Seed polyamines metabolism induced by seed priming with spermidine and 5-aminolevulinic acid for chilling tolerance improvement in rice (Oryza sativa L.) seedlings

Environmental and Experimental Botany 137 (2017) 58–72

Contents lists available at ScienceDirect

Environmental and Experimental Botany journal homepage: www.elsevier.com/locate/envexpbot

Seed polyamines metabolism induced by seed priming with spermidine and 5-aminolevulinic acid for chilling tolerance improvement in rice (Oryza sativa L.) seedlings Mohamed Sheteiwya,b , Hangqi Shena , Jungui Xua , Yajing Guana,* , Wenjian Songa , Jin Hua,* a b

Seed Science Center, College of Agriculture and Biotechnology, Zhejiang University, Hangzhou 310058, China Department of Agronomy, Faculty of Agriculture, Mansoura University, Mansoura 35516, Egypt

A R T I C L E I N F O

Article history: Received 14 November 2016 Received in revised form 19 January 2017 Accepted 3 February 2017 Available online 6 February 2017 Keywords: Chilling stress Oryza sativa Polyamines Gene expression Antioxidant enzymes ALA Spd Priming

A B S T R A C T

Polyamines (PAs) have been demonstrated to be involved in plant in response to abiotic stresses including chilling stress. The present study was designed to investigate the effects of seed priming with 5 mM of spermidine (Spd) and 8.5 mM of 5-Aminolevulinic acid (ALA) on seed polyamines metabolism associated with the improvement of chilling tolerance in two rice cultivars, Zhu Liang You 06 (ZY) and Qian You No.1 (QY). Germination percentage, seedling growth and seedling vigor index was decreased under chilling stress, but this physiological parameters was improved by Spd and ALA priming in both studied cultivars as compared with unprimed seeds. As well, total phenolics, flavonoids and glycine-betaine were improved by priming treatment. Contrarily, significant decrease of a-amylase activity, soluble sugars and soluble protein contents of both cultivars was observed in chilling stressed plants as compared with normal growth condition (25
C). However, priming with Spd and ALA significantly increased a-amylase activity, soluble sugars and soluble protein contents with more prominent increase in QY cultivar. Results showed that chilling stress significantly improved superoxide dismutase (SOD), peroxidase (POD), ascorbate peroxidase (APX) and glutathione peroxidase (GPX), and further enhancement was observed by Spd and ALA-primed seeds. Spd and putrescine (Put) were decreased under chilling stress, while a reverse tendency was observed in case of spermine (Spm) content. The enzymes involved in the PAs biosynthesis, arginine decarboxylase (ADC), ornithine decarboxylase (ODC) and S-adenosylmethionine decarboxylase (SAMDC) was improved by priming treatment. The relative expressions of genes encoding enzymes involved in PAs biosynthesis increased by Spd and ALA priming. Additionally, priming treatment improved leaf cell and grain structure as compared with the unprimed seeds. © 2017 Elsevier B.V. All rights reserved.

1. Introduction Chilling stress is one of the most abiotic stresses limiting the productivity, distribution, and the quality of many important strategy crops including rice. Most of the rice cultivars are extremely sensitive to chilling stress during emergence and early seedling development stages (Hussain et al., 2016). It is grown under wide range of environments covering approximately 11% of world arable lands (Seck et al., 2012). The kinetics of many physiological and metabolic processes of plants can be repressed by chilling stress (Ruelland et al., 2009). Earlier studies have

* Corresponding authors. E-mail addresses: [email protected] (Y. Guan), [email protected] (J. Hu). http://dx.doi.org/10.1016/j.envexpbot.2017.02.007 0098-8472/© 2017 Elsevier B.V. All rights reserved.

reported that chilling stress severely inhibited the germination percentage, seed vigor, and can also delay the seedling growth stages (Cheng et al., 2007; Kang and Saltveit, 2002). Seed priming is a technique that improves seed performance by uniform and rapid germination with vigorous and normal seedlings. PAs, particularly Put, Spd and Spm, are aliphatic amines with low-molecular-weight involved in various physiological and biochemical processes related to the regulation of plant growth and development under different abiotic stresses (Roychoudhury et al., 2011). Put can be synthesized directly by decarboxylation of ornithine (catalyzed by ODC), or indirectly by decarboxylation of arginine (catalyzed by ADC) via agmatine and N-carbamoylputrescine intermediates. Whereas, Spd and Spm are synthesized directly from Put by successive addition of aminopropyl groups from decarboxylated S-adenosylmethionine that is derived from

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

S-adenosylmethionine (SAM) by the action of SAMDC (Duan et al., 2008). Recent studies have focused on the involvement of PAs in the defense reaction of plants to various environmental stresses (Bouchereau et al., 1999). Some studies have shown the beneficial effects of priming with PAs on seed germination percentage, seed vigor, seedling growth and development of wheat (Farooq et al., 2011), sunflower (Farooq et al., 2007), rice (Farooq et al., 2008) and tomato (Afzal et al., 2009). Recently, several studies reported that priming with Spd successfully alleviated various abiotic stresses, and protected cell structure of the plants against salinity (Shu et al., 2012), heat (Mostofa et al., 2014) and chilling (Yamamoto et al., 2012) stresses. Furthermore, it has been suggested that priming with Spd plays an important role for improvements of stress tolerance of plants (Kasukabe et al., 2004). Previous studies have reported the beneficial effects of seed priming under chilling stress in different crops. In this regard, Xu et al. (2011) found that chilling tolerance of tobacco seed was improved by priming treatment during seed germination and seedling growth by activation of antioxidant system in the plant tissues during chilling stress. Likewise, Guan et al. (2009) observed that seed germination and seedling growth of maize were enhanced by seed priming under chilling stress. Earlier study demonstrated that exogenous Spd protected rice seedlings from chilling-induced injuries in terms of lower MDA and proline levels, as well as significant increase in SOD, POD, CAT and APX activities coupled with increased endogenous hormones metabolism was observed in Spd-primed plants (Zeng et al., 2016). Furthermore, Spd pretreatment enhanced chloroplast of rice seedlings under chilling stress as compared with untreated plants (Zeng et al., 2016). Similarly, it has reported that seeds primed with salicylic acid solutions produced a higher root and shoot length, final emergence percentage, and relative water content and ultimately induced higher antioxidant activity under chilling stress as compared with untreated seeds (Pouramir-Dashtmian et al., 2014). Our previous study reported that Spd treatment significantly improved seed germination as well as enhanced seed vigor which was indicated by higher germination index, vigor index, shoot heights and dry weights of shoot and root of sweet corn compared with the untreated seeds (Huang et al., 2017). Moreover, exogenous application of Spd significantly increased endogenous Spd content, gibberellins and ethylene contents and simultaneously reduced ABA concentration in embryos of sweet corn during seed imbibition (Huang et al., 2017). Exogenous applications of ALA have been found to regulate plant growth and development and to enhance chlorophyll biosynthesis and photosynthesis resulting in increasing of seed germination and crop yield (Hotta et al., 1997). It has been stated that treating rice, barley, potato and garlic plants at early growth stages with ALA promoted plant growth and photosynthetic rates resulting in significant increase of crop yield (Tanaka et al., 1992). Furthermore, ALA at low concentrations enhanced the tolerance of plant to chilling (Wang et al., 2004) and salinity stresses (Nishihara et al., 2003). It is also observed that ALA at low concentration regulated the physiological processes associated with plant growth under abiotic stresses, including low temperature (Zhang et al., 2012), salinity (Naeem et al., 2012), drought (Li et al., 2011) and heavy metals (Ali et al., 2013) stresses. Moreover, further studies are required to elucidate the mechanism underlying regulation of specific PAs reactions by Spd and ALA priming to increase the tolerance of crop seeds to low temperature stress. Therefore, the present study provides an interesting findings regarding Spd and ALA priming-induced tolerance to chilling stress in Oryza sativa seedlings. The present study aimed to elucidate the mechanism of Spd and ALA priming to regulate PAs metabolism at physiological levels under chilling stress for improving rice seed chilling-tolerance. In

59

addition, this study also investigated the biochemical changes in rice seed induced by seed priming with Spd and ALA in response to chilling stress. The regulation of PAs metabolism at the transcription level during exposure to chilling stress was analyzed for genes encoding enzymes involved in biosynthesis of PAs to obtain a better understanding of priming-induced mechanisms for enhancements the chilling tolerance and to provide insights for further analyses. 2. Materials and methods 2.1. Seed materials and priming treatments The seeds of ZY and QY cultivars used in this study were obtained from the Seed Science Center of Zhejiang University. Seeds were surface sterilized according to the method of Sheteiwy et al. (2015). Thereafter, one part of sterilized seeds was primed with Spd (5 mM) and ALA (8.5 mM) according to the method of Sheteiwy et al. (2015). Thereafter, the primed seeds were dried at room temperature for 24 h until they reach their original moisture content. Another part of sterilized seeds without both ALA and Spd priming was used as control (Ck) treatment. The primed and unprimed seeds were stored at room temperature for 24 h prior to germination or analyses. 2.2. Seed germination and seedling growth measurements After priming treatment, the germination tests and seedlings characters measurements were conducted according to the method of Hu et al. (2016). Three replicates for each treatment, and fifty seeds for each replicate were germinated in covered germination box (12  18  6 cm) containing 3 layers of moistened filter paper and placed in germination chambers under a diurnal cycle of 8 h of light at 30
C, and 16 h of darkness at 20
C for 14 days (Hu et al., 2016). The number of germinated seeds was recorded after 14 days and the final percentage of seed germination was calculated (ISTA, 2004). The length of shoots and roots of randomly selected ten seedlings for each treatment were manually measured. The seedling fresh weights of ten seedlings for each treatment were immediately weighed after harvesting, and used for dry weights measurement. Seedling vigor index was calculated according to the method of Sheteiwy et al. (2016). For estimation of total phenolics, a-amylase activity, PAs contents, enzymes involved in PAs biosynthesis and their related genes expression in rice seeds, the seeds were imbibed with Spd and ALA in three replications and exposed to chilling stress for only 7 days, thereafter the seeds were separated from the seedlings and stored at 80
C for their respective analysis. 2.3. Analysis of total phenolics content and a-amylase activity The content of total phenolic was determined using the FolinCiocalteu method as described by Shohag et al. (2012) with slight modification. The total phenolics were quantified by external calibration using gallic acid (Sigma-Aldrich) as a standard. The seeds samples (0.5 g) were independently analyzed in triplicate. For the a-amylase activity measurement, seeds after imbibition in Spd and ALA for 7 days were frozen in liquid nitrogen and then stored at 80
C. The seed sample (0.5 g) were then hulled and ground into fine powder, followed by fine homogenization with 10 mL distilled water, after which the mixtures were centrifuged at 5000  g for 10 min. Supernatant was collected in 10 mL-centrifuge tube for chromogenic reaction. The enzyme activity was measured by 3, 5-dinitrosalicylic acid colorimetric method as described by Sheteiwy et al. (2016).

