and metastasis through upregulation of integrin beta3-Mediated NF-kappaB signaling, Transl. Oncol. 11 (1) (2018) 182–192. [25] U.G. Lo, et al., IFNgamma-induced IFIT5 promotes epithelial-to-Mesenchymal transition in prostate Cancer via miRNA processing, Cancer Res. 79 (6) (2019) 1098–1112. [26] K.K. Ebbesen, J. Kjems, T.B. Hansen, Circular RNAs: identification, biogenesis and function, Biochim. Biophys. Acta 1859 (1) (2016) 163–168. [27] T.B. Hansen, et al., Natural RNA circles function as efficient microRNA sponges, Nature 495 (7441) (2013) 384–388. [28] Z. Li, et al., Exon-intron circular RNAs regulate transcription in the nucleus, Nat. Struct. Mol. Biol. 22 (3) (2015) 256–264. [29] W. Zhao, et al., Genome-wide identification and characterization of circular RNAs by high throughput sequencing in soybean, Sci. Rep. 7 (1) (2017) 5636. [30] H.L. Sanger, et al., Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures, Proc Natl Acad Sci U S A 73 (11) (1976) 3852–3856. [31] J.M. Nigro, et al., Scrambled exons, Cell 64 (3) (1991) 607–613. [32] W.R. Jeck, et al., Circular RNAs are abundant, conserved, and associated with ALU repeats, Rna 19 (2) (2013) 141–157. [33] S. Memczak, et al., Circular RNAs are a large class of animal RNAs with regulatory potency, Nature 495 (7441) (2013) 333–338. [34] Y. Dong, et al., Circular RNAs in cancer: an emerging key player, J. Hematol. Oncol.
9
Contents lists available at ScienceDirect
Pathology - Research and Practice journal homepage: www.elsevier.com/locate/prp
Screening and identification of epithelial-to-mesenchymal transition-related circRNA and miRNA in prostate cancer Zhijian Yan, Yiming Xiao, Yiyan Chen, Guangcheng Luo* Urology Department, Zhongshan Hospital Xiamen University, Xiamen, 361003, China
A R T I C LE I N FO
A B S T R A C T
Keywords: EMT Prostate cancer miRNAs circRNAs IFN-γ
Epithelial-to-mesenchymal transition (EMT) plays a vital role in the progression and metastasis of prostate cancer. However, the molecular mechanisms underlying prostate cancer metastasis are not fully demonstrated. In this study, EMT was induced by interferon-γ (IFN-γ) in PC-3M IE8 cells. High-throughput sequencing was used to screen the differentially expressed circular RNAs (circRNAs) and miRNAs in the cells with or without IFN-γ treatment. EMT-related circRNAs and miRNAs were further identified by quantitative real-time PCR (qPCR). In addition, the relationships among circRNAs, miRNAs, and mRNA were predicted. After cells were treated with IFN-γ, western blot analysis was conducted to detect the expression levels of EMT markers. E-cadherin expression levels were found to be downregulated, and Twist expression levels were found to be upregulated. Our results also found that IFN-γ promoted PC-3M IE8 cell migration and invasion, indicating that IFN-γ could induce EMT in PC-3M IE8 cells. Furthermore, high-throughput sequencing results revealed 827 upregulated and 1279 downregulated circRNAs and 39 upregulated and 2076 downregulated miRNAs in the IFN-γ group compared with the control group. KEGG analysis showed that both differentially expressed circRNAs and differentially expressed miRNAs were enriched in the MAPK signaling pathway related to EMT. Furthermore, the qPCR results revealed that the expression of hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001165, hsa-miR-196b-5p, and hsa-miR-187-3p in the IFN-γ group was consistent with the sequencing results. hsa_circ_0001165 and hsa_circ_0001085 were used to construct the network of circRNA-miRNA-mRNA. It was found that hsa_circ_0001165 may regulate TNF expression through hsa-miR-187-3p to induce EMT in prostate cancer cells. In addition, hsa_circ_0001085 may indirectly regulate the PI3K-Akt signaling and TGF-β signaling pathways through hsamiR-196b-5p and the MAPK signaling pathway through has-miR-451a, which played a regulatory role in prostate cancer cells in the EMT induction model. The results obtained in this study lay the foundation for future study.
1. Introduction Prostate cancer is a common malignant tumor of the male genitourinary system, and its incidence ranks is the highest among male malignancies. There were 1,276,106 new cases of prostate cancer in the United States in 2018, and the disease resulted in 358,989 deaths [1]. The incidence of prostate cancer in China is significantly lower than that in Western countries. However, with the changes in the lifestyle and the popularity of screening methods, the incidence and mortality of prostate cancer in China continues to rise [2]. Although treatments such as radical prostatectomy and radiation therapy exist, prostate cancer is still associated with problems such as frequent recurrence and poor prognosis [3]. An important reason for poor outcomes in patients with prostate cancer is its metastasis [4]. Cancer metastasis is a complex
⁎
process involving the separation of cancer cells from the primary tumor tissue, invasion of surrounding tissues, diffusion in the blood or lymph fluid, and proliferation at distant sites, forming metastases [3,4]. In cancer tissues, changes in regulatory genes result in the abnormal expression of target genes associated with metastasis, resulting in cell metastasis [5]. Therefore, the molecular mechanisms involved in prostate cancer metastasis to effectively treat and prevent cancer need to be studied immediately. Cancer cell metastasis is the leading cause of recurrence and death in most patients with cancer. Cancer metastasis is a multi-step, complex process that involving the interaction of different cell types and the surrounding environment [6,7]. Local infiltration is the first step in early metastasis. When cancer cells adhere to tumors in situ, local invasion and metastasis are unlikely to occur.However, when cancer cells
Corresponding author at: Urology Department, Zhongshan Hospital Xiamen University, 201-209 Hubin South Road, Siming District, Xiamen, 361003, China. E-mail address: [email protected] (G. Luo).
