Sebaceous carcinoma

Sebaceous Carcinoma Tumor Progressionthrough Mutationallnactiwttion of P53 Fed&co Gonzalez-Fernunder, MD, PhD,le4 Sara A. Kaltreider, MD,’ Be&z Da& Patnaik, MD,’ Jacques D. Retief, PhD,’ Yongde Bao, PhD,6 Steven Newman, MD,’ Mark H. Staler, MD,2 Paul A. Levine, MD 7 Background: Sebaceous carcinoma may masquerade for years as an inflammatory condition. In many cases, this may be because of the presence of longstanding intraepithelial disease (e.g., dysplasia or carcinoma in situ), which eventually progresses to invasive carcinoma recognized through tumefaction and a worsening clinical presentation. The mechanism for this tumor progression is unknown. In the Far East, human papilloma virus (HPV) has been suggested to play a role in the development of sebaceous carcinoma by inactivating tumor suppressor gene ~53. Here, the authors explore the molecular basis of the progression of ocular sebaceous carcinoma. Methods: Cases of sebaceous carcinoma seen at the University of Virginia, Department of Ophthalmology, during the period from 1989 to 1998 were analyzed for HPV infection by in situ hybridization and polymerase chain reaction. The expression of ~53, p21WAF-‘, Bcl-2, and epithelial membrane antigen was examined by immunohistochemistry. In one of the cases, frozen tumor was available, allowing exons 5 through 9 of the ~53 gene to be sequenced. Seven cases were identified, all of which were from women. All were negative for HPV. In cases in Results: which disease was restricted to dysplasia (carcinoma in situ), ~53 but not p21wA”’ was negative. In contrast, cases that contained a component of invasive or metastatic carcinoma showed striking hyperexpression of nuclear ~53 in all of the malignant cells. In one of these cases, a G:C - T:A transversion was found in the p53gene. This mutation, characteristic of bulky carcinogens, substituted phenylalanine for cysteine 277, a residue that participates in hydrogen bonding to the p53 DNA binding consensus sequence. Conclusions: Mutational inactivation of p53 may be involved in the progression of sebaceous carcinoma. Ophthalmology 1998; 105:#97-506

Ocular sebaceous carcinoma is a life-threatening malignant neoplasm that represents a significant challenge to Originally received: December 24, 1996. Revision accepted: September 15, 1997. ’ Department of Ophthalmology, University of Virginia Health Sciences Center, Charlottesville, Virginia. ’ Department of Pathology, University of Virginia Health Sciences Center, Charlottesville, Virginia. ’ Department of Neuropathology, University of Virginia Health Sciences Center, Charlottesville, Virginia. 4 Graduate Program in Neuroscience, University of Vxginia Health Sciences Center, Charlottesville, Virginia, ’ Information Technology & Communication/Academic Computing Health Sciences, University of Virginia Health Sciences Center, Charlottesville, Virginia. 6 Department of Microbiology, University of Virginia Health Sciences Center, Charlottesville, Virginia. 7 Department of Otolaryngology, University of Virginia Health Sciences Center, Charlottesville, Virginia, Supported by grant #IN149H from the American Cancer Society (FGF); Research Initiative Award from the Department of Otolaryngology, University of Virginia Health Sciences Center; an unrestricted developmental grant from Research to Prevent Blindness; and National Institutes of Health grant EY09412 (FGF). The authors have no proprietary interest in the development or marketing of reagents or equipment used in this study. Reprint requests to Federico Gonzalez-Fernandez, MD, PhD, Department of Ophthalmology, University of Virginia Health Sciences Center, Cobb Hall, Room B032, Charlottesville, VA 22908.

both ophthalmologists and pathologists.’ Early surgical excision generally is curative. However, difficulty in obtaining an early diagnosis is largely why the 5-year tumorrelated death rate has been reported to be as high as 30%.’ Fortunately, increased awareness and earlier definitive treatment are improving the prognosis.3 Nevertheless, sebaceous carcinoma continues to cause significant morbidity and mortality because of difficulties in early diagnosis and limited response of the neoplasm to radiation treatment. 1*4x5 Sebaceous carcinoma, which usually occurs during the fifth through ninth decades, accounts for 1% to 5.5% of all eyelid malignanciess6 However, according to a study from the Armed Forces Institute of Pathology, “Sebaceous carcinomas are second only to basal cell carcinomas in frequency of malignant neoplasms of the eyelids and second only to malignant melanoma in lethality.“’ The tumor is thought to usually arise from the Meibomian glands or the glands of Zeis. Sebaceous carcinoma also can arise from the sebaceous glands of the eyebrow, the caruncle, the sebaceous glands of the fine hair follicles on the cutaneous surface of the lids, the conjunctiva, and the lacrimal glands.’ If we are to ever understand the etiology of sebaceous carcinoma, a number of important questions need to be addressed. First, why is sebaceous carcinoma relatively rare in the noneyelid skin?’ Second, why is ocular sebaceous carcinoma 57% to 77% more common in women than in men?’ Third, why do sebaceous carcinomas com497