60

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

2.4. Determination of flavonoids, glycine-beatine, soluble sugars and soluble protein The flavonoid content of the leaf was determined according to Zhishen et al. (1999). Glycine-betaine estimation was measured in dried powder of leaf according to Greive and Grattan (1983). Total soluble protein contents of the shoots were determined using the method of Bradford (1976). Total soluble sugar contents of the leaf were determined according to the method of Sheteiwy et al. (2016) with slight modification. In brief, leaf sample (0.1 g) was added to a test tube with 10 mL of 70% ethanol and stored at 4
C for a week for soluble sugars extraction. Then, 0.5 mL of the solution was diluted by adding 1.5 mL distilled water. Thereafter, 1 mL of phenol (5%) and 5 mL of concentrated sulfuric acid was added. The absorbance was spectrophotometer tested at 485 nm, and the concentration of glucose was calculated using a standard curve. 2.5. Determination of antioxidant enzyme activities For antioxidant enzymes activities measurements, the leaf samples were prepared according to our previous study (Sheteiwy et al., 2015) and used for antioxidant enzymes activities determination. SOD activity was determined according to the method of Zhang et al. (2008). One unit of SOD activity was measured as the amount of enzyme required to cause 50% inhibition of the NBT reduction measured at 560 nm. POD activity was measured as described by Zhang (1992). APX activity was measured in a reaction mixture of 3 mL containing 100 mM phosphate (pH 7), 0.1 mM EDTA-Na2, 0.3 mM ascorbic acid, 0.06 mM H2O2 and 0.1 mL enzyme extract. The change in absorption was taken at 290 nm for 30 s after addition of H2O2 (Nakano and Asada, 1981). GPX activity was determined according to Chen et al. (2010). 2.6. Polyamine analysis Concentrations of PAs were measured according to the method of Gao et al. (2009) with slight modification. Briefly, fresh seed samples (0.1 g) with 7 days treatments was homogenized with 1 mL of 5% (w/v) cold HClO4. Then the seeds were incubated in ice for 1 h, centrifuged at 23000  g for 30 min at 4
C and then the supernatant was stored at 80
C for PAs measurements. Thereafter, 10 mL of 2 M NaOH and 10 mL of benzoyl chloride were added to 0.5 mL of the obtained supernatant and the mixture

was then vortex-mixed and incubated in bath water at 37
C for 20 min. Then, 2 mL of saturated NaCl solution and 2 mL of diethyl ether were added to the mixture. Thereafter, the mixture was centrifuged at 1500  g for 5 min at 4
C. Then, 1 mL of the ether phase was obtained and allowed to evaporate with a warm airstream. The dried materials were dissolved in 100 mL methanol and its filtration through a 0.22 mm filter was subjected to reading on an HPLC, which included a 3.9  150 mm, 4 mm particle size reverse-phase (C18) column (Waters Nova-Pak) and a Waters 2487 dual l absorbance detector. The mobile phases consisted of methanol-water (64: 36, v/v) at a flow rate of 1 mL min1. Three PAs standard samples of Put, Spd and Spm were prepared at different concentrations for the development of standard curves. 2.7. Determination of the activity of enzymes involved in polyamines biosynthesis To determine the activity of the enzymes involved in PAs biosynthesis, grains samples (0.5 g) were ground into fine powder and homogenized with 3 mL of extraction buffer (pH 8.0) containing 25 mM potassium phosphate, 50 M EDTA, 100 M phenylmethylsulphonyl fluoride, 1 mM 2-mercaptoethanol, and 25 mM ascorbic acid (Lee et al., 1997). After centrifugation at 25000  g at 4
C for 20 min, the obtained supernatant was dialyzed overnight against the extraction buffer. The activities of ADC, ODC, and SAMDC were determined by measuring CO2 evolution according to the method of Lee et al. (1997). Spd synthase activity was measured according to the method of Kasukabe et al. (2004). The supernatant was incubated at 37
C for 30 min in a reaction mixture consisting of 0.1 M TRIS-HCl (pH 8.0), 30 M Put, 25 M decarboxylated SAM, and 20 M adenine. Then, the reaction solution was estimated by using HPLC (Waters 2695 Sparations Module) equipped with a fluorescence detector (Waters 2475 Multi l, USA) and a reverse-phase (C18) column (Waters). Proteins in the extract were measured following the method of Bradford (1976). 2.8. Polyamine degradative enzyme activity Polyamine oxidase (PAO) and Diamine oxidase (DAO) activity was determined according to the method of Xue et al. (2009) with slight modifications. Grains samples (0.5 g) were homogenized in 0.5 mL of 0.2 M phosphate buffer (pH 6.5) and centrifuged at 8000  g for 15 min at 4
C. The reaction mixture was initiated by

Table 1 Sequences of oligonucleotide primers used in QRT-PCR. Locus

Primer name

Primer orientation

Sequence (50 -30 )

AY604047.1

ADC1-F ADC1-R ADC2-F ADC2-R SAMDC-F SAMDC-R SAMDC1-F SAMDC1-R ODC-F ODC-R Spd synthase1-F Spd synthase1-R OsPAO3-F OsPAO3-R OsPAO4-F OsPAO4-R Actin-F Actin-R

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

CTCTGTCCTGGTGTTCGAGG AACGCCGTCCTTGAACTGAT ACCTGGTCTGCAATGGCTAC GTGCAGCTTCCCCATCTTCT TCTTGCTTATGGCGACCTGG AGCAACAGGTACGTCTTCGG TTGGCTGATTCTTGGGGCTC AGGCTCGACTCTGAAAGCAC CAGCTCAGACTTCAACGGGT ACCGAAATTTCCGACCCTGG GTACGGCAAGGTTCTTGTGC CGCAAAACACCACCATCTCC TGTCACATTGGGGCTCAGAC GAACCGCTCAAGAACCCTCA AGTTGCCCTCATGGAAGAGC CAGATCAACGGCCTCCTTGT GTGATGGTTGGTATGGGGCA CTCAGTCAGCAACACAGGGT

Os04g0107600 AF067194.1 Os09g0424300 AY772006.1 AJ251298.1 NM_001060458 NM_001060753 AY212324.1

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

61

the addition of 0.2 mL of 20 mM of Spd for the determination of degradative enzyme activity. The content of H2O2 in grains was measured by using the method of Brennan and Frenkel (1977).

analyzed using SPSS v16.0 (SPSS, Inc., Chicago, IL, USA). Analysis of variance (ANOVA) was carried out, followed by Duncan’s multiple range tests (p < 0.05).

2.9. Expression analysis of PAs biosynthesis genes

3. Results

The expression analysis of studied genes related with PAs biosynthesis was performed according to the methods of Sheteiwy et al. (2016) with little modifications. Frozen grains sample (200 mg) was ground thoroughly in liquid nitrogen using a mortar and pestle. Total RNA was isolated from the control plants and 10
C-stressed plants by using RNA isolation (Takara, Japan). The concentration of the RNA was determined by NanoDrop (Thermo Scientific, USA). The RNA purity was also checked spectrophotometry by means of the 260/280 nm ratio (Sheteiwy et al., 2015). cDNA was synthesized using Primer Script RT reagent Kit (Takara, Japan) from 1 mg of total RNA in a 20 mL reaction, and diluted 4-fold with water. Quantitative real-time PCR (RT-PCR) was performed according to the method of Sheteiwy et al. (2015) using SYBR premix EX Taq (Takara, Japan). The primers of studied genes used in real-time PCR (RT-PCR) are shown in Table 1.