https://doi.org/10.1016/j.prp.2019.152784 Received 11 September 2019; Received in revised form 22 November 2019; Accepted 10 December 2019 0344-0338/ © 2019 Published by Elsevier GmbH.
Please cite this article as: Zhijian Yan, et al., Pathology - Research and Practice, https://doi.org/10.1016/j.prp.2019.152784
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Table 1 The primer sequences used in this study. Name
Sequences (5′ to 3′)
Length (bp)
hsa_circ_0006832-J197-F hsa_circ_0006832-J197-R hsa_circ_0006832-line173-F hsa_circ_0006832-line173-R hsa_circ_0001085-J178-F hsa_circ_0001085-J178-R hsa_circ_0001085-line199-F hsa_circ_0001085-line199-R hsa_circ_0004916-C248-F hsa_circ_0004916-C248-R hsa_circ_0004916-line186-F hsa_circ_0004916-line186-R hsa_circ_0001414-J227-F hsa_circ_0001414-J227-R hsa_circ_0001414-line170-F hsa_circ_0001414-line170-R hsa_circ_0001165-C179-F hsa_circ_0001165-C179-R hsa_circ_0001165-line211-F hsa_circ_0001165-line211-R Hsa GAPDH convergent-185-F Hsa GAPDH convergent-185-R Hsa GAPDH divergent-F Hsa GAPDH divergent-R hsa-miR-548o–RT hsa-miR-548o–F hsa-miR-196b-5p–RT hsa-miR-196b-5p–F hsa-miR-20a-5p–RT hsa-miR-20a-5p–F hsa-miR-301b-3p–RT hsa-miR-301b-3p–F hsa-miR-187-3p–RT hsa-miR-187-3p–F U6-F U6-R Universe-R
CAAAGGTTCCTTTGGACAGTGTTATAG CATCTGTCCAGCCATCTGAA TAGTTTTGCCGCTGGACTCT CATCTGTCCAGCCATCTGAA GACTTCTACTTCCAGATGTGTTCAGA GAATTTGGCCAGTTGAGGAA TTCCTCAACTGGCCAAATTC AGTCCACTCGGCTCTTTTCC TTTCAAATGCTCCCAAGGTC TTCCAAGCCGTGAGGAATAC GAGGCAGCGTGATGATACAA AGATCCCATCACAAGCCAAG GGCAGCTAGAGAGAAAATATTTACACC TCATTAGTCCCAAGGCAAGC GCTTGCCTTGGGACTAATGA CCAGTTCCTCTTGACCCTCA ATGAGGCCTGGCTTTGAAGA GGCAGATATCAGCTCAGCCAA CTTCAGGCATTGGATGGTTT GGGTCTCATTTGTCCAGGAA GAGTCAACGGATTTGGTCGT GAGTCAACGGATTTGGTCGT TCCTCACAGTTGCCATGTAGACCC TGCGGGCTCAATTTATAGAAACCGGG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGTTGGT TGGTGAAAATGTGTTGATT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCCAAC TAGGTAGTTTCCTGTTGT GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTACCT TAAAGTGCTTATAGTGCAG GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCTTTG CAGTGCAATGATATTGTCAA GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGGCT TCGTGTCTTGTGTTGCAG CGCTTCGGCAGCACATATAC CGAATTTGCGTGTCATCCTTG GTGCAGGGTCCGAGGT
197 173 178 199 248 186 227 170 179 211 185
the mechanism of circRNA in prostate cancer EMT regulation is still poorly understood. IFN-γ is reported to induce gastric cancer cell metastasis though the NF-κB signaling pathway [24]. In prostate cancer, IFN-γ has been shown to be an effective molecular mechanism in promoting EMT by upregulating the expression IFIT5 in specific miRNA turnover [25]. For this reason, we employed IFN-γ to induce EMT in PC-3M IE8 cells. High-throughput sequencing techniques were used to identify differentially expressed circRNAs and miRNAs in PC-3M IE8 cells with an EMT induction model. In addition, circRNAs and miRNAs associated with invasion and metastasis were screened and verified with quantitative real-time PCR (qPCR). The circRNAs and miRNAs screened in prostate cancer cells with the EMT induction model and target proteins that miRNA bind to were predicted to determine the possible signaling pathways for EMT regulation.
