- Email: [email protected]
Seasonal expressions of oxytocin and oxytocin receptor in epididymis of the male muskrat (Ondatra zibethicus)
Theriogenology 124 (2019) 24e31
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Seasonal expressions of oxytocin and oxytocin receptor in epididymis of the male muskrat (Ondatra zibethicus) Q. Liu, W. Xie, Y. Xiao, F. Gao, Q. Gao, H. Zhang, Y. Han, Z. Yuan, Q. Weng* College of Biological Science and Technology, Beijing Forestry University, Beijing, 100083, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 July 2018 Received in revised form 3 October 2018 Accepted 6 October 2018 Available online 9 October 2018
Oxytocin (OT) is presented in the male reproductive tract and has various physiological functions, such as stimulating contraction of the reproductive tract and aiding sperm transport. In this study we investigated seasonal expressions of OT and oxytocin receptor (OTR) in the epididymis of the muskrat during the breeding and non-breeding seasons. Morphologically, the weight and length of epididymis in the breeding season were significantly higher than those in the non-breeding season. In the breeding season, the lumen diameter and epithelial thickness of epididymis increased significantly, and there were a large number of sperms in the lumen. However, in the non-breeding season, the diameter of the lumen became significantly narrower, the epithelial height became thinner, and there was no sperm in the lumen. Immunohistochemical results showed that OT and OTR were presented in the cytoplasm of epithelial cells and smooth muscle cells within the epididymis, and the immunostainings of OT and OTR in the breeding season were significantly stronger compared with the non-breeding. In consistent with the immunohistochemical results, the mRNA levels of OT and OTR were higher in the whole epididymis during the breeding season than those in the non-breeding season. In addition, the concentrations of OT in the epididymis and sera were both significantly higher in the breeding season when compared to the non-breeding season. These results suggested that the epididymis of the muskrat was the direct target organ of OT, and OT might play a regulatory role in the epididymal function via endocrine or autocrine/ paracrine manners. © 2018 Elsevier Inc. All rights reserved.
Keywords: Epididymis Muskrat Oxytocin Oxytocin receptor Seasonal expression
1. Introduction Epididymis is an elongated and convoluted single duct and locate on the posterolateral side of the testis [1]. According to the structure and function, the epididymis of all mammalian can be roughly divided into caput, corpus and cauda [2]. The wall of the epididymis tube is composed of a pseudostratified stereociliated columnar epithelium and a thin layer of smooth muscle [3]. The epithelium of epididymis has many kinds of cells, including principal, basal, narrow, apical, halo, and clear cells surrounded by multiple layers of peritubular myoid cells, of which the principal cell and basal cell are the most important cell types [4]. Epithelial cells of epididymis have absorption and secretion function, which can secrete glycerophosphocholine and glycoproteins, help to maintain the viability of sperm [5]. And epididymal muscle cells
* Corresponding author. Laboratory of Animal Physiology, College of Biological Sciences and Biotechnology, Beijing Forestry University, Beijing, 100083, China. E-mail address: [email protected] (Q. Weng). https://doi.org/10.1016/j.theriogenology.2018.10.009 0093-691X/© 2018 Elsevier Inc. All rights reserved.
can help the sperm to move in the tract due to their motility contractile function [5]. The epididymis can store sperm, feed sperm nutrition, and promote sperm maturation. Only through the epididymis can sperms reach a physiological maturity and have the ability to fertilize the oocytes [6]. Oxytocin (OT) is a nonapeptide hormone equally presented in the posterior pituitary of both sexes. It is produced primarily in the neurons of the hypothalamic paraventricular nucleus and supraoptic nucleus and released into systemic circulation by posterior pituitary [7]. It plays a role in social bonding and sexual reproduction in both sexes, during and after childbirth [8,9]. The oxytocin peptide is synthesized as an inactive precursor protein from the oxytocin gene, which goes through post-translational progressive hydrolysis facilitated by a series of enzymes before maturing into the active form [10]. Outside the brain, the cells that contain OT have been identified in several different tissues, including the corpus luteum [11] and the placenta [12] in females as well as the testis and epididymis [13] in males. To exert peripheral hormonal actions in the reproductive system, the functional
Q. Liu et al. / Theriogenology 124 (2019) 24e31
receptor for OT must be presented. The oxytocin receptor (OTR) is a protein which belongs to the G-protein coupled receptor family, and its activity is mediated by G proteins that activate several different second messenger systems [14,15]. So far, studies about OTR function in peripheral organs have been mainly focusing on the reproductive system [16]. OTR is involved in the regulation of multiple physiological activities in peripheral tissues, such as the female uterine contractions and mammary gland milk ejection, as well as the male penile erection and ejaculation [17]. Although the research on the function of OT in the male reproductive system has long been reported [18], there are still many deficiencies in the study of OT function in the male reproductive tract, such as the effects of OT on the morphology and function of epididymis during different seasons. The muskrat (Ondatra zibethicus) is a medium-sized, semiaquatic rodent species with precious medicinal and economic values because of its meat, fur and musk. Especially, the musk is a widely-used and costly ingredient in traditional Chinese medicine and a raw material for making high-end perfumes [19,20]. The common name of the muskrat is derived from the conspicuous odor of secretions from paired perineal musk glands found beneath the skin at the ventral base of the tail [21]. The muskrat is a typical seasonal breeder whose annual life cycle can be roughly divided into the breeding season (March to October) and the non-breeding season (November to next February) [22]. Although several observations about reproduction in muskrat have been reported recently [23,24], there are still many gaps in understanding of the mechanisms of reproduction, such as sperm progression and maturation during different periods. In this study, we investigated the expressions and localizations of OT and OTR in the epididymis of the muskrat during the breeding and non-breeding seasons, to elucidate the relationship between OT and OTR and the epididymal function in the muskrat. 2. Materials and methods 2.1. Animals and tissues collections Thirty adult muskrats were obtained in the breeding (n ¼ 15) and the non-breeding (n ¼ 15) seasons from Jinmu Muskrat Breeding Farm, Hebei Province, China. The muskrats were kept with a pattern of one male and one female in one enclosure. All the procedures on animals were carried out in accordance with the Policy on the Care and Use of Animals by the Ethical Committee, Beijing Forestry University. Male muskrats were deeply anesthetized with ether and weighed, and then each pair of the epididymis was excised from the male muskrats after sacrificing, the epididymal weight and length were recorded. One of the epididymis was immediately fixed for 12 h in Bouin's solution and then stored in 70% ethanol for histological and immunohistochemical observations. The other of epididymis were immediately stored at 80 C for reverse transcription-polymerase chain reaction (RT-PCR) detection and hormone analysis. Blood samples were collected and centrifuged at 3000 g for 20 min to separate sera from blood cells, sera were collected and stored at 20 C for hormonal analysis. 2.2. Antibodies The primary antibodies were used in the present study included rabbit polyclonal anti-OTR (bs-1314R, Beijing Biosynthesis Biotechnology CO. LTD, Beijing, China), OT (bs-17581R, Beijing Biosynthesis Biotechnology CO. LTD, Beijing, China), and mouse polyclonal anti-b-actin (bsm-33139M, Beijing Biosynthesis Biotechnology CO. LTD, Beijing, China). The dilution ranges of OT,
25
OTR and b-actin antibodies for immunohistochemistry were 1: 500. The specificity of OT and OTR antibodies had been described in our previous study on the muskrat [25]. 2.3. Histology The epididymis was dehydrated in ethanol series and embedded in paraffin. Serial sections (5 mm) were mounted on slides coated with poly-L-lysine. Some sections were stained with hematoxylineosin (HE) for the general histological observation. The rest of the sections were processed for immunohistochemistry. 2.4. Immunohistochemistry The epididymal serial paraffin sections were incubated with 10% normal goat serum (C-0005, Beijing Biosynthesis Biotechnology CO. LTD, Beijing, China) to reduce background staining. The sections were then incubated with primary antibody for 12 h at 4 C. Subsequent incubations with the secondary antibody, goat anti-rabbit IgG conjugated with biotin and peroxidase with avidin, using rabbit ExtrAvidin Peroxidase staining kit (Sigma Chemical Co., St. Louis, MO, USA) was performed, followed by visualizing with 30 mg 3,3diaminobenzidine (Wako, Tokyo, Japan) solution in 150 ml of 0.05 mM Tris-HCl buffer, pH 7.6, plus 30 ml H2O2. Control sections were treated with normal goat serum instead of the primary antisera. immunohistochemical staining was determined as positive (þ), strong positive (þþ), very strong positive (þþþ), and negative (). Staining that was weak but higher than control was set as positive (þ); the highest intensity staining was set as very strong positive (þþþ); staining intensity between þ and þþþ was set as strong positive (þþ). 2.5. RNA isolation Total RNAs were extracted from epididymal tissues using Trizol Reagent (Invitrogen, Carlsbad, CA, USA). Approximately 0.1 g of epididymal tissues were thawed and immediately homogenized in 1 ml of Trizol Reagent by ultrasonic crusher. The homogenates were incubated at room temperature for 5 min to completely separate the nuclear protein complexes. After the addition of 0.2 ml chloroform, the mixture was vigorously shaken for 15 s at room temperature and centrifuged at 12,000 g for 20 min at 4 C. The aqueous phase was then transferred to RNase fresh tube and added 500 ml of isopropanol. Then the sample was kept for 10 min at room temperature. RNA was precipitated by centrifugation at 12,000 g for 20 min at 4 C. The RNA pellet was washed twice with 70% ethanol, briefly dried under air, and dissolved in 30 ml of diethylprocarbonate-treated water. The integrity of total RNA was tested by gel electrophoresis, and after measurement of concentration with spectrophotometer, RNA was diluted to 500 ng/ml. 2.6. RT-PCR The first-strand cDNA from total RNA was synthesized using StarScript II First-strand cDNA Synthesis Mix (GenStar, Beijing, China). The 20 ml of reaction mixture contained 2 ml of total RNA, 1 ml of Oligo (dT) 18, 1 ml of StarScript II RT Mix, 10 ml of 2 Reaction mix, 6 ml of diethylprocarbonate-dd H2O. The 20 ml of RT-PCR reaction mixture contained 1 ml of first-strand cDNA, 1 ml of each primer (10 mM), 7 ml dd H2O, 10 ml 2 Taq PCR StarMix with Loading Dye (GenStar, Beijing, China). The amplification was under the following condition: 94 C for 3 min for the initial denaturation of the RNA/cDNA hybrid, 35 cycles of 94 C for 30 s, 56.2 C, 57.5 C and 58.5 C (for otr, ot and Actb, respectively) for 30 s and 72 C for 1 min with a final extension of 10 min at 72 C. The first-strand cDNA was
26
Q. Liu et al. / Theriogenology 124 (2019) 24e31
2.8. Statistical analysis
Table 1 Oligonucleotide primers used for quantitative RT-PCR.
