Seasonal mercury transformation and surficial sediment detoxification by bacteria of Marano and Grado lagoons

Estuarine, Coastal and Shelf Science 113 (2012) 105e115

Contents lists available at SciVerse ScienceDirect

Estuarine, Coastal and Shelf Science journal homepage: www.elsevier.com/locate/ecss

Seasonal mercury transformation and surficial sediment detoxification by bacteria of Marano and Grado lagoons Franco Baldi a, *, Michele Gallo a, Davide Marchetto a, Renato Fani b, Isabel Maida b, Milena Horvat c, Vesna Fajon c, Suzana Zizek c, Mark Hines d a

Dept. of Scienze Molecolari e Nanosistemi, Cà Foscari University of Venice, Dorsoduro 2137, 30123 Venice, Italy Dept. of Evolutionary Biology, Via Romana, 17, 50125 Firenze, Italy Dept. of Environmental Sciences, “Jozef Stefan” Institut, Jamova 39, 1000 Ljubljana, Slovenia d Dept of Biological Sciences, University of Massachusetts Lowell, Lowell, MA 01854, USA b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 24 March 2011 Accepted 9 February 2012 Available online 20 February 2012

Marano and Grado lagoons are polluted by mercury from the Isonzo River and a chlor-alkali plant, yet despite this contamination, clam cultivation is one of the main activities in the region. Four stations (MA, MB, MC and GD) were chosen for clam seeding and surficial sediments were monitored in autumn, winter and summer to determine the Hg detoxifying role of bacteria. Biotransformation of Hg species in surficial sediments of Marano and Grado lagoons was investigated while taking into consideration the speciation of organic matter in the biochemical classes of PRT (proteins), CHO (carbohydrates) and LIP (lipids), waterwashed cations and anions, bacterial biomass, Hg-resistant bacteria, some specific microbial activities such as sulfate reduction rates, Hg methylation rates, Hg-demethylation rates, and enzymatic ionic Hg reduction. MeHg in sediments was well correlated with PRT content, whereas total Hg in sediments correlated with numbers of Hg-resistant bacteria. Correlations of the latter with Hg-demethylation rates in autumn and winter suggested a direct role Hg-resistant bacteria in Hg detoxification by producing elemental Hg (Hg0) from ionic Hg and probably also from MeHg. MeHg-demethylation rates were w10 times higher than Hg methylation rates, were highest in summer and correlated with high sulfate reduction rates indicating that MeHg was probably degraded in summer by sulfate-reducing bacteria via an oxidative pathway. During the summer period, aerobic heterotrophic Hg-resistant bacteria decreased to <2% compared to 53% in winter. Four Hg-resistant bacterial strains were isolated, two Gram-positive (Staphylococcus and Bacillus) and two Gram-negative (Stenotrophomonas and Pseudomonas). Two were able to produce Hg0, but just one contained a merA gene; while other two strains did not produce Hg0 even though they were able to grow at 5 mg ml of HgCl2. Lagoon sediments support a strong sulfur cycle in summer that controls Hg methylation and demethylation. However, during winter, Hg-resistant bacteria that are capable of degrading MeHg via the mer-catalyzed reductive pathway increase in importance. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: mercury pollution detoxification biopolimeric carbon mercury species bacteria plasmids

1. Introduction The present study is a part of the multidisciplinary project “MIRACLE” (Mercury Interdisciplinary Research for Appropriate Clam farming in a Lagoon Environment) conducted in 2008 and 2009 to assess the suitability for clam farming in lagoon sediments contaminated with mercury (Hg). Sediments of the Marano and Grado lagoons in coastal NW Italy are known to be polluted by Hg in the form of cinnabar transported by the Isonzo (So ca) River (Foucher et al., 2009) and from a chlor-alkali plant in the Aussa River (Covelli et al., 2009). Mercury pollution in Marano and Grado * Corresponding author. E-mail address: [email protected] (F. Baldi). 0272-7714/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.ecss.2012.02.008

Lagoons threatens clam cultivation, which is one of the major commercial activities in the lagoons. Bacterial conversions of ionic mercury and methymercury (MeHg) to elemental Hg (Hg0) by broad Hg-resistant strains (Barkay et al., 2003) could attenuate metal accumulation rates in clams and other organisms living in the two lagoons, especially in surficial sediments. The abundance of organic and inorganic nutrients in lagoon sediments might support the proliferation of bacteria involved in Hg detoxification. The investigation of enzymatic Hg resistance in aerobic bacteria, due to Hg0 volatilization from ionic Hg and MeHg, is in its fifth decade and has been studied from genes to environmental applications, including the bioremediation process (Barkay et al., 2003). Anaerobic Hg demethylation and Hg methylation are two important processes, which are not genetically controlled, but indirectly

106

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115

activated by secondary microbial metabolism. In complex environmental matrices at the wateresediment interface such as in a lagoon ecosystem, there is an intermittent flux of oxygen supply due to tides, prevalent winds, and boat circulation above lagoon sediments counterbalanced by a high biological O2 demand, which provokes hypoxic and anoxic conditions. In this context, Hg biotransformation in sediments plays an important role in Hg accumulation in the food chain of the lagoon ecosystem, in particular in Manila clams. The MIRACLE Project was conducted in order to investigate the risk of Hg bioaccumulation in these bivalves. The presence of Hg-resistant bacteria in soft tissue of clams from Marano and Grado lagoons and their role in Hg detoxification was studied previously using molecular microscopic techniques (FISH) (Baldi et al., 2011). The aim of the current study was to determine the detoxifying activity of Hg-resistant bacteria in sediments during seasonal changes in four sites of the Marano and Grado lagoons selected as potential areas for Manila clam cultivation and harvesting. The study was conducted by correlating the bacterial biomass and Hgresistant bacteria with organic and inorganic nutrient variations in sediments. In a previous investigation of the same area, total carbon, organic carbon and humic acids (HA) were determined. The latter was autochthonous (marine origin) and shown to preferentially bind MeHg (Acquavita et al., 2012). In the current study, we divided the biopolymeric carbon (BPC) into proteins (PRT), carbohydrates (CHO) and lipids (LIP). These biochemical molecules are synthesized and/or utilized by microbes under either aerobic or anaerobic conditions in the presence of various nutrients such as particular cations and anions, which may be adsorbed to sediment particles. In addition, we determined bacterial biodiversity, the presence of Hg-resistant bacteria, sulfate reduction rates, and Hg methylation and demethylation rates during autumn, winter and summer to highlight the role of bacteria activity in the seasonal Hg biotransformations.

were collected by hand in triplicate and stored in sterile plastic vessels. A subsample was immediately deep-frozen for biochemical and chemical analyses, and unfrozen samples were used the same day for isolation of Hg-resistant bacteria on agar plates and for counts of total microbes in sediments. Core samples were also collected for rates of microbial activities. 2.2. Biochemical composition of sediment organic matter Sediment samples were analyzed for total protein (PRT), carbohydrate (CHO) and lipid (LIP) content to evaluate the polymeric components of organic matter. PRT content was determined spectrophotometrically using Coomassie Brilliant Blue (Bradford, 1976; Mayer et al., 1986) after extraction of 4 g of freeze-dried sediment with 8 ml 0.5 N NaOH in an ultrasonic bath for 2 h at 40
C (Nunn and Keil, 2006). After reaction with the dye, absorbance was determined at 595 nm. PRT concentrations are reported in Bovine Serum Albumin (BSA, Biorad) equivalents. CHO content was determined by the Dubois et al. (1956) method after extraction of 2.5 g sediment with 50 ml 1 N CH3COOH for 4 h at 20e30
C in an ultrasonic bath (Mecozzi et al., 2000). Concentration of CHO was expressed in D(þ)-glucose equivalents after reaction with 96% sulfuric acid and 5% phenol followed by spectrophotometric detection at 485 nm. LIP were extracted overnight from 2 g of dried sediment by direct elution with chloroform and methanol (2:1 v/v) at 4
C (Bligh and Dyer, 1959) and LIP analysis was determined by charring with H2SO4 at 200
C for 15 min (Marsh and Weistein, 1966). Tripalmitin was used for standard solutions and the absorbance was determined at 375 nm. All analyses were conducted in triplicate. For each biochemical class, results are expressed per gram of sediment dry weight (s.d.w.). To compare biochemical classes, PRT, CHO and LIP were converted into carbon equivalents, assuming the respective conversion factors of 0.49, 0.40 and 0.75, respectively (Fichez, 1991). The sum of carbon equivalents of constituted biopolymeric carbon (BPC) was expressed as mg C g1 s.d.w.