Ophthalmology

Volume 105, Number 3, March 1998

prise 33% of malignant eye lid tumors in Shanghai, but only 2% in Boston?’ Fourth and finally, what is the mechanism for the multifocal origin’s3Z’0 of ocular sebaceous carcinoma and its relative resistance to radiation therapy?’ Stepwise accumulation of genetic damage probably is required for the development of ocular sebaceous carcinoma. The neoplasm can begin as a severe dysplasia without underlying carcinoma’.“.‘* and continue for years before transformation to invasive carcinoma occurs.‘3,‘4 More than one genetic event also is suggested by the fact that many years may be required for sebaceous carcinoma to develop after radiation therapy.‘5-‘7 Although the specific genes involved in the multistep process are unknown, tumor suppressor genes involved in protecting the genome from damage probably play a central role. Sebaceous carcinoma is associated with the Muire-Torre syndrome, a familial cancer susceptibility syndrome characterized by cutaneous sebaceous neoplasms and one or more lowgrade visceral malignancies.18 In this syndrome, cancer susceptibility can be because of inheritance of mutations in the hMSH2 (human Mut S homolog 2) gene, which encodes components of a DNA mismatch repair system.” Furthermore, spontaneous sebaceous carcinomas develop in the skin of hMSH2-deficient mice.*’ Finally, sebaceous carcinoma in Japan has been associated with human papilloma virus (HPV) infection and ~53 overexpression.*’ As the “guardian of the genome,” ~53 mediates functions that protect against the development of malignancy.22.23Its role in promoting Gl arrestz4and apoptosis25 suggests that the tumor-suppressing functions of ~53 preserve the genomic integrity of the cell. Normally, the concentration of p53 is kept low by its relatively short half-life (approximately 20 minutes). The DNA damage activates ~53 by increasing its half-life. The increased ~53 concentration then activates cell cycle arrest. Inhibition of the cell cycle gives the cell time to repair its DNA before the damage can become fixed as mutations. If the damage cannot be repaired, ~53 activates apoptosis (programmed cell death). ~53 therefore plays a central role in the elimination of potentially oncogenic cells.26 The death program can be presided over by specific genes, including the bcl2 (B-cell lymphoma-2) gene family.27 Thus, the apoptotic threshold of a malignant cell, which will dictate its response to radiation and chemotherapy, may eventually be defined for different types of cancer and used to guide treatment. p53, a zinc finger transcription factor, promotes cycle cell arrest and apoptosis by enhancing the transcription of seven known genes.*” The products of these genes carry out the p53-dependent functions of the cell. One of the seven genes activated by ~53 is p21wAFm’ (WAF = wildtype ~53 activated fragment).28 p21WAF-’ inactivates cyclin-dependent kinases, inhibitors of negative cell cycle regulators such as products of the retinoblastoma gene family.29 Unlike p21WA”‘, which rarely is disrupted in cancer, ~53 commonly is inactivated through mutation of its gene. Mutations of the ~53 gene, which are the most common alteration in human cancer, have been categorized according to the associated carcinogen. The ~53 mutational spectrum in tumors is providing information 498

about the origin of the mutations that give rise to certain types of cancer.3o Our long-term goal is to understand the etiology of ocular sebaceous carcinoma. As a first step toward this goal, we examined a group of cases comprising a histopathologic spectrum ranging from intraepithelial disease (dysplasia or carcinoma in situ) to metastatic carcinoma. The tumors were evaluated for the presence of HPV and expression of n53, ~21~~“‘. Bcl-2. and enithelial membrane antigen L(EMA). In one of the cases, in which a sufficient quantity of pure tumor was available, the sequence of ~53 exons 5 through 9 was determined. Materials

and Methods

Histopathologic

and Immunohistochemistry

Analysis The original hematoxylin- and eosin-stained slides and zincbuffered, formaldehyde-fixed tissue in paraffin blocks were available for each case. All lesions were reviewed histologically to confirm the diagnosis. The cases were graded according to Table 1, which combines the observation that early sebaceous carcinoma can be confined to the epithelium (dysplasia or carcinoma in situ; this and previous studies’~“~‘2~‘4), and that for invasive disease, the degree of differentiation correlates with clinical outcome.7 Oil-red-O and Sudan black histochemical stains for cytoplasmic lipid were performed on frozen sections of formaldehyde-fixed tissue or on cytologic specimens fixed in formaldehyde. The cytologic specimens were obtained by gently scraping the palpebral conjunctiva with a small rounded spatula. The scraping was smeared on a glass slide and fixed immediately in formaldehyde (for Oil-red-O stain) or methanol for immunocytochemistry. Frozen tumor from patient EH was used for ~53 sequence analysis (see below). For immunolocalization, the cytologic smears or 6-pm deparaffinized rehydrated sections mounted on polylysine-coated slides were subjected to microwave retrieval (for ~53 and Bcl2). Endogenous peroxidase activity was abolished with hydrogen peroxide. Tissue sections were treated with primary antibodies: epithelial membrane antigen (EMA, E-29, 1800 dilution; Dako, Carpinteria, CA), ~53 (DO-l, 1:8 dilution of manufacturer’s prediluted preparation; Immunotech, Westbrook, ME); p21WA”’ (1:40 dilution; Oncogene Sci., Uniondale, NY), and Bcl-2 (clone 124, 1:40; Dako). The primary antibodies were visualized by the avidin-biotin immunoperoxidase technique using 3-3’-diaminobenzidine-tetrahydrochloride as the chromogen (Vectastain; Vector Laboratories, Burlingame, CA). Replacement of the primary antibodies with normal nonimmune rabbit serum served as negative control specimens. Human Papilloma Virus In Situ Hybridization Polymerase Chain Reaction

and

For in situ hybridization, 4- to 5-pm sections of paraffin-embedded tumor were mounted on 3-aminopropyltriethoxysilane-

coated slides. The slides were probed with antisense [3H]labeled RNA whole-genomic transcripts directed against the RNA of HPV types 6, 11, and 16.3’ These three HPV types have been overwhelmingly associated with the positive reports of HPV infection in the upper respiratory tract. Conditions for probe generation and hybridization have been well characterized.32,33 The results of the in situ hybridization studies were con-

Gonzalez-Fernandez et al * Progression of SebaceousCarcinoma Table 1. Classilication of Sebaceous Carcinoma Used in This Study*

Patient

4%

(yrs)

Race/ Gender

YF

90

W/F

JR ES

68 72

Site,

(social)

History

Breast, lung Ca, smoker (Cook) Facial BCC, bun eXp”SUlY da

W/F W/F

LD

51

W/F

da

EF

80

W/F

n/a

SH

32

W/F

EH

75

(Beautician for 14 yrs, uv tanmng bed exposure)

W/F

(Maid)

Time? UL >1.5

Initial Diagnosis [Clin (Path)]+

SpecialStudies Grades

Basal or Seb Ca (Seb Ca)

Intraepithelial

Intraepithelial

2 yrs

Inflam lesion (Seb Ca) Chalazion (Seb Cd

LL 5-6 yrs UL 5 yrs UL 3 months

Inflam lesion (Seb Ca) lnflam lesion (Seb Ca) Seb Ca (Seb Cd

Invasive,

Mod-diff

Invasive,

Mod-dlff

Invasive,

Mod-diff

vrs

LL

4 yrs LL

LL

6 years

Inflam lesion (inflam and dyplasia)

Intraepithehal with focus of invasion

Invastvc, diff

Poorly

Follow-up Lid excision NED 2.5 yrs Lid excision NED, 1 yr FW excision Lid excision NED, 1.9 yrs Lid excision NED, 2 yrs LKI excision NED, 1.9 vrs Lid excision, RAD Exenteration FSC; +neck lymphatics, yrs Exenteration, +neck Iymphatlcs