otr ot Actb
Sequence of primer
Product size (bp)
F: 50 TGGCCTCATCAGCTTCAAGA 30 R: 50 ACACGATGAAGGCCAGTACA 30 F: 50 CTTGGCCTACTGGCTCTGAC 30 R: 50 GGGCAGGTAGTTCTCCTCCT 30 F: 50 GACTCGTCGTACTCCTGCTT 30 R: 50 AAGACCTCTATGCCAACACC 30
203 483 223
Statistical comparisons were made with the Student's t-test, one-way ANOVA followed by Tukey test or correlation analysis using Graphpad prism software (Version 5.0, GraphPad Software, Inc., San Diego, USA). A value of P < 0.05 was considered indication of statistical significance.
3. Results used for PCR amplification with the following primers (Table 1). The PCR products were electrophoresed in the 1% agarose gel and individual bands were visualized by Gelred (Biotium, Fremont, USA). The housekeeping gene Actb was selected as the endogenous control. The bands were quantified by using Quantity One Software (Bio-Rad Laboratories, Inc., USA, version 4.5) and the relative expression ratios relative to Actb were calculated. 2.7. Hormone assays The epididymis and sera samples from each muskrat were analyzed by the enzyme linked immunosorbent assay (ELISA) to detect OT concentration using the ELISA Kit (Kit CSB-E14197r for OT, Cusabio Biotech Co., Ltd., Wuhan, China). Samples preparation were performed according to the user manual. Tissue samples were rinsed with PBS, and then homogenized in 1 ml of PBS and stored overnight at 20 C. Next, the homogenates were thawed and centrifuged for 5 min at 5000 g at 4 C. Then the supernatant was collected and assayed. The sera samples were centrifuged for 15 min at 3000 g at 4 C, and then the supernatant was collected and assayed. The minimum level of OT detection of this ELISA kit is 9.375 pg ml1. The intra/inter-assay variation were both less than 15% for OT.
B
NB
The morphological differences of the epididymis of the muskrat were observed between the breeding and non-breeding seasons (Fig. 1a and b). The average weight and length of the epididymis in the breeding season were significantly higher than those in the non-breeding season, as shown in Fig. 1c and d. The higher values of epididymal weight (0.37 ± 0.03 g), length (4.35 ± 0.4 cm) occurred during the breeding season. The parameters including epididymal weight (0.17 ± 0.02 g), length (2.5 ± 0.03 cm) significantly decreased in the non-breeding season. Histological observation revealed that distinct changes in the caput, corpus and cauda of epididymis from the breeding and non-breeding seasons (Fig. 2). During the breeding season (Fig. 2a, b, c), there were wide epithelial thickness and large lumen diameter with abundant mature sperms. However, the narrow epithelial thickness and cramped lumen diameter were found in the non-breeding season (Fig. 2d, e, f). Meanwhile, no sperm was observed in the epididymis of the nonbreeding season. The significant differences in lumen diameter and epithelial thickness of the caput, corpus and cauda in the epididymis between the breeding and non-breeding seasons were shown in Fig. 3. The seasonal immunohistochemical localizations of OT and OTR in the epididymis of the muskrat were shown in Fig. 4 and Fig. 5, respectively. OT was detected in epithelial cells and smooth muscle
b
a caput
corpus
cauda
B 1cm
NB
c
d ***
***
Fig. 1. Morphological difference of the epididymis between the breeding and non-breeding seasons. The testis and epididymis excised from the male muskrat in the breeding (a, left) and non-breeding seasons (a, right). The part of the black coil represents the epididymis (a). Comparison of epididymal morphology in the breeding and non-breeding seasons (b). The dotted line indicates boundary of caput, corpus, cauda and the location of the tissue slice. The average weight of epididymis (n ¼ 5) in breeding and non-breeding seasons (c). The average length of epididymis (n ¼ 5) in breeding and non-breeding seasons (d). Scale bars represents 1 cm. B, the breeding season; NB, the non-breeding season. The error bars represent means ± s.e.m. for five independent experiments. ***P < 0.001.
Q. Liu et al. / Theriogenology 124 (2019) 24e31
27
Fig. 2. Histological observation of the epididymis in the breeding (n ¼ 5) (a, b, c) and non-breeding seasons (n ¼ 5) (d, e, f). Scale bars represents 20 mm. EC, epithelial cell; SMC, smooth muscle cell; SPM, sperm.
cells of the epididymal caput, corpus, cauda in both seasons. Compared with the breeding season (Fig. 4a, b, c), the immunostaining intensity of OT was weaker in the non-breeding season (Fig. 4e, f, g). OTR was immunolocalized in epithelial cells and smooth muscle cells of the entire epididymis, and the immunoreactivity of OTR was more intense in the breeding seasons (Fig. 5a, b, c) than that in the non-breeding season (Fig. 5e, f, g). No positive signal was observed in the negative controls (Figs. 4d and 5d). All staining images were quantifed and summarized in Table 2. Seasonal expressions of ot and otr mRNA in epididymis were characterized by RT-PCR, as shown in Fig. 6. The mRNA levels of ot (Fig. 6a) and otr (Fig. 6b) in the epididymal caput and cauda were significantly higher during the breeding season than those in the non-breeding season. The correlation analysis between the mRNA levels of ot and otr in the epididymis and epididymal weight during the breeding and non-breeding seasons in the muskrat were performed and the results were shown in Fig. 7. The positive correlations were observed between the expressions of ot (Fig. 7a, R2 ¼ 0.8061, P < 0.05), otr (Fig. 7b, R2 ¼ 0.7576, P < 0.05) and epididymal weight in the muskrat, respectively. The seasonal concentrations of OT in the epididymis and sera of the muskrat were analyzed in Fig. 8. In the whole epididymis, OT
a
level in the epididymis was significantly lower in the non-breeding season as compared to that in the breeding season (Fig. 8a). Moreover, OT level in the sera decreased from 289 ± 54 pg ml1 in the breeding season to 207 ± 53 pg ml1 in the non-breeding season (Fig. 8b). 4. Discussion This was the first report that described the seasonal variations of the epididymis and the expressions of OT and OTR within the epididymis of the muskrat. The expression levels of OT and OTR were increased during the breeding season, and the hormone concentrations of OT in the epididymis and sera varied seasonally as well. Meanwhile, the seasonal expressions of OT and OTR in the epididymis were corresponding with the changes in the epididymal weight, length, epithelial thickness and lumen diameter of the muskrat. These findings suggested that the epididymis has the ability to synthesize OT, and OT may have a regulatory role in the epididymal function via endocrine or autocrine/paracrine manners. The seasonality of reproductive activity in males is associated with cyclic changes in the growth and involution of both testes and the accessory sex glands [26]. The previous study on the muskrat
b
Fig. 3. The lumen diameter of epididymis in the breeding (n ¼ 5) and non-breeding (n ¼ 5) seasons (a). The epithelial thickness of epididymis in the breeding (n ¼ 5) and nonbreeding seasons (n ¼ 5) (b). B, the breeding season; NB, the non-breeding season; The error bars represent means ± s.e.m. for five independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001.