3.1. Seed germination and seedling growth

2.10. Electron microscopy observation The ultrastructure changes of leaf cell mesophyll were detected as previously described by Sheteiwy et al. (2015). In order to observe the changes in seed embryo ultrastructures of rice with or without priming under chilling stress, scanning electron microscope (SEM) was performed according to the method of Wei et al. (2009) with a little modification. Seed samples (0.1 g) were dehulled by sonication in dehydrated alcohol for 5 min. Cross sections through the dehulled seeds were done using double-stick carpet tape and a sputter-coated to 30 nm thickness with a gold target in a vacuum-coating apparatus. Silver paint applied to the base of the seeds section prevented charging from its surface. The structure of the seed endosperm used for scanning electron microscopy (SEM, JEOL JSM-1300) was typically examined on the central endosperm of a transverse section at an accelerating voltage of 15 kV. Totally, 4–6 images were scanned for each sample for each treatment. 2.11. Statistical analysis Treatments were arranged in completely randomized design in factorial experiment. All values were the mean of three replicates  standard deviation. Percentage data were arcsine-transformed ^ = arcsin [sqr (x/100)]. The data were before analysis according to y

The results clearly reported that germination percentage of both studied cultivars was gradually decreased under chilling stress as compared to the normal growth condition. However, priming with Spd and ALA improved the germination percentage under chilling stress by (38.23% and 34.95%, respectively in ZY cultivar, and 11.28% and 8.33%, respectively in QY cultivar) and normal condition by (10.48% and 6.56%, respectively in ZY cultivar, and 10.06% and 5.63%, respectively in QY cultivar) as compared to those of unprimed seeds (Table 2). The results demonstrated that QY cultivar recorded the highest germination percentage under normal and chilling conditions as compared to ZY cultivar. Root and shoot length was significantly decreased under chilling stress in both cultivars as compared to normal growth condition. On the contrary, seed priming with Spd and ALA significantly improved the root and shoot length under chilling stress. As compared to the control plants, priming with Spd and ALA significantly increased the root length under chilling stress by (39.63% and 14.02%, respectively in ZY cultivar and 10.39% and 4.27%, respectively in QY cultivar) and normal condition by (29.30% and 17.61%, respectively in ZY cultivar, and 24.15% and 12.46%, respectively in QY cultivar) as compared with unprimed seeds. Similarly, shoot length was significantly increased by priming with Spd and ALA under chilling stress by (29.88% and 18.51%, respectively and 25.71% and 14.18%, respectively in QY cultivar) and normal condition by (29.51% and 17.71%, respectively in ZY cultivar, and 28.78% and 21.68%, respectively in QY cultivar) relative to unprimed seeds (Table 2). Significant enhancements in seedling fresh and dry weight were observed in both Spd and Ala-primed seeds under chilling stress of both cultivars as compared to unprimed seeds (Table 2). Seed primed with Spd and ALA increased seedling fresh weight under chilling stress by (15.77% and 19.93%, respectively in ZY cultivar and 27.91% and 23.09%, respectively in QY cultivar) and normal condition by (34.61% and 16.4%, respectively in ZY cultivar and 28.93% and 14.48%, respectively in QY cultivar) as compared to unprimed seeds. Similarly, seedling dry weight was increased in primed seed with Spd and ALA under chilling stress by (21.11% and 8.82%, respectively in ZY cultivar and 40.15% and 28.1%, respectively in QY cultivar) and normal condition by (47.25% and 27.33%, respectively, in ZY cultivar, and 51.28% and 39.58%, respectively in

Table 2 Effect of seed priming with Spd and ALA on germination percentage (GP, %), root and shoot length (cm), seedlings fresh weight (SFW, g/10 seedlings) and seedlings dry weight (SDW, g/10 seedlings) and seedlings vigor index (SVI) of two rice cultivars under chilling stress. Cultivars

Priming

Chilling

GP

Root length

Shoot length

SFW

SDW

SVI

ZY

Control (Ck)

25
C 10
C 25
C 10
C 25
C 10
C

85.33  1.15a-c 49.00  1.20d 95.33  1.15ab 79.33  1.15a-c 91.33  1.15a-c 75.33  1.15bc

8.70  0.45f 6.56  0.87h 12.26  0.55a 9.16  0.41d-f 10.56  0.25bc 7.63  0.41g

8.36  0.45de 6.16  0.90g 11.86  0.55a 8.76  0.49de 10.16  0.25bc 7.56  0.98ef

0.627  0.02e 0.510  0.01f 0.920  0.02a 0.727  0.02 cd 0.750  0.05bc 0.637  0.04e

0.327  0.02e 0.310  0.01e 0.620  0.02a 0.393  0.04 cd 0.450  0.05c 0.340  0.04de

1456  8.3f 890  5.3i 2299  5.9b 1422  5.68f 1893  9.4d 1145  7.5h

25
C 10
C 25
C 10
C 25
C 10
C

89.33  3.05a-c 73.33  1.02c 99.33  1.15a 82.66  3.05a-c 94.66  2.30ab 80.00  2.0a-c

9.83  0.41c-e 8.96  0.30ef 12.96  0.20a 10.06  0.20 cd 11.23  0.30b 9.36  0.90d-f

8.76  0.45de 6.73  0.96fg 12.30  0.60a 9.06  0.68 cd 10.66  0.25b 7.90  0.87d-f

0.673  0.02de 0.550  0.02f 0.947  0.01a 0.763  0.02bc 0.787  0.05b 0.677  0.04de

0.323  0.02e 0.307  0.01e 0.663  0.04a 0.513  0.05b 0.537  0.05b 0.427  0.04c

1586  3.3e 1097  4.2h 2409  10.1a 1452  8.2f 2000  3.7c 1300  8.3g

Spd ALA

QY

Control (Ck) Spd ALA

Each value represents the mean of three replications of each treatment. The same letters within a column indicate that there was no significant difference at a 95% probability level (p < 0.05).

62

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

QY cultivar) relative to unprimed seeds. In the current study, chilling stress had significantly reduced the seedling vigor index in both studied cultivars as compared to the normal growth condition (Table 2). Irrespective of chilling stress effects, seed primed with Spd and ALA significantly increased the seedling vigor index of both cultivars as compared to their relative controls with more prominent increase in ZY cultivar. 3.2. Total phenolics, flavonoids, glycine-beatine, a-amylase, soluble sugars, and soluble protein The present study revealed that total phenolics significantly affected by Spd and ALA priming in both studied cultivars under chilling stress (Fig. 1A). Priming with Spd and ALA improved the total phenolics under chilling stress by 38.52% and 14.77%, respectively in ZY cultivar, and by 29.45% and 16.26%, respectively in QY cultivar as compared to untreated seeds (Fig. 1A). Interestingly, higher content of total phenolics was observed with QY cultivar upon primed with Spd under chilling stress as compare with ZY cultivar. Flavonoids contents were significantly improved by priming treatment of both cultivars under both normal and chilling stress conditions as compared with unprimed seeds (Fig. 1B). Seeds primed with Spd and ALA improved the flavonoids

content under chilling stress by 39.39% and 14.77%, respectively in ZY cultivar and by 36.11% and 11.53%, respectively in QY cultivar relative to their unprimed seeds (Fig. 1B). Similarly, glycine-betaine content was significantly increased when seeds of both cultivars were primed with Spd and ALA as compared with unprimed seeds under both chilling and normal growth conditions, with more prominent increase in QY cultivar (Fig. 1C). It has observed from the revealed results that glycine-betaine content was increased by priming with Spd and ALA under chilling stress by 19.72% and 11.94%, respectively in ZY cultivar, and by 31.63% and 17.12%, respectively in QY cultivar as compared to untreated seeds. On the contrary, a-amylase activity, soluble sugars content and soluble protein content showed a reverse tendency in response to priming treatments and chilling stress condition (Fig. 1D–F). Chilling stress resulted in significant decrease of a-amylase activity, soluble sugars content and soluble protein content of both cultivars as compared with normal growth condition. Spd and ALA priming increased a-amylase activity (by 54.36% and 49.63%, respectively in ZY cultivar and by 50.48% and 27.49%, respectively in QY cultivar) and total soluble protein (by 54.36% and 49.63%, respectively in ZY cultivar and by 44.63% and 39.75%, respectively in QY cultivar) as compared with untreated seeds (Fig. 1C and D). Similarly total soluble sugars significantly improved by Spd and

Fig. 1. Effect of seed priming with Spd and ALA on total phenolic (A), flavonoids (B), glycine beatine (C), a-amylase (D), total soluble protein (E) and total soluble sugars (F) of two rice cultivars under chilling stress.

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

ALA priming under both normal and chilling stress as compared with unprimed seeds with more pronounced decrease in QY cultivar (Fig. 1F). 3.3. Antioxidant enzyme activities and lipid peroxidation The activity of antioxidant enzymes related to reactive oxygen species (ROS) scavenging significantly changed with different priming treatments (Table 3). Spd and ALA priming alleviates the chilling stress and significantly improved SOD, POD, APX and GPX as compared to unprimed seeds. It could be stated that Spd and ALA priming significantly increased SOD activity under chilling stress by 10.48% and 2.85%, respectively, in ZY cultivar and by 11.30% and 6.28%, respectively in QY cultivar as compared with those of unprimed seeds. Furthermore, priming treatment with Spd and ALA significantly improved the POD activity irrespective of chilling stress by 24.62% and 16.34%, respectively in ZY cultivar and by 20.37% and 15.96%, respectively in QY cultivar as compared with the unprimed seeds. Similarly, APX was significantly improved under chilling stress by 23.34% and 17.91%, respectively in ZY cultivar and by 19.86% and 14.28%, respectively in QY cultivar as compared with those of unprimed seeds (Table 3). Our results revealed that chilling stress significantly increased GPX activity in both cultivars as compared with the normal growth condition with further increased observed with Spd and ALA-primed seeds (Table 3). On contrast, MDA content was significantly increased under chilling stress, and this increase was diminished by Spd and ALA priming. Importantly, the priming treatment with Spd and ALA significantly decreased MDA content under chilling stress by 24.25% and 6.01%, respectively in ZY cultivar and by 26.67% and 6.68%, respectively in QY cultivar as compared with those of controls (Table 3). 3.4. Changes of polyamine contents The results showed that Spd and Put contents in the seeds significantly decreased under chilling stress in both cultivars, and significantly improved by Spd and ALA priming (Fig. 2A and C). Spd and ALA priming significantly increased the content of Spd under chilling stress by 42.93% and 33.22%, respectively in ZY cultivar and by 34.48% and 25.58%, respectively in QY cultivar relative to unprimed seeds. Priming with Spd and ALA resulted in significant increase of Put content under chilling stress by 38.15% and 31.28%, respectively in ZY cultivar and by 40.96% and 37.78%, respectively in QY cultivar relative to their respective controls (Fig. 2C). Conversely, Spm content significantly increased under chilling stress in both cultivars as compared with normal growth condition