2. Materials and methods 2.3. Quantification of water-washed cations and anions 2.1. Samplings The study area was previously described in detail (Acquavita et al., 2012; De Vittor et al., 2012). Surficial sediments (upper 1 cm) were collected at four stations, MA, MB, and MC in autumn, winter and summer and GD only in winter and summer (Fig. 1). These sites were used for seeding Manila clams (Tapes philippinarum). Sediment cores

Cations and anions were quantified to correlate biochemical occurrence with nutrients in precipitated salts on sediment particles. Nutrients were washed from 1 g of frozen sample with 50 ml of milliRo water after 3 min vortexing at 5
C. The supernatant was filtered through Whatman black ribbon 589/1. An aliquot of 20 ml was injected into a pre-loop filter with 0.45 mm cartridge ion

Fig. 1. Map of Marano and Grado lagoons (with map inset of Italy) with sampling sites (MA, MB, MC and GD) of surficial sediments.

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115

chromatograph (METROHM 761 Compact IC) with a conductivity detector. For anion determination, the chromatograph was equipped with a column containing METROSEP ASUPP5 150 mm  4 mm with a mobile phase consisting of NaHCO3 1 mM/Na2CO3 3.2 mM running at a flow rate of 0.7 ml min1; for cation determination the chromatograph was equipped with a METROSEP C3 250  4 mm column with mobile phase consisting of HNO3 3 mM working at 1 ml min1. The determination of cations and anions was performed using standard solutions for each ion. The salinity was calculated from chlorine concentration in water-washed sediments as S ¼ 1.80655Cl. 2.4. Determination of mercury (Hg-T) in sediments About 50e100 mg of dry sample was weighed directly in a Teflon digestion vessel, and after addition of 4 ml of conc. HNO3, the vessel was closed and the mixture was left to react at the room temperature for one hour. Digestion was finished by heating at 100
C for 12 h on a hot plate. When cooled, the sample was diluted with Milli-Q water to the mark (25.8 ml). An aliquot of the digest was added to the reduction cell and after reduction with SnCl2 mercury was swept from the solution by aeration and concentrated on a gold trap. After heating, Hg was released into a Cold Vapor Atomic Absorption Spectrophotometer (CVAAS) (Milton Roy). The detection limit, calculated on the basis of three standard deviations of procedural blanks was 1 ng/g. Repeatability of the method was 3e4%. A detailed description of the methods is described elsewhere (Horvat et al., 1991). 2.5. Determination of methylmercury (MeHg) in samples by acid dissolution/solvent extraction/aqueous phase ethylation/isothermal GC/CV AFS detection Approximately 100 mg of sample was weighed directly in a 30 ml screw capped Teflon vials. After addition of 7 ml of mixture comprising 5% H2SO4, 18% KBr and 1.5 ml 1 M CuSO4, the vials were closed and shaken vigorously for 15 min. 10 ml of CH2Cl2 was added to each vial and the samples were shaken again for 15 min. The samples were then centrifuged for 5 min at 3200 rpm. The organic phase was separated from the aqueous phase in a Teflon separating funnel and CH2Cl2 was collected in a 60 ml Teflon vial. Extraction was repeated with an additional 5 ml CH2Cl2. Approximately 35 ml of Milli-Q water was added to the combined CH2Cl2. The organic phase was evaporated is a water bath at about 90
C. Samples were then purged with N2 for 5 min to remove any remaining CH2Cl2. An aliquot of the aqueous sample was added to a Teflon reaction vial and the pH was adjusted to be 4.6 with the addition of 100 ml of acetate buffer. 50 ml of 1% NaBEt4 was added to the reaction vial at the end and the mixture was left to react at room temperature for 15 min. Ethylated MeHg as ethylmethylmercury was purged onto a Tenax trap for 15 min with Hg-free nitrogen. Tenax traps were then connected to the flow of argon and MeHg was thermally desorbed (180
C) onto an isothermal GC column. Hg species were converted to Hg(0) by pyrolysis at 600
C and measured by CVAFS. The limit of detection, calculated on the basis of three standard deviations of procedural blanks, was about 50 pg MeHg/g. Repeatability of the method was about 10% (Horvat et al., 1993a,b; Liang et al., 1994). 2.6. Total cell counts Fresh sediments were fixed immediately after sampling by the addition of 15% paraformaldehyde solution (final concentration 2%) (Maruyama and Sunamura, 2000) and stored at 4
C in the dark. Before analysis, sediment slurries were prepared by thoroughly shaking sediments that were diluted 1000-fold in 0.1 M particle-

107

free tetrasodium pyrophosphate dispersing solution. A 1e3 ml aliquot of the suspension was incubated 15 min with 4,6diamidino-2-phenylindole (final concentration 1 mg ml1) and filtered through a black polycarbonate membrane (0.2 mm pore size, 25 mm diameter, Isopore, Millipore, Milan, Italy). Cell counts were determined by counting stained cells on 20 randomly selected fields using a Zeiss Axioplan epifluorescence microscope with excitation/emission filters of 365/420 nm. 2.7. Counting and isolation of Hg-resistant strains Total aerobic heterotrophic bacteria and Hg-resistant bacteria were counted and isolated by sonicating (3 min) 2 g of fresh sediments diluted in 10 ml of sterile saline solution (0.9% NaCl) to detach most of bacteria from sediment particles. Dry weights were calculated by drying sediments to constant weight at 50
C. After 1 min of sediment decantation, the suspension was diluted in order of ten. A 0.1 ml aliquot of each dilution was spread on solid Nelson medium, at pH 7.5, containing per liter: 2 g D-Glucose, 5 g Casamino acids, 1 g yeast extract, 10 g NaCl, 2.3 g MgCl2$6H2O, 3 g KCl, and 15 g Bacto-agar (Difco). Media were made with and without added HgCl2 (5 mg ml1). After 24 h incubation at 30
C colonies forming units (CFU) were counted. Colonies with different shapes, colors and consistency were purified and stored at 80
C in 20% glycerol for further analyses. 2.8. Analysis of plasmid content Analytical amounts of plasmid DNA were obtained from 1.5 ml bacterial cultures using either the alkaline lysis method (Sambrook et al., 1989) or the commercial Kit Plasmid Miniprep (Qiagen) according to the manufacturer’s instructions. The presence of plasmid molecules was analyzed by agarose gel (0.8% w/v) electrophoresis in TAE buffer (0.04 M TriseAcetate, 0.01 M EDTA) containing 0.5 mg/ml (w/v) of ethidium bromide. 2.9. Preparation of cell lysates or genomic DNA and amplification of 16S rRNA genes from bacterial isolates For preparation of cell lysates, bacterial colonies grown overnight at 28
C on LB (Luria Broth) plates were resuspended in 20 ml sterile distilled water, heated to 95
C for 10 min, and cooled on ice for 5 min. Genomic DNA extraction was carried out as previously described (Giovannetti et al., 1990). Two ml of each cell lysate were used for the amplification via polymerase chain reaction (PCR). Amplification of 16S rRNA genes was performed in a total volume of 50 ml containing 1 Reaction Buffer, 150 mM MgCl2, each deoxynucleoside triphosphate at a concentration of 250 mM, and 2.0 U of Polytaq DNA polymerase (all reagents obtained from Polymed, Florence, Italy) and 0.6 mM of each primer [P0 50 GAGAGTTTGATCCTGGCTCAG, and P6 50 CTACGGCTACCTTGTTACGA] (Grifoni et al., 1995). A primary denaturation treatment of 90 s at 95
C was performed and amplification of 16S rRNA genes was carried out for 30 cycles consisting of 30 s at 95
C, 30 s at 50
C and 1 min at 72
C, with a final extension of 10 min at 72
C. Amplification of merA gene was carried out using the following primer sets, set 1 (merAgram-forward CCGTCCAAGATCATGAT merAgram-reverse, GGRTCGGTRAACACCAC) and set 2 (merAgram þ forward GGAAGAAMACCRAATAC merAgram þ reverse, CCTTCWGHCATTGTTA), for Gram-negative (Gram) and Grampositive (Gramþ) bacteria, respectively. The two primer sets were designed as follows: for both Gram and Gramþ bacteria all the merA sequences available in database were retrieved. Then, a multialignment using a reduction set of the retrieved sequences was