EMA

HPV

+

--+

+

FSC,

ND

~53

021

RCL2

-

ND

-

+

-++

-

+

-++

-

+

-++

+

-

+

+

-

++

+

-

with 2.5 RAD,

-

8 mos

W = white; F = female; UL and LL = upper and lower lid, respectively; NED = no evidence of disease; FW = full-thickness wedge rescctmn; FSC = intraoperative frozen section control; RAD = radlatmn therapy; EMA = epithelial membrane antigen; HPV = human papilloma virus (m bitu and PCR methodologies); ~53 = tumor suppressor gene; p21 = wild type ~53 associated factor (WAF-1); ND = not done; n/a = not applicable. * The grading scheme combines the observation and other studies’,“,‘*,“‘), and that for mvaslve -F Duratton

of symptoms

$ Clinical

and pathologic

9: Grade

base on Table

before diagnosis

that early sebaceous carcinoma can be confined to the cpithehum (dysplasia disease, the degree of differentiation correlates with clinical outcome.’

of sebaceous carmoma

diagnoses at time of mltial

or carcmoma

m situ; thla

was made.

presentation.

2.

firmed by polymerasechain reaction (PCR), as describedpreviousIy.3’ Briefly, a S-pm sectionadjacentto that usedfor in situ hybridization was scrapedin sterile fashioninto a 1.5ml tube. The samplewas extracted with xylene and ethanol to removethe paraffin, andthenthe DNA wasreleasedvia proteinase-Kdigestion(Oncor, Gaithersburg,MD) at 55” C for 2 hours followed by boiling for 20 minutes.The PCR amplification was performed under rigorous anticontaminationprocedures, including physical separationof the pre-PCR and post-PCR procedures,which were followed throughout.Negative control specimens includedall reactioncomponentswithout DNA.

verseprimer sequence(underlined).The DNA oligonucleotide primerswere as follows. Exons 5 + 6: ggaggtgcttacacatand ataagcagcaggagaaagcc (outer pair); B-tgtaaaacgacRKccagtctgccgtgttccagttgcttt and caggaaacagctutgaccggccactgacaaccacccttaacc(inner pair). Exons 7 through 9: aaggagaatggcgtgaacct and gttagctacaaccaggagcc (outer pair). B-tg~auuacgacggccagtagcttgcagtgagctgagat and cugguuucugcrutguccctggaaactttccacttgat (inner pair). The nonbiotinylated oligonucleotides were synthesizedon an Expedite 8909 DNA synthesizer(Perceptive Biosystems).5’-biotinylated oligonucleotideswere obtainedfrom the Midland Certified ReagentCo. (Midland, TX). All primerswere purified by high-performanceliquid chromatography.Standardprotocolsfor PCR (50-~1volume)were fol~53 Sequence Analysis lowed as describedby the manufacturer(Perkin-Elmer Cetus, The sequenceof ~53 geneexons 5 through 9 was determined Norwalk, CT). Eachreactionused1pg of tumor genomicDNA. AmpliTaq DNA polymerase(BoehringerMannheim,Indianapfrom tumor DNA of patient EH. For this patient, we were olis, IN) was addedafter the reagentswere held for 4 minutes ableto obtain sufficient quantitiesof pure frozen tumor from a cervical lymph nodemetastasis. Hematoxylin- andeosin-stained at 95 “C to minimize nonspecificannealing.Thirty cycles of PCR wasperformedusing95 “C (45 seconds),58 “C (45 secfrozen sectionswere usedto establishthat the portion of the onds),and70 “C (45 seconds)for denaturation,annealing,and node used for the DNA extraction consistedonly of tumor extensionconditions,respectively.The PCR product waspuriwithout contaminatingnormaltissue.The DNA was extracted fied by agarose(SeaPlaque;FMC BioProducts,Rockland,ME) and purified by the acid-phenol chloroform method.34 electrophoresis, andthe ethidiumbromide-stained bandwasexFrom the purified tumor genomicDNA, ~53 exons 5 + 6 and7 through9 wereamplifiedseparatelyby PCRandsubjected cised.One microliter of the meltedgel bandslicewasusedfor a amplificationusingthe internal~53 specificprimers to automatedfluorescenceDNA sequencingusing magnetic subsequent describedabove. The conditionsfor this secondPCR were the beadsanddye-primeranddye-terminatorchemistries.j5 The two pairs of exons were amplified using nestedprimer pairs. The sameasfor the first, except that the annealingtemperaturewas increasedto 60 “C andthe numberof cyclesreducedto 25. The upstreamprimer of the inner pair wasbiotinylated (B) at its 5’ terminusand containedthe M13(-21)-forward primer sequence 5’-terminusof the upstreamprimer in each pair was biotinyl(underlined).The downstreamprimer containedthe Ml3-reated, allowing the individual DNA strandsto be purified by

499

Ophthalmology

Volume 10.5, Number

Table 2. Summary of Clinical and Histopathologic Findings: Patients Ordered According to Histologic Grade Classification

No. of Cases

Dysplasia(carcinomain situ) Completelyrestricted to the epithelium lntraepithelialwith singlefocus of invasion Invasive Well differentiated Moderatelydifferentiated Poorly differentiated

avidin-coated magnetic beads according to the manufacturer’s protocol (Dynal AS, Oslo, Norway). DNA sequencing was performed using an Applied Biosystems PRISM 377 automated fluorescence DNA sequencer (Perkin-Elmer). Dye-terminator and dye-primer sequencing methods were performed on both sense and antisense strands with AmpliTaq DNA polymeraseFS according to the manufacturer’s recommended protocol (Perkin-Elmer).