63

(Fig. 2B). The results showed that priming treatment with Spd and ALA resulted in significant increase of Spm content under chilling stress by 54.85% and 39.58%, respectively in ZY cultivar and by 60.14% and 49.20%, respectively in QY cultivar relative to their respective control (Fig. 2B). PAs significantly decreased under chilling stress in both cultivars as compared with normal growth condition and significantly increased with Spd and ALA priming (Fig. 2D). 3.5. Changes of enzyme activities involved in polyamines biosynthesis Results revealed that ADC activity significantly decreased under chilling stress in both studied cultivars as compared with unstressed plants (Fig. 3A). However, priming with Spd and ALA significantly improved the activity of ADC in both studied cultivars as compared with unprimed seed. Priming with Spd and ALA resulted in significant increase of ADC activity under chilling stress by 42.4% and 30.99%, respectively in ZY cultivar and by 37.75% and 25.13%, respectively in QY cultivar relative to unprimed seeds (Fig. 3A). Similarly, chilling stress induced significant decrease in the activity of ODC as compared with normal condition (Fig. 3B). Our results showed that Spd and ALA priming increased ODC activity under chilling stress by 28.01% and 12.56%, respectively in ZY cultivar and by 30.31% and 18.69%, respectively in QY cultivar as compared with unprimed seeds (Fig. 3B). SAMDC activity significantly decreased in both studied cultivars under chilling stress (Fig. 3C). Importantly, Spd and ALA priming significantly improved the activity of SAMDC under chilling stress by 22.8% and 13.08%, respectively in ZY cultivar and by 20.03% and 10.66%, respectively in QY cultivar as compared with unprimed seeds. Spd synthase activity was significantly decreased in response to chilling stress (Fig. 3D). Spd and ALA priming significantly improved the activity of SAMDC under chilling stress by 22.57% and 12.20%, respectively in ZY cultivar and by 26.06% and 15.21%, respectively in QY cultivars as compared with unprimed seeds. Interestingly, Spd priming recorded highest activities of ADC, ODC, SAMDC and Spd synthase as compared with ALA priming and control plants. 3.6. Changes of polyamine degradative enzyme activity In the present study, chilling stress caused a significant increase in PAO activity of both cultivars without significant differences between them (Fig. 3E). The results depicted that there was no significant change in PAO activity except for ALA-primed seeds in both cultivar. Priming with Spd and ALA decreased PAO activity of both cultivars as compared with control treatment. Spd and ALA

Table 3 Effect of seed priming with Spd and ALA on SOD (U mg1 protein), POD (mmol min1 mg1 protein), APX (mmol min1 mg1 protein), GPX (mmol min1 mg1 protein) activities and MDA (mmol mg1 protein) content of two rice cultivars under chilling stress. Cultivars

Priming

Chilling

SOD

POD

APX

GPX

MDA

ZY

Control (Ck)

25
C 10
C 25
C 10
C 25
C 10
C

444.4  58.19j 1295.2  38.09f 1041.6  95.87h 1447.6  76.19e 850.7  95.87i 1333.3  38.09f

2.07  0.11h 2.20  0.04g 2.75  0.03d 2.86  0.02c 2.42  0.06f 2.63  0.09e

1.77  0.4h 1.97  0.01g 2.26  0.01e 2.57  0.01c 2.11  0.03f 2.40  0.04d

0.121  0.002f 0.260  0.05e 0.343  0.01 cd 0.500  0.05b 0.240  0.03e 0.390  0.02c

11.31  0.70d 15.13  1.21a 8.41  0.52f 11.46  0.45d 9.78  0.52e 14.22  0.45ab

25
C 10
C 25
C 10
C 25
C 10
C

1181.0  38.09g 1892.1  21.99c 1561.9  38.09d 2133.3  38.09a 1333.3  38.09f 2019.0  65.98b

2.38  0.04f 2.58  0.09e 3.03  0.05b 3.24  0.02a 2.82  0.04 cd 3.07  0.01b

2.10  0.03f 2.34  0.09d 2.61  0.01c 2.92  0.01a 2.42  0.03d 2.73  0.08b

0.230  0.01e 0.363  0.01 cd 0.446  0.02b 0.606  0.04a 0.323  0.02d 0.446  0.01b

9.94  0.70e 13.76  1.21bc 7.03  0.52g 10.09  0.45e 8.41  0.52f 12.84  0.45c

Spd ALA

QY

Control (Ck) Spd ALA

Each value represents the mean of three replications of each treatment. The same letters within a column indicate that there was no significant difference at a 95% probability level (p < 0.05).

64

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

Fig. 2. Effect of seed priming with Spd and ALA on Spd (A), Spm (B), Put (C) and PAs (D) of two rice cultivars under chilling stress.

priming decreased PAO activity under chilling stress by 8% and 19.42%, respectively in both cultivars. The results reported that DAO activity decreased in response to chilling stress as compared to normal condition. Primed seeds with ALA and Spd have decreased DAO activity under chilling stress by 35.84% and 45.19%, respectively in ZY cultivar and by 7.90% and 18.56%, respectively in QY cultivar relative to their respective controls (Fig. 3F). 3.7. Expression levels of PAs biosynthesis genes In order to elucidate the molecular basis for changes in the studied polyamine biosynthesis in response to chilling stress, the expression levels of genes encoding enzymes involved in polyamine biosynthesis were analyzed. The results depicted in Fig. 4 revealed that ADC1 and ADC2 down-regulated under chilling stress as compared with normal condition. However, Spd and ALAprimed seeds resulted in increase of ADC1 and ADC2 of both cultivars under chilling stress as compared with unprimed seeds, with more prominent increase in QY cultivar (Fig. 4A and B). The decrease of the expression levels of polyamines biosynthesis genes under chilling stress are consistent with the results obtained by HPLC regarding to the enzymes encoding polyamines biosynthesis (Fig. 3A). Similarly, the expression level of SMADC, SAMDC1, ODC and Spd synthase was decreased under chilling stress in both cultivars with more prominent decrease in QY for SAMDC and Spd synthase, and ZY for SAMDC1 and ODC (Fig. 4C–F). Spd and ALAprimed seeds resulted in increase of SAMDC, SAMDC1, ODC and Spd synthase as compared to unprimed seeds in both studied cultivars. Interestingly, the relative transcript level of OsPAO3 and OsPAO4 was increased under chilling stress as compared to the normal condition (Fig. G and H). Priming with Spd and ALA increased the relative expression of OsPAO3 and OsPAO4 genes as compared to

the control treatment, with more prominent decrease in QY cultivar, despite the PAO content was decreased in response to the priming treatments reflecting the feedback regulation of gene expression-induced by priming to protect the plant cell and meet the metabolic demand for plant under abiotic stress. Changes in the expression levels of PAs biosynthesis genes, ADC1, ADC2, SAMDC, SAMDC1, ODC and Spd synthase1 were consistent with those in the activities of ADC, SAMDC, ODC and Spd synthase (Fig. 3A–D), indicating that these genes regulate PAs biosynthesis and respond chilling stress at the transcriptional level. 3.8. Ultrastructural of leaf mesophyll cell The present study depicted that seed priming with Spd and ALA improved the leaf mesophyll structure under normal growth condition. However, injuries became obvious in both studied cultivars under chilling stress irrespective of priming treatments (Fig. 5). Transmission electron microscopy (TEM) of the unprimed seed of ZY cultivar under normal condition showed clear and thin cell walls, developed thylakoid and the cell has normal starch grain (Fig. 5A). TEM analysis of the Spd-primed seeds of ZY cultivar under normal condition show clean and thin cell walls, properly well-developed chloroplasts having well-arranged thylakoids along with normal starch grain and plastoglobuli were observed and the cell with rich contents and normal organelles. Moreover, the cytoplasm contained well-developed nucleus with roundish nucleoli and intact nuclear membrane was also observed. Furthermore, rough ribosome was not swollen and had rich ribosomes (Fig. 5B). Similarly, leaf mesophyll of ZY cultivar primed with ALA and grown under normal condition show clear cell wall, well-developed chloroplast with a tidy thylakoids and plastoglobuli (Fig. 5C). TEM analysis of leaf chloroplast of unprimed seed of

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

65

Fig. 3. Effect of seed priming with Spd and ALA on the activities of ADC (A), ODC (B), SAMDC (C), Spd synthase (D), PAO (E) and DAO (F) of two rice cultivars under chilling stress.

ZY cultivar under chilling stress show unclear cell wall, a lot of vacuoles and starch granule, the large number of vacuoles indicates that the plants undergone chilling stress (Fig. 5D). However, priming with both Spd and ALA somewhat improved the leaf mesophyll structure under chilling stress (Fig. 5E and F). TEM analysis for unprimed seeds of QY cultivar under normal condition show clear cell wall and plastoglobuli and the other cell organelles was not observed as compared to ZY cultivar (Fig. 5G). However, priming with Spd resulted in clear cell wall developed chloroplast with tidy and well-arranged thylakoid and the plastoglobuli were also observed, but the rough ribosome was swollen and had few ribosomes as compared with QY cultivar (Fig. 5H). Similarly, seeds primed with ALA of QY cultivar show clear cell wall, developed chloroplast with a tidy thylakoid and the plastoglobuli (Fig. 5I). Under chilling stress, the TEM analysis revealed that more damage in both primed and unprimed seeds of QY cultivar and the most of the cell organelles could not observed as compared with the normal condition (Fig. 5J–L). 3.9. Scanning electron microscopy observations in rice seed Under normal condition, the unprimed seed of ZY show protein bodies, starch grain (Fig. 6A). For ZY seeds primed with Spd and ALA resulted in increase of protein bodies as compared to the unprimed seed (Fig. 6B and C). A high concentration of protein bodies at the periphery was observed with Spd-primed seeds reducing the damage to the seeds as compared with unprimed seeds (Fig. 6B). Seeds primed with Spd and ALA had large protein

bodies embedded compound starch granules. Under chilling stress, both primed and unprimed seeds of ZY cultivar with Spd and ALA showed little change in size for starch granules and were enriched with protein deposits (Fig. 6D–E). The SEM analysis of the unprimed seed of QY cultivar under normal condition showed starch grain and protein deposits as well as protein matrix (Fig. 6G). Notwithstanding, Spd and ALA priming improved the grain structure and showed a large protein bodies embedded compound starch granules (Fig. 6H and I). On the contrary, chilling stress resulted in smaller starch granules as compared to the normal condition (Fig. 6J–L). 4. Discussion Chilling stress had adverse effects on crop growth and development, resulting in reduction of grain quality and yield (Yamamoto et al., 2012). Chilling stress can induce physiological and biochemical changes in plant tissues. In the present study, germination, vigor index and seedlings paramaters was improved by Spd and ALA priming under chilling stress, this might be due to the involvement of Spd in the regulation of plant growth and development under chilling stress (Yamamoto et al., 2012). Our results are in accord with the findings obtained by Groppa and Benavides (2008) who evidenced that cold acclimation could be achieved by exogenous application of PAs such as Spd treatment. These compounds can regulate plant growth and development through different physiological processes (Paschalidis and Roubelakis-Angelakis, 2005). Likewise, the priming with ALA improved