28
Q. Liu et al. / Theriogenology 124 (2019) 24e31
Fig. 4. Seasonal immunolocalization of OT in the epididymis of the muskrat. Black arrows indicate the two cell types: epithelial cells, smooth muscle cells. Immunolocalization of OT in the breeding (n ¼ 5) (a, caput; b, corpus; c, cauda) and non-breeding seasons (n ¼ 5) (e, caput; f, corpus; g, cauda). d; negative control, sections were treated with normal rabbit serum instead of primary antisera. EC, epithelial cell, SMC, smooth muscle cell. B, the breeding season; NB, the non-breeding season. Scale bars represents 50 mm (aeg) and 20 mm (a’ - g’).
had shown that testicular weight and size with significantly high values in the breeding season, corresponding to higher levels of follicle stimulating hormone (FSH), luteinizing hormone (LH) and testosterone [27]. In this study, the epididymal morphology of the muskrat illustrated seasonal changes in the structural characteristics, showed that the length and weight of the epididymis and the quantity of sperm in the lumen varied in the different periods. These findings were similar to other animals [28e32]. In the wild male ground squirrel, the diameter of epididymis lumen was
maximal during the breeding season, and there was a large amount of spermatozoa in the lumen, while in the non-breeding season, the lumen appeared collapsed and no sperm was presented [28]. A study of viscacha also found that during the short period of gonadal regression, the epididymal cauda showed a decrease in luminal diameter and spermatozoa population, and an increase of lamina propria thickness [29]. One study on hamster suggested that the degeneration of epididymal morphology and disappearance of spermatozoa under short-day conditions [30]. Several studies
Fig. 5. Seasonal immunolocalization of OTR in the epididymis of the muskrat. Black arrows indicate the two cell types: epithelial cells, smooth muscle cells. Immunolocalization of OTR in the breeding (n ¼ 5) (a, caput; b, corpus; c, cauda) and in the non-breeding seasons (n ¼ 5) (e, caput; f, corpus; g, cauda). d; Negative control, sections were treated with normal rabbit serum instead of primary antisera. EC, epithelial cell; SMC, smooth muscle cell. B, the breeding season; NB, the non-breeding season. Scale bars represents 50 mm (aeg) and 20 mm (a’ - g’).
Q. Liu et al. / Theriogenology 124 (2019) 24e31
29
Table 2 Immunohistochemical localizations of OT and OTR in the epididymis of the muskrat. EC, epithelial cell; SMC, smooth muscle cell. B, the breeding season: NB, the non-breeding season. þ, positive staining; þþ, strong positive staining; þþþ, very strong positive staining; , negative staining. EC
SMC
B
OT OTR
NB
B
NB
caput
corpus
cauda
caput
corpus
cauda
caput
corpus
cauda
caput
corpus
cauda
þþþ þþ
þþþ þþþ
þþþ þþþ
þ þ
þ þ
þ þ
þþþ þþþ
þþ þþ
þþ þþ
þ þ
þ þ
þ þ
a
b
ot Actb
483bp 223bp
otr Actb
203bp 223bp
Fig. 6. Seasonal mRNA expressions of ot (a) and otr (b) in the epididymis (B, n ¼ 5; NB, n ¼ 5). The error bars represent means ± s.e.m. for five independent experiments. B, the breeding season; NB, the non-breeding season. *P < 0.05; **P < 0.01.
indicated that seasonal changes of epididymal morphology and function to some extent reflect the change in testicular tissue and the up-regulation and down-regulation of spermatogenesis in the testis, and the size and secretory activity of epithelium in the epididymis were influenced by testosterone [26,31,32]. Taken together published and current results, we supported the proposal that a cyclical alteration in the growth and involution of the epididymis might be universal in seasonal breeding mammal [28]. The OTR had been demonstrated to be localized in both the epithelial and muscular layers of the epididymis in several animals [33e35]. In this study, the immunohistochemical observation clearly showed that the immunoreactivity of OTR was distributed in the cytoplasm of epithelial cells and smooth muscle cells in the breeding season. The mRNA expression of OTR further confirmed
a
its presence in the epididymis. In fact, the localization of OTR in the epididymis changed with various sites of the epididymis in different species [15,16,33e35]. In human, OTR was not only presented in the smooth muscle cells of the epididymis but also in the epithelial compartment, suggested that OT might control epididymal motility and sperm progression through the male genital tract [33]. In rams, the data identified OTR on epithelial cells throughout the epididymis, on peritubular smooth muscle cells in the cauda epididymis, and on the epithelial cells and circular smooth muscle layers of the ductus deferens, revealing that OT may be involved in promoting sperm transit [34]. In dogs, the positive OTR immunostaining cells were found in the epithelium, lamina propria and muscular layer of entire epididymis, showed that OTR may have a significant impact on the maturation and transportation of sperm
b
Fig. 7. Correlation between mRNA expressions of ot (a) and otr (b) in the epididymis (n ¼ 5) and the epididymal weight (n ¼ 5) in the muskrat.
30
Q. Liu et al. / Theriogenology 124 (2019) 24e31
a
b
Fig. 8. Seasonal OT concentration in the epididymis (n ¼ 5) (a) and sera (n ¼ 5) (b). The error bars represent means ± s.e.m. for five independent experiments. B, the breeding season; NB, the non-breeding season. *P < 0.05; **P < 0.01.
in epididymis by promoting the secretion of epididymal epithelium and the contraction of the muscle layers [35]. Some other studies also speculated the presence of OTR in the muscle cells of the epididymis cauda was compatible with the contractility of that part of the organ that occurred during coitus and ejaculation [33], and OTR in epithelial cells may be related to the regulation of dihydrotestosterone (DHT) for epididymal growth and function maintenance [34]. In the present study, OTR was localized in the epithelial cells and smooth muscle cells throughout the entire epididymis. Therefore, the present results implied that OT might regulate the epididymal function of the muskrat by the locally expressed its receptor. The morphological characteristics of affiliated gonads usually show annual reproductive cycle changes with reproductive hormones [29]. Our previous studies showed that the sera concentrations of FSH, LH and prolactin in the male muskrat were higher in the breeding season than those in the non-breeding season [21,36]. In this study, the levels of OT in the epididymis and sera also showed a similar seasonal changes profile, with it increasing during the breeding season and decreasing during the non-breeding season. Consistent with the OT levels profile, the mRNA expression of OT in the epididymis was also higher in the breeding season than that in the non-breeding season as well. These findings suggested that the epididymis may be able to synthesize OT, which is likely to play an important regulatory role in the epididymal function via autocrine/paracrine manners. Previously, the local production of OT in peripheral organs has been reported, especially in the male reproductive tract [25]. The synthesis of OT in the testis and accessory gland had been demonstrated in many animals, including rat, sheep and human. There was a conclusive evidence that OT was synthesized within the mammalian testis, epididymis and prostate and the presence of OTR through the reproductive tract supported a local action for this peptide. OT had a paracrine role in stimulating contractility of the seminiferous tubule, epididymis and the prostate gland [37]. In guinea pigs, in vitro cultured Leydig cells were capable of producing an oxytocin-like peptide de novo [38]. In rams, OT was produced in the testicular Leydig and epididymal principal cells and increased during puberty [29]. In brushtail possums, the seasonal changes of local mesotocin (an OT-like peptide in marsupials) concentration might be related to the growth and regression of their prostate [39]. Our previous study on the scented gland of muskrat also found the scented gland could be able to synthesize OT, and OT may be required for the contraction of the scented gland to promote musk secretion during the breeding season [25]. Similarly, our results here suggested that OT might be synthesized in the smooth muscle cells and epithelial cells of the epididymis
and its level closely associated with the seasonal changes of epididymal morphology. In addition, the epididymal function in the muskrat may be regulated by the OT from both endocrine and autocrine/paracrine manners. In conclusion, our results described the seasonal expressions and localizations of OT and OTR in the epididymis of the muskrat and showed higher expression level in the breeding season, and the seasonal concentrations of OT was positively correlated with the morphological changes of epididymis and its mRNA expression level. These findings suggested that OT may be involved in the regulation of seasonal changes in the epididymal function of the muskrat via endocrine, autocrine or paracrine mechanisms. This study may contribute to achieve a better understanding of epididymal physiology in the seasonal reproduction of this rodent. Conflicts of interest The authors declare that they have no competing interests. Authors’ contributions QL, WX and QG participated in sample collection, performing the experiments, analyzing the data and drafting the manuscript. QL, YX, FG and HZ assisted with all experiments and helped revising the manuscript. YH, ZY and QW designed, supervised the study, and revised manuscript. All authors read and approved the final version. Acknowledgements This research work is supported by National Natural Science Foundation of China (31872320, 21806010) and Beijing Natural Science Foundation (8182039) and Young Scientist Start-up funding of Beijing Forestry University (BLX201714). References [1] Turner TT. De Graaf's thread: the human epididymis. J Androl 2008;29: 237e50. [2] Turner TT, Bomgardner D, Jacobs JP, Nguyen QA. Association of segmentation of the epididymal interstitium with segmented tubule function in rats and mice. Reproduction 2003;125:871e8. [3] Victor UO, Alese MO, Ashaolu OJ, Oluyemi KA, Ojo GB, Ashamu E. Demonstration of reticulin fibres in the epididymis of adult male wistar rats (Rattus norvegicus). Eur J Exp Biol 2014;4:42e5. [4] Browne JA, Yang R, Leir SH, Eggener SE, Harris A. Expression profiles of human epididymis epithelial cells reveal the functional diversity of caput, corpus and cauda regions. Mol Hum Reprod 2016;22:69e82.
