- Email: [email protected]
Seasonal prevalence of Vibrio species in retail shrimps with an emphasis on Vibrio parahaemolyticus
Food Control 25 (2012) 107e109
Contents lists available at SciVerse ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Seasonal prevalence of Vibrio species in retail shrimps with an emphasis on Vibrio parahaemolyticus Mehdi Zarei*, Mahdi Pourmahdi Borujeni, Amirhesam Jamnejad, Marjan Khezrzadeh Department of Food Hygiene, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz 61355-145, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 21 May 2011 Received in revised form 4 October 2011 Accepted 12 October 2011
Seasonal prevalence of Vibrio species in shrimp samples from retail outlets in the South-western part of Iran was studied. A total of 300 samples were analyzed (75 samples in each season). Special attention was paid to the prevalence of total and pathogenic Vibrio parahaemolyticus. All the TCBS isolates were first identified to the genus level with PCR and then identified to the species level using a battery of biochemical reactions and tests. To investigate the pathogenicity of the isolated V. parahaemolyticus, multiplex PCR (tl, tdh and trh genes) was performed. Vibrios were detected during the whole investigation period, depending on the sampling season. They were detected in 18.6% of the winter samples, 64% of the spring samples, 70.6% of the summer samples and 41.3% of the autumn samples. Vibrio calviensis and Vibrio alginolyticus were dominant in samples of different seasons, with the average prevalence of 18.6% and 17.6%, respectively. V. parahaemolyticus was found in 4.0% of the winter samples, 13.3% of the spring samples, 18.6% of the summer samples and 8% of the autumn samples. During the period of this study, two tdh-positive strains were isolated, while no trh-positive V. parahaemolyticus strain was detected in samples of different seasons. Ó 2011 Elsevier Ltd. All rights reserved.
Keywords: Prevalence Vibrio parahaemolyticus Shrimp Iran
1. Introduction Shrimp is one of the most important fishery products of the South and South-western part of Iran and shrimp farming is an important economy characteristic of these areas. A large portion of this product is exported to other countries especially European countries (Hosseini, Cheraghali, Yalfani, & Razavilar, 2004). Therefore, the microbiological safety of this product should be of paramount importance. Vibrios are Gram-negative rod-shaped bacteria that are widespread in the marine and estuarine environments. They are frequently isolated from seafood; in particular, shellfish and some of them are associated with bacterial infections in shrimp (Austin & Austin, 2007). Of the known Vibrio species, Vibrio parahaemolyticus is recognized as an important seafood-borne pathogen throughout the world. Consumption of raw or undercooked seafood, particularly shellfish, contaminated with V. parahaemolyticus may lead to development of acute gastroenteritis characterized by diarrhea, headache, vomiting, nausea, abdominal cramps and low fever (Cho, Shin, Choi, Park, & Lee, 2008; Sakazaki, 2002). Although the mechanism by which the organism infects humans has yet to be entirely determined, thermosable direct hemolysin (TDH) and TDH-related hemolysin (TRH) have been recognized as * Corresponding author. Tel.: þ98 917 302 1142; fax: þ98 611 3360807. E-mail addresses: [email protected], [email protected] (M. Zarei). 0956-7135/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodcont.2011.10.024
primary virulence factors in V. parahaemolyticus. The TDH and TRH hemolysins are produced by V. parahaemolyticus strains that respectively harbour tdh and trh genes. Only members of this species that produce virulence factors are considered to be pathogenic and can cause acute gastroenteritis (Shirai et al.,1990; Wong et al., 2000). It has been reported that 1e5% of environmental Vibrio isolates possess the tdh or the trh gene (Hervio-Heath et al., 2002; Martinez-Urtaza et al., 2008). It is also assumed that the prevalence of V. parahaemolyticus in the environment is correlated to parameters such as temperature and salinity. Higher densities of total and pathogenic V. parahaemolyticus were observed with higher water temperatures (DePaola, Kaysner, Bowers, & Cook, 2000; DePaola, Nordstrom, Bowers, Wells, & Cook, 2003) which could explain the seasonality of infections, being more abundant in warmer months (Yeung & Boor, 2004). The objective of this study was to determine the seasonal prevalence of Vibrio spp. in shrimp throughout the year 2010; special attention was paid to the prevalence of total and pathogenic V. parahaemolyticus. 2. Materials and methods 2.1. Sampling During the year 2010, a total of 300 farmed or wild shrimp samples (75 samples in each season) were collected from shrimp
108
M. Zarei et al. / Food Control 25 (2012) 107e109
Table 1 Oligonucleotide primers used in this study. Target bacterium and gene
Primer sequence (50 / 30 )
Product size (bp)
Reference
All Vibrio spp., 16S rRNA
F: CGGTGAAATGCGTAGAGAT R: TTACATGCGATTCCGAGTTC
663
Tarr et al., 2007
V. parahaemolyticus, tl
F: AAAGCGGATTATGCAGAAGCACTG R: GCTACTTTCTAGCATTTTCTCTGC
450
Bej et al., 1999
V. parahaemolyticus, tdh
F: GTAAAGGTCTCTGACTTTTGGAC R: TGGAATAGAACCTTCATCTTCACC
269
Bej et al., 1999
V. parahaemolyticus, trh
F: TTGGCGTCGATATTTTCAGTATCT R: CATAACAAACATATCCCATTTCCG
500
Bej et al., 1999