Results Our study included all patients (seven total) treated for sebaceous carcinoma in the Department of Ophthalmology, University of Virginia Health Sciences Center, during the period from 1989 through 1996. The clinical and histopathologic data of the patients are summarized in Table 2. All the patients were white women generally older than 50 years of age. One of the patients, a 32-year-old beautician (SH), was unusually young for having a sebaceous carcinoma develop, which usually occurs in the fifth through ninth decades. In Table 2, the cases are ordered according to the histopathologic grading system described in Table 1. In the first two patients (YF and JR), the sebaceous carcinoma was completely intraepithelial (dysplasia or carcinoma in situ). In the third patient (ES), although the neoplastic process was primarily intraepithelial, an area of invasive carcinoma was identified. Patients LD, EF, and SH had moderately differentiated, invasive sebaceous carcinomas. The sebaceous carcinoma of patient EH was poorly differentiated and invasive. For six of the cases, the paraffin-embedded tissue was analyzed by both in situ hybridization and PCR for HPV DNA. Both methods failed to show HPV DNA, although control specimens (actin messenger RNA [mRNA] and genomic DNA) were detected easily from all patients (data not illustrated). Intraepithelial sebaceous carcinoma could involve large regions of the eyelid without showing invasive disease. Such lesions are analogous to dysplasia or carcinoma in situ, regarded as early lesions in the progression of other carcinomas, In patient YF (Fig l), the dysplastic process extended from the eyelash follicles to the bulbar conjunctiva. Serial sections did not identify an area of invasive carcinoma. ~53 was not overexpressed. Throughout the eyelid, the dysplasia showed upregulation of cyclin-dependent kinase inhibitor p21WAF-‘, which is an effector ofp53 (Fig 1E). p21WAF-’also was upregulated in cases showing ~53 overexpression (Table 2). This is consistent with recent studies indicating that p21WA”’ can be activated by p53dependent and -independent mechanisms (reviewed by Gartel et a12*). For example, in cutaneous squamous cell carcinoma, in which ~53 often is inactivated, p21WA”’ is overexpressed greatly compared to the surrounding normal epithelium.36 This

500

3, March 1998

suggests that p21WAF-’ overexpression alone is not sufficient to suppress cancer development. Upregulation of p21WAF-’ in sebaceous carcinoma may therefore reflect an unsuccessful attempt to suppress cell proliferation. Expression of EMA and Bcl-2 also was independent of ~53 expression. All of our cases were positive for EMA (Table 2). Like that of the normal sebaceous glands (Meibomian and Zeis), which often were included within the surgical specimens (Fig 2C), the EMA staining pattern of the neoplastic cells also was cytoplasmic. The degree of EMA immunoreactivity was variable and correlated to the degree of cytologic sebaceous differentiation. This is illustrated in the inset of Figure 2C, in which immunospecific EMA reactivity was associated only with clusters of cells displaying cytoplasmic lipid vacuoles. Bcl-2 was negative in all cases (data not illustrated). Normal lymphatic follicles and follicular lymphoma,which were usedascontrol specimens,showedclear reactivity with the Bcl-2 antibody. In contrastto EMA, ~53 was either strikingly overexpressed or undetectable.The sameregionof intraepithelialneoplasiain Figure 2C, which containedonly scatteredcollectionsof weakly EMA-positive cells, showeduniform nuclear~53 hyperexpression (Fig 2D). In contrast,~53 could not be detectedin cases in which sebaceous carcinomawascompletelyrestrictedto intraepithelialdisease(patientsYF and JR). However, casesthat containedat leastone region of dermal invasion showed~53 hyperexpression.The level of ~53 overexpressiondid not depend on the degreeof cytologic sebaceous differentiation. ~53 immunolocalizationcould thereforebe usefulin identifying the neoplasticcells. As shown in Figures 2 through 4, pagetoid spreadof the carcinomacellswithin the dermalor conjunctival epitheliumcould be identifiedby ~53 immunolocalization.This wasparticularly useful in patient EH, in whom the neoplastic cellswereundifferentiated(Figs4B,F). For this patient,a retrospectiveanalysisof archivalblocksof conjunctivalbiopsyspecimensdiagnosedpreviously as inflammatorydiseaseidentified the malignantcells (Figs 4C,D). From a neck lymph node metastasisof patient EH, sufficiently pure tumor wasobtained,allowing~53 DNA sequence analysisto be performed.Exons 5 through9 were amplifiedby PCR from the tumor genomicDNA. The amplified DNA was subjectedto automatedDNA sequencingusingmagneticbeads. The sequenceof exons 5 through 9 was normal, except for a G:C - T:A transversioninvolving one allele. Figure 5 shows the fluorescenceDNA sequence datafrom the sensestrand.The transversionresultedin two peaksof similar heightssuperimposedat the positionof the secondbaseof the codon277. Wildtype DNA, analyzedsimultaneously,had only onepeak at the secondbaseposition of this codon. The transversionresulted in a substitutionof phenylalaninefor cysteine-277(Cys-277). The mutation was confirmedon both strandsusingboth dyeterminator and dye-primer chemistriesduring the DNA sequencingreaction.

Discussion We evaluated the role of HPV, ~53, p21WAF-‘,and Bcl-2 in the progression of sebaceouscarcinoma from dysplasia to invasive carcinoma. Our main findings were asfollows. All patients with sebaceouscarcinoma treated in the Department of Ophthalmology between 1989 and 1996 were women. The casesdid not contain HPV and were negative for Bcl-2. Sebaceouscarcinoma restricted to intraepithelial disease(e.g., dysplasia or carcinoma in situ) did not overexpress ~53, although expression of p21WAF-’could

Gonzuales-Fernundey

et al * Progression

of Sebaceous Carcinoma

Figure 1. Patient YF had a diffuse intraepithelial sebaceous carcinoma that involved a large area of the eyelid but showed no evidence of invasive carcinoma. The dysplastic process did not overexpress p53, although the expression of P21 WA’-1 was upregulated. The 90-year-old woman had upper lid alopecia without inflammation (A). The sections shown in the photomicrographs (A-D, F) were stained with hematoxylin and eosin. A vertical section through the lid is presented for orientation (B). The dysplastic process extends from the follicles of the eyelashes (position 1) to the surgical margin at the bulbar conjunctiva (position 3). Although the dysplastic process involves hair follicles, it is restricted by the basement membrane (arrows, C). Higher mag nification of the region indicated by the arrowhead shows sebaceous differentiation (D). E, this section, which corresponds to position 2 (B), shows the immunohistochemical localization for p21WAF~‘. The intraeplthehal sebaceous carcmoma, which replaced the normal eplthehum, overexpressed nuclear p21 VJM 1 The neoplasnc process did not show p53 overexpresslon (data not Illustrated). The mtraeplthehal neoplastlc process extends to the bulbar surgical margm (F) (posmon 3, B).