Q. Liu et al. / Theriogenology 124 (2019) 24e31 [5] Dacheux JL, Dacheux F. New insights into epididymal function in relation to sperm maturation. Reproduction 2014;147:27e42. [6] Pearl CA, Roser JF. Lactoferrin expression and secretion in the stallion epididymis. Reprod Biol 2014;14:148e54. [7] Onaka T. Neural pathways controlling central and peripheral oxytocin release during stress. J Neuroendocrinol 2004;16:308e12. [8] Carter CS. Developmental consequences of oxytocin. Physiol Behav 2003;79: 383e97. [9] Yang HP, Wang L, Han L, Wang SC. Nonsocial functions of hypothalamic oxytocin. ISRN Neurosci 2013;2013. 179272. [10] Yamashita J, Kawabata Y, Okubo K. Expression of isotocin is male-specifically upregulated by gonadal androgen in the medaka brain. J Neuroendocrinol 2017;29. e12545. [11] Sakumoto R, Hayashi KG, Takahashi T. Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy. Reprod Biol 2014;14:115e21. [12] Chaves VE, Tilelli CQ, Brito NA, Brito MN. Role of oxytocin in energy metabolism. Peptides 2013;45:9e14. [13] Assinder SJ, Carey M, Parkinson T, Nicholson HD. Oxytocin and vasopressin expression in the ovine testis and epididymis: changes with the onset of spermatogenesis. Biol Reprod 2000;63:448e56. [14] Devost D, Wrzal P, Zingg HH. Oxytocin receptor signalling. Prog Brain Res 2008;170:167e76. [15] Simmons CFJ, Clancy TE, Quan R, Knoll JHM. The oxytocin receptor gene (OXTR) localizes to human chromosome 3p25 by fluorescence in situ hybridization and PCR analysis of somatic cell hybrids. Genomics 1995;26: 623e5. [16] Gimpl G, Fahrenholz F. The oxytocin receptor system: structure, function, and regulation. Physiol Rev 2001;81:629e83. [17] Gimpl G, Reitz J, Brauer S, Trossen C. Oxytocin receptors: ligand binding, signalling and cholesterol dependence. Prog Brain Res 2008;170:193e204. [18] Thackare H, Nicholson HD, Whittington K. Oxytocin-its role in male reproduction and new potential therapeutic uses. Hum Reprod Update 2006;12: 437e48. [19] Lu L, Zhang H, Na L, Ma X, Long T, Xiao H, et al. Immunolocalization of Androgen Receptor, aromatase cytochrome P450, estrogen receptor alpha and estrogen receptor beta proteins during the breeding season in scent glands of muskrats (Ondatra zibethicus). Zool Sci 2011;28:727e32. [20] Ma X, Zhang H, Weng J, Sheng X, Lu L, Hu X, Liu S, Xu M, Weng Q, Watanabe G, Taya K. Immunolocalization of inhibin/activin subunit proteins during the breeding season in testes and scented glands of muskrats (Ondatra zibethicus). J Vet Med Sci 2011;73:1199e205. [21] Cao H, Wang L, Zhang S, Lu L, Sheng X, Han Y, et al. Seasonal expression of prolactin receptor in the scented gland of male muskrat (Ondatra zibethicus). Sci Rep 2015;5. 15036. [22] Zhang H, Lu L, Zhu M, Zhang F, Sheng X, Yuan Z, et al. Seasonal expression of P450arom and estrogen receptors in scented glands of muskrats (Ondatra zibethicus). Am J Physiol Regul Integr Comp Physiol 2016;312:380e7. [23] Zhang T, Peng D, Qi L, Li W, Fan M, Shen J, et al. Musk gland seasonal development and musk secretion are regulated by the testis in muskrat (Ondatra zibethicus). Biol Res 2017;50:10. [24] Li Q, Weng J, Zhang H, Lu L, Ma X, Wang Q, et al. Immunohistochemical
[25]
[26]
[27]
[28]
[29]
[30]
[31] [32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
31
evidence: testicular and scented glandular androgen synthesis in muskrats (Ondatra zibethicus) during the breeding season. Eur J Histochem 2011;55: 143e7. Zhang F, Liu Q, Wang Z, Xie W, Sheng X, Zhang H, et al. Seasonal expression of oxytocin and oxytocin receptor in the scented gland of male muskrat (Ondatra zibethicus). Sci Rep 2017;7. 16627. Goeritz F1, Quest M, Wagener A, Fassbender M, Broich A, Hildebrandt TB, Hofmann RR, Blottner S. Seasonal timing of sperm production in roe deer: interrelationship among changes in ejaculate parameters, morphology and function of testis and accessory glands. Theriogenology 2003;59:1487e502. Lu L, Liu S, Li Q, Huang S, Bao L, Sheng X, et al. Seasonal expression of androgen receptor in scented gland of muskrat (Ondatra zibethicus). Gen Comp Endocrinol 2014;204:1e7. Zhang M, Sheng X, Zhang H, Wang Q, Xu M, Weng Q, et al. Seasonal changes in morphology and immunoreactivity of PDGF-A and its receptor PDGFR-a in the epididymis of wild ground squirrels (Citellus dauricus Brandt). J Reprod Dev 2012;58:353e9. Aguilera-Merlo C, Munoz E, Dominguez S, Scardapane L, Piezzi R. Epididymis of viscacha (Lagostomus maximus maximus): morphological changes during the annual reproductive cycle. Anat Rec A Discov Mol Cell Evol Biol 2005;282: 83e92. n E, Pastor LM. Morphological and histochemical Calvo A, Bustos-Obrego changes in the epididymis of hamsters (Mesocricetus auratus) subjected to short photoperiod. J Anat 2010;191:77e88. €n J, Blottner S. Seasonal variations in the epididymis of the roe deer Scho (Capreolus capreolus). Anim Reprod Sci 2009;111:344e52. s MW. Effect of climatic varVelez S, Sassi PL, Borghi CE, Monclus MA, Forne iables on seasonal morphological changes in the testis and epididymis in the wild rodent Microcavia australis from the andes mountains, Argentina. J Exp Zool A Ecol Genet Physiol 2010;313:474e83. Filippi S, Vannelli GB, Granchi S, Luconi M, Crescioli C, Mancina R, et al. Identification, localization and functional activity of oxytocin receptors in epididymis. Mol Cell Endocrinol 2002;193:89e100. Whittington K, Assinder SJ, Parkinson T, Lapwood KR, Nicholson HD. Function and localization of oxytocin receptors in the reproductive tissue of rams. Reproduction 2001;122:317e25. Prapaiwan N, Manee-In S, Moonarmart W, Srisuwatanasagul S. The expressions in oxytocin and sex steroid receptors in the reproductive tissues of normal and unilateral cryptorchid dogs. Theriogenology 2017;100:59e65. Zhang H, Zhang F, Zhu M, Wang J, Sheng X, Yuan Z, et al. Seasonal expressions of follicle stimulating hormone receptor and luteinizing hormone receptor in the scented gland of male muskrat (Ondatra zibethicus). Am J Physiol Regul Integr Comp Physiol 2017;312:569e74. Thackare H, Nicholson HD, Whittington K. Oxytocineits role in male reproduction and new potential therapeutic uses. Hum Reprod Update 2006;12: 437e48. Kukucka MA, Misra HP. HPLC determination of an oxytocin-like peptide produced by isolated Guinea pig Leydig cells: stimulation by ascorbate. Arch Androl 1992;29:185e90. Fink JW, McLeod BJ, Assinder SJ, Parry LJ, Nicholson HD. Seasonal changes in mesotocin and localization of its receptor in the prostate of the brushtail possum (Trichosurus vulpecula). Biol Reprod 2005;72:470e8.