retail outlets in the South-western part of Iran. In the region, climate is hot from May to October and temperate thereafter. All samples were transported to the laboratory in containers with ice bags for analysis within 1 h. 2.2. Isolation and identification of Vibrio spp. Twenty-five grams of samples were homogenized for 60 s in a stomacher (Bagmixer 400W, Interscience, St. Nom, France) with 225 ml of alkaline peptone water containing 2% NaCl, pH 8.5 and incubated at 35 C for 18 h. After primary enrichment, a loopful of samples was streaked onto Thiosulfate Citrate Bile Salts Sucrose (TCBS) agar and incubated at 35 C for 24 h. Both sucrose-positive (yellow colonies on TCBS) and sucrose-negative (green colonies on TCBS) were picked and purified on TSA-2% NaCl. All the isolates were first identified to the genus level with PCR according to Tarr et al. (2007) (Table 1). PCR reactions were performed in a thermal cycler (Eppendorf, Mastercycler Gradient) under the following conditions: denaturation at 94 oC for 3 min, followed by 30 cycles of denaturation at 94 oC for 45 s, primer annealing at 57 oC for 45 s, and extension at 72 oC for 60 s. The final cycle included an additional 5 min of extension time at 72 oC. The Vibrio isolates were then identified to the species level using a battery of biochemical reactions and tests according to the keys provided by Noguerola and Blanch (2008). 2.3. PCR confirmation of total and pathogenic V. parahaemolyticus All the V. parahaemolyticus isolates were subjected to multiplex PCR assays aimed at tl, tdh and trh genes (Table 1) for reliable identification of the total and pathogenic V. parahaemolyticus (Bej et al., 1999). V. parahaemolyticus (tdh, trh, Prince of Songkla University-PSU 2591) and V. parahaemolyticus (tdhþ, trhþ, PSU 2586) were used as positive controls. A Vibrio alginolyticus isolated in our laboratory was used as negative control. The bacteria were grown overnight in TSB-2% NaCl at 35 C. 500 ml of the culture was centrifuged and the pellet was washed and resuspended in 100 ml sterile distilled water. The suspension was heated to 100 C for 10 min in water bath to release the bacterial DNA. After boiling, the clear supernatants obtained after 5 min centrifugation, were collected and stored at 20 oC until use. Multiplex PCR reactions were performed under the following conditions: denaturation at 94 oC for 3 min, followed by 35 cycles of denaturation at 94 oC for 45 s, primer annealing at 56 oC for 45 s, and extension at 72 oC for 60 s. The final cycle included an additional 5 min of extension time at 72 oC. PCR products were visualized following gel electrophoresis on 2% agarose gels using ethidium bromide staining. 3. Results and discussion In recent years researchers have focused their attention on the non-cholerae vibrios. These organisms are not only natural
inhabitants of aquatic environments, but are also more and more frequently involved in human gastroenteric episodes, because of consumption of raw or insufficiently cooked seafood, and in systemic pathologies by contact with sea water (Ottaviani, Masini, & Bacchiocchi, 2003). However, the correct identification of environmental isolates is still in discussion because of their biochemical variability (Ortigosa, Garay, & Pujalte, 1994; West, Brayton, Bryant, & Colwell, 1986). Indeed, the common biochemical commercial kits are unable to recognize Vibrio spp., and sometimes they are not able to distinguish between Aeromonas and Vibrio (Austin et al., 1997). Therefore, in the present study, a PCR-based method was used (Tarr et al., 2007) for accurate identification of the Vibrio isolates to the genus level. The Vibrio isolates were then identified to the species level according to the scheme developed by Noguerola and Blanch (2008). They presented an initial identification key according to the results of arginine dihydrolase, lysine decarboxylase, and ornithine decarboxylase tests, which leads to eight different clusters of biochemical tests for accurate identification of all recognized Vibrio spp. Seasonal prevalence of Vibrio spp. in shrimp samples collected from the retail outlets was shown in Table 2. Vibrios were detected during the whole investigation period, depending on the sampling season. They were detected in 18.6% of the winter samples, 64% of the spring samples, 70.6% of the summer samples and 41.3% of the autumn samples. Samples contained one or more vibrios. The percentage of the samples contained only one Vibrio species was higher in winter and autumn, while a high percentage of the samples were contained more than one Vibrio species in summer. These findings reflect the fact that some Vibrio species are not detectable at low temperatures. Vibrio calviensis and V. alginolyticus were dominant in samples of different seasons, with the average prevalence of 18.6% and 17.6%, respectively. V. alginolyticus has been
Table 2 Seasonal prevalence of Vibrio spp. in shrimp samples. Isolates
V. V. V. V. V. V. V. V. V. V. V. V. a
aerogenes alginolyticus calviensis campbelli coralliilyticus hepatarius litoralis mediterranei orientalis parahaemolyticus ruber tasmaniensis
Percentage composition of Vibrios in Winter (n ¼ 75)a
Spring (n ¼ 75)
Summer (n ¼ 75)
Autumn (n ¼ 75)
Avg
e 8.0 5.3 5.3 1.3 e 1.3 e e 4.0 e e
e 21.3 26.6 9.3 4.0 1.3 1.3 e 1.3 13.3 2.6 e
1.3 25.3 28 13.3 2.6 e 2.6 e e 18.6 2.6 1.3
e 16.0 14.6 10.6 2.6 e e 1.3 1.3 8.0 1.3 e
0.3 17.6 18.6 9.6 2.6 0.3 1.3 0.3 0.6 11.0 1.6 0.3
n: Number of shrimp samples analyzed.