66

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

Fig. 4. Effect of seed priming with Spd and ALA on expression levels of ADC1 (A), ADC2 (B), SAMDC (C) SAMDC1 (D), ODC (E), Spd synthase1 (F), OsPAO3 (G) and OsPAO4 (H) of two rice cultivars under chilling stress.

seed germination and seedling growth as well as seed vigor (Table 2), which are consistent with those obtained by Korkmaz and Korkmaz (2009) who demonstrated that seed priming with ALA enhanced the germination rate, germination percentage and seedling uniformity of pepper seedlings under chilling stress. However Youssef and Awad (2008) stated that pre-soaking seeds with ALA may have the potential to enhance chilling stress tolerance by decreasing the lipid peroxidation by activating the antioxidant enzyme systems to scavenge ROS accumulation like H2O2 (Nishihara et al., 2003). Recent study reported that seed priming with ALA enhanced rice seed germination percentage, seedling growth, and antioxidant enzyme activity in rice seedlings subjected to accelerated ageing treatment (Kanto et al., 2015). In the present study, QY cultivar recorded higher germination percentage and seedlings growth as well as seed vigor under chilling stress as compared with ZY cultivar. These results are consistent with our previous study (Sheteiwy et al., 2015 and 2016) who reported that higher germination percentage, root and shoot length and SVI was recorded with QY cultivar primed with PEG as compared with ZY cultivars under nano-ZnO stress.

It has been reported that phenolic compounds play a vital role in the alleviation of oxidative stress as they are involved in the detoxification of ROS (Wang et al., 2011). In the present study, total phenolic and flavonoids content significantly increased under chilling stress in both studied cultivar, which are in line with the findings obtained by Griffith and Yaish (2004) who reported that chilling stress increases phenolic production and their subsequent incorporation into the cell wall. Similarly, Ali and Abbas (2003) observed higher concentration of flavonoids in salt-stressed barley. Furthermore, the increase in flavonoids and phenolic compounds in the tissue mitigated the ionic effect of salt stress (Muthukumarasamy et al., 2000). In the present study, significant increase in glycine-betaine content of both cultivars was observed under chilling stress. These results are supported by the findings obtained by Chen et al. (2007) who reported that enhanced glycine-betaine levels in Tibetan wild barley may exert protection on enzyme activity, including enzymes associated with sugar and amino acid metabolism, leading to greater increases in soluble sugars and proline in Tibetane wild barley than control.

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

67

Fig. 5. Transmission electron microscopy (TEM) of leaf mesophyll of rice cultivars primed or without priming and grown under normal (25
C) and chilling stress (10
C). (A) Unprimed seeds of ZY cultivar under normal condition. (B) Spd-primed seeds of ZY cultivar under normal condition. (C) ALA-primed seeds of ZY cultivar under normal condition. (D) Unprimed seeds of chilled-ZY cultivar. (E) Spd-primed seeds of chilled-ZY cultivar. (F) ALA-primed seeds of chilled-ZY cultivar. (G) Unprimed seeds of QY cultivar under normal condition. (H) Spd-primed seeds of QY cultivar under normal condition. (I) ALA-primed seeds of QY cultivar under normal condition. (J) Unprimed seed of chilled-QY cultivar. (K) Spd-primed seeds of chilled-QY cultivar. (L) ALA-primed seeds of chilled-QY cultivar. CW, cell walls; Thy thylakoid; SG, starch grain, Chl, chloroplasts; PG, plastoglobuli; N, nucleus; Nue, nucleoli; RER, rough ribosome; Va, vacuoles; NM, nuclear membrane; M, mitochondria.

In the present study, seed primed with Spd and ALA significantly improved a-amylase activity under chilling stress in both studied cultivars (Fig. 1D). Recently, Sheteiwy et al. (2016) reported that a-amylase activity was significantly improved in PEG-primed seed under nano-ZnO stress. Furthermore, Sung and Chang (1993) observed that osmopriming and matripriming increased a- and b-amylase activities in sweet corn. It has been reported that a-amylase activity and total soluble sugars significantly reduced under chilling stress in rice by limiting starch degradation depicting that seed reserves were not metabolized under chilling stress (Hussain et al., 2016). Moreover, the ability of plants to degrade starch into soluble sugars reflects their survival and growth rate under a wide range of environments

stresses. In this regard, Hussain et al. (2016) revealed that seed priming increased the activity of a-amylase significantly which promoted the hydrolysis of starch into soluble sugars for seed respiration and better growth. Previously, Hussain et al. (2015) also reported that higher germination percentage and seedling growth performance was observed with primed rice seedlings and was accompanied by enhanced starch metabolism. Total soluble protein and total soluble sugar were significantly decreased by Spd and ALA priming under chilling stress as compared with the normal growth condition. The present findings are consistent with the previous study of Sheteiwy et al. (2016) who reported that priming rice with 30% PEG improved soluble sugar content under nano-ZnO stress. In addition, soluble sugars have been considered

68

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

Fig. 6. Scanning electron microscopy (SEM) images of endosperm of Oryza sativa seeds, ZY cultivar (A–F) and QY cultivar (G–L) grown under control (A–C) and (G–I), exposed to chilling stress (D–F) and (J–L), unprimed (left panel), primed with Spd (middle panel) and primed with ALA (right panel). All images are shown at the same level of magnification, with 20 mm scale bars. Note: SG, starch granules; PB, protein bodies; PM, protein matrix; PD; protein deposits; CSG, intact compound starch granule.

as important compatible solutes in osmoregulation and protect plants from stress through different mechanisms, including cellular osmotic adjustment, detoxification of ROS, protection of membrane integrity and stabilization of proteins and enzymes (Ashraf and Foolad, 2007). A numerous studies have demonstrated that the antioxidant systems play important roles in protecting plants against oxidative damage induced by chilling stress (Korkmaz et al., 2010). In the present study, the antioxidant enzymes improved under chilling stress as compared with normal growth conditions. It has reported

that the antioxidant enzymes in plants are important defense systems to detoxify ROS under abiotic stress condition (Ashraf, 2009). ALA has been reported to stimulate the activities of antioxidative enzymes including SOD in spinach seedlings under salinity stress (Nishihara et al., 2003) and pakchoi seedlings grown under optimum conditions (Memon et al., 2009). In the present study, the antioxidant enzyme was increased with ALA and Spd priming under chilling stress in both studied cultivars (Table 3). It has been well documented that PAs counteract oxidative damage in plants by acting as direct free radical scavengers or binding to

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

antioxidant enzyme molecules to scavenge free radical (Bors et al., 1989). Similarly, Duan et al. (2008) reported that higher endogenous concentrations of Spd are positively correlated with greater increase in antioxidant enzymes in response to salinity stress. The antioxidant enzymes markedly increased in QY cultivar under chilling stress as compared to ZY cultivar. Interestingly, in our previous study, we have found that ZY cultivar recorded higher antioxidant enzyme as compared with those of QY cultivar under nano-ZnO stress (Sheteiwy et al., 2015). MDA content was significantly decreased by Spd and ALA priming under chilling stress (Table 3). In this regards, Li et al. (2014) reported that antioxidant enzyme activities was enhanced in Spd-treated seeds resulted in lower ROS and MDA content and thereby improved cell membrane stability, as demonstrated by lower electrolyte leakage. This indicates that Spd is able to promote the antioxidant defense system to moderate the oxidative stress intensity induced by chilling stress during seed germination (Li et al., 2014). Plant polyamines are preferentially detected in the different active tissues of the plants in response to abiotic stresses, but the relationship between PAs accumulation and protection has not been clarified yet. Current study revealed that Spd-primed seeds increased the free PAs as compared to the unprimed seeds under chilling stress (Fig. 2). Our results in agreement with the findings obtained by Tajima and Kabaki (1981) who reported that application of Spd could increase the tolerance of whole rice seedlings to chilling stress. Spd and Put content in the present study was decreased under chilling stress with a reverse tendency in Spm content. These results are consistent with the results obtained by Do et al. (2013) who reported that Put and Spd levels were strongly reduced under drought stress (2.4–87.1-fold for Put and 2.4–11.1-fold for Spd). In contrast, Spm levels were either unchanged or somewhat increased. Recently, Spd treatment induced recovery from salinity-induced damage of the plasma membrane and PM-bound H+-ATPase in salt-tolerant as well as salt-sensitive cultivars (Roy et al., 2005). Spd levels decreased in both studied cultivars under chilling stress which are similar to those observed in barley cultivars under drought stress (Turner and Stewart, 1986) and in rape seed under osmotic stress (Aziz et al., 1997). In the present study, QY cultivar recorded higher accumulation of free PAs under chilling stress. These findings supported by Lee et al. (1997) who reported that when rice cultivars are exposed to chilling stress, the rate of PAs accumulation is faster in chilling-tolerant cultivars than those of chillingsensitive cultivars. Put would increase protection against the chilling stress in many plants species (Kim et al., 2002). Earlier, changes in PAs levels have been observed in various plant species subjected to a range of abiotic stresses, including drought, high salinity, low and high temperatures (Liu et al., 2007). A recent study by Zhang et al. (2015) demonstrated that damage caused by saline-alkaline stress to tomato (Solanum lycopersicum) plants was substantially alleviated by 0.25 mM of Spd, and exogenous Spd supplementation can also alleviate salinity stress in sorghum seedlings (Yin et al., 2015). In the present study, priming treatment has improved enzymes involved in PAs biosynthesis such as ADC, ODC, SAMDC and Spd synthase under chilling stress (Fig. 3A–D), and the changes of these enzymes were consistent with the changes in contents of Spd, put and Spm (Fig. 2). It has been suggested that ADC is responsive to environmental stress, while ODC is irresponsive to any kind of stress (Bouchereau et al., 1999). ADC is thought to be the enzyme primarily responsible for abiotic stress-induced Put accumulation (Tiburcio et al., 1997). In the present study, an increase of PAO and DAO activity stress was observed under chilling stress, and this increase was diminished by Spd and ALA priming treatment. These results are in line with the findings obtained by Duan et al. (2008) who observed large increase in PAO and DAO activities under

