- Email: [email protected]
Selection, characterization and application of aptamers targeted to Aflatoxin B2
Food Control 47 (2015) 545e551
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Selection, characterization and application of aptamers targeted to Aflatoxin B2 Xiaoyuan Ma a, b, Wenfeng Wang a, Xiujuan Chen a, Yu Xia a, b, Nuo Duan a, Shijia Wu a, b, Zhouping Wang a, b, * a b
State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, Wuxi 214122, PR China Synergetic Innovation Center of Food Safety and Nutrition, Jiangnan University, Wuxi 214122, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 January 2014 Received in revised form 18 July 2014 Accepted 19 July 2014 Available online 12 August 2014
Aflatoxins are naturally occurring mycotoxins that can contaminate foodstuffs and consequently affect human health. In this study, the systematic evolution of ligands by exponential enrichment (SELEX) technology was used to effectively screen DNA aptamers that recognize Aflatoxin B2 (AFB2) with high affinity and specificity. AFB2 was first combined with magnetic nanoparticles, which served as carriers, and then incubated with a library of single-stranded DNA (ssDNA). The entire selection process included incubation, separation, elution, PCR amplification and single chain preparation. The selection conditions were optimized. After 10 rounds of selection, 30 aptamer sequences were obtained and enriched. Homological analysis in combination with structural analysis as well as the affinity and specificity experiments revealed that aptamer sequence 17 showed the best affinity and specificity toward AFB2. The dissociation constants value for aptamer sequence 17 was 9.83 nM. And the specificity experiment results showed the binding between AFB2 aptamer with five other toxins was very week (did not exceed 18% compared to AFB2). The selected AFB2 aptamer was used to construct a fluorescent biosensor. The assay showed a wide linear range, with the AFB2 concentration ranging from 100 ng/L to 1800 ng/L and a detection limit of 50 ng/L. Additionally, the spiked recovery experiment of AFB2 in peanut oil sample exhibited a recovery ratio between 94.0% and 101.6% which showed good accuracy of the proposed aptamer-based bioassay. © 2014 Elsevier Ltd. All rights reserved.
Keywords: SELEX Aflatoxin B2 Aptamer Bioassay
1. Introduction Aflatoxins are highly toxic, teratogenic, mutagenic and carcinogenic metabolites produced by fungi of the genus Aspergillus, mainly by the species Aspergillus flavus, Aspergillus parasiticus and Aspergillus nomius (Klich, 1998; Moss, 1998; Sweeney & Dobson, 1998). Eighteen different types of aflatoxin species have been identified while aflatoxins B1, B2, G1, G2 and M1 are the major species (Bennett & Klich, 2003). Foodstuffs can be contaminated by aflatoxins while foods are growing, being harvested and finally while they are being stored (Bankole & Adebanjo, 1996). This contamination will negatively affect not only the economy but also human health (Kamika & Takoy, 2011). Studies have revealed that aflatoxin species show immunosuppressive effects as a result of the * Corresponding author. State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, Wuxi 214122, PR China. Tel./fax: þ86 510 85917023. E-mail address: [email protected] (Z. Wang). http://dx.doi.org/10.1016/j.foodcont.2014.07.037 0956-7135/© 2014 Elsevier Ltd. All rights reserved.
inhibition of DNA, RNA and protein synthesis through different mechanisms (Jiang et al., 2005; Kensler, Roebuck, Wogan, & Groopman, 2011). For example, aflatoxicosis may cause rapid death, while hepatocellular carcinoma develops as a chronic outcome when exposed to a high dose of aflatoxin. The U.S. Food and Drug Administration has set aflatoxin action levels in various foods and feedstuffs (Eaton & Groopman, 1994). Different methods have been established for the separation and detection of aflatoxins, including high performance liquid chromatography (HPLC), thin layer chromatography (TLC), enzyme linked immunosorbent assay (ELISA), etc (Bakirdere et al., 2012). HPLC is a widely used technique and has been coupled with different detectors during analysis (Silva, Raquel, Collins, Grespan, & Carla, 2011; Wu & Thompson, 2006). Fluorescent detectors are the most popular choice for Aflatoxins B2 and G2 because these molecules are naturally strongly fluorescent due to the high conjugation of their oxygenated structures (Gurbay et al., 2010; Heperkan, Somuncuoglu, Karbancioglu-Guler, & Mecik, 2012). Chromatographic methods require expensive instrumentation and