M. Zarei et al. / Food Control 25 (2012) 107e109
reported to be the most common species in Europe and North America (Toti et al., 1996). Although some authors count V. alginolyticus to the causative agents of ear and wound infections (Farmer, Janda, & Birkhead, 2003), others do not recognize any pathogenicity for this species (Janda, Powers, Bryant, & Abbott, 1988). Infection with V. alginolyticus after consumption of contaminated seafood has never been reported. V. parahaemolyticus, known as the very important classical food poisoning agent, is distributed throughout the world, but reported densities in the environment and in seafood vary greatly according to season, location, sample type, and analytical methodology employed (Cook, Bowers, & DePaola, 2002; DePaola et al., 2003; Martinez-Urtaza et al., 2008; Parveen et al., 2008). In the present study, V. parahaemolyticus was found in 11.0% of the whole samples analyzed. It was detected in 4.0% of the winter samples, 13.3% of the spring samples, 18.6% of the summer samples and 8% of the autumn samples. These results showed the seasonal variation in occurrence of this pathogen. V. parahaemolyticus has been isolated and detected from seafood, particularly shellfish or bivalve mollusks all over the world. In Croatia, during the summer of year 2000, 117 samples of sea fish, shrimps and bivalve mollusks were sampled and V. parahaemolyticus was found in 9.4% of the total samples (Jacksic, Suncica, Petrak, Bazulic, & Lada, 2002). A very high level of contamination with V. parahaemolyticus has been reported in cockle (Anadara granosa) in Malaysia. According to Bilung et al. (2005), of the 100 cockle samples tested, 62 were positive for the presence of V. parahaemolyticus. In Germany, Vibrio spp. was detected in 74.4% of the blue mussel samples analyzed. Among Vibrio isolates, V. parahaemolyticus was detected in 39.5% of the samples (Lhafi & Kühne, 2007). Only a few reports on the prevalence of V. parahaemolyticus in seafood products in Iran have been previously published. According to the previous reports, 9.3% of the shrimp samples (Rahimi, Ameri, Doosti, & Gholampour, 2010) and 21.4% of the fish samples (Basti, Misaghi, Salehi, & Kamkar, 2006) were positive for the presence of this pathogen. As the presence of tdh and/or trh-positive V. parahaemolyticus strains in seafood represents a public health risk, their detection would be of paramount importance. To investigate the pathogenicity of the isolated V. parahaemolyticus, multiplex PCR (tl, tdh and trh genes) was performed. The strains that were identified according to the Noguerola’s scheme were all tl gene positive, and were therefore confirmed as V. parahaemolyticus. Only two tdhpositive strains were identified in samples that were collected in summer. No trh-positive V. parahaemolyticus strain was detected in samples of different seasons. In another report from Iran, the prevalence of tdh-positive and trh-positive V. parahaemolyticus were 1.7% and 0.7%, respectively (Rahimi et al., 2010). In conclusion, the detection of tdh-positive V. parahaemolyticus in shrimp marketed in Iran shows a probable risk for public health. Therefore, intensive and continuous monitoring of potentially pathogenic V. parahaemolyticus is strongly recommended in order to evaluate the human health risk arising from seafood consumption. Acknowledgements This study was supported by the research grant provided by Shahid Chamran University of Ahvaz. The authors would like to thank Mrs. N. Norouzieh and Mrs. P. Esfahani for their assistance. References Austin, B., & Austin, D. A. (2007). Bacterial fish pathogens, disease of farmed and wild fish (4th ed.). Godalming: Springer Praxis.