108

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115

constructed in order to check for the presence of highly conserved regions that might represent the target sites for ad hoc designed primer. Once the conserved regions were identified, two primer sets were designed (one for the Gram and the other for the Gramþ bacteria) and the presence of the identified target sequence was checked in each sequence of the complete multialignment. The amplification profiles were as follows; for PCR employing the primer set 1 a primary denaturation at 95
C for 2 min was followed by 30 cycles consisting of 95
C for 30 s, 51
C for 45 s, and 72
C for 1 min, with a final extension at 72
C for 10 min. For PCR employing the primer set 2 a primary denaturation at 95
C for 2 min was followed by 30 cycles consisting of 95
C for 30 s, Ta (48, 45, 43)
C for 45 s, and 72
C for 1 min, with a final extension at 72
C for 10 min. The expected size of the amplicon was about 930 and 540 bp for Gram and Gramþ bacteria respectively, corresponding to a merA region spanning from nt 451 and 1381 and nt 1330 and 1870 for Gram and Gramþ bacteria, respectively. 2.10. Sequencing of 16S rRNA and merA genes Amplicons corresponding to the 16S rRNA or merA genes (observed under UV, 312 nm) were excised from the gel and purified using the “QIAquick” gel extraction kit (QiAgen, Chatsworth, CA, USA) according to manufacturer’s instructions. Direct sequencing was performed on both DNA strands using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems) and the chemical dye terminator (Sanger et al., 1977). Each sequence was submitted to GenBank and assigned the accession number shown in Table 3. 2.11. Homologs retrieval and phylogenetic analysis BLAST probing of the DNA databases was performed with the BLASTn option of the BLAST program (Altschul et al., 1997), using default parameters. Nucleotide sequences were retrieved from the GenBank, EMBL, and RDP databases. The ClustalW program (Thompson et al., 1994) was used to align the 16S rRNA gene sequences obtained with the most similar ones retrieved from the databases. Each alignment was checked manually, corrected, and then analyzed using the neighbor-joining method (Saitou and Nei, 1987) according to the model of Kimura 2-parameter distances (Kimura, 1980). The Molecular Evolutionary Genetics Analysis 4 (MEGA4) software (Tamura et al., 2007) was used to construct phylogenetic trees whose robustness was evaluated by 1000 bootstrap resamplings. 2.12. Southern hybridization Genomic bacterial DNA was purified as described by Giovannetti et al. (1990). Restriction digestions using Boehringer (Mannheim) enzymes and buffers were carried out by treating 1e3 mg of DNA with 10e30 units of enzyme at 37
C for 5e6 h. Fragments were separated by electrophoresis on a 0.6% w/v agarose gel. Probes, prepared according to standard protocols (Sambrook et al., 1989), were labeled and the hybridization signals detected with the “Digoxigenin Labeling and Detection Kit” (Boehringer, Mannheim) using the colorimetric method following the instructions of the supplier. Southern blotting was carried out as described in Sambrook et al. (1989) on nylon membranes (Hybond N, Amersham), which were hybridized as described by Fani et al. (1991). 2.13. Determination of gaseous Hg in cultures Stored isolated strains were retrieved from 80
C on liquid Nelson medium and were adapted to grow with 1 mg ml1 HgCl2. For the Hg volatilization test, 2 ml of dense culture (1.0 absorbance

at 600 nm) was transferred in 18 ml test tubes sealed with Mininert valve caps (Supelco). Volatile Hg species were taken from the headspaces of vial by a gas-tight syringe and injected into a closed double amalgamation system connected to a CVAFS analyzer system. Hg on the sampling gold trap was then released by heating (w500
C) for 1 min in a flow of Ar to a permanent gold trap, released again (heating for 1 min, w500
C) and detected by a CVAFS analyzer (Tekran 2500). The system was calibrated by gas phase Hg (Hg0) kept at 15
C (Tekran, model 2505 mercury vapor calibration unit). An aliquot of 10e20 ml was transferred with a gastight syringe into the measurement train through a septum. The amount of Hg injected was calculated from the gas law and a correction for the difference in temperature of the gas phase and the syringe was also applied. The detection limit was 4 pg based on three standard deviations of the procedural blank. The repeatability of the method was 4% (Horvat et al., 2003). 2.14. Radioisotopic determination MeHg production and degradation Sediment cores were collected by hand at each of the four lagoon sties. After transport to the laboratory and removal of the overlying water by siphon, cores were placed into an N2-filled glove bag and the upper cm removed, placed into a jar, and homogenized. Subsamples (2.0 ml) were added to N2-flushed serum vials for Hg transformation measurements and plastic 5-cc syringes (distal end removed) for sulfate (SO4)-reduction measurements as described previously (Hines et al., 2006). Vials were sealed with butyl-rubber septa and aluminum crimps. Syringes were sealed with sleeve stoppers. Pore water for sulfate analysis was extracted from the remaining sediment by centrifugation under N2 followed by filtration through 0.45 mm syringe filters (Hines et al., 2006). Rate constants of MeHg production and degradation (% day1) were determined using radioisotopic methods (Hines et al., 2006; Gray and Hines, 2009). Sample slurries consisting of 2.0 ml of wet sediment diluted with 2.0 ml of anoxic lagoon water were injected (2.0 ml) with the radiotracers 203HgCl2 (0.5 mCi equivalent to 170 ng Hg) or 14C-methyl-Hg chloride (0.1 mCi equivalent to 334 ng Hg) for methylation and demethylation, respectively, and incubated at ambient temperature in darkness for 18  2 h. The amount of Hg added as 203Hg was 5e90 times less than ambient total Hg in samples. The 14C-methyl-Hg added was 60e370 times more Hg than ambient. Before use, the 14C-methyl-Hg was extracted into CH2Cl2 and then back extracted into water. This preparation was tested by an outside analytical laboratory and found to be w100% methyl-Hg. After incubation, vials for methylation assays received multiple injections of small volumes of 6 N HCI to stop the reaction, dissolve carbonate material, and to store samples at low pH; 2e3 ml of concentrated HCI was required to dissolve carbonates. Radiolabeled 203 Hg-MeHg was extracted twice into toluene following treatment with CuSO4 and KCl in H2SO4 (Gray and Hines, 2009). Pooled toluene extracts were dehydrated using anhydrous Na2SO4 and radioactivity determined by scintillation counting. Alkali (NaOH, 3 N) was added following incubation to stop the demethylation reaction and to sequester 14CO2 in the liquid phase. Demethylation was determined by measuring 14C in CO2 and CH4 using a gas-stripping and trapping system similar to that previously described (Gray and Hines, 2009). Briefly, CH4 was flushed from the vial with air (30 ml/min for 15 min) and combusted to CO2 in a CuO-packed quartz column at 850
C. The resulting CO2 was trapped in phenethylamine, methanol, and a toluene-based scintillation fluid and 1.0 ml of CH4 was injected into each vial to facilitate removal of CH4. Following 14CH4 measurements, samples in vials were acidified with 1.0 ml of 6.0 N HCl and after 24 h, 14CO2