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Seasonal expressions of oxytocin and oxytocin receptor in epididymis of the male muskrat (Ondatra zibethicus) Q. Liu, W. Xie, Y. Xiao, F. Gao, Q. Gao, H. Zhang, Y. Han, Z. Yuan, Q. Weng* College of Biological Science and Technology, Beijing Forestry University, Beijing, 100083, China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 20 July 2018 Received in revised form 3 October 2018 Accepted 6 October 2018 Available online 9 October 2018
Oxytocin (OT) is presented in the male reproductive tract and has various physiological functions, such as stimulating contraction of the reproductive tract and aiding sperm transport. In this study we investigated seasonal expressions of OT and oxytocin receptor (OTR) in the epididymis of the muskrat during the breeding and non-breeding seasons. Morphologically, the weight and length of epididymis in the breeding season were significantly higher than those in the non-breeding season. In the breeding season, the lumen diameter and epithelial thickness of epididymis increased significantly, and there were a large number of sperms in the lumen. However, in the non-breeding season, the diameter of the lumen became significantly narrower, the epithelial height became thinner, and there was no sperm in the lumen. Immunohistochemical results showed that OT and OTR were presented in the cytoplasm of epithelial cells and smooth muscle cells within the epididymis, and the immunostainings of OT and OTR in the breeding season were significantly stronger compared with the non-breeding. In consistent with the immunohistochemical results, the mRNA levels of OT and OTR were higher in the whole epididymis during the breeding season than those in the non-breeding season. In addition, the concentrations of OT in the epididymis and sera were both significantly higher in the breeding season when compared to the non-breeding season. These results suggested that the epididymis of the muskrat was the direct target organ of OT, and OT might play a regulatory role in the epididymal function via endocrine or autocrine/ paracrine manners. © 2018 Elsevier Inc. All rights reserved.
Keywords: Epididymis Muskrat Oxytocin Oxytocin receptor Seasonal expression
1. Introduction Epididymis is an elongated and convoluted single duct and locate on the posterolateral side of the testis [1]. According to the structure and function, the epididymis of all mammalian can be roughly divided into caput, corpus and cauda [2]. The wall of the epididymis tube is composed of a pseudostratified stereociliated columnar epithelium and a thin layer of smooth muscle [3]. The epithelium of epididymis has many kinds of cells, including principal, basal, narrow, apical, halo, and clear cells surrounded by multiple layers of peritubular myoid cells, of which the principal cell and basal cell are the most important cell types [4]. Epithelial cells of epididymis have absorption and secretion function, which can secrete glycerophosphocholine and glycoproteins, help to maintain the viability of sperm [5]. And epididymal muscle cells
* Corresponding author. Laboratory of Animal Physiology, College of Biological Sciences and Biotechnology, Beijing Forestry University, Beijing, 100083, China. E-mail address: [email protected] (Q. Weng). https://doi.org/10.1016/j.theriogenology.2018.10.009 0093-691X/© 2018 Elsevier Inc. All rights reserved.
can help the sperm to move in the tract due to their motility contractile function [5]. The epididymis can store sperm, feed sperm nutrition, and promote sperm maturation. Only through the epididymis can sperms reach a physiological maturity and have the ability to fertilize the oocytes [6]. Oxytocin (OT) is a nonapeptide hormone equally presented in the posterior pituitary of both sexes. It is produced primarily in the neurons of the hypothalamic paraventricular nucleus and supraoptic nucleus and released into systemic circulation by posterior pituitary [7]. It plays a role in social bonding and sexual reproduction in both sexes, during and after childbirth [8,9]. The oxytocin peptide is synthesized as an inactive precursor protein from the oxytocin gene, which goes through post-translational progressive hydrolysis facilitated by a series of enzymes before maturing into the active form [10]. Outside the brain, the cells that contain OT have been identified in several different tissues, including the corpus luteum [11] and the placenta [12] in females as well as the testis and epididymis [13] in males. To exert peripheral hormonal actions in the reproductive system, the functional
Q. Liu et al. / Theriogenology 124 (2019) 24e31
receptor for OT must be presented. The oxytocin receptor (OTR) is a protein which belongs to the G-protein coupled receptor family, and its activity is mediated by G proteins that activate several different second messenger systems [14,15]. So far, studies about OTR function in peripheral organs have been mainly focusing on the reproductive system [16]. OTR is involved in the regulation of multiple physiological activities in peripheral tissues, such as the female uterine contractions and mammary gland milk ejection, as well as the male penile erection and ejaculation [17]. Although the research on the function of OT in the male reproductive system has long been reported [18], there are still many deficiencies in the study of OT function in the male reproductive tract, such as the effects of OT on the morphology and function of epididymis during different seasons. The muskrat (Ondatra zibethicus) is a medium-sized, semiaquatic rodent species with precious medicinal and economic values because of its meat, fur and musk. Especially, the musk is a widely-used and costly ingredient in traditional Chinese medicine and a raw material for making high-end perfumes [19,20]. The common name of the muskrat is derived from the conspicuous odor of secretions from paired perineal musk glands found beneath the skin at the ventral base of the tail [21]. The muskrat is a typical seasonal breeder whose annual life cycle can be roughly divided into the breeding season (March to October) and the non-breeding season (November to next February) [22]. Although several observations about reproduction in muskrat have been reported recently [23,24], there are still many gaps in understanding of the mechanisms of reproduction, such as sperm progression and maturation during different periods. In this study, we investigated the expressions and localizations of OT and OTR in the epididymis of the muskrat during the breeding and non-breeding seasons, to elucidate the relationship between OT and OTR and the epididymal function in the muskrat. 2. Materials and methods 2.1. Animals and tissues collections Thirty adult muskrats were obtained in the breeding (n ¼ 15) and the non-breeding (n ¼ 15) seasons from Jinmu Muskrat Breeding Farm, Hebei Province, China. The muskrats were kept with a pattern of one male and one female in one enclosure. All the procedures on animals were carried out in accordance with the Policy on the Care and Use of Animals by the Ethical Committee, Beijing Forestry University. Male muskrats were deeply anesthetized with ether and weighed, and then each pair of the epididymis was excised from the male muskrats after sacrificing, the epididymal weight and length were recorded. One of the epididymis was immediately fixed for 12 h in Bouin's solution and then stored in 70% ethanol for histological and immunohistochemical observations. The other of epididymis were immediately stored at 80 C for reverse transcription-polymerase chain reaction (RT-PCR) detection and hormone analysis. Blood samples were collected and centrifuged at 3000 g for 20 min to separate sera from blood cells, sera were collected and stored at 20 C for hormonal analysis. 2.2. Antibodies The primary antibodies were used in the present study included rabbit polyclonal anti-OTR (bs-1314R, Beijing Biosynthesis Biotechnology CO. LTD, Beijing, China), OT (bs-17581R, Beijing Biosynthesis Biotechnology CO. LTD, Beijing, China), and mouse polyclonal anti-b-actin (bsm-33139M, Beijing Biosynthesis Biotechnology CO. LTD, Beijing, China). The dilution ranges of OT,
25
OTR and b-actin antibodies for immunohistochemistry were 1: 500. The specificity of OT and OTR antibodies had been described in our previous study on the muskrat [25]. 2.3. Histology The epididymis was dehydrated in ethanol series and embedded in paraffin. Serial sections (5 mm) were mounted on slides coated with poly-L-lysine. Some sections were stained with hematoxylineosin (HE) for the general histological observation. The rest of the sections were processed for immunohistochemistry. 2.4. Immunohistochemistry The epididymal serial paraffin sections were incubated with 10% normal goat serum (C-0005, Beijing Biosynthesis Biotechnology CO. LTD, Beijing, China) to reduce background staining. The sections were then incubated with primary antibody for 12 h at 4 C. Subsequent incubations with the secondary antibody, goat anti-rabbit IgG conjugated with biotin and peroxidase with avidin, using rabbit ExtrAvidin Peroxidase staining kit (Sigma Chemical Co., St. Louis, MO, USA) was performed, followed by visualizing with 30 mg 3,3diaminobenzidine (Wako, Tokyo, Japan) solution in 150 ml of 0.05 mM Tris-HCl buffer, pH 7.6, plus 30 ml H2O2. Control sections were treated with normal goat serum instead of the primary antisera. immunohistochemical staining was determined as positive (þ), strong positive (þþ), very strong positive (þþþ), and negative (). Staining that was weak but higher than control was set as positive (þ); the highest intensity staining was set as very strong positive (þþþ); staining intensity between þ and þþþ was set as strong positive (þþ). 2.5. RNA isolation Total RNAs were extracted from epididymal tissues using Trizol Reagent (Invitrogen, Carlsbad, CA, USA). Approximately 0.1 g of epididymal tissues were thawed and immediately homogenized in 1 ml of Trizol Reagent by ultrasonic crusher. The homogenates were incubated at room temperature for 5 min to completely separate the nuclear protein complexes. After the addition of 0.2 ml chloroform, the mixture was vigorously shaken for 15 s at room temperature and centrifuged at 12,000 g for 20 min at 4 C. The aqueous phase was then transferred to RNase fresh tube and added 500 ml of isopropanol. Then the sample was kept for 10 min at room temperature. RNA was precipitated by centrifugation at 12,000 g for 20 min at 4 C. The RNA pellet was washed twice with 70% ethanol, briefly dried under air, and dissolved in 30 ml of diethylprocarbonate-treated water. The integrity of total RNA was tested by gel electrophoresis, and after measurement of concentration with spectrophotometer, RNA was diluted to 500 ng/ml. 2.6. RT-PCR The first-strand cDNA from total RNA was synthesized using StarScript II First-strand cDNA Synthesis Mix (GenStar, Beijing, China). The 20 ml of reaction mixture contained 2 ml of total RNA, 1 ml of Oligo (dT) 18, 1 ml of StarScript II RT Mix, 10 ml of 2 Reaction mix, 6 ml of diethylprocarbonate-dd H2O. The 20 ml of RT-PCR reaction mixture contained 1 ml of first-strand cDNA, 1 ml of each primer (10 mM), 7 ml dd H2O, 10 ml 2 Taq PCR StarMix with Loading Dye (GenStar, Beijing, China). The amplification was under the following condition: 94 C for 3 min for the initial denaturation of the RNA/cDNA hybrid, 35 cycles of 94 C for 30 s, 56.2 C, 57.5 C and 58.5 C (for otr, ot and Actb, respectively) for 30 s and 72 C for 1 min with a final extension of 10 min at 72 C. The first-strand cDNA was
26
Q. Liu et al. / Theriogenology 124 (2019) 24e31
2.8. Statistical analysis
Table 1 Oligonucleotide primers used for quantitative RT-PCR.