109
Austin, B., Austin, D. A., Blanch, A. R., Cerda, M. M., Grimont, F., Grimont, P. A. D., et al. (1997). A comparison of methods for the typing of fish-pathogenic Vibrio spp. Systematic and Applied Microbiology, 20, 89e101. Basti, A. A., Misaghi, A., Salehi, T. Z., & Kamkar, A. (2006). Bacterial pathogens in fresh, smoked and salted Iranian fish. Food Control, 17, 183e188. Bej, A. K., Patterson, D. P., Brasher, C. W., Vickery, M. C. L., Jones, D. D., & Kaysner, C. A. (1999). Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh, and trh. Journal of Microbiology Methods, 36, 215e225. Bilung, L. M., Radu, S., Bahaman, A. R., Abdul Rahim, R., Napis, S., Ling, M. W., et al. (2005). Detection of Vibrio parahaemolyticus in cockle (Anadara granosa) by PCR. FEMS Microbiology Letters, 252, 85e88. Cho, S. H., Shin, H. H., Choi, Y. H., Park, M. S., & Lee, B. K. (2008). Enteric bacteria isolated from acute diarrheal patients in the Republic of Korea between the year 2004 and 2006. Journal of Microbiology, 46, 325e330. Cook, D. W., Bowers, J. C., & DePaola, A. (2002). Density of total and pathogenic (tdhþ) Vibrio parahaemolyticus in Atlantic and Gulf coast molluscan shellfish at harvest. Journal of Food Protection, 65, 1873e1880. DePaola, A., Kaysner, C. A., Bowers, J. C., & Cook, D. W. (2000). Environmental investigation of Vibrio parahaemolyticus in oysters after outbreaks in Washington, Texas, and New-York (1997 and 1998). Applied and Environmental Microbiology, 66, 4649e4654. DePaola, A., Nordstrom, J. L., Bowers, J. C., Wells, J. G., & Cook, D. W. (2003). Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters. Applied and Environmental Microbiology, 69, 1521e1526. Farmer, J. J., III, Janda, M., & Birkhead, K. (2003). Vibrio. In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. A. Pfaller, & R. H. Yolken (Eds.), Manual of clinical microbiology (pp. 706e718). Washington DC: ASM Press. Hervio-Heath, D., Colwell, R. R., Derrien, A., Robert-Pillot, A., Fournier, J. M., & Pommepuy, M. (2002). Occurrence of pathogenic vibrios in coastal areas of France. Journal of Applied Microbiology, 92, 1123e1135. Hosseini, H., Cheraghali, A. M., Yalfani, R., & Razavilar, V. (2004). Incidence of Vibrio spp. in shrimp caught off the south coast of Iran. Food Control, 15, 187e190. Jacksic, S., Suncica, U., Petrak, T., Bazulic, D., & Lada, G. K. (2002). Occurrence of Vibrio spp. in sea fish, shrimps and bivalve mollusks harvested from Adriatic sea. Food Control, 13, 491e493. Janda, J. M., Powers, C., Bryant, R. G., & Abbott, S. L. (1988). Current perspectives on the epidemiology and pathogenesis of clinically significant Vibrio spp. Clinical Microbiology Reviews, 1(3), 245e267. Lhafi, S. K., & Kühne, M. (2007). Occurrence of Vibrio spp. in blue mussels (Mytilus edulis) from the German Wadden Sea. International Journal of Food Microbiology, 116, 297e300. Martinez-Urtaza, J., Lozano-Leon, A., Varela-Pet, J., Trinanes, J., Pazos, Y., & GarciaMartin, O. (2008). Environmental determinants of the occurrence and distribution of Vibrio parahaemolyticus in the rias of Galicia, Spain. Applied and Environmental Microbiology, 74, 265e274. Noguerola, I., & Blanch, A. R. (2008). Identification of Vibrio spp. with a set of dichotomous keys. Journal of Applied Microbiology, 105, 175e185. Ortigosa, M., Garay, E., & Pujalte, M. J. (1994). Numerical taxonomy of Vibrionaceae isolated from oysters and seawater along an annual Kyle. Systematic and Applied Microbiology, 17, 216e225. Ottaviani, D., Masini, L., & Bacchiocchi, S. (2003). A biochemical protocol for the isolation and identification of current species of Vibrio in seafood. Journal of Applied Microbiology, 95, 1277e1284. Parveen, S., Hettiarachchi, K. A., Bowers, J. C., Jones, J. L., Tamplin, M. L., McKay, R., et al. (2008). Seasonal distribution of total and pathogenic Vibrio parahaemolyticus in Chesapeake Bay oysters and waters. International Journal of Food Microbiology, 128, 354e361. Rahimi, E., Ameri, M., Doosti, A., & Gholampour, A. R. (2010). Occurrence of toxigenic Vibrio parahaemolyticus strains in shrimp in Iran. Foodborne Pathogens and Disease, 7(9), 1107e1111. Sakazaki, R. (2002). Vibrio. In D. O. Cliver, & H. P. Riemann (Eds.), Food-borne diseases (pp. 127e136). London: Academic Press. Shirai, H., Ito, H., Hirramaya, T., Nakamoto, T., Nakabayashi, N., Kumagai, K., et al. (1990). Molecular epidemiologic evidence for association of thermostable direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with gastroenteritis. Infection and Immunity, 58, 3568e3573. Tarr, C. L., Patel, J. S., Puhr, N. D., Sowers, E. G., Bopp, C. A., & Strockbine, N. A. (2007). Identification of Vibrio iolates by a multiplex PCR assay and rpoB sequence determination. Journal of Clinical Microbiology, 45, 134e140. Toti, L., Serratore, P., Croci, L., Stacchini, A., Milandri, S., & Cozzi, L. (1996). Bacteria isolated from seawater and mussels: identification and toxin production. Microbiology Alimentation Nutrition, 14, 161e165. West, P. A., Brayton, P. R., Bryant, T. N., & Colwell, R. R. (1986). Numerical taxonomy of vibrios isolated from aquatic environments. International Journal of Systematic Bacteriology, 36, 531e543. Wong, H. C., Liu, S. H., Ku, W., Lee, I. Y., Wang, T. K., Lee, Y. S., et al. (2000). Characterization of Vibrio parahaemolyticus isolates obtained from food-borne illness outbreaks during 1992 through 1995 in Taiwan. Journal of Food Protection, 63, 900e906. Yeung, P. S. M., & Boor, K. J. (2004). Epidemiology, pathogenesis, and prevention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathogens and Disease, 1, 74e88.