adhere to epithelial cells, local invasion and metastasis occurs [8]. Epithelial-to-mesenchymal transition (EMT) plays a crucial role in the progression and metastasis of prostate cancer [9–11]. EMT refers to the process in which epithelial cells transform into stromal cells under specific physiological or pathological conditions. EMT involves morphological changes in epithelial cells, decreased or absent cell adhesion, and altered levels of marker protein expression. Its primary role is the removal of cancer cells from the in situ process, which is the initial step in cancer metastasis [12,13]. During tumor development, tumor cells interact with the local microenvironment. In EMT, a series of changes occur, including changes in polarity, increases in the mobility, and invasiveness of tumor cells, leading to cancer metastasis [14]. Circular RNA (circRNA) is a class of non-coding RNAs with a closed loop structure. CircRNA has significant unique characteristics, including an abundant presence in eukaryotic cells; high conservation; structural stability; and specificity of organization, timing, and disease [15,16]. Previous studies have shown that circRNA plays an important role in gene expression regulation, including acting as an miRNA sponge, interacting with RNA-binding proteins, and regulating gene transcription [14,17–19]. For example, ciRS-7 is a competitive endogenous RNA (ceRNA) that inhibits miR-7 activity and competes with miR-7 for binding to other RNAs to regulate expression of the target gene [20]. Exon-intron circular RNAs (EIciRNAs) bind to U1 snRNA to form an EIciRNA–U1 snRNP complex, which interacts with the RNA polymerase II transcription complex on the parental gene promoter to enhance transcription of the parental gene [21]. CircRNA circ0005276 can increase migration and proliferation in prostate cancer [22]. Silencing circRNA circZNF609 can inhibit invasion and migration in prostate cancer through upregulating miRNA-186-5p [23]. However,
2. Methods and materials 2.1. Cell culture PC-3M IE8 cells were obtained from National Infrastructure of Cell Line Resource and maintained in RPMI 1640 with 10 % (v/v) fetal bovine serum (Invitrogen, Carlsbad, CA). Cell lines were maintained in a humidified chamber at 5 % CO2 at 37 °C. Cells between two and three passages were used in the experiments. All PC-3 M IE8 cells were randomly divided into three different subgroups: Control group (PC-3M IE8 without treatment for 48 h culture), 10 ng/ml group (PC-3M IE8 with 10 ng/ml IFN-γ treatment for 48 h culture), and 20 ng/ml group (PC-3M IE8 with 20 ng/ml IFN-γ treatment for 48 h culture). IFN-γ was 2
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
was used to construct the libraries. A 2 × 150 bp paired-end sequencing strategy was also carried out on the Illumina Hiseq4000 platform. Differentially expressed circRNAs and miRNAs were obtained using the same method [27]. Enrichr (http://amp.pharm.mssm.edu/Enrichr/) was used to analyze Gene Ontology (GO) terms enriched in differentially expressed genes [28]. KOBAS software was used to test the statistical enrichment of differential genes in KEGG pathways [29].
obtained from peprotech (300-02, USA). 2.2. qPCR PC-3M IE8 cells were treated with 20 ng/ml IFN-γ in 100 μl final volume with 400 ng total RNA. Total RNA was extracted with the TaKaRaMiniBEST Universal RNA Extraction Kit (TaKaRa, Japan) based on the manufacturer's instructions. Reactions were performed in 50 μl volumes containing SYBR Green PCR master mix (Perkin-Elmer Biosystems). qPCR was performed using a BioRad C1000system (BioRad, USA) in 96-well optical plates. Thermal cycling conditions were as follows: 2 min at 50 °C and 10 min at 95 °C, followed by 40 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 2 min. RNA expression level was calculated based on a relative standard curve with the 2−ΔΔct method. PCR productions were analyzed by 1.5 % agarose gel electrophoresis. The circRNA and miRNA primer sequences in this study are shown in Table 1.
2.6. Construction of circRNA-miRNA-mRNA network miRanda software was used to predict miRNA binding to circRNA. By inputting the human mature miRNA sequence and circRNA sequence, we could predict the miRNA that circRNA might combine with and filter out the miRNA that was differentially expressed in sequencing. miRNA target genes were downloaded in miRTarbase and miRNA target genes related to migration and invasion were screened out. A regulatory network of circRNA-miRNA-mRNA was constructed using Cytoscape ver. 3.5.1.
2.3. Western blot analysis 2.7. Statistical analysis Total cellular protein from PC-3M IE8 cells treated with different conditions was isolated with the addition of 1 % phenylmethanesulfonyl fluoride and RIPA lysis buffer (50 mM Tris-HCl with pH 7.4, 150 mM NaCl, 1 % NP-40, 0.1 % sodium dodecylsulfate). After boiling with sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDSPAGE) sample buffer for 5 min, the samples were assessed for SDSPAGE. The proteins were transferred onto a polyvinylidene difluoride membrane (Millipore, USA). After blocking for 1 h at room temperature, the membrane was incubated with a 1 : 1000 dilution of rabbit polyclonal anti-mouse E-cadherin, Twist, and GAPDH (ABGENT, USA) overnight. The proteins were incubated with the corresponding secondary antibody for 1 h at room temperature and analyzed with an ECL chemiluminescence detection kit (Advansta, USA). The bands were obtained using GeneGnome 5 (Synoptics Ltd., UK).