546
X. Ma et al. / Food Control 47 (2015) 545e551
expertise in the field of chromatography. ELISA as immunoassaybased sensors is another practical alternative for the determination of aflatoxin species. ELISA is a rapid and sensitive technique for the routine analysis of food products. Aptamers have been widely investigated as a biorecognition ligand. They are generated using an in vitro SELEX (systematic evolution of ligands by exponential enrichment) technology, which was first reported by Tuerk in 1990 (Tuerk & Gold, 1990). An aptamer is defined as the obtained oligonucleotide sequence that can bind to a wide range of target molecules, ranging from protein molecules, nucleic acids and whole bacterial cells to small molecules such as peptides, amino acids, toxins and even metal ions (Zhou, Battig, & Wang, 2010). Aptamers show a high affinity and specificity which make them ideal alternatives to antibodies for a variety of applications. Additionally, aptamers possess a small size, rapid and reproducible synthesis, simple and controllable modifications, nontoxicity, a lack of immunogenicity, etc (Famulok, Hartig, & Mayer, 2007; Fang & Tan, 2010). These attributes largely expand the scope of applications for SELEX technology (Famulok & Mayer, 2011; Iliuk, Hu, & Tao, 2011; Vinkenborg, Karnowski, & Famulok, 2011). Traditional SELEX technology consists of incubation, separation, dissociation and PCR amplification processes, which usually require 8e20 rounds of screening. After 20 years of development, the SELEX technology has been gradually developed, enriched and improved. The emerging SELEX technologies include negative screening, reverse screening, automation technology, etc (Berezovski, Musheev, Drabovich, & Krylov, 2006; Huang, Lin, Shiesh, & Lee, 2010; Ito, Kawazoe, & Imanishi, 2000). In this study, SELEX was used for the successful selection of the Aflatoxin B2 (AFB2) aptamer. Aminated Fe3O4 magnetic nanoparticles served as the carrier to fix the activated AFB2. Then, the target was incubated with an 80 bp random ssDNA library. Using 10 repeated selection and amplification rounds, consisting of incubation, washing, elution, PCR amplification, PAGE electrophoresis, purification, single-chain preparation, purification and the incubation cycle, the ssDNA sequences with a high affinity and specificity to AFB2 were obtained. This entire process, including the reaction conditions, was optimized. The ssDNA sequences were analyzed for their homology, structures, dissociation constant, affinity and specificity to finally obtain the AFB2 aptamer. 2. Materials and methods 2.1. Materials AFB2, AFB1, AFG1, AFG2, OTA, FB1, carboxymethoxylamine hemihydrochloride ((C2H5NO3)2HCl), carbodiimide (EDC, C8H17N3$HCl), sulfo-NHS acetate and polyacrylamide were purchased from Sigma (San Francisco, USA). Pyridine (C5H5N), methanol (CH2O), dimethylformamide (C3H7NO), trichloromethane (CHCl3), 1,6-hexy lenediamime (C6H16N2), ferric chloride (FeCl3$6H2O), ethylene glycol (C2H6O2), ethanol (C2H5OH), sodium chloride (NaCl), potassium chloride (KCl), calcium chloride (CaCl2), magnesium chloride hexahydrate (MgCl2), sodium hydrogen phosphate (Na2HPO4), potassium phosphate monobasic (KH2PO4), Tween 20 (C58H114O26), trishydroxymethyl aminomethane (Tris, C4H11NO3), hydrochloric acid (HCl), bromophenol blue (C19H10Br4O5S), sucrose (C12H22O11), bovine serum albumin (BSA), and petroleum ether were purchased from the Chinese Medicine Shanghai Chemical Reagent Company. Taq plus DNA polymerase, deoxy-ribonucleoside triphosphate (dNTP) and 10 PCR amplification buffer were purchased from the Shanghai Sangon Biological Science & Technology Company (Shanghai, China). Peanut oil was bought from the local supermarket. The oligonucleotide sequences were all synthesized by Shanghai Sangon Biological Science & Technology Company (Shanghai,
China). The initial ssDNA library and primers were obtained from Integrated DNA Technologies (Coralville, IA). The ssDNA library for aptamer selection: 50 -AGCAGCACAG AGGTCAGATG(N40)CCTATGCGTGCTACCGTGAA-30 ; Primer I: 50 -AGCAGCACAGAGGTCAGATG-30 ; Primer II: 50 -PO4-TTCACGGTAGCACGCATAGG-30 .