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115

was stripped via a stream of N2 for 15 min and trapped as described above. Radioactivity was determined by scintillation counting. Since radiotracers used for both methylation and demethylation assays are not in the exact chemical form as ambient molecules, which tend to be associated with solutes and particulate matter, these rates must be considered as potential rates that are useful for comparative purposes. 2.15. Radioisotopic determination of sulfate reduction rates Sulfate reduction rates were determined using 35S and the chromium reduction assay as described previously (Hines et al., 1997, 2001). Briefly, 35SO4 (1.0 mCi) was injected into syringes (described above) containing 2.0 ml of sediment, that were then incubated for 18 h at in situ temperature in an N2-filled jar. The reaction was stopped by freezing, and reduced sulfur species were stripped by an N2 gas stream while refluxing in a mixture of HCl, reduced Cr, and ethanol (Hines et al., 2001). The resulting H2S was trapped as ZnS in a zinc acetate solution and radioactivity determined by scintillation counting. 3. Results 3.1. Sediment characterizations Sediments were characterized by various groups involved in the MIRACLE project and included grain size, total carbon, organic carbon, total nitrogen, humic acids (Acquavita et al., 2012), and phosphate content (De Vittor et al., 2012). In this study we further characterized the organic carbon by determining the biopolymeric carbon (BPC), constituted mainly by PRT, CHO and LIP (Fig. 2). Seasonal variations of the three biochemical classes were evident (Fig. 2). In autumn, sediments showed the lowest content of BPC with a prevalence of CHO at station MB. Moreover, LIP and CHO were relatively high at the expense of PRT with the lowest concentration measured at site MA (166 mg g1 d.w.). In winter, sediments showed the highest contents of PRT and CHO especially at stations MA and MC. In contrast, at site GD with the highest Hg pollution, BPC was very low with a prevalence of CHO. In summer, BPC exhibited intermediate concentrations compared with autumn and winter except for PRT at station MC, which had the highest value (3681 mg g1 d.w.) of the entire study (Fig. 2). The highest

109

fluctuations of CHO occurred at station MA and ranged from 640 mg g1 d.w. in autumn to 2594 mg g1 d.w. in winter (w4-fold). Conversely, LIP concentrations displayed the lowest fluctuations (2.6-fold) from 250 mg g1 d.w. in summer at MA station to 656 mg g1 d.w. at MC station (Fig. 2). The LIP variations were mainly correlated (r2 ¼ 0.910; n ¼ 8) with PRT, except in autumn when LIP was relatively high with respect to PRT and CHO. The CHO was not correlated with any other biochemical parameters, probably because the origin of organic matter in the two lagoons was mainly influenced by polysaccharides of terrestrial origin from river effluents and by exopolysaccharides from cyanobacteria and diatoms attached to sediments of marine origin (Acquavita et al., 2012). Since the microbial production of the biochemical classes depends on nutrient availability, seasonal variations of waterleached cations and anions from sediments were determined (Table 1). Salinity variations were consistent with a typical lagoon ecosystem; the widest range of salinity was found at station MB from 12.0 in winter up to 32.8 in summer and the maximum value (33.5) was found at station MC in autumn, which is near the Aussa River outflow. Salinity correlated with sulfate reduction rates (r2 ¼ 0.893; n ¼ 8), except for station MB in autumn and at MA and MC stations in summer (Fig. 3). The seasonal variations of sulfate reduction rates were consistent with temperature changes of sediments (Fig. 4A). The highest rates were in autumn with a mild temperature (18.3
C  1.1) for this season in Northern Italy, and in summer (Fig. 4A) with a significant increase of temperature (24.5
C  0.9). In winter, this activity was reduced because of the relative cold temperature (T ¼ 9.8
C  1.1). In contrast, the sulfate content in sediments did not correlate with sulfate reduction rates except in summer when sulfates were lower than in autumn and winter due to high rates anaerobic respiration (Hines et al., 2012). It is also interesting that sulfate itself was very well correlated with Ca2þ (r2 ¼ 0.812; n ¼ 11) but less with Mg2þ(r2 ¼ 0.464; n ¼ 11), suggesting a different solubility. However, the presence of sulfate reduction in sediments is always synonymous with anaerobic conditions, which increased significantly in summer at station MC and in autumn at station MB (Fig. 4A). Acetate accumulation in sediments highlights the fermentative processes (Fig. 4B). Fermenters and sulfate-reducing bacteria (SRB) complement each other; when sulfate respiration is high, SRB consume acetate (Fig. 4A,B). In winter, nitrate and ammonia

Fig. 2. Distributions of CHO (mg g1, d.w.) (empty histograms), LIP (gray histograms) (mg g1, d.w.) and PRT (mg g1, d.w.) (black histograms) at 4 stations (MA, MB, MC and GD) in three periods of the year (A, autumn, W, winter and S, summer). Standards deviation bars are reported.

110

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115

Table 1 Concentrations of water-leached cations and anions in sediments of two lagoons at 4 stations (MA, MB, MC and GD) in three periods of the year (A, autumn, W, winter and S, summer). Stations

NHþ 4 (mg g1)

Kþ (mg g1)

Mg2þ (mg g1)

Ca2þ (mg g1)

Naþ (mg g1)

Sl (mg g1)

Salinity (&)

NO3 (mg g1)

SO2 4 (mg g1)

PO3 4 (mg g1)

Acetate (mg g1)

MA-A MB-A MC-A

0.056 0.033 0.065

0.401 0.309 0.636

0.834 0.577 1.203

1.545 1.581 2.904

6.639 4.136 9.321

12.93 7.85 18.53

23.35 14.18 33.47

0.043 0.053 0.073

0.568 0.517 0.996

n.d. n.d. n.d.

0.087 0.098 0.205

MA-W MB-W MC-W GD-W

0.093 0.082 0.289 n.d.

0.686 0.945 0.959 0.808

1.455 1.233 1.736 1.646

1.575 1.548 1.932 1.889

5.084 4.562 5.747 5.898

9.38 6.84 9.65 10.94

16.95 12.35 17.44 19.76

0.363 0.337 0.319 0.339

0.667 0.469 0.869 0.69

0.145 n.d. n.d. n.d.

0.015 n.d. 0.016 n.d.

MA-S MB-S MC-S GD-S

0.006 0.01 0.021 n.d.

0.326 0.526 0.624 0.348

0.629 0.888 0.769 0.582

1.002 1.139 1.139 1.016

5.084 4.562 5.747 5.898

8.19 18.18 12.81 10.59

14.79 32.84 23.13 19.14

0.016 0.022 0.059 0.024

0.336 0.578 0.497 0.403

0.102 0.113 0.019 n.d.