be elevated. In contrast, hyperexpression of ~53 was observed in all cases containing a component of invasive sebaceous carcinoma. In one of these cases, a G:C T:A transversion, characteristic of mutations caused by bulky carcinogens, substituted Phe for Cys-277, a residue that normally participates in hydrogen bonding to the p53 DNA binding consensus sequence. Taken together, our data suggest that mutational inactivation of ~53 may be involved in the progression of ocular sebaceous carcinoma. Most of our cases had a component of intraepithelial neoplasia. It has been emphasized that the recognition of intraepithelial neoplasia can be important in arriving at the diagnosis of sebaceous carcinoma.37s’8 In this regard, ~53 and EMA immunohistochemical analysis can be useful. In the case of patient EH, in whom hematoxylinand eosin-stained sections did not show unequivocally the presence of the intraepithelial neoplasia, retrospective immunostaining for ~53 clearly identified the neoplastic cells (Figs 4C,D). Epithelial membrane antigen also can be a useful marker, but its expression depends on the level of sebaceous differentiation. In contrast, when ~53 was positive, its striking nuclear overexpression did not depend on the degree of cytologic differentiation. The limitation of ~53 as a marker is that it was not overexpressed in cases restricted to carcinoma in situ (see below). Conjunctival scrape biopsy specimen combined

with ~53 immunocytochemical analysis was useful in showing tumor recurrence in patient ES (Fig 2F). Although fine-needle aspiration has been used to diagnose metastatic sebaceous carcinoma,39 this is the first reported use of cytologic scraping to identify sebaceous carcinoma in the eyelid. Although sebaceous carcinoma has been associated with HPV infection in Japan, we did not detect HPV by in situ hybridization or by PCR. A variety of factors can effect in situ hybridization sensitivity4”.4’ and modify the sensitivity of PCR when using formaldehyde-fixed, paraffin-embedded tissue.42 However, it is unlikely that our negative result is false because we were able to detect positive internal control markers. Furthermore, radioactive RNA probes against mRNA targets are even more sensitive than PCR. In contrast to our negative result, 61.9% of cases of sebaceous carcinomas in Japan contain HPV.41 Unlike in the West, where sebaceous carcinoma accounts for only 0.1% to 0.7% of eyelid cancers6 28% of eyelid cancers in Shanghai44 and 12.8% to 26.9% of eyelid cancers in Japan4” are sebaceous carcinomas. In a comparative study,’ the incidence of sebaceous carcinoma was 32.7% and 1.5% in Shanghai and Boston, respectively. It is plausible that the lower incidence of sebaceous carcinoma in the United States may be because of a lower incidence of ocular HPV. It is becoming increasingly recognized that sebaceous 501

Volume 105, Number 3, March

Ophthalmology

Figure

2.

Patlent

of the tumor when dysplastic eplthehum,

ES had

an mtraeplthehal

It recurred which

1 year after the was stamed with

sebaceous

carcmoma

a focus

disease.

This

figure

was widespread. The ~53 lmmunolocaluatlon recurrence was shown by p53 lmmunocytochemlcal

shows and focal vacuoles

the chmcal

and

hlstologlc

features

loss of eyelashes (arrow, A). The (arrows, B). Another area ot the

dlustrated). The lmmunolocahzatlon of eplthehal membrane antigen (EMA) (C). Focal m cells contammg cytoplasmlc vacuoles. Two such areas are shown at high magmficatlon gland (m) for EMA (D). I n contrast to the focal lmmunoreactlvlty for EMA, ~53

was used to ldentlfy the pagetold analysis of a conlunctlval

carcinoma may begin as a premalignant process. In two of our patients (YF and JR), the sebaceous carcinoma was completely intraepithelial. This intraepithelial neoplasia also is referred to here as dysplasia or carcinoma in situ. In these patients, the carcinoma was confined completely to the epithelium of the palpebral conjunctiva, dermis, hair follicles, or adnexal apocrine glands (glands of Moll) without showing evidence of invasion into underlying dermis. Recent reports have shown that intraepithelial sebaceous carcinoma can exist without an invasive component.‘1~12 Those published cases and our cases (patients YF and JR) in the current study represent premalignant disease (dysplasia or carcinoma in situ). Case ES, as well as two previously reported cases,13,14 represent sebaceous carcinoma in transition from intraepithelial disease to invasive carcinoma. These cases, which had longstanding intraepithelial disease involving a large area of the conjunctiva, contained a single focus of invasive carcinoma. The events triggering the progression of the dysplasia to invasive sebaceous carcinoma are unknown. Studies of the dysplasia-carcinoma sequence at other body sites suggest that malignant transformation is the result of the accumulation of genetic alterations in multiple proto-oncogenes or tumor suppressor genes or both. Our data suggest that inactivation of p53 is not the initial event but may be central to the progression of sebaceous carcinoma from dysplasia to invasive disease. Inactivation of p53 would be important to this process because it

502

of mvas~ve

wedge resectIon of the mltlal lesmn Cqunctlval thlckenmg hematoxylm end eosm, contams numerous cytoplasmlc hpld

specimen showed early mvaslve sebaceous carcmoma (data not areas of sebaceous dlfferentlatlon are mdlcated by EMA posltlvlty m the Insert (arrows) Note the posltlvlty of the Melbommn overexpresalon (E) Tumor

with

1998

spread of the neoplastlc scrape biopsy (F)

cells

(arrows)

wlthm

the eprthelum

would make the genome of the dysplastic cells vulnerable to the accumulation of further genetic damage. Inactivation of p53 is thought to have such a role in the progression of other types of cancer, particularly breast, colon, esophageal, and skin.46m49 In five of our cases, p53 hyperexpression was observed. Hyperexpression often is the result of p53 inactivation. The mechanism of the hyperexpression appears to be that the turnover of the altered p53 is reduced compared to that of wild-type ~53. Mutational inactivation has been associated with a compact nuclear staining pattern.50 Such a pattern was seen in all the cases in the current study. Nevertheless, because p53 can be overexpressed by mechanisms other than mutational inactivation, immunohistochemical data must be evaluated with caution5’ To address whether the overexpression of p53 seen in the current study was the result of mutational inactivation, we determined the sequence of ~53 exons 5 through 9 for case EH, in which pure tumor was available. These exons, which contain 90% of known mutations, were amplified by PCR. A G:C - T:A transversion was found that resulted in a substitution of phenylalanine for cysteine at amino acid residue position 277 (Fig 5). Crystallographic studies have shown that Cys-277 together with the H2-a helix, which it immediately precedes, forms the contact with the major grove of the p53 DNA pentamer consensus sequence.52 Despite the fact that Cys-277 is involved in the interaction with the con-