otr ot Actb
Sequence of primer
Product size (bp)
F: 50 TGGCCTCATCAGCTTCAAGA 30 R: 50 ACACGATGAAGGCCAGTACA 30 F: 50 CTTGGCCTACTGGCTCTGAC 30 R: 50 GGGCAGGTAGTTCTCCTCCT 30 F: 50 GACTCGTCGTACTCCTGCTT 30 R: 50 AAGACCTCTATGCCAACACC 30
203 483 223
Statistical comparisons were made with the Student's t-test, one-way ANOVA followed by Tukey test or correlation analysis using Graphpad prism software (Version 5.0, GraphPad Software, Inc., San Diego, USA). A value of P < 0.05 was considered indication of statistical significance.
3. Results used for PCR amplification with the following primers (Table 1). The PCR products were electrophoresed in the 1% agarose gel and individual bands were visualized by Gelred (Biotium, Fremont, USA). The housekeeping gene Actb was selected as the endogenous control. The bands were quantified by using Quantity One Software (Bio-Rad Laboratories, Inc., USA, version 4.5) and the relative expression ratios relative to Actb were calculated. 2.7. Hormone assays The epididymis and sera samples from each muskrat were analyzed by the enzyme linked immunosorbent assay (ELISA) to detect OT concentration using the ELISA Kit (Kit CSB-E14197r for OT, Cusabio Biotech Co., Ltd., Wuhan, China). Samples preparation were performed according to the user manual. Tissue samples were rinsed with PBS, and then homogenized in 1 ml of PBS and stored overnight at 20 C. Next, the homogenates were thawed and centrifuged for 5 min at 5000 g at 4 C. Then the supernatant was collected and assayed. The sera samples were centrifuged for 15 min at 3000 g at 4 C, and then the supernatant was collected and assayed. The minimum level of OT detection of this ELISA kit is 9.375 pg ml1. The intra/inter-assay variation were both less than 15% for OT.
B
NB
The morphological differences of the epididymis of the muskrat were observed between the breeding and non-breeding seasons (Fig. 1a and b). The average weight and length of the epididymis in the breeding season were significantly higher than those in the non-breeding season, as shown in Fig. 1c and d. The higher values of epididymal weight (0.37 ± 0.03 g), length (4.35 ± 0.4 cm) occurred during the breeding season. The parameters including epididymal weight (0.17 ± 0.02 g), length (2.5 ± 0.03 cm) significantly decreased in the non-breeding season. Histological observation revealed that distinct changes in the caput, corpus and cauda of epididymis from the breeding and non-breeding seasons (Fig. 2). During the breeding season (Fig. 2a, b, c), there were wide epithelial thickness and large lumen diameter with abundant mature sperms. However, the narrow epithelial thickness and cramped lumen diameter were found in the non-breeding season (Fig. 2d, e, f). Meanwhile, no sperm was observed in the epididymis of the nonbreeding season. The significant differences in lumen diameter and epithelial thickness of the caput, corpus and cauda in the epididymis between the breeding and non-breeding seasons were shown in Fig. 3. The seasonal immunohistochemical localizations of OT and OTR in the epididymis of the muskrat were shown in Fig. 4 and Fig. 5, respectively. OT was detected in epithelial cells and smooth muscle
b
a caput
corpus
cauda
B 1cm
NB
c
d ***
***
Fig. 1. Morphological difference of the epididymis between the breeding and non-breeding seasons. The testis and epididymis excised from the male muskrat in the breeding (a, left) and non-breeding seasons (a, right). The part of the black coil represents the epididymis (a). Comparison of epididymal morphology in the breeding and non-breeding seasons (b). The dotted line indicates boundary of caput, corpus, cauda and the location of the tissue slice. The average weight of epididymis (n ¼ 5) in breeding and non-breeding seasons (c). The average length of epididymis (n ¼ 5) in breeding and non-breeding seasons (d). Scale bars represents 1 cm. B, the breeding season; NB, the non-breeding season. The error bars represent means ± s.e.m. for five independent experiments. ***P < 0.001.
Q. Liu et al. / Theriogenology 124 (2019) 24e31
27
Fig. 2. Histological observation of the epididymis in the breeding (n ¼ 5) (a, b, c) and non-breeding seasons (n ¼ 5) (d, e, f). Scale bars represents 20 mm. EC, epithelial cell; SMC, smooth muscle cell; SPM, sperm.
cells of the epididymal caput, corpus, cauda in both seasons. Compared with the breeding season (Fig. 4a, b, c), the immunostaining intensity of OT was weaker in the non-breeding season (Fig. 4e, f, g). OTR was immunolocalized in epithelial cells and smooth muscle cells of the entire epididymis, and the immunoreactivity of OTR was more intense in the breeding seasons (Fig. 5a, b, c) than that in the non-breeding season (Fig. 5e, f, g). No positive signal was observed in the negative controls (Figs. 4d and 5d). All staining images were quantifed and summarized in Table 2. Seasonal expressions of ot and otr mRNA in epididymis were characterized by RT-PCR, as shown in Fig. 6. The mRNA levels of ot (Fig. 6a) and otr (Fig. 6b) in the epididymal caput and cauda were significantly higher during the breeding season than those in the non-breeding season. The correlation analysis between the mRNA levels of ot and otr in the epididymis and epididymal weight during the breeding and non-breeding seasons in the muskrat were performed and the results were shown in Fig. 7. The positive correlations were observed between the expressions of ot (Fig. 7a, R2 ¼ 0.8061, P < 0.05), otr (Fig. 7b, R2 ¼ 0.7576, P < 0.05) and epididymal weight in the muskrat, respectively. The seasonal concentrations of OT in the epididymis and sera of the muskrat were analyzed in Fig. 8. In the whole epididymis, OT
a
level in the epididymis was significantly lower in the non-breeding season as compared to that in the breeding season (Fig. 8a). Moreover, OT level in the sera decreased from 289 ± 54 pg ml1 in the breeding season to 207 ± 53 pg ml1 in the non-breeding season (Fig. 8b). 4. Discussion This was the first report that described the seasonal variations of the epididymis and the expressions of OT and OTR within the epididymis of the muskrat. The expression levels of OT and OTR were increased during the breeding season, and the hormone concentrations of OT in the epididymis and sera varied seasonally as well. Meanwhile, the seasonal expressions of OT and OTR in the epididymis were corresponding with the changes in the epididymal weight, length, epithelial thickness and lumen diameter of the muskrat. These findings suggested that the epididymis has the ability to synthesize OT, and OT may have a regulatory role in the epididymal function via endocrine or autocrine/paracrine manners. The seasonality of reproductive activity in males is associated with cyclic changes in the growth and involution of both testes and the accessory sex glands [26]. The previous study on the muskrat
b
Fig. 3. The lumen diameter of epididymis in the breeding (n ¼ 5) and non-breeding (n ¼ 5) seasons (a). The epithelial thickness of epididymis in the breeding (n ¼ 5) and nonbreeding seasons (n ¼ 5) (b). B, the breeding season; NB, the non-breeding season; The error bars represent means ± s.e.m. for five independent experiments. *P < 0.05; **P < 0.01; ***P < 0.001.