Data were presented as mean ± standard deviation and the graphs were made using GraphPad Prism software. Differences between two groups’ mean values were analyzed using analysis of variance, and comparisons between means were performed with a 2-tailed Student’s ttest by SPSS software. The statistical significance between two groups was defined as P-value of < 0.05 and < 0.01. 3. Results 3.1. EMT induction To construct the EMT induction model in prostatic cancer cells, we employed different concentrations of IFN-γ (0, 10, and 20 ng/ml) to treat PC-3M IE8 cells for 48 h. Western blot analysis was used to determine the effect of EMT induction in prostate cancer cells. The results showed that E-cadherin protein in PC-3M IE8 cells treated with 20 ng/ ml IFN-γ was significantly lower than in the control group (P < 0.05). Twist protein in PC-3M IE8 cells treated with 20 ng/ml IFN-γ was significantly higher than in the control group (P < 0.01) (Fig. 1A and B). To identify the effect of IFN-γ on prostate cancer cell behavior, transwell chambers were used to assess the in vitro migration potential of PC3M IE8 cells. In cell migration analysis, the number of migration cells in the 20 ng/ml IFN-γ treatment group was significantly higher than in the control group (P < 0.01) (Fig. 1C). In the cell invasion analysis, the number of invasion cells in both the 20 ng/ml IFN-γ treatment group and 10 ng/ml IFN-γ treatment group was significantly higher than in the control group (P < 0.01) (Fig. 1D). These results showed that the EMT induction model in PC-3 M IE8 cells was constructed successfully, and that 20 ng/ml IFN-γ treatment was an effective dosage for the EMT model in PC-3M IE8 cells.
2.4. Migration and invasion assay The cell migration assay was carried out using Transwell Permeable Support (Corning Incorporated, Corning, NY, USA). Cells with different treatments were carefully transferred into the top chamber of each transwell apparatus at a density of 1 × 106 per ml (100 μl per chamber). Cells were allowed to migrate for 48 h at 37 °C. Cells that penetrated into the bottom side of the membrane were then fixed in methanol, stained using hematoxylin, and counted under a microscope. Cell invasion was analyzed using the Cultrex 24-well BME Cell Invasion Assay (Trevigen Inc., Gaithersburg, MD, USA) according to standard procedures. Briefly, 1 × 103 cells under different conditions were seeded in 100 μl serum-free media into the upper wells previously coated with the Matrigel basement extract, and 500 μl of media were added to the bottom wells. After 48 h of CO2 incubation at 37 °C, the non-invasive cells on the upper surface were removed, and the cells that had migrated to the lower surface were fixed in 500 μl of Cell Dissociation Solution/Calcein-AM, incubated at 37 °C in a CO2 incubator for 1 h and quantified by fluorimetric analysis (485 nm excitation, 520 nm emission).
3.2. Differentially expressed circRNA identification To obtain the differentially expressed circRNA, we performed highthroughput sequencing to identify the differentially expressed circRNAs in the 20 ng/ml IFN-γ treatment group and the control group. The results showed that 4788 circRNA molecules with over two back-splicing reads were identified in this study in the IFN-γ treatment group and control group (Supplement Fig. 1A). The 4788 circRNA molecules were mainly derived from exon (Supplement Fig. 1B). Most of circRNAs were less than 1000bp in length (Supplement Fig. 1C), and the first three chromosomes with the largest distribution of detected circular molecules were chromosome 1, chromosome 2, and chromosome 3 in the IFN-γ treatment group and control group (Supplement Fig. 1D). Heatmap and volcano maps showed that 827 differentially expressed
2.5. High-throughput sequencing The Ribo-Zero Gold Kit (Epicentre, USA) was used to remove ribosomal RNA of 8 μg total RNA. The total RNA without ribosomal RNA was incubated with 10 U/μg RNase R (Epicentre, Madison, WI) at 37 °C for 1 h. A mRNA-Seq sample preparation kit was used to construct cDNA libraries according to the manufacturer’s instructions (Illumina, USA). A 2 × 150 bp paired-end sequencing strategy was carried out on the Illumina Hiseq4000 platform. Differential expressions of circRNAs were identified [26]. The Illumina® TruSeqsmall RNA Library Prep Kit 3
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 1. IFN-γ promoted EMT in PC-3 M IE8 cells. (A) Western blot analysis of EMT-related biomarkers in PC-3 M IE8 cells under different treatment conditions. (B) Semi-quantitative results of graph A. (C) Cell migration analysis of PC-3 M IE8 cells under different treatment conditions. (D) Cell invasion analysis of PC-3 M IE8 cells under different treatment conditions. *P < 0.05 and **P < 0.01 represent significant difference compared with the control group.
differentially expressed miRNAs were enriched in the PI3K-Akt and MAPK signaling pathways related to EMT (Fig. 3D).
circRNAs were significantly upregulated and 1279 differentially expressed circRNAs were significantly downregulated in the IFN-γ group compared with the control group (Fig. 2A and B). GO annotation of all 2106 differentially expressed circRNA target genes was carried out using KOBAS software (http://kobas.cbi.pku.edu.cn/home.do) (Fig. 2C). The GO annotation results indicated that biological processes, cellular process, single organism process in biological processes; cell, cell part, and organelle in the cellular component; and binding and catalytic activities in the molecular function were the main biological processes related to EMT in PC-3M IE8 cells. KEGG analysis showed that the mTOR, Wnt, and MAPK signaling pathways related to EMT were functional enrichment pathways (Fig. 2D).