Gonzalez-Fernunder

et al * Progression

of Sebaceous Carcinoma

Figure 3. Patient EF had a moderately differentiated sebaceous carcinoma with stromal invasion and intraepithelial pagetoid spread. She was treated for 2.5 years for apparent chronic blepharoconjunctivitis. Destruction of the eyelashes in the erythematous and eczematous upper lid (A). Sebaceous carcinoma extending into the dermal epithelium (stain, hematoxylin-eosin) (B). Higher magnification photomicrographs (stain, hematoxylin-eosin) taken under phase contrast (C,D). Lack of intercellular desmosomal bridges (black arrows) between the malignant cells (asterisk) (C). Cytoplasmic vacuoles within the neoplastic cells (arrows) and several mitotic figures (upper right) (D). Low-magnification photomicrograph of an Oil-red-O preparation showing numerous red cytoplasmic vacuoles indicative of fat (insert, D). Anti-p53 immunohistochemical preparations (E,F). Lobules of tumor cells are invading the underlying stroma (E). The neoplastic cells also are extending within the dermal epithelium by pagetoid spread (arrows, F). A sheet of malignant cells replacing the base of the conjunctival epithelium where they continued to overexpress p53 (inset, G).

sensus sequence, substitutions of this residue are not as common as those of the other six residues, which also hydrogen bond to the consensus sequence. The lower frequency of Cys-277 substitutions may lie in the observation that Cys-277 is not involved in binding to 53BP2.53 Twenty-one Cys-277 substitutions involving a variety of cancer types have been reported in the European Bioinformatic Institute database.54 In slightly more than half of these tumors, the mutation is identical to that found in the current study, a G:C - T:A transversion resulting in Cys-277 - Phe-277 substitution. This nonconservative substitution may produce a regional alteration in the tertiary structure of the 53BP2 or p.53 binding sites or both, explaining why this is the most frequent amino acid residue substitution for Cys-277. Mutation in ~53 is not only the most common alteration in human cancer, but it also corresponds to one of the most frequent mutations available for a single gene. Studies of the ~53 mutation spectrum in tumors can provide information about the origin of the mutations that give rise to some types of cancer. Different mutagens

generate specific kinds of base substitutions at certain preferred sites. Thus, some carcinogenic agents produce a fingerprint characteristic for the agent (reviewed by Greenblatt et a13’). G:C - T:A transversions are associated with bulky carcinogens. Carcinogen-DNA adducts may cause the bases to be unreadable, stalling the replication machinery. DNA polymerases tend to fill these sites with adenine. When this occurs opposite to guanine, a common target for the bulky carcinogens, a thymine will pair with the adenine in the next round of DNA synthesis, resulting in the G:C - T:A transversion. G:C - T:A transversions are the most common mutation in the adenine phosophoriboxyl transferase gene in in vitro and animal studies using dihydroxy, epoxy-tetrahydrobenzomurine skin tup(a)pyrene.30,55 Benzop(a)pyrene-induced mors exhibit frequent and characteristic G-to-T mutations in the ~53 gene, including the corresponding Cys-to-Phe substitution observed in the current study.56 A similar mutation spectrum has been observed in the human ~53 gene, drawing a molecular link between tobacco and lung cancer.57-59

503

Ophthalmology

Volume 10.5, Number 3, March 1998

Figure 4. In patlent EH, sebaceous carcmoma masqueraded as mflammatory disease for 6 years. The mrtlal appearance of the eye (A). A retrospectwe analysis of bmpsy specimens taken at the mmal chmcal presentatmn (B-E). Atyplcal cells (arrows) mterspersedwthm the eplthehum (stam,hematoxylin-eosin) (B). AntI-p53 mmunohlstochemIstry showmg mvolvement of adnexal hair folhcles (arrowheads), and the base of the dermal epxhehum wth mtraeplthehal sebaceous carclnoma (arrow, C,D). Higher magnlficauon of the dermal epxhehum (D) shows pag etold spread of p53-posltlve (arrows) cells. The pagetold InfiltratIon can be appreclated by anuep~thehal membrane antigen Immunohlstochemistry (arrows, E). Note that the reactlon product LS cytoplasmlc, wherraa the antl-p53 stammg ts nuclear. The undlfferentlated nature of the neoplasm, which contamed only rare cytoplasmlc vacuoles (arrow; stam, hematoxylm-eosm, F) Demonstratlon of sebaceousdlfferentlatlon requred Od-red-0 stammg (Inset, F). The use of the antl-p53 antlbody in the ldentlficatlon of small cords of mvaswe undlfferentlated sebaceous carc[noma cells (arrows, G)

Normal

Patient EH ~

Figure 5. In patient EH, automated fluorescence DNA sequence analysis (sense strand) of the p.53 mutation present in the sebaceous carcinoma tumor DNA. This example uses dye-primer chemistry. The G:C - T:A transversion substituted phenylalanine for cysteine at amino acid residue position 277.

TGT Cysteine

504

T

;

T

Phenylalanine

Gowaley-Fernandez

et al * Progression of Sebaceous Carcinoma

In the current study, all of the patients were women, Men were not excluded from our study because any patient treated for sebaceous carcinoma in the Department of Ophthalmology, University of Virginia, during the period between 1989 and 1996 was included. It has been noted previously that sebaceous carcinoma afflicts women more than men. Between 57% and 77% of patients have been women in the various published reports.’ It is not known why ocular sebaceous carcinoma is more common in women compared to men. There is no known difference in the size or number of the ocular adnexal sebaceous glands in women compared to men. Furthermore, at nonocular sites, there does not appear to be a significant difference in the incidence of sebaceous carcinoma between men and women. ” The fact that the type of ~53 mutation found in this study is characteristic of that produced by bulky carcinogens suggests that carcinogen exposure may play a role in ocular sebaceous carcinoma. Patient SH, in whom a sebaceous carcinoma developed at only 32 years of age, was employed as a beautician for 14 years. It is plausible that the increased incidence of sebaceous carcinoma in women compared to men may be because of exposure to a carcinogen that women are more likely to be exposed to than men. Further studies are needed to evaluate this possibility. The current study may provide a model to explain the known tendency for sebaceous carcinoma to present as multifocal disease.‘s3”’ The incidence of multifocal disease in sebaceous carcinoma may be as high as 30%.’ In such cases, the intraepithelial neoplasia could involve a large region of conjunctival epithelium, as was seen for patient YF in the current study, or in cases of others.“.‘4 Eventually, perhaps requiring years, the dysplastic epithelium obtains a ~5’3 mutation, reducing its ability to guard against further genetic damage. This could occur at separate sites on the dysplastic conjunctiva, leading to separate foci of invasive disease. Such a field cancerization is thought to underlie common skin cancers.6”62 Acknowledgments. The authors thank Dr. Philip H. Cooper for helpful discussion, and the patients and their referring physicians, Dr. William Mears, Dr. Ashley Schauer, Dr. MacIlwaine, and Dr. William Massie, for their participation.