Contents lists available at SciVerse ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Seasonal prevalence of Vibrio species in retail shrimps with an emphasis on Vibrio parahaemolyticus Mehdi Zarei*, Mahdi Pourmahdi Borujeni, Amirhesam Jamnejad, Marjan Khezrzadeh Department of Food Hygiene, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz 61355-145, Iran
a r t i c l e i n f o
a b s t r a c t
Article history: Received 21 May 2011 Received in revised form 4 October 2011 Accepted 12 October 2011
Seasonal prevalence of Vibrio species in shrimp samples from retail outlets in the South-western part of Iran was studied. A total of 300 samples were analyzed (75 samples in each season). Special attention was paid to the prevalence of total and pathogenic Vibrio parahaemolyticus. All the TCBS isolates were first identified to the genus level with PCR and then identified to the species level using a battery of biochemical reactions and tests. To investigate the pathogenicity of the isolated V. parahaemolyticus, multiplex PCR (tl, tdh and trh genes) was performed. Vibrios were detected during the whole investigation period, depending on the sampling season. They were detected in 18.6% of the winter samples, 64% of the spring samples, 70.6% of the summer samples and 41.3% of the autumn samples. Vibrio calviensis and Vibrio alginolyticus were dominant in samples of different seasons, with the average prevalence of 18.6% and 17.6%, respectively. V. parahaemolyticus was found in 4.0% of the winter samples, 13.3% of the spring samples, 18.6% of the summer samples and 8% of the autumn samples. During the period of this study, two tdh-positive strains were isolated, while no trh-positive V. parahaemolyticus strain was detected in samples of different seasons. Ó 2011 Elsevier Ltd. All rights reserved.
Keywords: Prevalence Vibrio parahaemolyticus Shrimp Iran
1. Introduction Shrimp is one of the most important fishery products of the South and South-western part of Iran and shrimp farming is an important economy characteristic of these areas. A large portion of this product is exported to other countries especially European countries (Hosseini, Cheraghali, Yalfani, & Razavilar, 2004). Therefore, the microbiological safety of this product should be of paramount importance. Vibrios are Gram-negative rod-shaped bacteria that are widespread in the marine and estuarine environments. They are frequently isolated from seafood; in particular, shellfish and some of them are associated with bacterial infections in shrimp (Austin & Austin, 2007). Of the known Vibrio species, Vibrio parahaemolyticus is recognized as an important seafood-borne pathogen throughout the world. Consumption of raw or undercooked seafood, particularly shellfish, contaminated with V. parahaemolyticus may lead to development of acute gastroenteritis characterized by diarrhea, headache, vomiting, nausea, abdominal cramps and low fever (Cho, Shin, Choi, Park, & Lee, 2008; Sakazaki, 2002). Although the mechanism by which the organism infects humans has yet to be entirely determined, thermosable direct hemolysin (TDH) and TDH-related hemolysin (TRH) have been recognized as * Corresponding author. Tel.: þ98 917 302 1142; fax: þ98 611 3360807. E-mail addresses: [email protected], [email protected] (M. Zarei). 0956-7135/$ e see front matter Ó 2011 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodcont.2011.10.024
primary virulence factors in V. parahaemolyticus. The TDH and TRH hemolysins are produced by V. parahaemolyticus strains that respectively harbour tdh and trh genes. Only members of this species that produce virulence factors are considered to be pathogenic and can cause acute gastroenteritis (Shirai et al.,1990; Wong et al., 2000). It has been reported that 1e5% of environmental Vibrio isolates possess the tdh or the trh gene (Hervio-Heath et al., 2002; Martinez-Urtaza et al., 2008). It is also assumed that the prevalence of V. parahaemolyticus in the environment is correlated to parameters such as temperature and salinity. Higher densities of total and pathogenic V. parahaemolyticus were observed with higher water temperatures (DePaola, Kaysner, Bowers, & Cook, 2000; DePaola, Nordstrom, Bowers, Wells, & Cook, 2003) which could explain the seasonality of infections, being more abundant in warmer months (Yeung & Boor, 2004). The objective of this study was to determine the seasonal prevalence of Vibrio spp. in shrimp throughout the year 2010; special attention was paid to the prevalence of total and pathogenic V. parahaemolyticus. 2. Materials and methods 2.1. Sampling During the year 2010, a total of 300 farmed or wild shrimp samples (75 samples in each season) were collected from shrimp
108
M. Zarei et al. / Food Control 25 (2012) 107e109
Table 1 Oligonucleotide primers used in this study. Target bacterium and gene
Primer sequence (50 / 30 )
Product size (bp)
Reference
All Vibrio spp., 16S rRNA
F: CGGTGAAATGCGTAGAGAT R: TTACATGCGATTCCGAGTTC
663
Tarr et al., 2007
V. parahaemolyticus, tl
F: AAAGCGGATTATGCAGAAGCACTG R: GCTACTTTCTAGCATTTTCTCTGC
450
Bej et al., 1999
V. parahaemolyticus, tdh
F: GTAAAGGTCTCTGACTTTTGGAC R: TGGAATAGAACCTTCATCTTCACC
269
Bej et al., 1999
V. parahaemolyticus, trh
F: TTGGCGTCGATATTTTCAGTATCT R: CATAACAAACATATCCCATTTCCG
500
Bej et al., 1999