3.4. CircRNA identification To further analyze circRNAs and miRNAs associated with tumor metastasis, we further screened the differentially expressed molecules in this study: five downregulated expression circRNAs, three upregulated expression circRNAs, and the corresponding miRNAs related with EMT, according to bioinformatic analyses (Table 2). To confirm the sequencing result, we identified the expression levels of preselected hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001414, and hsa_circ_0001165 with the qPCR method. The amplification productions were analyzed with agarose gel electrophoresis and the Sanger sequencing method (Fig. 4A and B). Agarose gel electrophoresis showed both ring and linear primers could amplify a single band in the cDNA, while only linear primers could amplify a single band in the gDNA, suggesting that four circRNAs had bands of expected sizes in cDNA in the IFN-γ treatment group (Fig. 4A). Sanger sequencing showed that hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001414, and hsa_circ_0001165 could form rings (Fig. 4B). We identified the expressions of hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001414, hsa_circ_0001165, hsa-miR-196b-5p, hsa-miR-187-3p, hsa-miR-20a-5p, and hsa-miR-301-3p in normal and 20 ng/ml IFN-γ treated PC-3M IE8 cells and PC3 cells with qPCR (Fig. 4C). The results revealed that the expressions of hsa_circ_0001085, hsa_circ_0004916, hsa_circ_0001165 in
3.3. Differentially expressed miRNAs identification To obtain the differentially expressed miRNA, the differentially expressed miRNAs were identified in the IFN-γ treatment group and the control group. Heatmap and volcano maps showed that 39 differentially expressed miRNAs were significantly upregulated and 2,076 differentially expressed miRNAs were significantly downregulated in the IFN-γ treatment group compared with the control group (Fig. 3A and B). GO annotation showed the differentially expressed miRNAs were mainly concentrated in biological processes, followed by cellular components, which was consistent with the functional enrichment of differentially expressed circRNAs (Fig. 3C). KEGG analysis showed that pathways in cancer were the top enriched terms. Moreover, 4
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 2. Function analysis of differentially expressed circRNAs between the two groups. (A) Volcano map of differentially expressed circRNAs between the two groups. (B) Heatmap analysis of differentially expressed circRNAs between the two groups. (C) Gene Ontology (GO) analysis of differentially expressed circRNAs. (D) KEGG analysis of differentially expressed circRNAs.
Memczak et al. identified approximately 2000 human circRNAs, 1900 mouse circRNAs, and 700 nematode circRNAs using RNA sequencing [33]. Previous study have shown that circRNA is involved in a variety of diseases and plays an important role in tumors [34]. However, there is little evidence regarding the role of circRNA in prostate cancer. In this study, we employed high-throughput sequencing to examine the potential effects of circRNA in prostate cancer cells with an EMT induction model. Four differentially expressed circRNAs and miRNAs that were related to EMT were identified by a qPCR approach in prostate cancer cells with an EMT induction model. The potential relationship of the four circRNAs, miRNAs, and the EMT-related genes was studied. During tumor development, the surrounding microenvironment stimulates tumor cells to induce EMT. The characteristics of EMT in tumor cells include changes in cell polarity and enhanced cell migration, which in turn promotes the migration, invasion, and metastasis of cells [35]. To explore the relevance of circRNA and EMT in prostate cancer, we employed IFN-γ to induce EMT in PC-3M IE8 cells. The study of invasion and migration suggested that 20 ng/ml IFN-γ could effectively induce EMT in PC-3M IE8 cells, which was further verified by western blot analysis of EMT-related biomarkers (E-cadherin and Twist). E-cadherin belongs to the family of cadherins and is a transmembrane glycoprotein that is highly sensitive to calcium ions. This molecule can mediate adhesion between epithelial cells and maintain tissue integrity and polarity [36]. Many factors influence the expression of E-cadherin, and downregulated expression can lead to a decrease in adhesion between cells. For this reason, this molecule is considered an
PC-3M IE8 cells treated with IFN-γ were consistent with the highthroughput sequencing results. Meanwhile, the expression of the three molecules mentioned above in PC-3 cells was similar to in PC-3M IE8 cells. The expression of hsa-miR-20a-5p and hsa-miR-301b-3p in the 20 ng/ml IFN-γ treatment group was consistent with the high-throughput sequencing results (Fig. 4D). Based on the expression and sequence results, we selected hsa_circ_0001165 and hsa_circ_0001085 to construct the network of circRNA-miRNA-mRNA. Fig. 5 shows that hsa_circ_0001165 may regulate TNF expression through hsa-miR-187-3p to induce EMT in prostatic cancer cells. Hsa_circ_0001085 may indirectly regulate AKT1 and PIK3CG protein expression levels through the PI3KAkt signaling pathway, TGFBR2 protein expression level through the TGF-β signaling pathway through hsa-miR-196b-5p, and MAPK1 protein expression level through the MAPK signaling pathway through hsamiR-451a, which played a regulatory role in prostate cancer cells in the EMT induction model. 4. Discussion CircRNA is a type of non-coding RNA that is widely found in eukaryotes. The molecule has a variety of unique features, including structural stability, tissue specificity, and species evolutionary conservation. CircRNA has been studied for many years [30]. Nigro et al. observed that the exon of the DCC gene is reversely linked to form circRNA in human cells [31]. Jeck et al. detected more than 25,000 circRNAs in human fibroblasts by high-throughput sequencing [32]. 5
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 3. Function analysis of differentially expressed miRNAs between the two groups. (A) Volcano map of differentially expressed miRNAs between the two groups. (B) Heatmap analysis of differentially expressed miRNAs between the two groups. (C) Gene Ontology (GO) analysis of differentially expressed miRNAs. (D) KEGG analysis of differentially expressed miRNAs.