28
Q. Liu et al. / Theriogenology 124 (2019) 24e31
Fig. 4. Seasonal immunolocalization of OT in the epididymis of the muskrat. Black arrows indicate the two cell types: epithelial cells, smooth muscle cells. Immunolocalization of OT in the breeding (n ¼ 5) (a, caput; b, corpus; c, cauda) and non-breeding seasons (n ¼ 5) (e, caput; f, corpus; g, cauda). d; negative control, sections were treated with normal rabbit serum instead of primary antisera. EC, epithelial cell, SMC, smooth muscle cell. B, the breeding season; NB, the non-breeding season. Scale bars represents 50 mm (aeg) and 20 mm (a’ - g’).
had shown that testicular weight and size with significantly high values in the breeding season, corresponding to higher levels of follicle stimulating hormone (FSH), luteinizing hormone (LH) and testosterone [27]. In this study, the epididymal morphology of the muskrat illustrated seasonal changes in the structural characteristics, showed that the length and weight of the epididymis and the quantity of sperm in the lumen varied in the different periods. These findings were similar to other animals [28e32]. In the wild male ground squirrel, the diameter of epididymis lumen was
maximal during the breeding season, and there was a large amount of spermatozoa in the lumen, while in the non-breeding season, the lumen appeared collapsed and no sperm was presented [28]. A study of viscacha also found that during the short period of gonadal regression, the epididymal cauda showed a decrease in luminal diameter and spermatozoa population, and an increase of lamina propria thickness [29]. One study on hamster suggested that the degeneration of epididymal morphology and disappearance of spermatozoa under short-day conditions [30]. Several studies
Fig. 5. Seasonal immunolocalization of OTR in the epididymis of the muskrat. Black arrows indicate the two cell types: epithelial cells, smooth muscle cells. Immunolocalization of OTR in the breeding (n ¼ 5) (a, caput; b, corpus; c, cauda) and in the non-breeding seasons (n ¼ 5) (e, caput; f, corpus; g, cauda). d; Negative control, sections were treated with normal rabbit serum instead of primary antisera. EC, epithelial cell; SMC, smooth muscle cell. B, the breeding season; NB, the non-breeding season. Scale bars represents 50 mm (aeg) and 20 mm (a’ - g’).
Q. Liu et al. / Theriogenology 124 (2019) 24e31
29
Table 2 Immunohistochemical localizations of OT and OTR in the epididymis of the muskrat. EC, epithelial cell; SMC, smooth muscle cell. B, the breeding season: NB, the non-breeding season. þ, positive staining; þþ, strong positive staining; þþþ, very strong positive staining; , negative staining. EC
SMC
B
OT OTR
NB
B
NB
caput
corpus
cauda
caput
corpus
cauda
caput
corpus
cauda
caput
corpus
cauda
þþþ þþ
þþþ þþþ
þþþ þþþ
þ þ
þ þ
þ þ
þþþ þþþ
þþ þþ
þþ þþ
þ þ
þ þ
þ þ
a
b
ot Actb
483bp 223bp
otr Actb
203bp 223bp
Fig. 6. Seasonal mRNA expressions of ot (a) and otr (b) in the epididymis (B, n ¼ 5; NB, n ¼ 5). The error bars represent means ± s.e.m. for five independent experiments. B, the breeding season; NB, the non-breeding season. *P < 0.05; **P < 0.01.
indicated that seasonal changes of epididymal morphology and function to some extent reflect the change in testicular tissue and the up-regulation and down-regulation of spermatogenesis in the testis, and the size and secretory activity of epithelium in the epididymis were influenced by testosterone [26,31,32]. Taken together published and current results, we supported the proposal that a cyclical alteration in the growth and involution of the epididymis might be universal in seasonal breeding mammal [28]. The OTR had been demonstrated to be localized in both the epithelial and muscular layers of the epididymis in several animals [33e35]. In this study, the immunohistochemical observation clearly showed that the immunoreactivity of OTR was distributed in the cytoplasm of epithelial cells and smooth muscle cells in the breeding season. The mRNA expression of OTR further confirmed
a
its presence in the epididymis. In fact, the localization of OTR in the epididymis changed with various sites of the epididymis in different species [15,16,33e35]. In human, OTR was not only presented in the smooth muscle cells of the epididymis but also in the epithelial compartment, suggested that OT might control epididymal motility and sperm progression through the male genital tract [33]. In rams, the data identified OTR on epithelial cells throughout the epididymis, on peritubular smooth muscle cells in the cauda epididymis, and on the epithelial cells and circular smooth muscle layers of the ductus deferens, revealing that OT may be involved in promoting sperm transit [34]. In dogs, the positive OTR immunostaining cells were found in the epithelium, lamina propria and muscular layer of entire epididymis, showed that OTR may have a significant impact on the maturation and transportation of sperm
b
Fig. 7. Correlation between mRNA expressions of ot (a) and otr (b) in the epididymis (n ¼ 5) and the epididymal weight (n ¼ 5) in the muskrat.
30
Q. Liu et al. / Theriogenology 124 (2019) 24e31
a
b
Fig. 8. Seasonal OT concentration in the epididymis (n ¼ 5) (a) and sera (n ¼ 5) (b). The error bars represent means ± s.e.m. for five independent experiments. B, the breeding season; NB, the non-breeding season. *P < 0.05; **P < 0.01.
in epididymis by promoting the secretion of epididymal epithelium and the contraction of the muscle layers [35]. Some other studies also speculated the presence of OTR in the muscle cells of the epididymis cauda was compatible with the contractility of that part of the organ that occurred during coitus and ejaculation [33], and OTR in epithelial cells may be related to the regulation of dihydrotestosterone (DHT) for epididymal growth and function maintenance [34]. In the present study, OTR was localized in the epithelial cells and smooth muscle cells throughout the entire epididymis. Therefore, the present results implied that OT might regulate the epididymal function of the muskrat by the locally expressed its receptor. The morphological characteristics of affiliated gonads usually show annual reproductive cycle changes with reproductive hormones [29]. Our previous studies showed that the sera concentrations of FSH, LH and prolactin in the male muskrat were higher in the breeding season than those in the non-breeding season [21,36]. In this study, the levels of OT in the epididymis and sera also showed a similar seasonal changes profile, with it increasing during the breeding season and decreasing during the non-breeding season. Consistent with the OT levels profile, the mRNA expression of OT in the epididymis was also higher in the breeding season than that in the non-breeding season as well. These findings suggested that the epididymis may be able to synthesize OT, which is likely to play an important regulatory role in the epididymal function via autocrine/paracrine manners. Previously, the local production of OT in peripheral organs has been reported, especially in the male reproductive tract [25]. The synthesis of OT in the testis and accessory gland had been demonstrated in many animals, including rat, sheep and human. There was a conclusive evidence that OT was synthesized within the mammalian testis, epididymis and prostate and the presence of OTR through the reproductive tract supported a local action for this peptide. OT had a paracrine role in stimulating contractility of the seminiferous tubule, epididymis and the prostate gland [37]. In guinea pigs, in vitro cultured Leydig cells were capable of producing an oxytocin-like peptide de novo [38]. In rams, OT was produced in the testicular Leydig and epididymal principal cells and increased during puberty [29]. In brushtail possums, the seasonal changes of local mesotocin (an OT-like peptide in marsupials) concentration might be related to the growth and regression of their prostate [39]. Our previous study on the scented gland of muskrat also found the scented gland could be able to synthesize OT, and OT may be required for the contraction of the scented gland to promote musk secretion during the breeding season [25]. Similarly, our results here suggested that OT might be synthesized in the smooth muscle cells and epithelial cells of the epididymis
and its level closely associated with the seasonal changes of epididymal morphology. In addition, the epididymal function in the muskrat may be regulated by the OT from both endocrine and autocrine/paracrine manners. In conclusion, our results described the seasonal expressions and localizations of OT and OTR in the epididymis of the muskrat and showed higher expression level in the breeding season, and the seasonal concentrations of OT was positively correlated with the morphological changes of epididymis and its mRNA expression level. These findings suggested that OT may be involved in the regulation of seasonal changes in the epididymal function of the muskrat via endocrine, autocrine or paracrine mechanisms. This study may contribute to achieve a better understanding of epididymal physiology in the seasonal reproduction of this rodent. Conflicts of interest The authors declare that they have no competing interests. Authors’ contributions QL, WX and QG participated in sample collection, performing the experiments, analyzing the data and drafting the manuscript. QL, YX, FG and HZ assisted with all experiments and helped revising the manuscript. YH, ZY and QW designed, supervised the study, and revised manuscript. All authors read and approved the final version. Acknowledgements This research work is supported by National Natural Science Foundation of China (31872320, 21806010) and Beijing Natural Science Foundation (8182039) and Young Scientist Start-up funding of Beijing Forestry University (BLX201714). References [1] Turner TT. De Graaf's thread: the human epididymis. J Androl 2008;29: 237e50. [2] Turner TT, Bomgardner D, Jacobs JP, Nguyen QA. Association of segmentation of the epididymal interstitium with segmented tubule function in rats and mice. Reproduction 2003;125:871e8. [3] Victor UO, Alese MO, Ashaolu OJ, Oluyemi KA, Ojo GB, Ashamu E. Demonstration of reticulin fibres in the epididymis of adult male wistar rats (Rattus norvegicus). Eur J Exp Biol 2014;4:42e5. [4] Browne JA, Yang R, Leir SH, Eggener SE, Harris A. Expression profiles of human epididymis epithelial cells reveal the functional diversity of caput, corpus and cauda regions. Mol Hum Reprod 2016;22:69e82.