retail outlets in the South-western part of Iran. In the region, climate is hot from May to October and temperate thereafter. All samples were transported to the laboratory in containers with ice bags for analysis within 1 h. 2.2. Isolation and identification of Vibrio spp. Twenty-five grams of samples were homogenized for 60 s in a stomacher (Bagmixer 400W, Interscience, St. Nom, France) with 225 ml of alkaline peptone water containing 2% NaCl, pH 8.5 and incubated at 35 C for 18 h. After primary enrichment, a loopful of samples was streaked onto Thiosulfate Citrate Bile Salts Sucrose (TCBS) agar and incubated at 35 C for 24 h. Both sucrose-positive (yellow colonies on TCBS) and sucrose-negative (green colonies on TCBS) were picked and purified on TSA-2% NaCl. All the isolates were first identified to the genus level with PCR according to Tarr et al. (2007) (Table 1). PCR reactions were performed in a thermal cycler (Eppendorf, Mastercycler Gradient) under the following conditions: denaturation at 94 oC for 3 min, followed by 30 cycles of denaturation at 94 oC for 45 s, primer annealing at 57 oC for 45 s, and extension at 72 oC for 60 s. The final cycle included an additional 5 min of extension time at 72 oC. The Vibrio isolates were then identified to the species level using a battery of biochemical reactions and tests according to the keys provided by Noguerola and Blanch (2008). 2.3. PCR confirmation of total and pathogenic V. parahaemolyticus All the V. parahaemolyticus isolates were subjected to multiplex PCR assays aimed at tl, tdh and trh genes (Table 1) for reliable identification of the total and pathogenic V. parahaemolyticus (Bej et al., 1999). V. parahaemolyticus (tdh, trh, Prince of Songkla University-PSU 2591) and V. parahaemolyticus (tdhþ, trhþ, PSU 2586) were used as positive controls. A Vibrio alginolyticus isolated in our laboratory was used as negative control. The bacteria were grown overnight in TSB-2% NaCl at 35 C. 500 ml of the culture was centrifuged and the pellet was washed and resuspended in 100 ml sterile distilled water. The suspension was heated to 100 C for 10 min in water bath to release the bacterial DNA. After boiling, the clear supernatants obtained after 5 min centrifugation, were collected and stored at 20 oC until use. Multiplex PCR reactions were performed under the following conditions: denaturation at 94 oC for 3 min, followed by 35 cycles of denaturation at 94 oC for 45 s, primer annealing at 56 oC for 45 s, and extension at 72 oC for 60 s. The final cycle included an additional 5 min of extension time at 72 oC. PCR products were visualized following gel electrophoresis on 2% agarose gels using ethidium bromide staining. 3. Results and discussion In recent years researchers have focused their attention on the non-cholerae vibrios. These organisms are not only natural
inhabitants of aquatic environments, but are also more and more frequently involved in human gastroenteric episodes, because of consumption of raw or insufficiently cooked seafood, and in systemic pathologies by contact with sea water (Ottaviani, Masini, & Bacchiocchi, 2003). However, the correct identification of environmental isolates is still in discussion because of their biochemical variability (Ortigosa, Garay, & Pujalte, 1994; West, Brayton, Bryant, & Colwell, 1986). Indeed, the common biochemical commercial kits are unable to recognize Vibrio spp., and sometimes they are not able to distinguish between Aeromonas and Vibrio (Austin et al., 1997). Therefore, in the present study, a PCR-based method was used (Tarr et al., 2007) for accurate identification of the Vibrio isolates to the genus level. The Vibrio isolates were then identified to the species level according to the scheme developed by Noguerola and Blanch (2008). They presented an initial identification key according to the results of arginine dihydrolase, lysine decarboxylase, and ornithine decarboxylase tests, which leads to eight different clusters of biochemical tests for accurate identification of all recognized Vibrio spp. Seasonal prevalence of Vibrio spp. in shrimp samples collected from the retail outlets was shown in Table 2. Vibrios were detected during the whole investigation period, depending on the sampling season. They were detected in 18.6% of the winter samples, 64% of the spring samples, 70.6% of the summer samples and 41.3% of the autumn samples. Samples contained one or more vibrios. The percentage of the samples contained only one Vibrio species was higher in winter and autumn, while a high percentage of the samples were contained more than one Vibrio species in summer. These findings reflect the fact that some Vibrio species are not detectable at low temperatures. Vibrio calviensis and V. alginolyticus were dominant in samples of different seasons, with the average prevalence of 18.6% and 17.6%, respectively. V. alginolyticus has been
Table 2 Seasonal prevalence of Vibrio spp. in shrimp samples. Isolates
V. V. V. V. V. V. V. V. V. V. V. V. a
aerogenes alginolyticus calviensis campbelli coralliilyticus hepatarius litoralis mediterranei orientalis parahaemolyticus ruber tasmaniensis
Percentage composition of Vibrios in Winter (n ¼ 75)a
Spring (n ¼ 75)
Summer (n ¼ 75)
Autumn (n ¼ 75)
Avg
e 8.0 5.3 5.3 1.3 e 1.3 e e 4.0 e e
e 21.3 26.6 9.3 4.0 1.3 1.3 e 1.3 13.3 2.6 e
1.3 25.3 28 13.3 2.6 e 2.6 e e 18.6 2.6 1.3
e 16.0 14.6 10.6 2.6 e e 1.3 1.3 8.0 1.3 e
0.3 17.6 18.6 9.6 2.6 0.3 1.3 0.3 0.6 11.0 1.6 0.3
n: Number of shrimp samples analyzed.