0.006 0.225 0.287 n.d.

accumulated in sediments confirming the low microbial activity and lack of infaunal bioturbation during this period of the year (Fig. 4B). The correlation between PRT and acetate (r2 ¼ 0.972; n ¼ 7) occurred in autumn and summer, but not winter (r2 ¼ 0.887; n ¼ 4). This result suggests that acetate is produced in conjunction with PRT that is probably formed by growing microbial communities. Acetate concentrations did not correlate with CHO. All these findings suggest that anaerobic processes in lagoon sediments are common except in sediments at Grado lagoon (GD), which were more aerobic as confirmed by low sulfate reduction rates and the absence of acetate and ammonia in sediments. In general, anaerobic conditions favor microbial MeHg production (Merrit and Amirbahman, 2009), and in this study MeHg was very well correlated with PRT content except for sediments collected at station MC in all seasons (Fig. 5A). The Hg methylation rates and MeHg concentrations in sediments did not correlate with sulfate reduction rates in these samples, which are from the upper 1 cm. However, nitrate concentrations did correlate with Hg methylation rates (Fig. 5B) and with MeHg content (Fig. 5C).

plate method on solid agar media to isolate Hg-resistant bacteria (Table 2). Bacteria counted with the two methods in winter decreased in number, which corresponded with the low microbial activities. Viable aerobic heterotrophic bacteria (CFU g1) varied from 0.049% to 0.27% of the total bacteria determined by DAPI, and numbers from both counting techniques correlated with each other (r2 ¼ 0.775; n ¼ 11). A further significant correlation was found between Hg-demethylation rates and aerobic heterotrophic Hgresistant bacteria (HgrCFU g1, d.w.), but regressions of these data differed greatly between summer and autumn/winter (Fig. 6A). In

3.2. Microbial activities In order to gain more information about microbial activity and its role in Hg transformation, total bacteria were counted in sediments by epifluorescence microscopy (DAPI) and by the spread

Fig. 3. Correlation between salinity, calculated from chlorine concentrations in waterwashed sediments, and sulfate reduction rates (nmol ml1 day1) in pore waters of surficial sediments. Outliners (empty circles) represent sediments sampled in autumn (MB-A), and in summer (MC-S, MA-S).

Fig. 4. A. Histograms representing the distribution of sulfate reduction rates (nmoles ml1 day1) in pore waters at 4 stations (MA, MB, MC and GD) in three periods of the year (A, autumn, W, winter and S, summer) with temperature values (continuous line) taken during sampling. B. Distribution of acetate (mg g1, d.w.) (empty histograms), ammonia (mg g1, d.w.) (gray histograms) and nitrates (mg g1, d.w.) (black histograms) at 4 stations (MA, MB, MC and GD) in three periods of the year (A, autumn, W, winter and S, summer).

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115

Fig. 5. A. Correlation between PRT (mg g1, d.w.) and MeHg (ng g1, d.w.) in sediments (black circles) collected in three periods of the year, except for samples (empty circles) collected at stations MC adjacent to Aussa river outflow. B. Hg methylation rates (day1) correlated to nitrates concentrations in winter (black circles) but not in samples collected in autumn and summer. C. MeHg content (ng g1, d.w.) correlated to nitrates concentrations in winter (black circles) but not in samples collected in autumn and summer.

autumn and winter, a good correlation was found between the number of total aerobic heterotrophic bacteria and the Hg-resistant bacteria (Fig. 6B), which ranged from 27% to 53% (Table 2). In these two periods, the variability of Hg-resistant bacteria correlated with total Hg concentrations in sediments (r2 ¼ 0.839; n ¼ 7). These data suggest that Hg-resistant strains may play a significant role in MeHg demethylation. On the other hand, Hg-demethylation rates in summer were higher than during autumn and winter, but the low percentage of Hg-resistant bacteria in summer (<2%) (Table 2) suggested anaerobic bacteria other than Hg-resistant aerobes conduct demethylation in summer. Hg-demethylation rates, especially in autumn and winter, might be ascribed to the presence of narrow and broad-spectrum Hgresistant bacteria. In order to check this hypothesis, we were able to isolate four Hg-resistant strains in the presence of 5 mg ml1 HgCl2, but none using 1 mg ml1 CH3HgCl. The four strains were identified by the nucleotide sequence of the 16S rRNA gene amplified via PCR. Each of the 4 sequences obtained was used as seed to probe the

111

nucleotide databases using the BLAST program (Altschul et al., 1997). Data obtained revealed that the four isolates were representative of four bacterial genera, two Gramþ (Staphylococcus and Bacillus) and two Gram (Stenotrophomonas and Pseudomonas). The most similar sequences were then retrieved and aligned to those obtained in this work using the ClustalW (Thompson et al., 1994) program. The alignments were used to construct four phylogenetic trees (data not shown), which were used to affiliate each strain to a given species (Table 3): 1) isolate MA-01 joined the cluster including sequences from Staphylococcus xylosus; 2) the other Gram-positive bacterium, MC-02, clustered with Bacillus cereus sequences; 3) strain MB-01 was affiliated with the genus Pseudomonas, although on the basis of the sole 16S rRNA sequence it was not possible to assign it to a given species; 4) lastly, strain MC-01 was affiliated to the genus Stenotrophomonas. The evaluation of the presence of plasmid molecules was carried out on the four bacterial strains. Plasmid profiles (Fig. 7) revealed that two (MA-01 and MC-01) out of the four bacterial isolates harbored plasmid molecules. Both strains exhibited multiple plasmids of different sizes, ranging from about 2 kb to 25 kb. In order to check the presence of merA (encoding the mercuric reductase) in the genome of the four strains, a PCR amplification of a merA region was carried out using the primer sets and the amplification conditions described in Section 2.9. We checked primer set 1 (designed for Gram bacteria) on the DNA of strains MB-01 and MC-01 and primer set 2 (designed for Gramþ bacteria) on the DNA of strains MA-01 and MC-02. Data obtained (not shown) revealed an amplicon of the expected size (about 900 bp) only from the Stenothrophomonas strain MC-01 (Table 3). In order to verify whether the amplicon actually corresponded to a region of the merA gene, it was purified from agarose gel and its nucleotide sequence determined. The sequence obtained was used to probe the public databases using the BLAST program (Altschul et al., 1997). The query sequence retrieved merA sequences belonging to different bacteria, demonstrating that it actually corresponded to a fragment of the merA gene. The whole body of data obtained suggested that strain MC-01 might possess the genetic determinants responsible for mercuric degradation, a finding that, in turn, suggested that this strain might be resistant to ionic Hg. We also performed a phylogenetic analysis of the MC01 merA gene and the most similar sequences retrieved from the BLASTn analysis were aligned to the MC-01 merA gene sequence and the alignment was then used to construct a phylogenetic tree (Fig. S1) whose analysis revealed that the MC-01 sequence joined a cluster containing orthologous sequences coming from different Gram bacteria, most of which affiliated with Pseudomonadacee. Most of these sequences were plasmid-borne. The possible absence of the merA gene in the other three strains was confirmed by a Southern blot experiment using the total DNA of the four strains digested with the restriction endonuclease HindIII as target and the MC-01 merA amplicon as probe. Data obtained (not shown) revealed that a hybridization signal was retrieved only from the MC-01 genome. Moreover, the merA gene was not located on the MC-01 plasmid(s). We also determined the biochemical production of Hg0 in pure cultures of the 4 Hg-resistant strains. After induction and incubation of liquid culture, Hg0 was measured in the headspace of each culture. The Stenotrophomonas sp. strain MC-01 harboring merA was able to produce volatile Hg(0) from medium amended with 1 mg ml1 HgCl2 (Fig. 8). The Staphylococcus xylosus strain MA-01 also reduced ionic Hg to Hg0, and the remaining two strains were not able to produce any Hg0 in the headspace under the same laboratory conditions. These findings suggested the existence of different mechanisms enabling microbial cells to tolerate high Hg concentrations.