References 1. Jakobiec FA. Sebaceous tumors of the ocular adnexa. In: Albert DM, Jakobiec FA, eds. Principles and Practice of Ophthalmology: Clinical Practice. Philadelphia: WB Saunders, 1994;3:chap. 156. 2. Drummond JT, Li GM, Longley MJ, Modrich P. Isolation of an hMSHZp160 heterodimer that restores DNA mismatch repair to tumor cells. Science 1995;268: 1909- 12. 3. Doxanas MT, Green WR. Sebaceous gland carcinoma. Review of 40 cases. Arch Ophthalmol 1984; 102:245-9. 4. Hendley RL, Rieser JC, Cavanagh HD, et al. Primary radiation therapy for Meibomian gland carcinoma. Am J Ophthalmol 1979; 87:206-9. 5. Nunery WR, Welsh MG, McCord CD Jr. Recurrence of sebaceous carcinoma of the eyelid after radiation therapy. Am J Ophthalmol 1983; 96:10-5. 6. Kass LG, Hornblass A. Sebaceous carcinoma of the ocular adnexa. Surv Ophthalmol 1989;33:477-90.

7. RaoNA, Hidayat AA, McLean IW, ZimmermanLE. Seba-

ceouscarcinomasof the ocular adnexa:a clinicopathologic study of 104 cases,with five-year follow-up data. Hum Path011982;13:113-22. 8. Fujimoto Y, HamptonLL, SnyderwineEG, et al. ~53 gene mutationin hepatocellularcarcinomainducedby 2-amino3-methylimidazo[4,5-flquinoline in nonhumanprimates. Jpn J CancerRes1994;85:506-9. 9. Ni C, Sear1SS, Kuo PK, et al. Sebaceous cell carcinomas of the ocular adnexa.Int OphthalmolClin 1982:22:23-61. 10. CavanaghHD, GreenWR, GoldbergHK. Multicentric sebaceousadenocarcinoma of the Meibomian gland. Am J Ophthalmol1974;77:326-32. 11. Margo CE, GrossniklausHE. Intraepithelialsebaceous neoplasiawithout underlying invasive carcinoma.Surv Ophthalmol 1995;39:293-301. 12. Loeffler KU, PerlmanJI. Diffuse intraepithelialsebaceous carcinomaof the conjunctiva [letter]. Br J Ophthalmol 1997;81:168. carcinomasof the ex13. NilssonA. Radiostrontium-induced ternal ear. Acta Radio1Ther Phys Biol 1971;lo:321-8. 14. Margo CE, LessnerA, Stern GA. Intraepithelialsebaceous carcinomaof the conjunctiva and skin of the eyelid. Ophthalmology 1992;99:227-31. 15. LemosLB, SantaCruz DJ, Baba N. Sebaceous carcinoma of the eyelid following radiationtherapy.Am J SurgPath01 1978;2:305-11. 16. SchlernitzauerDA, Font RL. Sebaceousgland carcinoma of the eyelid. Arch Ophthalmol 1976;94:1523-5. 17. Kahn G. Diseasesof the skin of the newborn.Mod Probl Paediatr 1975;17:95-100. 18. Schwartz RA, Torre DP. The Muir-Torre syndrome:a 25year retrospect.J Am Acad Dermatol 1995;33:90-104. 19. Kolodner RD, Hall NR, Lipford J, et al. Structure of the humanMSH2 locus and analysisof two Muir-Torre kindreds for msh2 mutations[publishederratum appearsin Genomics1995;28:613]Genomics1994;24:516-26. 20. ReitmairAH, RedstonM, Cai JC, et al. Spontaneous intestinal carcinomasandskinneoplasms in Msh2-deficientmice. CancerRes 1996;56:3842-9. 21. HasebeT, Mukai K, YamaguchiN, et al. Prognosticvalue of immunohistochemical stainingfor proliferating cell nuclear antigen,~53, andc-erbB-2 in sebaceous gland carcinomaand sweatgland carcinoma:comparisonwith histopathologicalparameter.Mod Path011994;7:37-43. 22. Lane DP. Cancer. ~53, guardianof the genome.Nature 1992;358:15-6. 23. Levine AJ. ~53, the cellular gatekeeperfor growth and division, Cell 1997;88:323-31. 24. Kuerbitz SJ, Plunkett BS, Walsh WV, KastanMB. Wildtype ~53 is a cell cycle checkpointdeterminantfollowing irradiation, Proc Nat1Acad Sci U S A 1992;89:7491-5. 25. LiebermannDA, HoffmanB, SteinmanRA. Molecularcontrols of growth arrest and apoptosis:p53-dependentand independentpathways.Oncogene1995;11:199-210. 26. White E. Life, death,and the pursuit of apoptosis.Genes Dev 1996;10:1-15. 27. Wyllie AH. Apoptosis. Death gets a brake. Nature 1994;369:272-3. 28. GartelAL, SerfasMS, Tyner AL. P-21-negative regulator of the cell cycle. Proc Sot Exp Biol Med 1996;213:13849. 29. JacksonPK, ChevalierS, PhilippeM, KirschnerMW. Early

eventsin DNA replicationrequirecyclin E andareblocked by p21CIPl. J Cell Biol 1995;130:755-69. 30. Greenblatt MS, Bennett WP, Hollstein M, Harris CC. Mutations in the ~53 tumor suppressorgene: clues to

50.5

Ophthalmology

31.

32.

33.

34. 35.

36.

37.

38. 39. 40. 41.

42.

43.

44. 45. 46.