2.2. The connection between Aflatoxin B2 and aminated magnetic nanoparticles Activation of AFB2 was conducted as described by Morgan (Gendloff et al., 1986) with some modifications. Four hundred microliters of AFB2 (2.5 mg/mL, dissolved in N,N-dimethylformamide), 2 mg of carboxymethoxylamine hemihydrochloride and 12 mL of a mixed solution (2 mL of water, 2 mL of pyridine and 8 mL of methanol) were added to a round-bottom flask for oil bath refluxing at 85 C (3 h). The solvent was removed by distillation using a rotary evaporator. The resulting precipitate was dissolved in 1 mL of chloroform. Thin-layer chromatography was used to compare the activated AFB2 with the standard AFB2 (the volume ratio of the developing agent was methanol:chloroform ¼ 1:9). Then, the chloroform was removed by distillation, and the activated AFB2 was dissolved in N,N-dimethylformamide for further use. Aminated magnetic nanoparticles were prepared as described by Deng et al. (2005) with some modifications: 6.5 g of 1,6hexanediamine, 2.0 g of anhydrous sodium acetate and 1.0 g of FeCl3$6H2O were dissolved in 30 mL of ethylene glycol with vigorous stirring at 50 C for 1 h until the solution became clear, at which time it was transferred to an autoclave. The autoclave was placed in an oven for completion of the reaction (198 C, 6 h) and subsequently cooled to room temperature. The liquid in the reaction vessel was washed 3 times with water and ethanol and then dried at 50 C, forming a powder. The powder was dissolved in a PBS-T buffer for further use. The connection between AFB2 and aminated magnetic nanoparticles was conducted under the amidation reaction using EDC (catalyzer) and sulfo-NHS (stabilizer) which referred to published work (Eric & Mark, 2009). One milliliter of EDC (5 mg/mL) was added dropwise to the activated AFB2 and heated at 37 C for 5 min to form unstable intermediate product. The aminated magnetic nanoparticles were added to avoid light reaction at 37 C for 3 h. Then, 1 mL of sulfo-NHS acetate (10 mg/mL) was added for subsequent reactions (2 h). Under the amidation reaction, the reaction product (AFB2 covered on the surface of magnetic nanoparticles) was collected magnetically and dissolved in a PBS-T buffer at 4 C for further use (AFB2-MNPs). 2.3. The Aflatoxin B2 aptamer selection SELEX was carried out using a procedure based on previous work (Duan, Wu, Chen, Huang, & Wang, 2012). A random ssDNA library at a concentration of 2 nmol (second round begins with each addition of 200 pmol) was added to 500 mL of BB buffer (pH 7.0:100 mmol/L NaCl, 20 mmol/L TriseHCl pH 7.6, 2 mmol/L MgCl2, 5 mmol/L KCl, 1 mmol/L CaCl2 and 0.02% Tween 20) and placed in a water bath at 95 C for 5 min and then in an ice bath for 5 min. Afterwards, 200 mL of the AFB2-MNPs was collected from the bottom of the tube, and the supernatant was discarded. The ice bath product was then added for incubation at 37 C for 2 h. A magnet was used to remove the supernatant. The precipitant was washed five times with 1 mL of BB buffer. Then, the elution buffer, 1 PCR (100 mL), was placed in the water bath for 5 min and then in the ice bath for 5 min. The eluent was collected using a magnet. This
X. Ma et al. / Food Control 47 (2015) 545e551
elution process was repeated, and the eluents were combined for the PCR amplification template. The bare MNPs were used as negative control to incubated with the DNA pool aiming to reduce the DNA sequences which can bind to MNPs. The PCR amplification conditions were as follows: 5 mL of PCR template, 1 mL of primer I, 1 mL of primer II, 1 mL of dNTP, 5 mL of 10 PCR buffer, 36.5 mL of sterile water, 0.5 mL of Taq enzyme, 95 C for 5 min, 95 C for 30 s, 60 C for 40 s, 72 C for 30 s, repeated 30 cycles, 72 C for 7 min and 12 C for 2 min. The polyacrylamide gel electrophoresis was used to characterize the PCR amplification product. This aptamer selection process was repeated for 10 rounds. 2.4. Cloning, sequencing and analysis for the Aflatoxin B2 aptamer The product from the final round of the PCR amplification was cloned and sequenced by the Shanghai Sangon Biotech Company, China. Structural information of the 30 AFB2-aptamer sequences obtained was analyzed using DNAMAN (a highly integrated molecular biology application software which was developed by Lynnon Biosoft Company, USA) and RNA Structure 4.2 software (a Windows program for the prediction and analysis of RNA secondary structure). The affinity experiment was conducted as follows. Eight AFB2aptamer sequences with low energy levels and stable structures were synthesized with biotin labeled aptamers by the Shanghai Sangon Biotech Company, China. The biotin labeled aptamers (20 mol/L, 40 mL) were connected with avidin-modified Fe3O4 MNPs (1 mg/mL, 100 mL) to form the aptamer probe and were then diluted to concentrations of 10 nM, 20 nM, 40 nM, 60 nM, 80 nM, 100 nM, 120 nM and 150 nM using the BB buffer. Fe3O4 MNPs were then blocked with a blocking buffer (1% BSA in PBS) for 1 h at room temperature to prevent the appearance of false positive signals (matrix effect). The excess BSA was removed by magnetic separation. Then, AFB2 was added to yield a final concentration of 1000 ng/L. The mixture was incubated at 37 C for 1 h. The supernatant was removed by magnetic separation, and the precipitate was washed 5 times with BB buffer. Then, the fluorescent intensity was measured. 