112

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115

Table 2 Counting total bacteria in triplicates (DS ¼ standard deviations) in sediments by DAPI and plate count method for total aerobic heterotrophic cultivable bacteria as colonies forming units (CFU g1, d.w.) and Hg-resistant bacteria with their percentage. Stations

N
TB (g1) DAPI

DS

totCFU (g1)

DS

% totCFU

merCFU (g1)

DS

%mer (CFU g1)

Autumn MA-A MB-A MC-A

4.30Eþ07 3.90Eþ07 6.21Eþ07

3.94Eþ06 6.44Eþ06 4.24Eþ06

1.01Eþ05 1.07Eþ05 1.39Eþ05

4.29Eþ04 3.66Eþ03 7.85Eþ04

0.23 0.27 0.22

2.79Eþ04 3.52Eþ04 4.47Eþ04

1.20Eþ04 3.66Eþ03 1.96Eþ03

27.7 32.8 32.2

Winter MA-W MB-W MC-W GD-W

3.97Eþ07 3.31Eþ07 2.42Eþ07 2.57Eþ07

7.11Eþ06 6.87Eþ06 3.85Eþ06 8.90Eþ06

2.67Eþ04 2.43Eþ04 3.18Eþ04 1.26Eþ04

8.59Eþ03 3.27Eþ03 1.41Eþ02 8.31Eþ03

0.07 0.07 0.13 0.05

8.51Eþ03 7.53Eþ03 9.95Eþ03 6.71Eþ03

1.72Eþ03 8.19Eþ02 2.81Eþ03 4.75Eþ03

31.8 31.0 31.3 53.3

Summer MA-S MB-S MC-S GD-S

5.76Eþ07 9.33Eþ07 7.31Eþ07 5.06Eþ07

3.74Eþ06 9.09Eþ06 6.15Eþ05 2.03Eþ06

7.19Eþ04 1.78Eþ05 1.45Eþ05 1.00Eþ05

1.66Eþ04 5.83Eþ04 1.32Eþ04 3.91Eþ04

0.12 0.19 0.20 0.20

1.44Eþ03 1.89Eþ03 1.95Eþ03 1.55Eþ03

3.20Eþ02 4.10Eþ02 4.57Eþ02 3.12Eþ02

2.00 1.06 1.35 1.54

N
TB ¼ number of total bacteria; Tot-CFU ¼ total colony forming unit; % tot-CFU ¼ percentage of total colony forming unit; Mer-CFU ¼ total mercury resistant strains; % mer ¼ Percentage of mercury resistant strains.

4. Discussion Transformation of Hg species in surficial sediments of Marano and Grado lagoons was investigated in three different seasons. In winter, microbial activities, such as sulfate reduction, were slow and nitrates, ammonia and acetate accumulated in sediments. It is known that the two adjacent lagoon systems present an annual average salinity distribution ranging from 24 to 34 with a westeeast salinity gradient, and rivers are responsible for a great daily excursion in the salinity of the western part of the lagoon. In this study, sulfate reduction rates in sediments were mainly correlated with water-washed salinity instead of sulfates, suggesting that this anion is consumed faster by sulfate-reducing bacteria than it is replaced. Actually, the minimum concentrations of sulfate (Table 1) were found in correspondence with the highest sulfate reduction rates, which would be expected if SRB were removing sulfate rapidly. In the Marano and Grado lagoons, total organic carbon concentrations in sediments were low and relatively evenly distributed (mean 1.23  0.52%) (Acquavita et al., 2012). However, biopolymeric organic carbon varied greatly in composition of three biochemical components: PRT, CHO and LIP. These molecules are produced and consumed by bacterial communities, which are very sensitive to temperature changes and nutrient supply. In this study, the percentage of PRT tended to increase while LIP decreased from autumn to summer. This was probably due to the accumulation of PRT in summer due to increasing anoxia in sediments and low degradability of PRT under anaerobic conditions (Baldi et al., 2010). CHO degradation did not seem to vary seasonally, even though carbohydrate hydrolysis is facilitated by anaerobic conditions in marine habitats (Arnosti and Repeta, 1994). CHO persistence may be due to its association with refractory lignin of terrestrial origin or by the presence of complex exopolysaccharides of marine origin. Table 3 List of bacterial strains isolated from Marano Lagoon sediments, phylogenetic affiliation and 16S rDNA sequences accession number.

Fig. 6. A. Correlation between Hg-demethylation rates (% day1) and numbers of Hg-resistant bacteria (CFU g1, d.w.), which were determined by plate counts in autumn and winter (black circles) and in summer (empty circles). B. Correlation between numbers of total aerobic heterotrophic cultivable bacteria with Hg-resistant bacteria, which were determined by plate counts in autumn and winter (black circles) and in summer (empty circles).

Strains

Taxonomy

Plasmids (bp)

16S rRNA gene accession number

MA-01

Staphylococcus xylosus Pseudomonas sp. Stenotrophomonas sp. Bacillus cereus

2000; 10,000; 25,000 n.d. 5000; 20,000 n.d.

HQ455050

MB-01 MC-01 MC-02

HQ455051 HQ455049 HQ534311

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115

Fig. 7. Agarose gel electrophoresis (0.6%) of plasmids profiles from four bacterial strains. Lines: 1) Marker with different base pairs (bp) of DNA standards fragments; 2) strain MA-01; 3) strain MB-01; 4) strain MC-01; 5) strain MC-02: Arrows indicate the presence of plasmids in low copies.

The benthic photoautotrophic community produces CHO, but much of this material consists of refractory exopolysaccharides produced by cyanobacteria and diatoms (Arnosti, 2004; Baldi et al., 2010), which might explain the lack of relationship between acetate and CHO. PRT concentrations varied 22-fold throughout the study, whereas total organic carbon (1.23  0.52%) and humic acids (HA, 3.75  2.97 mg g1) were relatively homogeneous (Acquavita et al., 2012) with respect to BPC. Therefore, PRT was the best parameter for considering bioavailable organic carbon variations in relation to organic mercury. Indeed, MeHg content in sediments was well correlated with PRT, except for all sediments collected at station MC that is near the Aussa River mouth (Fig. 5A). The lack of correlation at MC was due to the fact that HA at MC was of terrestrial origin while other sediments contained HA of marine origin. Acquavita et al. (2012) found a less significant correlation (r2 ¼ 0.375; n ¼ 13) between MeHg normalized to HA content and humic d13CHA than we found between PRT and MeHg (r2 ¼ 0.952) in this study. A chemical competition might occur between these two organic carbon fractions. The affinity of ionic Hg and MeHg for humic substances is known (Amirbahman et al., 2002), but our data seem to be the first to show a correlation between MeHg and PRT in a natural lagoon environment. Probably the presence of sulfhydryl groups of cysteine and cystine in proteins of marine origin play an important role in capturing MeHg in this ecosystem. Anaerobic conditions probably influenced the MeHg content and Hg methylation activity in lagoon sediments. However, these

Fig. 8. Volatilization of Hg(0) in the headspace (ng ml1) by three Hg-resistant strains MC-01 (solid circles) , MA-01 (empty squares) and MB-01 (empty circles) cultivated in liquid Nelson medium amended with 5 mg ml1 of HgCl2.