Volume

cancer etiology and molecular pathogenesis. Cancer Res 1994;54:4855-78, Stoler MH. In situ hybridization. In: Gorstein F, Thor A, eds. Clinics in Laboratory Medicine: Tumor Markers in Diagnostic Pathology. New York: WB Saunders, 1990;215-36. Angerer LM, Stoler MH, Angerer RC. In situ hybridization with RNA probes-an annotated recipe. In: Valentino KL, Eberwine JH, Barchas JD, eds. In Situ Hybridization: Applications to Neurobiology. New York: Oxford University Press, 1987;42-70. Gaffey MJ, Frierson HF, Weiss LM, et al. Human papillomavirus and Epstein-Barr virus in sinonasal Schneiderian papillomas. An in situ hybridization and polymerase chain reaction study. Am J Clin Path01 1996; 106:475-82. Chomczynski P. A reagent for the single-step simultaneous isolation of RNA, DNA and proteins from cell and tissue samples. Biotechniques 1993; 15:532-4. Leren TP, Rodningen OK, Rosby 0, et al. Screening for point mutations by semi-automated DNA sequencing using sequenase and magnetic beads. Biotechniques 1993; 14:618-23. Tron VA, Tang L, Yong WP, Trotter MJ. Differentiationassociated overexpression of the cyclin-dependent kinase inhibitor p21 waf-1 in human cutaneous squamous cell carcinoma. Am J Path01 1996; 149:1139-46. Russell WG, Page DL, Hough AJ, Rogers LW. Sebaceous carcinoma of Meibomian gland origin. The diagnostic importance of pagetoid spread of neoplastic cells. Am J Clin Path01 1980;73:504-11. Wolfe JT III, Yeatts RP, Wick MR, et al. Sebaceous carcinoma of the eyelid. Errors in clinical and pathologic diagnosis. Am J Surg Path01 1984;8:597-606. Hood IC, Qizilbash AH, Salama SS, et al. Needle aspiration cytology of sebaceous carcinoma. Acta Cytol 1984; 28:305-12. Staler MH. Tissue in situ hybridization. In: Henry JB, ed. Clinical Diagnosis and Management by Laboratory Methods, 19th ed. Philadelphia: Saunders, 1996; 1400-12. Stoler MH. The biology of human papillovmaviruses and their role in cervical carcinogenesis. In: Bonfiglio TA, ed. Cytopathology of the Female Genital Tract. Philadelphia: Lippincott-Raven, 1996. Ting Y, Manos MM. Detection and typing of genital human papilloma viruses. In: Innis MA, Gelfand DH, Sninsky JJ, eds. PCR Protocols: A Guide to Methods and Applications. San Diego: Academic Press, 1990;356-67. Hayashi N, Furihata M, Ohtsuki Y, Ueno H. Search for accumulation of p53 protein and detection of human papillomavirus genomes in sebaceous gland carcinoma of the eyelid. Virchows Arch 1994;424:503-9. Ni C, Guo BK. Pathologic classification of Meibomian gland carcinomas of eyelids: clinical and pathologic study of 156 cases. Chin Med J (Engl) 1979;92:671-6. Abe M, Ohnishi Y, Hara Y, et al. Malignant tumor of the eyelid-clinical survey during 22-year period. Jpn J Ophthalmol 1983;27:175-84. Allred DC, O’Connell P, Fuqua SA, Osborne CK. Immuno-

506

105, Number 3, March 1998

47.

48.

49.

50.

51.

52. 53. 54. 55.

56.

57, 58. 59 60. 61.

62.

histochemical studies of early breast cancer evolution. Breast Cancer Res Treat 1994;32:13-8. Elledge RM, Fuqua SA, Clark GM, et al. William L. McGuire Memorial Symposium. The role and prognostic significance of p53 gene alterations in breast cancer. Breast Cancer Res Treat 1993;27:95-102. Hinds PW, Finlay CA, Quartin RS, et al. Mutant p53 DNA clones from human colon carcinomas cooperate with ras in transforming primary rat cells: a comparison of the “hot spot” mutant phenotypes. Cell Growth Differ 1990; 1:57180. Gao H, Wang LD, Zhou Q, et al. p53 tumor suppressor gene mutation in early esophageal precancerous lesions and carcinoma among high-risk populations in Henan, China. Cancer Res 1994;54:4342-6. Ren ZP, Ponten F, Nister M, Ponten J. Two distinct p53 immunohistochemical patterns in human squamous-cell skin cancer, precursors and normal epidermis. Int J Cancer 1996;69:174-9. Schenkman NS, Sesterhenn IA, Washington L, et al. Increased p53 protein does not correlate to p53 gene mutations in microdissected human testicular germ cell tumors. J Urol 1995; 154(2 Pt 1):617-21. Cho Y, Gorina S, Jeffrey PD, Pavletich NP. Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations. Science 1994;265:346-55. Rodriguez-Tome P, Stoehr PJ, Cameron GN, Flares TP. The European Bioinformatics Institute (EBI) databases. Nucleic Acids Res 1996;24:6-12. Gorina S, Pavletich NP. Structure of the p53 tumor suppressor bound to the ankyrin and SH3 domains of 53BP2. Science 1996;274:1001-5. Mazur M, Glickman BW. Sequence specificity of mutations induced by benzo[a]pyrene-7,8-diol-9,10-epoxide at endogenous aprt gene in CHO cells. Somat Cell Mol Genet 1988; 14:393-400. Ruggeri B, DiRado M, Zhang SY, et al. Benzo[a]pyreneinduced murine skin tumors exhibit frequent and characteristic G to T mutations in the p53 gene. Proc Nat1 Acad Sci U S A 1993;90:1013-7. Hsu IC, Tokiwa T, Bennett W, et al. p53 gene mutation and integrated hepatitis B viral DNA sequences in human liver cancer cell lines. Carcinogenesis 1993; 14:987-92. Miller CW, Simon K, As10 A, et al. p53 mutations in human lung tumors. Cancer Res 1992;52:1695-8. Suzuki H, Takahashi T, Kuroishi T, et al. p53 mutations in non-small cell lung cancer in Japan: association between mutations and smoking. Cancer Res 1992;52:734-6. Prioleau PG, Santa Cruz DJ. Sebaceous gland neoplasia. J Cutan Path01 1984; 11:396-414. Kanjilal S, Strom SS, Clayman GL, et al. p53 mutations in nonmelanoma skin cancer of the head and neck: molecular evidence for field cancerization. Cancer Res 1995; 55:3604-9. Ren ZP, Hedrum A, Ponten F, et al. Human epidermal cancer and accompanying precursors have identical p53 mutations different from p53 mutations in adjacent areas of clonally expanded non-neoplastic keratinocytes. Oncogene 1996; 12:765-73.