69

salinity stress could be the reason for slighter increase of Spd and Put content, with further decrease in Spd-primed seeds. Our results revealed that significant increase of SAMDC activity in Spdprimed seeds could be attributed not only to a direct uptake of Spd but also to an increased Spd and Put biosynthesis may be due to a considerable increase of SAMDC activity (Duan et al., 2008). Spd priming significantly decreased PAO activity under chilling stress as compared to the unprimed seeds (Fig. 3E). PAs biosynthesis genes in response to environmental stresses are usually studied at the molecular level to give more precise estimate of antioxidant gene expression than enzyme activity. The relative expression of ADC1, ADC2, ODC, SAMDC, SAMDC1 and Spd synthase1 was down-regulated in response to chilling stress (Fig. 4A–D). Contrarily, another study reported a correlation of the accumulation of an ADC transcript with salt stress tolerance in rice (Chattopadhyay et al., 1997). Also in Arabidopsis thaliana overexpression of the homologous ADC2 gene conferred drought tolerance after accumulation of putrescine (Alcazar et al., 2010). The results showed that PAs content was decreased under chilling stress and further increased were observed with Spd and ALAprimed seed. The decrease of PAs might be due to increasing conversion of SAM to dcSAM by increasing the transcript level of SAMDC2, lead to efficient conversion resulting in decrease of Put and Spd levels (Do et al., 2013). Previous study reported that under salinity stress at 100 mM NaCl, the sensitive cultivars compensate the lower ADC2 induction by the induction of ODC1, while tolerant cultivars activated both pathways under salinity, suggesting that the ADC pathway for PAs biosynthesis is predominant in higher plants (Rodriguez-Kessler et al., 2006). In addition, the relative expression of the genes involved in PAs degradative enzyme activity, OsPAO3 and OsPAO4 was up-regulated under chilling stress. To date, PAO genes have been identified in several plant species, including A. thaliana (Fincato et al., 2011), tobacco (Yoda et al., 2006), rice (Ono et al., 2012), barley (Cervelli et al., 2001), maize (Cervelli et al., 2000). In the present study, ALA priming induced significant decreases in PAO activity, but induced increases in OsPAO3 and OsPAO4 relative expression, it might be due to a feedback regulation of gene-induced by ALA priming and this type of feedback is considered as a positive feedback regulatory mechanism to meet the metabolic needs and protect the plant cell under stress condition. Seed priming treatment induced changes in the polyamines metabolism such as Spd, Put, Spm and their enzymes such as ADC, ODC, SAMDC, Spd synthase and their related gene expression under chilling stress. Chilling stress induced changes in PAs metabolism in both studied cultivars, which are consistent with the findings obtained by Bouchereau et al. (1999) who reported that major changes in PA metabolism occur in response to various abiotic stress conditions. Similarly, it has reported that PAs metabolism are involved in abiotic stress adaptation might be due to their roles in osmotic adjustment, inhibit lipid peroxidation, cell wall strengthening, membrane stability, scavenging free radicals, induces antioxidant enzymes, affecting nucleic acid and protein synthesis, interacting with hormones and ethylene biosynthesis (Pang et al., 2007). Recently, it has confirmed that in addition to stabilizing macromolecular structures, polyamines act as regulatory molecules in many fundamental cellular processes (Alcazar et al., 2006). TEM analysis helped to assess the damage induced by abiotic stress at the tissue level, providing the basis for macroscopic examination (Caasilit et al., 1997). In the present study, the leaf mesophyll cells structure were totally damaged under chilling stress and ZY was more sensitive as compared with QY cultivar. These results are consistent the findings obtained by Sheteiwy et al. (2015) who reported that priming treatment with PEG improved the leaf mesophyll structure under nano-ZnO stress of

70

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

the same studied cultivars. Spd and ALA priming has reduced the damage induced by chilling stress and improved the ultrastructure of both cultivars as compared to unprimed seeds. The present results revealed that chilling stress improved the total phenolics, flavonoids, glycine-beatine in leaves of rice and higher activities of antioxidants enzymes as well as reduced lipid peroxidation with Spd and ALA priming may alleviate those changes and protect cell membranes from lipid peroxidation under chilling stress. Our results are consistent with the findings obtained by Yan-hua et al. (2015) who found that Spd might protect chloroplast membranes to avoid the damaged through the activated behavior of antioxidant system as observed by reduced the level of MDA in Spd pretreatment seedlings under chilling condition. In our study, chilling stress induce swelling of the chloroplast as compared with normal growth condition, which might be due to the enzyme responsible for the degradation of the starch in the stroma of the chloroplast remaining active (Ma et al., 1990). In the present study, ALA priming improved cell form and chloroplast structure under chilling stress in both studied cultivar, this might be due to the application of ALA reduced lipid peroxidation (Zhang et al., 2008) of thylakoids and cell membranes by induction of the antioxidant system. This explains the capacity of ALA and Spd priming for recuperating leaf structure that was also evident from the study of plant morphological traits under chilling stress. Smaller starch granules were observed with chilling stress as compared to the normal growth condition (Fig. 6J–L). However, Spd and ALAprimed seeds improved the grain structure and showed a large protein bodies embedded compound starch granules (Fig. 6H and I). Moreover, a high concentration of protein bodies at the periphery was observed with Spd-primed seeds might be able to reduce the damage to the seedlings induced by chilling stress (Leesawatwong et al., 2004). In addition, large numbers of protein deposit precipitates around the starch granules under chilling stress in both studied cultivars as compared with normal growth condition might be due to the aggregation of the protein under chilling stress. These results are consistent with the findings obtained by Wei et al. (2009) who observed large numbers of protein deposits were accumulated in barley grain grown under temperature stress. Moreover, it has been reported that temperature stress exposure leads to protein modification of the endosperm (Briggs, 1987).

5. Conclusions Seed priming with Spd and ALA could improve seed germination, seedling growth and seedling vigor index of Oryza sativa under chilling stress conditions. The physiological effects of exogenous Spd and ALA priming for improving seeds tolerance to chilling stress during germination were reflected by increasing antioxidant enzymes, PAs content, enzymes involved in PAs biosynthesis and their related gene expression. Furthermore, improved antioxidant enzymes of SOD, CAT, GPX, POD and APX were beneficial to suppress oxidative damage induced by the chilling stress. It could be concluded that Spd and ALA act as antioxidant machinery to prevent chilling stress effect through counteracting the oxidative stresses imposed on chilled rice cultivars. Additionally, priming treatments induced-PAs enhancements may modulate directly or indirectly plant defense in response to chilling stress through regulation of antioxidant enzymes system. The high level of endogenous PAs induced by Spd and ALA priming could be considered as a major factor responsible for chilling tolerance of both rice cultivars.