Q. Liu et al. / Theriogenology 124 (2019) 24e31 [5] Dacheux JL, Dacheux F. New insights into epididymal function in relation to sperm maturation. Reproduction 2014;147:27e42. [6] Pearl CA, Roser JF. Lactoferrin expression and secretion in the stallion epididymis. Reprod Biol 2014;14:148e54. [7] Onaka T. Neural pathways controlling central and peripheral oxytocin release during stress. J Neuroendocrinol 2004;16:308e12. [8] Carter CS. Developmental consequences of oxytocin. Physiol Behav 2003;79: 383e97. [9] Yang HP, Wang L, Han L, Wang SC. Nonsocial functions of hypothalamic oxytocin. ISRN Neurosci 2013;2013. 179272. [10] Yamashita J, Kawabata Y, Okubo K. Expression of isotocin is male-specifically upregulated by gonadal androgen in the medaka brain. J Neuroendocrinol 2017;29. e12545. [11] Sakumoto R, Hayashi KG, Takahashi T. Different expression of PGE synthase, PGF receptor, TNF, Fas and oxytocin in the bovine corpus luteum of the estrous cycle and pregnancy. Reprod Biol 2014;14:115e21. [12] Chaves VE, Tilelli CQ, Brito NA, Brito MN. Role of oxytocin in energy metabolism. Peptides 2013;45:9e14. [13] Assinder SJ, Carey M, Parkinson T, Nicholson HD. Oxytocin and vasopressin expression in the ovine testis and epididymis: changes with the onset of spermatogenesis. Biol Reprod 2000;63:448e56. [14] Devost D, Wrzal P, Zingg HH. Oxytocin receptor signalling. Prog Brain Res 2008;170:167e76. [15] Simmons CFJ, Clancy TE, Quan R, Knoll JHM. The oxytocin receptor gene (OXTR) localizes to human chromosome 3p25 by fluorescence in situ hybridization and PCR analysis of somatic cell hybrids. Genomics 1995;26: 623e5. [16] Gimpl G, Fahrenholz F. The oxytocin receptor system: structure, function, and regulation. Physiol Rev 2001;81:629e83. [17] Gimpl G, Reitz J, Brauer S, Trossen C. Oxytocin receptors: ligand binding, signalling and cholesterol dependence. Prog Brain Res 2008;170:193e204. [18] Thackare H, Nicholson HD, Whittington K. Oxytocin-its role in male reproduction and new potential therapeutic uses. Hum Reprod Update 2006;12: 437e48. [19] Lu L, Zhang H, Na L, Ma X, Long T, Xiao H, et al. Immunolocalization of Androgen Receptor, aromatase cytochrome P450, estrogen receptor alpha and estrogen receptor beta proteins during the breeding season in scent glands of muskrats (Ondatra zibethicus). Zool Sci 2011;28:727e32. [20] Ma X, Zhang H, Weng J, Sheng X, Lu L, Hu X, Liu S, Xu M, Weng Q, Watanabe G, Taya K. Immunolocalization of inhibin/activin subunit proteins during the breeding season in testes and scented glands of muskrats (Ondatra zibethicus). J Vet Med Sci 2011;73:1199e205. [21] Cao H, Wang L, Zhang S, Lu L, Sheng X, Han Y, et al. Seasonal expression of prolactin receptor in the scented gland of male muskrat (Ondatra zibethicus). Sci Rep 2015;5. 15036. [22] Zhang H, Lu L, Zhu M, Zhang F, Sheng X, Yuan Z, et al. Seasonal expression of P450arom and estrogen receptors in scented glands of muskrats (Ondatra zibethicus). Am J Physiol Regul Integr Comp Physiol 2016;312:380e7. [23] Zhang T, Peng D, Qi L, Li W, Fan M, Shen J, et al. Musk gland seasonal development and musk secretion are regulated by the testis in muskrat (Ondatra zibethicus). Biol Res 2017;50:10. [24] Li Q, Weng J, Zhang H, Lu L, Ma X, Wang Q, et al. Immunohistochemical
[25]
[26]
[27]
[28]
[29]
[30]
[31] [32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
31
evidence: testicular and scented glandular androgen synthesis in muskrats (Ondatra zibethicus) during the breeding season. Eur J Histochem 2011;55: 143e7. Zhang F, Liu Q, Wang Z, Xie W, Sheng X, Zhang H, et al. Seasonal expression of oxytocin and oxytocin receptor in the scented gland of male muskrat (Ondatra zibethicus). Sci Rep 2017;7. 16627. Goeritz F1, Quest M, Wagener A, Fassbender M, Broich A, Hildebrandt TB, Hofmann RR, Blottner S. Seasonal timing of sperm production in roe deer: interrelationship among changes in ejaculate parameters, morphology and function of testis and accessory glands. Theriogenology 2003;59:1487e502. Lu L, Liu S, Li Q, Huang S, Bao L, Sheng X, et al. Seasonal expression of androgen receptor in scented gland of muskrat (Ondatra zibethicus). Gen Comp Endocrinol 2014;204:1e7. Zhang M, Sheng X, Zhang H, Wang Q, Xu M, Weng Q, et al. Seasonal changes in morphology and immunoreactivity of PDGF-A and its receptor PDGFR-a in the epididymis of wild ground squirrels (Citellus dauricus Brandt). J Reprod Dev 2012;58:353e9. Aguilera-Merlo C, Munoz E, Dominguez S, Scardapane L, Piezzi R. Epididymis of viscacha (Lagostomus maximus maximus): morphological changes during the annual reproductive cycle. Anat Rec A Discov Mol Cell Evol Biol 2005;282: 83e92. n E, Pastor LM. Morphological and histochemical Calvo A, Bustos-Obrego changes in the epididymis of hamsters (Mesocricetus auratus) subjected to short photoperiod. J Anat 2010;191:77e88. €n J, Blottner S. Seasonal variations in the epididymis of the roe deer Scho (Capreolus capreolus). Anim Reprod Sci 2009;111:344e52. s MW. Effect of climatic varVelez S, Sassi PL, Borghi CE, Monclus MA, Forne iables on seasonal morphological changes in the testis and epididymis in the wild rodent Microcavia australis from the andes mountains, Argentina. J Exp Zool A Ecol Genet Physiol 2010;313:474e83. Filippi S, Vannelli GB, Granchi S, Luconi M, Crescioli C, Mancina R, et al. Identification, localization and functional activity of oxytocin receptors in epididymis. Mol Cell Endocrinol 2002;193:89e100. Whittington K, Assinder SJ, Parkinson T, Lapwood KR, Nicholson HD. Function and localization of oxytocin receptors in the reproductive tissue of rams. Reproduction 2001;122:317e25. Prapaiwan N, Manee-In S, Moonarmart W, Srisuwatanasagul S. The expressions in oxytocin and sex steroid receptors in the reproductive tissues of normal and unilateral cryptorchid dogs. Theriogenology 2017;100:59e65. Zhang H, Zhang F, Zhu M, Wang J, Sheng X, Yuan Z, et al. Seasonal expressions of follicle stimulating hormone receptor and luteinizing hormone receptor in the scented gland of male muskrat (Ondatra zibethicus). Am J Physiol Regul Integr Comp Physiol 2017;312:569e74. Thackare H, Nicholson HD, Whittington K. Oxytocineits role in male reproduction and new potential therapeutic uses. Hum Reprod Update 2006;12: 437e48. Kukucka MA, Misra HP. HPLC determination of an oxytocin-like peptide produced by isolated Guinea pig Leydig cells: stimulation by ascorbate. Arch Androl 1992;29:185e90. Fink JW, McLeod BJ, Assinder SJ, Parry LJ, Nicholson HD. Seasonal changes in mesotocin and localization of its receptor in the prostate of the brushtail possum (Trichosurus vulpecula). Biol Reprod 2005;72:470e8.