undifferentiated tissue [38]. Studies have confirmed that Twist is involved in the development of EMT in epithelial-derived tumor cells, which promotes tumor invasion and metastasis [35]. In this study, the expression of Twist was significantly higher in PC-3 M IE8 cells in the
important marker of EMT development [37]. Meanwhile, Twist is an alkaline helix-loop-helix (bHLH) transcription factor present in flies, mice, humans, and other organisms. It is mainly expressed in the placenta, embryonic mesoderm or in adult mesoderm-derived
Table 2 EMT related circRNA and miRNA identified in this study. circRNA Up-Down-Regulation (IFN-γ/Con)
circRNA
miRNA Up-Down-Regulation (IFN-γ/Con)
miRNA combined with circRNA
Down Down
hsa_circ_0006832 hsa_circ_0001085
Down Down Down Up
hsa_circ_0004916 hsa_circ_0008301 hsa_circ_0001414 hsa_circ_0001326
Up
hsa_circ_0001165
Up
hsa_circ_0008210
Up Up Up Up Up Up Up Down Down Down Down Down Down Down Down Down Down Down
hsa-miR-548o-3p hsa-miR-96-5p hsa-miR-196b-5p hsa-miR-548o-3p hsa-miR-20a-5p hsa-miR-486-5p hsa-miR-301b-3p hsa-miR-141-5p hsa-miR-608 hsa-miR-146a-3p hsa-miR-96-3p hsa-miR-187-3p hsa-miR-141-5p hsa-miR-146a-3p hsa-miR-96-3p hsa-miR-216b-5p hsa-miR-187-3p hsa-miR-608
6
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 4. CircRNA verification and expression analysis. (A) Head-to-tail splicing of three circRNAs was confirmed by the Sanger sequencing method. (B) Four circRNAs were amplified using divergent and convergent primers with cDNA and gDNA of both the groups. CircRNAs could only be amplified in the cDNA template. M: DNA molecular markers. The sizes of two bands are 200 and 100 bp. (C) qPCR analysis of expressions of four circRNAs in PC-3 M IE8 and PC-3 cells with or without 20 ng/ ml IFN-γ treatment. * P < 0.05, **P < 0.01.
miRNAs, circRNAs and target genes was predicted. The results suggested that hsa_circ_0001165 may regulate TNF expression through hsamiR-187-3p to induce EMT in prostatic cancer cells. Hsa_circ_0001085 may indirectly regulate AKT1 and PIK3CG protein expression levels through the PI3K-Akt signaling pathway, TGFBR2 protein expression level through the TGF-β signaling pathway through hsa-miR-196b-5p, and MAPK1 protein expression level through the MAPK signaling pathway through hsa-miR-451a, which played a regulatory role in prostate cancer cells in the EMT induction model. TGF-β has been shown to promote EMT progression by activating kinase-dependent signaling processes. Inhibition of the TGF-βor receptor may inhibit tumor invasion and metastasis [42]. Meanwhile, The PI3K/Akt signaling pathway has been shown to be involved in the induction of EMT in cancer cells. Activated PI3K produces a second messenger, PIP3, that activates downstream Akt, which in turn activates or inhibits downstream target proteins by phosphorylation. This cascade reaction can regulate the survival, proliferation, and differentiation of the cytoskeleton and induce EMT. Therefore, activation of the PI3K/Akt signaling
EMT induction model, which is consistent with the results of previous studies. Our results indicated that 20 ng/ml IFN-γ was an effective dosage for EMT induction in PC-3M IE8 cells. High-throughput sequencing was performed to screen the differentially expressed circRNAs and miRNAs in prostate cancer cells with the EMT induction model. miRNA is a group of endogenous non-coding protein single-stranded RNAs that binds to the 3′non-coding region (3′UTR) of the target mRNA, resulting in mRNA cleavage degradation at post-transcriptional levels. Therefore, this molecule can indirectly regulate gene expression [39]. miRNA is widely involved in many biological processes such as cell differentiation, proliferation, apoptosis, stress, and immunity, and also plays an important role in tumors [40]. An increasing amount of evidence suggests that miRNAs has a regulatory effect on prostate cancer EMT and can affect the transmission of the EMT signaling pathway and the expression of downstream genes [41]. In this study, we employed a PCR method to identify the sequencing results of four miRNAs and circRNAs. The relationship between the four 7
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
Fig. 5. Regulatory network analysis of hsa_circ_0001165 and hsa_circ_0001085.