Acknowledgments This research was supported by the Special Fund for Agroscientific Research in the Public Interest (No. 201203052), the National Natural Science Foundation (No.31201279 and 31371708), Zhejiang Provincial Natural Science Foundation (LZ14C130002, LY15C130002), the Project of the Science and Technology Department of Zhejiang Province (No. 2013C02005) and Jiangsu Collaborative Innovation Center for Modern Crop Production, P. R. China. References Afzal, I., Munir, F., Ayub, C.M., Basra, S.M.A., Hameed, A., Nawaz, A., 2009. Changes in antioxidant enzymes, germination capacity and vigour of tomato seeds in response of priming with polyamines. Seed Sci. Technol. 37, 765–770. Alcazar, R., Cuevas, J.C., Patron, M., Altabella, T., Tiburcio, A.F., 2006. Abscisic acid modulates polyamine metabolism under water stress in Arabidopsis thaliana. Physiol. Plant. 128, 448–455. Alcazar, R., Planas, J., Saxena, T., Zarza, X., Bortolotti, C., 2010. Putrescine accumulation confers drought tolerance in transgenic Arabidopsis plants overexpressing the homologous Arginine decarboxylase 2 gene. Plant Physiol. Biochem. 48, 547–552. Ali, R., Abbas, H., 2003. Response of salt stressed barley seedlings to phenylurea. Plant Soil Environ. 49, 158–162. Ali, B., Tao, Q.J., Zhou, Y.F., Gill, R.A., Ali, S., 2013. 5-Aminolevolinic acid mitigates the cadmium-induced changes in Brassica napus as revealed by the biochemical and ultra-structural evaluation of roots. Ecotoxicol. Environ. Saf. 92, 271–280. Ashraf, M., Foolad, M.R., 2007. Roles of glycine betaine and proline in improving plant abiotic stress resistance. Environ. Exp. Bot. 59, 206–216. Ashraf, M., 2009. Biotechnological approach of improving plant salt tolerance using antioxidants as markers. Biotechnol. Adv. 27, 84–93. Aziz, A., Martin-Tanguy, J., Larher, F., 1997. Plasticity of polyamine metabolism associated with high osmotic stress in rape leaf discs and with ethylene treatment. Plant Growth Regul. 21, 153–163. Bors, W., Langebartels, C., Michel, C., Sandermann, H., 1989. Polyamines as radical scavengers and protectants against ozone damage. Phytochemistry 28, 1589– 1595. Bouchereau, A., Aziz, A., Larher, F., Martin-Tanguy, J., 1999. Polyamines and environmental challenges: recent development. Plant Sci. 140, 103–125. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal. Biochem. 72, 248–254. Brennan, T., Frenkel, C., 1977. Involvement of hydrogen peroxide in the regulation of senescence in pear. Plant Physiol. 3, 411–416. Briggs, D.E., 1987. Endosperm breakdown and its regulation in germinating barley. In: Pollock, J.R.H. (Ed.), Brewing Science, vol. 3. Academic Press, London, pp. 441–532. Caasilit, M., Whitecross, M.I., Nayudu, M., Tanner, J.G., 1997. UV-B irradiation induces differential leaf damage, ultrastructural changes and accumulation of specific phenolic compounds in rice cultivars. Aust. J. Plant Physiol. 24, 261–274. Cervelli, M., Tavladoraki, P., Agostino, S.D., Angelini, R., Federico, R., Mariottini, P., 2000. Isolation and characterization of three polyamine oxidase genes from Zea mays. Plant Physiol. Biochem. 38, 667–677. Cervelli, M., Cona, A., Angelini, R., Polticelli, F., Federico, R., Mariottini, P., 2001. A barley polyamine oxidase isoform with distinct structural features and subcellular localization. Eur. J. Biochem. 268, 3816–3830. Chattopadhyay, M.K., Gupta, S., Sengupta, D.N., Ghosh, B., 1997. Expression of arginine decarboxylase in seedlings of indica rice (Oryza sativa L.) cultivars as affected by salinity stress. Plant Mol. Biol. 34, 477–493. Chen, Z., Cuin, T.A., Zhou, M., Twomey, A., Naidu, B.P., Shabala, S., 2007. Compatible solute accumulation and stress-mitigating effects in barley genotypes contrasting in their salt tolerance. J. Exp. Bot. 58, 4245–4255. Chen, F., Wang, F., Wu, F.B., Mao, W.H., Zhang, G.P., Zhou, M.X., 2010. Modulation of exogenous glutathione in antioxidant defense system against Cd stress in the two barley genotypes differing in Cd tolerance. Plant Physiol. Biochem. 48, 663– 672. Cheng, C., Yun, K.Y., Ressom, H.W., Mohanty, B., Bajic, V.B., Jia, Y., Yun, S.J., Reyes, B.G. D., 2007. An early response regulatory cluster induced by low temperature and hydrogen peroxide in seedlings of chilling-tolerant japonica rice. BMC Genomics 8, 164–175. Do, P.T., Degenkolbe, T., Erban, A., Heyer, A.G., Kopka, J., Karin, I.K., Hincha, D.K., Ellen, Z., 2013. Dissecting rice polyamine metabolism under controlled long-term drought stress. PLoS One 8, e60325. Duan, J., Li, J., Guo, S., Kang, Y., 2008. Exogenous spermidine affects polyamine metabolism in salinity-stressed Cucumis sativus roots and enhances short-term salinity tolerance. J. Plant Physiol. 165, 1620–1635. Farooq, M., Basra, S.M.A., Hussain, M., Rehman, H., Saleem, B.A., 2007. Incorporation of polyamines in the priming media enhances the germination and early seedling growth in hybrid sunflower (Helianthus annuus L.). IJAB 9, 868–872.

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72 Farooq, M., Basra, S.M.A., Rehman, H., Hussain, M., 2008. Seed priming with polyamines improves the germination and early seedling growth in fine rice. J. New Seeds 9, 145–155. Farooq, M., Aziz, T., Rehman, H., Rehman, A., Cheema, S.A., Aziz, T., 2011. Evaluating surface drying and re-drying for wheat seed priming with polyamines: effects on emergence: early seedling growth and starch metabolism. Acta Physiol. Planta 33, 1707–1713. Fincato, P., Moschou, P.N., Spedaletti, V., Tavazza, R., Angelini, R., Federico, R., Roubelakis-Angelakis, K.A., Tavladoraki, P., 2011. Functional diversity inside the Arabidopsis polyamine oxidase gene family. J. Exp. Bot. 62, 1155–1168. Gao, C.H., Hu, J., Zhang, S., Zheng, Y.Y., Knapp, A., 2009. Association of polyamines in governing the chilling sensitivity of maize genotypes. Plant Growth Regul. 57, 31–38. Greive, C., Grattan, S., 1983. Rapid assay for determination of water soluble quaternary-amino compounds. Plant Soil 70, 303–307. Griffith, M., Yaish, M.W.F., 2004. Antifreeze proteins in overwintering plants: a tale of two activities. Trends Plant Sci. 9, 399–405. Groppa, M.D., Benavides, M.P., 2008. Polyamines and abiotic stress: recent advance. Amino Acids 34, 35–45. Guan, Y.J., Hu, J., Wang, X.J., Shao, C.X., 2009. Seed priming with chitosan improves maize germination and seedling growth in relation to physiological changes under low temperature stress. J. Zhejiang Univ. Sci. B 10, 427–433. Hotta, Y., Tanaka, H., Takaoka, Y., Takeuchi, Y., Konnai, M., 1997. Promotive effects of 5-aminolevulinic acid on the yield of several crops. Plant Growth Regul. 22, 109– 114. Hu, Q., Fu, Y., Guan, Y., Lin, C., Cao, D., Hu, W., Sheteiwy, M., Hu, J., 2016. Inhibitory effect of chemical combinations on seed germination and pre-harvest sprouting in hybrid rice. Plant Growth Regul. 80, 281–289. Huang, Y., Lin, C., He, F., Li, Z., Guan, Y., Hu, Q., Hu, J., 2017. Exogenous spermidine improves seed germination of sweet corn via involvement in phytohormone interactions, H2O2 and relevant gene expression. BMC Plant Biol. 17, 1. Hussain, S., Zheng, M., Khan, F., Khaliq, A., Fahad, S., Peng, S., Huang, J., Cui, K., Nie, L., 2015. Benefits of rice seed priming are offset permanently by prolonged storage and the storage conditions. Sci. Rep. 5, 1–12. Hussain, S., Khan, F., Hussain, H.A., Nie, L., 2016. Physiological and biochemical mechanisms of seed priming-induced chilling tolerance in rice cultivars. Front. Plant Sci. 7, 1–14. International seed testing association (ISTA), 2004. Seed testing and sampling. Seed Sci. Technol. 24, 1–335. Kang, H.M., Saltveit, M.E., 2002. Chilling tolerance of maize, cucumber and rice seedling leaves and roots are differentially affected by salicylic acid. Physiol. Plant. 115, 571–576. Kanto, U., Jutamanee, K., Osotsapar, Y., Chaiarree, W., Jattupornpong, S., 2015. Promotive effect of priming with 5-aminolevulinic acid on seed germination capacity, seedling growth and antioxidant enzyme activity in rice subjected to accelerated ageing treatment. Plant Prod. Sci. 18, 443–454. Kasukabe, Y., He, L.X., Nada, K., Misawa, S., Ihara, I., Tachibana, S., 2004. Overexpression of spermidine synthase enhances tolerance to multiple environmental stresses and up-regulates the expression of various stress-regulated genes in transgenic Arabidopsis thaliana. Plant Cell Physiol. 45, 712–722. Kim, T.E., Kim, S.K., Han, J.T., Lee, J.S., Chang, S.C., 2002. ABA and polyamines act independently in primary leaves of cold-stressed tomato (Lycopersicon esculentum). Physiol. Plant. 115, 370–376. Korkmaz, A., Korkmaz, Y., 2009. Promotion by 5-aminolevulenic acid of pepper seed germination and seedling emergence under low-temperature stress. Sci. Hortic. 119, 98–102. Korkmaz, A., Korkmaz, Y., Demirkıran, A.R., 2010. Enhancing chilling stress tolerance of pepper seedlings by exogenous application of 5-aminolevulinic acid. Environ. Exp. Bot. 67, 495–501. Lee, T.M., Lur, H.S., Chu, C., 1997. Role of abscisic acid in chilling tolerance of rice (Oryza sativa L.) seedlings. Modulation of free polyamine levels. Plant Sci. 126, 1– 10. Leesawatwong, M., Jamjod, S., Kuo, J., Dell, B., Rerkasem, B., 2004. Nitrogen fertilizer alters milling quality and protein distribution in head rice. Proceedings of the 4th International Crop Science Congress: The Regional Institute Ltd.. Li, D.M., Zhang, J., Sun, W.J., Li, Q., Dai, A.H., 2011. 5-Aminolevulinic acid pretreatment mitigates drought stress of cucumber leaves through altering antioxidant enzyme activity. Sci. Hortic-Amsterdam 130, 820–828. Li, Z., Peng, Y., Zhang, X., Ma, X., Huang, L., Yan, Y., 2014. Exogenous spermidine improves seed germination of white clover under water stress via involvement in starch metabolism, antioxidant defenses and relevant gene expression. Molecules 19, 1–22. Liu, J.H., Kitashiba, H., Wang, J., Ban, Y., Moriguchi, T., 2007. Polyamines and their ability to provide environmental stress tolerance to plants. Plant Biotechnol. 24, 117–126. Ma, S.F., Lin, C.Y., Chen, Y.M., 1990. Comparative studies of chilling stress on alteration of chloroplast ultrastructure and protein synthesis in the leaves of chilling-sensitive (Mungbean) and insensitive (Pea) seedlings. Acad. Sin. 31, 263–272. Memon, S.A., Hou, X., Wang, L.J., Li, Y., 2009. Promotive effect of 5-aminolevulinic acid on chlorophyll, antioxidative enzymes and photosynthesis of Pakchoi (Brassica campestris ssp. chinensis var. communis Tsen et Lee). Acta Physiol. Plant. 31, 51–57. Mostofa, M.G., Yoshida, N., Fujita, M., 2014. Spermidine pretreatment enhances heat tolerance in rice seedlings through modulating antioxidative and glyoxalase systems. Plant Growth Regul. 73, 31–44.