M. Zarei et al. / Food Control 25 (2012) 107e109
reported to be the most common species in Europe and North America (Toti et al., 1996). Although some authors count V. alginolyticus to the causative agents of ear and wound infections (Farmer, Janda, & Birkhead, 2003), others do not recognize any pathogenicity for this species (Janda, Powers, Bryant, & Abbott, 1988). Infection with V. alginolyticus after consumption of contaminated seafood has never been reported. V. parahaemolyticus, known as the very important classical food poisoning agent, is distributed throughout the world, but reported densities in the environment and in seafood vary greatly according to season, location, sample type, and analytical methodology employed (Cook, Bowers, & DePaola, 2002; DePaola et al., 2003; Martinez-Urtaza et al., 2008; Parveen et al., 2008). In the present study, V. parahaemolyticus was found in 11.0% of the whole samples analyzed. It was detected in 4.0% of the winter samples, 13.3% of the spring samples, 18.6% of the summer samples and 8% of the autumn samples. These results showed the seasonal variation in occurrence of this pathogen. V. parahaemolyticus has been isolated and detected from seafood, particularly shellfish or bivalve mollusks all over the world. In Croatia, during the summer of year 2000, 117 samples of sea fish, shrimps and bivalve mollusks were sampled and V. parahaemolyticus was found in 9.4% of the total samples (Jacksic, Suncica, Petrak, Bazulic, & Lada, 2002). A very high level of contamination with V. parahaemolyticus has been reported in cockle (Anadara granosa) in Malaysia. According to Bilung et al. (2005), of the 100 cockle samples tested, 62 were positive for the presence of V. parahaemolyticus. In Germany, Vibrio spp. was detected in 74.4% of the blue mussel samples analyzed. Among Vibrio isolates, V. parahaemolyticus was detected in 39.5% of the samples (Lhafi & Kühne, 2007). Only a few reports on the prevalence of V. parahaemolyticus in seafood products in Iran have been previously published. According to the previous reports, 9.3% of the shrimp samples (Rahimi, Ameri, Doosti, & Gholampour, 2010) and 21.4% of the fish samples (Basti, Misaghi, Salehi, & Kamkar, 2006) were positive for the presence of this pathogen. As the presence of tdh and/or trh-positive V. parahaemolyticus strains in seafood represents a public health risk, their detection would be of paramount importance. To investigate the pathogenicity of the isolated V. parahaemolyticus, multiplex PCR (tl, tdh and trh genes) was performed. The strains that were identified according to the Noguerola’s scheme were all tl gene positive, and were therefore confirmed as V. parahaemolyticus. Only two tdhpositive strains were identified in samples that were collected in summer. No trh-positive V. parahaemolyticus strain was detected in samples of different seasons. In another report from Iran, the prevalence of tdh-positive and trh-positive V. parahaemolyticus were 1.7% and 0.7%, respectively (Rahimi et al., 2010). In conclusion, the detection of tdh-positive V. parahaemolyticus in shrimp marketed in Iran shows a probable risk for public health. Therefore, intensive and continuous monitoring of potentially pathogenic V. parahaemolyticus is strongly recommended in order to evaluate the human health risk arising from seafood consumption. Acknowledgements This study was supported by the research grant provided by Shahid Chamran University of Ahvaz. The authors would like to thank Mrs. N. Norouzieh and Mrs. P. Esfahani for their assistance. References Austin, B., & Austin, D. A. (2007). Bacterial fish pathogens, disease of farmed and wild fish (4th ed.). Godalming: Springer Praxis.