Appendix A. Supplementary data
pathway increases the invasiveness and metastasis of tumor cells [43,44]. At the same time, research shows that snail transcription factor may induce EMT in prostate cancer cells through the MAPK pathway [45] and Let-7a also promotes the invasion and metastasis of prostate cancer cells via the MAPK pathway [46]. The RAS/MAPK pathway has been shown to be significantly activated in a prostate cancer metastasis model [47]. These findings are consistent with the results of our research.
Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.prp.2019.152784. References [1] P. Rawla, Epidemiology of prostate Cancer, World J. Oncol. 10 (2) (2019) 63–89. [2] D.W. Ye, Y. Zhu, Prostate cancer and prostatic diseases best of China, 2018, Prostate Cancer Prostatic Dis. 22 (1) (2019) 1–2. [3] M. van Son, et al., Focal salvage treatment of radiorecurrent prostate Cancer: a narrative review of current strategies and future perspectives, Cancers (Basel) 10 (12) (2018). [4] S. Ziaee, et al., Prostate cancer metastasis: roles of recruitment and reprogramming, cell signal network and three-dimensional growth characteristics, Transl. Androl. Urol. 4 (4) (2015) 438–454. [5] I.J. Fidler, The pathogenesis of cancer metastasis: the’ seed and soil’ hypothesis revisited, Nat. Rev. Cancer 3 (6) (2003) 453–458. [6] L. Dong, et al., Metastatic prostate cancer remains incurable, why? Asian J. Urol. 6 (1) (2019) 26–41. [7] Y. Liao, K. Xu, Epigenetic regulation of prostate cancer: the theories and the clinical implications, Asian J. Androl. 21 (3) (2019) 279–290. [8] T.N. Seyfried, L.C. Huysentruyt, On the origin of cancer metastasis, Crit. Rev. Oncog. 18 (1–2) (2013) 43–73. [9] A.W. Lambert, D.R. Pattabiraman, R.A. Weinberg, Emerging biological principles of metastasis, Cell 168 (4) (2017) 670–691. [10] W. Yu, et al., Cadherin signaling in Cancer: its functions and role as a therapeutic target, Front. Oncol. 9 (2019) 989. [11] K.A. Cheaito, et al., EMT markers in locally-advanced prostate Cancer: predicting recurrence? Front. Oncol. 9 (2019) 131. [12] S. Figiel, et al., Clinical significance of epithelial-mesenchymal transition markers in prostate cancer, Hum. Pathol. 61 (2017) 26–32. [13] H. Dicken, P.J. Hensley, N. Kyprianou, Prostate tumor neuroendocrine differentiation via EMT: the road less traveled, Asian J. Urol. 6 (1) (2019) 82–90. [14] S.P. Barrett, J. Salzman, Circular RNAs: analysis, expression and potential functions, Development 143 (11) (2016) 1838–1847. [15] S. Lamouille, J. Xu, R. Derynck, Molecular mechanisms of epithelial-mesenchymal transition, Nat. Rev. Mol. Cell Biol. 15 (3) (2014) 178–196. [16] G.W. Pearson, Control of invasion by epithelial-to-mesenchymal transition programs during metastasis, J. Clin. Med. 8 (5) (2019). [17] L.M. Holdt, A. Kohlmaier, D. Teupser, Molecular roles and function of circular RNAs in eukaryotic cells, Cell. Mol. Life Sci. 75 (6) (2018) 1071–1098. [18] M. Paolillo, S. Schinelli, Extracellular matrix alterations in metastatic processes, Int. J. Mol. Sci. 20 (19) (2019).
5. Conclusion hsa_circ_0001165 may regulate TNF expression through hsa-miR187-3p to induce the EMT in prostate cancer cells. hsa_circ_0001085 may indirectly regulate the PI3K-Akt signaling pathway and TGF-β signaling pathway through hsa-miR-196b-5p, and the MAPK signaling pathway through has-miR-451a. The results obtained in this study lay the foundations for further in-depth research. Author statement Zhijian Yan and Guangcheng Luo were responsible for the study design. Zhijian Yan, Yiming Xiao, Yiyan Chen, and Guangcheng Luo were responsible for the experimental studies. Declaration of Competing Interest The authors declare no competing financial interest. Acknowledgment This research was supported by the Project of Science and Technology Bureau of Xiamen,China in(3502Z20174077 and 3502Z20184033) for financial support. 8