71

Muthukumarasamy, M., Gupta, S.D., Panneerselvam, R., 2000. Enhancements of peroxidase, polyphenol oxidase and superoxide dismutase activities by triadimefon in NaCl stressed Raphanus sativus L. Biol. Planta 43, 317–320. Naeem, M.S., Warusawitharana, H., Liu, H., Liu, D., Ahmad, R., 2012. 5Aminolevulinic acid alleviates the salinity-induced changes in Brassica napus as revealed by the ultrastructural study of chloroplast. Plant Physiol. Biochem. 57, 84–92. Nakano, Y., Asada, K., 1981. Hydrogen-peroxide is scavenged by ascorbate-specific peroxidase in spinach-chloroplasts. Plant Cell Physiol. 22, 867–880. Nishihara, E., Kondo, K., Parvez, M.M., Takahashi, K., Watanabe, K., Tanaka, K., 2003. Role of 5-aminolevulinic acid (ALA) on active oxygen-scavenging system in NaCl-treated spinach (Spinacia oleracea). Plant Physiol. 160, 1085–1091. Ono, Y., Kim, D.W., Watanabe, K., Sasaki, A., Niitsu, M., Berberich, T., Kusano, T., Takahashi, Y., 2012. Constitutively and highly expressed Oryza sativa polyamine oxidases localize in peroxisomes and catalyze polyamine back conversion. Amino Acids 42, 867–876. Pang, X., Zang, Z., Wen, X., Ban, Y., Moriguchi, T., 2007. Polyamines all-purpose players in response to environment stress in plants. Plant Stress 1, 173–188 Global Science Book. Paschalidis, K.A., Roubelakis-Angelakis, K.A., 2005. Spatial and temporal distribution of polyamine levels and polyamine anabolism in different organs/ tissues of the tobacco plant. Plant Physiol. 138, 142–152. Pouramir-Dashtmian, F., Khajeh-Hosseini, M., Esfahani, M., 2014. Improving chilling tolerance of rice seedling by seed priming with salicylic acid. Arch. Agron. Soil Sci. 60, 1291–1302. Rodriguez-Kessler, M., Alpuche-Solis, A., Ruiz, O., Jimenez-Bremont, J., 2006. Effect of salt stress on the regulation of maize (Zea mays L.) genes involved in polyamine biosynthesis. Plant Growth Regul. 48, 175–185. Roy, P., Niyogi, K., Sengupta, D.N., Ghosh, B., 2005. Spermidine treatment to rice seedlings recovers salinity stress-induced damage of plasma membrane and PM-bound H+-ATPase in salt-tolerant and salt-sensitive rice cultivars. Plant Sci. 168, 583–591. Roychoudhury, A., Basu, S., Sengupta, D.N., 2011. Amelioration of salinity stress by exogenously applied spermidine or spermine in three varieties of indica rice differing in their level of salt tolerance. J. Plant Physiol. 168, 317–328. Ruelland, E., Vaultier, M.N., Zachowski, A., Hurry, V., 2009. Cold signalling and cold acclimation in plants. Adv. Bot. Res. 49, 35–150. Seck, P.A., Diagne, A., Mohanty, S., Wopereis, M.C., 2012. Crops that feed the world 7: rice. Food Secur. 4, 7–24. Sheteiwy, M.S., Guan, Y., Cao, D., Li, J., Nawaz, A., Hu, Q., Hu, W., Ning, M., Hu, J., 2015. Seed priming with polyethylene glycol regulating the physiological and molecular mechanism in rice (Oryza sativa L.) under nano-ZnO stress. Sci. Rep. 5, 1–14. Sheteiwy, M.S., Fu, Y., Hu, Q., Nawaz, A., Guan, Y., Li, Z., Huang, Y., Hu, J., 2016. Seed priming with polyethylene glycol induces antioxidative defense and metabolic regulation of rice under nano-ZnO stress. Environ. Sci. Pollut. Res. 1–14. Shohag, M., Wei, Y., Yang, X., 2012. Changes of folate and potential other health promoting phytochemicals in legume seeds as affected by germination. J. Agric. Food Chem. 60, 9137–9143. Shu, S., Guo, S.R., Sun, J., Yuan, L.Y., 2012. Effects of salt stress on the structure and function of the photosynthetic apparatus in Cucumis sativus and its protection by exogenous putrescine. Physiol. Plant. 146, 285–296. Sung, F.J., Chang, Y.H., 1993. Biochemical activities associated with priming of sweet corn seeds to improve vigor. Seed Sci. Technol. 21, 97–105. Tajima, K., Kabaki, N., 1981. Effects of sugars and several growth regulators on the chilling injury of rice seedlings. J. Crop Sci. 50, 411–412. Tanaka, T., Takahashi, K., Hotta, T., Takeuchi, Y., Konnai, M., 1992. Promotive effects of 5-aminolevulinic acid on yield of several crops. Proceedings of the 19th Annual Meeting of Plant Growth Regulator Society of America, San Francisco, USA, pp. 237–241. Tiburcio, A.F., Altabella, T., Borrell, A., Masgrau, C., 1997. Polyamine metabolism and its regulation. Physiol. Plant. 100, 664–674. Turner, L.B., Stewart, G.R., 1986. The effect of water stress upon polyamine levels in barley (Hordeum vulgare L.) leaves. J. Exp. Bot. 37, 170–177. Wang, J.J., Jiang, W.B., Huang, B.J., 2004. Promotion of 5-aminolevulinic acid on photosynthesis of melon (Cucumis melo) seedlings under low light and chilling stress conditions. Physiol. Plant. 121, 258–264. Wang, C., Lu, J., Zhang, S., Wang, P., Hou, J., Qian, J., 2011. Effects of Pb stress on nutrient uptake and secondary metabolism in submerged macrophyte Vallisneria natans. Ecotoxicol. Environ. Saf. 74, 1279–1303. Wei, K., Dai, F., Wu, F.B., Zhang, G.P., 2009. The variation of b-amylase activity and protein fractions in barley grains as affected by genotypes and postanthesis temperatures. J. Inst. Brew. 115, 208–213. Xu, S., Hu, J., Li, Y., Ma, W., Zheng, Y., Zhu, S., 2011. Chilling tolerance in Nicotiana tabacum induced by seed priming with putrescine. Plant Growth Regul. 63, 279– 290. Xue, B., Zhang, A., Jiang, M., 2009. Involvement of polyamine oxidase in abscisic acid induced cytosolic antioxidant defense in leaves of maize. J. Integr. Plant Biol. 3, 225–234. Yamamoto, A., Shim, I.S., Fujihara, S., 2012. Chilling-stress responses by rice seedlings grown with different ammonium concentrations and its relationship to leaf spermidine content. J. Plant Biol. 55, 191–197. Yan-hua, Z., Yu-ping, Z., Jing, X., Hui, W., Hui-zhe, C., Yi-kang, Z., De-feng, Z., 2015. Effects of chilling tolerance induced by spermidine pretreatment on antioxidative activity, endogenous hormones and ultrastructure of indicajaponica hybrid rice seedlings. J. Integr. Agric. 15, 1–20.

72

M. Sheteiwy et al. / Environmental and Experimental Botany 137 (2017) 58–72

Yin, L., Wang, S., Tanaka, K., Fujihara, S., Itai, A., Den, X., Zhang, S., 2015. Siliconmediated changes in polyamines participate in silicon-induced salt tolerance in Sorghum bicolor L. Plant Cell Environ. 39, 245–258. Yoda, H., Hiroi, Y., Sano, H., 2006. Polyamine oxidase is one of the key elements for oxidative burst to induce programmed cell death in tobacco cultured cells. Plant Physiol. 142, 193–206. Youssef, T., Awad, M.A., 2008. Mechanisms of enhancing photosynthetic gas exchange in date palm seedlings (Phoenix dactylifera L.) under salinity stress by a 5-aminolevulinic acid-based fertilizer. J. Plant Growth Regul. 27, 1–9. Zeng, Y., Zahng, Y., Xiang, J., Wu, H., Chen, H., Zhang, Y., Zhu, D., 2016. Effects of chilling tolerance induced by spermidine pretreatment on antioxidative activity, endogenous hormones and ultrastructure of indica-japonica hybrid rice seedlings. J. Integr. Agric. 15, 295–308.

Zhang, W.F., Zhang, F., Raziuddin, R., Gong, H.J., Yang, Z.M., Lu, L., Ye, Q.F., Zhou, W.J., 2008. Effects of 5-aminolevulinic acid on oilseed rape seedling growth under herbicide toxicity stress. J. Plant Growth Regul. 27, 159–169. Zhang, J., Li, D.M., Gao, Y., Yu, B., Xia, C.X., 2012. Pretreatment with 5-aminolevulinic acid mitigates heat stress of cucumber leaves. Biol. Plant. 56, 780–784. Zhang, Y., Zhang, H., Zou, Z.R., Liu, Y., Hu, X.H., 2015. Deciphering the protective role of spermidine against saline-alkaline stress at physiological and proteomic levels in tomato. Phytochemistry 110, 13–21. Zhang, X.Z., 1992. The measurement and mechanism of lipid peroxidation and SOD, POD and CAT activities in biological system. Research Methodology of Crop Physiology. Agriculture Press, Beijing, pp. 208–211. Zhishen, J., Mengcheng, T., Jianming, W., 1999. The determination of flavonoid contents in mulberry and their scavenging effects on superoxide radicals. Food Chem. 64, 555–559.