109
Austin, B., Austin, D. A., Blanch, A. R., Cerda, M. M., Grimont, F., Grimont, P. A. D., et al. (1997). A comparison of methods for the typing of fish-pathogenic Vibrio spp. Systematic and Applied Microbiology, 20, 89e101. Basti, A. A., Misaghi, A., Salehi, T. Z., & Kamkar, A. (2006). Bacterial pathogens in fresh, smoked and salted Iranian fish. Food Control, 17, 183e188. Bej, A. K., Patterson, D. P., Brasher, C. W., Vickery, M. C. L., Jones, D. D., & Kaysner, C. A. (1999). Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh, and trh. Journal of Microbiology Methods, 36, 215e225. Bilung, L. M., Radu, S., Bahaman, A. R., Abdul Rahim, R., Napis, S., Ling, M. W., et al. (2005). Detection of Vibrio parahaemolyticus in cockle (Anadara granosa) by PCR. FEMS Microbiology Letters, 252, 85e88. Cho, S. H., Shin, H. H., Choi, Y. H., Park, M. S., & Lee, B. K. (2008). Enteric bacteria isolated from acute diarrheal patients in the Republic of Korea between the year 2004 and 2006. Journal of Microbiology, 46, 325e330. Cook, D. W., Bowers, J. C., & DePaola, A. (2002). Density of total and pathogenic (tdhþ) Vibrio parahaemolyticus in Atlantic and Gulf coast molluscan shellfish at harvest. Journal of Food Protection, 65, 1873e1880. DePaola, A., Kaysner, C. A., Bowers, J. C., & Cook, D. W. (2000). Environmental investigation of Vibrio parahaemolyticus in oysters after outbreaks in Washington, Texas, and New-York (1997 and 1998). Applied and Environmental Microbiology, 66, 4649e4654. DePaola, A., Nordstrom, J. L., Bowers, J. C., Wells, J. G., & Cook, D. W. (2003). Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters. Applied and Environmental Microbiology, 69, 1521e1526. Farmer, J. J., III, Janda, M., & Birkhead, K. (2003). Vibrio. In P. R. Murray, E. J. Baron, J. H. Jorgensen, M. A. Pfaller, & R. H. Yolken (Eds.), Manual of clinical microbiology (pp. 706e718). Washington DC: ASM Press. Hervio-Heath, D., Colwell, R. R., Derrien, A., Robert-Pillot, A., Fournier, J. M., & Pommepuy, M. (2002). Occurrence of pathogenic vibrios in coastal areas of France. Journal of Applied Microbiology, 92, 1123e1135. Hosseini, H., Cheraghali, A. M., Yalfani, R., & Razavilar, V. (2004). Incidence of Vibrio spp. in shrimp caught off the south coast of Iran. Food Control, 15, 187e190. Jacksic, S., Suncica, U., Petrak, T., Bazulic, D., & Lada, G. K. (2002). Occurrence of Vibrio spp. in sea fish, shrimps and bivalve mollusks harvested from Adriatic sea. Food Control, 13, 491e493. Janda, J. M., Powers, C., Bryant, R. G., & Abbott, S. L. (1988). Current perspectives on the epidemiology and pathogenesis of clinically significant Vibrio spp. Clinical Microbiology Reviews, 1(3), 245e267. Lhafi, S. K., & Kühne, M. (2007). Occurrence of Vibrio spp. in blue mussels (Mytilus edulis) from the German Wadden Sea. International Journal of Food Microbiology, 116, 297e300. Martinez-Urtaza, J., Lozano-Leon, A., Varela-Pet, J., Trinanes, J., Pazos, Y., & GarciaMartin, O. (2008). Environmental determinants of the occurrence and distribution of Vibrio parahaemolyticus in the rias of Galicia, Spain. Applied and Environmental Microbiology, 74, 265e274. Noguerola, I., & Blanch, A. R. (2008). Identification of Vibrio spp. with a set of dichotomous keys. Journal of Applied Microbiology, 105, 175e185. Ortigosa, M., Garay, E., & Pujalte, M. J. (1994). Numerical taxonomy of Vibrionaceae isolated from oysters and seawater along an annual Kyle. Systematic and Applied Microbiology, 17, 216e225. Ottaviani, D., Masini, L., & Bacchiocchi, S. (2003). A biochemical protocol for the isolation and identification of current species of Vibrio in seafood. Journal of Applied Microbiology, 95, 1277e1284. Parveen, S., Hettiarachchi, K. A., Bowers, J. C., Jones, J. L., Tamplin, M. L., McKay, R., et al. (2008). Seasonal distribution of total and pathogenic Vibrio parahaemolyticus in Chesapeake Bay oysters and waters. International Journal of Food Microbiology, 128, 354e361. Rahimi, E., Ameri, M., Doosti, A., & Gholampour, A. R. (2010). Occurrence of toxigenic Vibrio parahaemolyticus strains in shrimp in Iran. Foodborne Pathogens and Disease, 7(9), 1107e1111. Sakazaki, R. (2002). Vibrio. In D. O. Cliver, & H. P. Riemann (Eds.), Food-borne diseases (pp. 127e136). London: Academic Press. Shirai, H., Ito, H., Hirramaya, T., Nakamoto, T., Nakabayashi, N., Kumagai, K., et al. (1990). Molecular epidemiologic evidence for association of thermostable direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with gastroenteritis. Infection and Immunity, 58, 3568e3573. Tarr, C. L., Patel, J. S., Puhr, N. D., Sowers, E. G., Bopp, C. A., & Strockbine, N. A. (2007). Identification of Vibrio iolates by a multiplex PCR assay and rpoB sequence determination. Journal of Clinical Microbiology, 45, 134e140. Toti, L., Serratore, P., Croci, L., Stacchini, A., Milandri, S., & Cozzi, L. (1996). Bacteria isolated from seawater and mussels: identification and toxin production. Microbiology Alimentation Nutrition, 14, 161e165. West, P. A., Brayton, P. R., Bryant, T. N., & Colwell, R. R. (1986). Numerical taxonomy of vibrios isolated from aquatic environments. International Journal of Systematic Bacteriology, 36, 531e543. Wong, H. C., Liu, S. H., Ku, W., Lee, I. Y., Wang, T. K., Lee, Y. S., et al. (2000). Characterization of Vibrio parahaemolyticus isolates obtained from food-borne illness outbreaks during 1992 through 1995 in Taiwan. Journal of Food Protection, 63, 900e906. Yeung, P. S. M., & Boor, K. J. (2004). Epidemiology, pathogenesis, and prevention of foodborne Vibrio parahaemolyticus infections. Foodborne Pathogens and Disease, 1, 74e88.