Pathology - Research and Practice xxx (xxxx) xxxx
Z. Yan, et al.
10 (1) (2017) 2. [35] D.S. Micalizzi, S.M. Farabaugh, H.L. Ford, Epithelial-mesenchymal transition in cancer: parallels between normal development and tumor progression, J. Mammary Gland Biol. Neoplasia 15 (2) (2010) 117–134. [36] L. Li, S.A. Bennett, L. Wang, Role of E-cadherin and other cell adhesion molecules in survival and differentiation of human pluripotent stem cells, Cell Adh. Migr. 6 (1) (2012) 59–70. [37] T.T. Onder, et al., Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways, Cancer Res. 68 (10) (2008) 3645–3654. [38] S. Ansieau, et al., TWISTing an embryonic transcription factor into an oncoprotein, Oncogene 29 (22) (2010) 3173–3184. [39] E.J. Tokar, MicroRNAs: small molecules with big effects, Toxicol. Appl. Pharmacol. 312 (2016) 1–2. [40] P. Gandellini, E. Giovannetti, F. Nicassio, MicroRNAs in Cancer management: big challenges for small molecules, Biomed Res. Int. 2015 (2015) 982156. [41] J. Liu, et al., MicroRNAs, an active and versatile group in cancers, Int. J. Oral Sci. 3 (4) (2011) 165–175. [42] J. Zavadil, E.P. Bottinger, TGF-beta and epithelial-to-mesenchymal transitions, Oncogene 24 (37) (2005) 5764–5774. [43] S.J. Grille, et al., The protein kinase Akt induces epithelial mesenchymal transition and promotes enhanced motility and invasiveness of squamous cell carcinoma lines, Cancer Res. 63 (9) (2003) 2172–2178. [44] W. Yan, et al., PI3 kinase/Akt signaling mediates epithelial-mesenchymal transition in hypoxic hepatocellular carcinoma cells, Biochem. Biophys. Res. Commun. 382 (3) (2009) 631–636. [45] C.L. Neal, D. McKeithen, V.A. Odero-Marah, Snail negatively regulates cell adhesion to extracellular matrix and integrin expression via the MAPK pathway in prostate cancer cells, Cell Adh. Migr. 5 (3) (2011) 249–257. [46] G. Tang, et al., MiRNALet-7a mediates prostate cancer PC-3 cell invasion, migration by inducing epithelial-mesenchymal transition through CCR7/MAPK pathway, J. Cell. Biochem. 119 (4) (2018) 3725–3731. [47] D.J. Mulholland, et al., Pten loss and RAS/MAPK activation cooperate to promote EMT and metastasis initiated from prostate cancer stem/progenitor cells, Cancer Res. 72 (7) (2012) 1878–1889.
[19] S. Qu, et al., Circular RNA: a new star of noncoding RNAs, Cancer Lett. 365 (2) (2015) 141–148. [20] F. Wang, A.J. Nazarali, S. Ji, Circular RNAs as potential biomarkers for cancer diagnosis and therapy, Am. J. Cancer Res. 6 (6) (2016) 1167–1176. [21] S. Qu, et al., The emerging landscape of circular RNA in life processes, RNA Biol. 14 (8) (2017) 992–999. [22] Y. Feng, et al., Circular RNA circ0005276 promotes the proliferation and migration of prostate cancer cells by interacting with FUS to transcriptionally activate XIAP, Cell Death Dis. 10 (11) (2019) 792. [23] C. Jin, et al., Silencing circular RNA circZNF609 restrains growth, migration and invasion by up-regulating microRNA-186-5p in prostate cancer, Artif. Cells Nanomed. Biotechnol. 47 (1) (2019) 3350–3358. [24] Y.H. Xu, Z.L. Li, S.F. Qiu, IFN-gamma induces gastric Cancer cell proliferation and metastasis through upregulation of integrin beta3-Mediated NF-kappaB signaling, Transl. Oncol. 11 (1) (2018) 182–192. [25] U.G. Lo, et al., IFNgamma-induced IFIT5 promotes epithelial-to-Mesenchymal transition in prostate Cancer via miRNA processing, Cancer Res. 79 (6) (2019) 1098–1112. [26] K.K. Ebbesen, J. Kjems, T.B. Hansen, Circular RNAs: identification, biogenesis and function, Biochim. Biophys. Acta 1859 (1) (2016) 163–168. [27] T.B. Hansen, et al., Natural RNA circles function as efficient microRNA sponges, Nature 495 (7441) (2013) 384–388. [28] Z. Li, et al., Exon-intron circular RNAs regulate transcription in the nucleus, Nat. Struct. Mol. Biol. 22 (3) (2015) 256–264. [29] W. Zhao, et al., Genome-wide identification and characterization of circular RNAs by high throughput sequencing in soybean, Sci. Rep. 7 (1) (2017) 5636. [30] H.L. Sanger, et al., Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures, Proc Natl Acad Sci U S A 73 (11) (1976) 3852–3856. [31] J.M. Nigro, et al., Scrambled exons, Cell 64 (3) (1991) 607–613. [32] W.R. Jeck, et al., Circular RNAs are abundant, conserved, and associated with ALU repeats, Rna 19 (2) (2013) 141–157. [33] S. Memczak, et al., Circular RNAs are a large class of animal RNAs with regulatory potency, Nature 495 (7441) (2013) 333–338. [34] Y. Dong, et al., Circular RNAs in cancer: an emerging key player, J. Hematol. Oncol.
9