113

rates were correlated with nitrate concentrations in winter. Bacterial activities were low during the winter as confirmed by low numbers of total bacteria determined by both counting methods, and by low rates of sulfate reduction. Total number of bacteria (DAPI counting) had a low correlation with Hg methylation rates (r2 ¼ 0.407; n ¼ 11) suggesting that Hg methylation in winter might be linked to a biological release of Hg methylating co-factors (Filippelli and Baldi, 1993; Baldi, 1996). The relationship between MeHg concentrations, methylation rates and nitrate concentrations was interesting. However, methylation rates reported here are rate constants that were not directly converted to the mass of Hg methylated. When these constants were multiplied by pore water concentrations of total Hg and MeHg (Hines et al., 2012), it was shown that the methylation of Hg in winter was quite low and probably did into contribute significantly to the MeHg pool in the sediments. In addition, the nitrate concentrations in winter were extremely high and did not vary among sites. With only four data points for winter, it is impossible to state unequivocally that nitrate levels were important in affecting Hg methylation. Hg methylation is often related to bacterial sulfate reduction, but in this study, which focused on the upper 1.0 cm, we did not found a correlation between them, instead this activity was mostly correlated to salinity. Chlorine and sulfate have a constant ratio in seawater, but if sulfate is biologically consumed, this relationship can change. However, when the upper 10 cm of sediment at these sites was investigated, Hg methylation and MeHg demethylation correlated significantly with sulfate reduction. In addition, the application of the sulfate reduction inhibitor molybdate significantly inhibited Hg methylation (Hines et al., 2012). These results indicated that sulfate reduction was an important control on Hg transformations in lagoon sediments. Therefore, processes in the upper 1.0 cm of sediment may behave differently than the remaining sediment column. In two lagoon sediments we found that sulfate was mostly correlated to calcium rather than to magnesium suggesting a prevalence of this cation. This finding suggests that the Chloralkali plant, located inland at Torviscosa, contributes not only Hg into the Aussa River, but also other less harmful compounds used during the Solvay process, such as limestone, which is a source for calcium, carbonates and sulfates, and brines which are sources of chlorine and ammonia, which was partly converted to nitrates. These materials flow mainly to station MC, located at the Aussa River mouth. The chloro-alkali by-products explain why high chlorine levels (18.53 mg g1) were found in sediments at the river mouth in autumn compared to 12.93 mg g1 at station MA, which is adjacent to the open sea (Baldi et al., 2012). In autumn and winter, Hg-demethylation rates correlated with numbers of Hg-resistant bacteria, which ranged from 27% to 53% of the total recoverable aerobic heterotrophs. Broad Hg-resistant bacteria were not isolated, but we cannot exclude that other non culturable aerobic Hg-resistant bacteria possess the organomercurial lyase to break down MeHg to Hg(0) and CH4 (Barkay et al., 2003). During demethylation measurements, the partitioning of 14 C between CO2 and CH4 was determined (Hines et al., 2012), and the highest proportion of 14CH4 occurred during winter. This result agrees with the importance of the mer-mediated reductive demethylation pathway found in Hg-resistant bacteria and suggests that mer-coded enzymes catalyze a significant portion of the MeHg degraded by bacteria in winter. The highest Hg-demethylation activity was detected in summer (14 fold) when the aerobic Hg-resistant bacteria were the lowest, suggesting that another type of Hg-demethylation process occurred besides the mer pathway noted in winter. In summer, Hgdemethylation rates were instead triggered by anaerobic conditions, which favors fermentation and sulfate reduction. This

114

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115

chemical species reacts strongly with Hg2þ to form metacinnabar (HgS) but also with MeHg to dismutate to HgS and dimethylmercury (Craig and Bartlett, 1978; Baldi et al., 1993, 1995). The high rates of demethylation and the increased importance of 14CO2 as an end product of 14C-MeHg demethylation in summer and fall (Hines et al., 2012) suggest that the bulk of MeHg degradation in the lagoon sediments occurred via an oxidative demethylation process (Oremland et al., 1995) that is not catalyzed by enzymes coded by mer genes. It was reported previously that oxidative demethylation is an important process in coastal sediments in the northern Adriatic Sea, but similar to the current study, the reductive path increased in importance in winter/autumn when oxygen penetrated the sediments (Hines et al., 2006). Our finding that the relative abundance of Hg-resistant bacteria increased in winter/ autumn when the reductive path was more important, suggests that these bacteria are significant contributors to MeHg degradation in that period. 5. Conclusions Despite high Hg contamination in sediments of both lagoons, the high percentage of Hg-resistant strains probably attenuated Hg pollution in winter/autumn. Hg-demethylation rates were as much as 46 times higher than Hg methylation rates with the largest differences occurring in summer when demethylation was oxidative in nature. However, Hg-resistant bacteria may play a direct role in Hg detoxification during several months of the year by producing the less harmful Hg0 from ionic Hg and probably also from MeHg. The number of Hg-resistant bacteria in autumn and winter was correlated to total Hg concentrations in sediments and their percentage indicates high Hg pollution in the two lagoons. Four strains were characterized and affiliated with four bacterial genera on the basis of 16S rRNA gene sequence analysis. Just one (MC-01) isolate possessed a merA gene, which was very likely located on the bacterial chromosome(s), even though this strain harbored plasmids of different sizes. However, we cannot exclude that other mechanisms can be induced with respect to enzymatic reduction of ionic Hg to Hg0. Most of our strains produced mucoid colonies in the presence of 5 mg g1 HgCl2, and were not able to form volatile Hg0. Thus, it is possible that a massive production of exopolysaccharide, which binds mercury, might be responsible for the reduction of ionic Hg. However, this idea needs further investigation. Acknowledgment The authors are very grateful for the fieldwork and sampling operations carried out by Stefano Caressa. The “MIRACLE” (Mercury Interdisciplinary Research for Appropriate Clam farming in Lagoon Environment) Project was supported financially by the Commissario Delegato for the Marano and Grado Lagoons in 2008e2009 (coordinator: S. Covelli). Appendix. Supplementary material Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.ecss.2012.02.008. References Acquavita,, A., Covelli, S., Emili, A., Berto, D., Faganeli, J., Giani, M., Horvat, M., Koron, N., Rampazzo, F., 2012. Mercury in the sediment of the Marano and Grado Lagoon (Northern Adriatic Sea): sources, distribution, and speciation. Estuarine, Coastal and Shelf Science (Miracle Hg project) 113, 20e31.

Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Research 25, 3389e3402. Amirbahman, A., Reid, A.L., Haines, T.A., Kahl, J.S., Arnold, C., 2002. Association of methylmercury with dissolved humic acids. Environmental Science & Technology 36, 690e695. Arnosti, C., 2004. Speed bumps and barricades in the carbon cycle: substrate structural effects on carbon cycling. Marine Chemistry 92, 263e273. Arnosti, C., Repeta, D.J., 1994. Oligosaccharide degradation by anaerobic marine bacteria: characterization of an experimental system to study polymer degradation in sediments. Limnology and Oceanography 38, 1865e1877. Baldi, F., 1996. Microbial transformation of mercury species and their importance in the biogeochemical cycle of mercury. In: Sigel, A.S.H. (Ed.), Mercury and its Effects on Environment and Biology. Marcel Dekker Inc., New York, pp. 213e257. Baldi, F., Pepi, M., Filippelli, M., 1993. Dimethylmercury and methane produced by methylmercury-resistant Desulfovibrio desulfuricans. Applied and Environmental Microbiology 59, 2479e2485. Baldi, F., Parati, F., Filippelli, M., 1995. Dimethylmercury and dimethylmercurysulfide of microbial origin in the biogeochemical cycle of mercury. Water, Air & Soil Pollution 80, 805e815. Baldi, F., Marchetto, D., Pini, F., Fani, R., Michaud, L., Lo Giudice, A., Berto, D., Giani, M., 2010. Biochemical and microbial diversity of shallow marine sediment along the Terra Nova Bay (Ross Sea, Antarctica). Continental Shelf Research 30, 1614e1625. Baldi, F., Facca, C., Marchetto, D., Nguyen, T.N.M., Spurio, R., 2011. Diatom quantification by real-time PCR and diatom distribution with salinity brines in coastal sediments from Terra Nova Bay (Antarctica). Marine Environmental Research 71, 304e311. Baldi, F., Marchetto, D., Gallo, M., Fani, R., Maida, I., Covelli, S., Fajon, V., Zizek, S., Hines, M., Horvat, M., 2012. Chloro-alkali plant contamination of Aussa River sediments induced by a large Hg-resistant bacterial community. Estuarine, Coastal and Shelf Science 113, 96e104. Barkay, T., Miller, S., Summer, A., 2003. Bacterial mercury resistance from atoms to ecosystems. FEMS Microbiology Reviews 27, 355e384. Bligh, E.G., Dyer, W.J., 1959. A rapid method of total lipid extraction and purification. Canadian Journal of Biochemistry and Physiology 37, 911e917. Bradford, M.M., 1976. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of proteinedye binding. Analytical Biochemistry 72, 248e254. Covelli, S., Acquavita, A., Piani, R., Predonzani, S., De Vittor, C., 2009. Recent contamination of mercury in an estuarine environment (Marano lagoon, Northern Adriatic, Italy). Estuarine, Coastal and Shelf Science 82, 273e284. Craig, P.J., Bartlett, P.D., 1978. The role of hydrogen sulfide in environmental transport of mercury. Nature 275, 635e637. De Vittor, C., Faganeli, J., Emili, A., Covelli, S., Predonzani, S., Acquavita, A., 2012. Benthic fluxes of oxygen, carbon, and nutrients in the Marano and Grado lagoons (Northern Adriatic Sea, Italy). Estuarine, Coastal and Shelf Science 113, 57e70. Dubois, M., Gilles, K.A., Hamilton, J.K., Rebers, P.A., Smith, F., 1956. Colorimetric method for determination of sugars and related substances. Analytical Chemistry 28 (3), 350e356. Fani, R., Bazzicalupo, M., Gallori, E., Giovannetti, L., Ventura, S., Polsinelli, M., 1991. Restriction fragment length polymorphism of Azospirillum strains. FEMS Microbiology Letters 83, 225e230. Fichez, R., 1991. Composition and fate of organic matter in submarine cave sediments; implication for the biogeochemical cycle of organic carbon. Oceanologica Acta 14, 369e377. Filippelli, M., Baldi, F., 1993. Alkylation of ionic mercury to methylmercury and dimethylmercury by methylcobalamine: simultaneous determination by purge and trap gas chromatography in line with Fourier transform infrared spectroscopy. Applied Organometallic Chemistry, 487e493. Foucher, D., Ogrinc, N., Hintelmann, H., 2009. Tracing mercury contamination from the Idrija mining region (Slovenia) to the Gulf of Trieste using Hg isotope ratio measurements. Environmental Science & Technology 43, 33e39. Giovannetti, L., Ventura, S., Bazzicalupo, M., Fani, R., Materassi, R., 1990. DNA restriction fingerprint analysis of the soil bacterium Azospirillum. Journal of General Microbiology 136, 1161e1166. Gray, J.E., Hines, M.E., 2009. Biogeochemical mercury methylation influenced by reservoir eutrophication, Salmon Falls Creek Reservoir, Idaho, USA. Chemical Geology 258, 157e167. Grifoni, A., Bazzicalupo, M., Di Serio, C., Fancelli, S., Fani, R., 1995. Identification of Azospirillum strains by restriction fragment length polymorphism of the 16S rDNA and of the histidine operon. FEMS Microbiology Letters 127, 85e91. Hines, M.E., Faganeli, J., Planinc, R., 1997. Sedimentary anaerobic microbial biogeochemistry in the Gulf of Trieste, northern Adriatic Sea: influences of bottom water oxygen depletion. Biogeochemisty 39, 65e86. Hines, M.E., Visscher, P.T., Devereux, R., 2001. Manual for environmental microbiology. In: Hurst, G.R.K.C.J., McInerney, M.J., Stetzenbach, L.D., Walter, M.V. (Eds.), Sulfur Cycling. American Society for Microbiology Press, Washington, DC, pp. 427e438. Hines, M.E., Faganeli, J., Adatto, I., Horvat, M., 2006. Microbial mercury transformations in marine, estuarine and freshwater sediment downstream of the Idrija Mercury Mine, Slovenia. Applied Geochemistry 21, 1924e1939.

F. Baldi et al. / Estuarine, Coastal and Shelf Science 113 (2012) 105e115 Hines, M., Poitras, E.N., Covelli, S., Faganeli, J., Emili, A., Zizek, S., Horvat, M., 2012. Mercury methylation and demethylation in Hg-contaminated lagoon sediments (Marano & Grado Lagoons, Italy). Estuarine, Coastal and Shelf Science 113, 85e95. Horvat, M., Lupsina, V., Pihlar, B., 1991. Determination of total mercury in coal fly ash by gold amalgamation cold vapour atomic absorption spectrometry. Analytica Chimica Acta 243, 71e79. Horvat, M., Liang, L., Bloom, N.S., 1993a. Comparison of distillation with other current isolation methods for the determination of methyl mercury compounds in low level environmental samples: sediments. Analytica Chimica Acta 281 (1), 135e152. Horvat, M., Liang, L., Bloom, N.S., 1993b. Comparison of distillation with other current isolation methods for the determination of methyl mercury compounds in low level environmental samples: water. Analytica Chimica Acta 282 (1), 153e168. Horvat, M., Kotnik, J., Logar, M., Fajon, V., Znonaric, T., Pirrone, N., 2003. Speciation of mercury in surface and deep-sea waters in the Mediterranean sea. Atmospheric Environment 37 (1), S93eS108. Kimura, M.A., 1980. Simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16, 11e120. Liang, L., Horvat, M., Bloom, N.S., 1994. An improved method for speciation of mercury by aqueous phase ethylation, room temperature precollection, GC separation and CV AFS detection. Talanta 41 (3), 371e379. Marsh, J.B., Weistein, D.B., 1966. Simple charring methods for determination of lipids. Journal of Lipid Research 7, 574e576. Maruyama, A., Sunamura, M., 2000. Simultaneous direct counting of total and specific microbial cells in seawater, using a deep-sea microbe as target. Applied and Environmental Microbiology 66, 2211e2215.

115

Mayer, L.M., Shick, L.L., Setchell, F.W., 1986. Measurement of protein in nearshore marine sediments. Marine Ecology Progress Series 30, 159e165. Mecozzi, M., Dragone, P., Amici, M., Pietrantonio, E., 2000. Ultrasound assisted extraction and determination of carbohydrate fraction in marine sediments. Organic Geochemistry 31, 1797e1803. Merrit, K.A., Amirbahman, A., 2009. Mercury methylation dynamics in estuary and coastal marine sediments. Earth-Science Reviews 96, 54e66. Nunn, B.L., Keil, R.G., 2006. A comparison of non-hydrolytic methods for extracting amino acids and proteins from coastal marine sediments. Marine Chemistry 98, 31e42. Oremland, R.S., Miller, L.G., Dowdle, P., Connel, T., Barkay, T., 1995. Methylmercury oxidative degradation potentials in contaminated and in pristine sediments of the Carson River, Nevada. Applied and Environmental Microbiology 61, 2745e2753. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4, 406e425. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA sequencing with chain terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America 74, 5463e5467. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596e1599. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673e4680.