2.5. Specificity and sensitivity analysis of AFB2 aptamer The three aptamers with the best affinities were selected to perform the specificity experiment. First, a 50 pM aptamer probe was prepared and the Fe3O4 MNPs were blocked with a blocking buffer as described in Section 2.4. The aptamer probe were then incubated with 50 pM AFB2, AFB1, AFG1, AFG2, FB1 and OTA at 37 C for 1 h. The supernatant was removed by magnetic separation, and the precipitate was washed 5 times with BB buffer. Then, the fluorescent intensity was measured. 2.6. Detection of AFB2 using AFB2 aptamer The AFB2 aptamer with the best affinity and specificity was used for the detection application. Then, 300 mL aptamer probe combined with FAM-labeled (FAM refers to carboxy fluorescein. It is a kind of commonly used fluorophores for labeling.) ssDNA (1 mg/ mL) with the complementary sequences and 700 mL of varying concentrations of AFB2 (50 ng/L, 90 ng/L, 100 ng/L, 300 ng/L, 500 ng/L, 800 ng/L, 1000 ng/L, 1300 ng/L, 1500 ng/L, 1800 ng/L, and 2000 ng/L) were incubated at 37 C for 1 h. Among which, the blocking step was conducted as described in Section 2.4. The supernatant was collected by magnetic separation and washed with BB buffer before measuring the fluorescence generated from the fluorophore FAM. The fluorescent intensity was measured by F7000 fluorescence spectrophotometer (Hitachi, Japan).
547
2.7. Peanut oil sample detection Peanut oil bought from the local supermarket was used for the food sample detection. First, different concentrations of AFB2 were added to the oil sample to make their final concentrations at 0 ng/L, 10 ng/L, 20 ng/L, 100 ng/L, 500 ng/L, 800 ng/L 4 g oil sample dispersed in 20 mL petroleum ether was placed in a separating funnel. Then 20 mL methanol/water (the volume ratio was 55:45) solution was added for full shaking. After standing stratification, the lower methanol/water layer was collected in an evaporating dish. Another 5 mL methanol/water solution was used for extraction once again. The lower methanol/water layer was merged with the first extraction process. Then the evaporating dish was place in a fuming cupboard for evaporating dryness under a 65 C water bath. BB buffer was used to dissolve the dry residue after evaporation. At last, it was used as real sample for detection using the above constructed method. Among which, the blocking step of Fe3O4 MNPs was conducted as described in Section 2.4 to prevent the matrix effect. 2.8. Statistical analysis All the analytical performance was repeated for at least three times to ensure the stability and reliability of the data. The screened aptamer sequences were analyzed for their structural homology using DNAMAN software (Lynnon Biosoft Company, USA) and lowest energy analysis using the RNA Structure 4.2 software (a Windows version for the prediction and analysis of RNA secondary structure developed by Mathews et al., 2004). The dissociation constants were calculated using GraphPad Prism 5 software (GraphPad Software, San Diego, USA). 3. Results and discussion 3.1. Activation of AFB2 and the connection to aminated MNPs The selection of aptamers for small molecules is relatively difficult because target materials and small molecules are difficult to separate using conventional separation methods, such as centrifugation and capillary electrophoresis, thus influencing the subsequent experiment. Generally, small molecules must be immobilized on a carrier for screening. AFB2 does not possess amino, carboxyl, hydroxyl or other active groups; therefore, activation treatment is necessary before it is immobilized onto a carrier. The C3 position of the cyclopentanone molecule was used as the active site, and the carbonyl group was converted to a carboxyl group. Magnetic nanoparticles have been widely used in the bioanalytical field for their good biocompatibility, simple operation, high sensitivity, and their high enrichment of samples under the effect of an external magnetic field, etc. Therefore, aminated magnetic Fe3O4 nanoparticles were prepared as the carrier for AFB2 using a hydrothermal method. The diameter of the nanoparticles was approximately 25e50 nm, and they exhibited a spherical morphology with single-crystal structures. AFB2 carboxyl compounds can rapidly react with EDC (which was played as activating reagents) to form unstable intermediate compounds and subsequently react with amino groups in the Fe3O4 nanoparticles to form a stable product (AFB2-MNPs). Because AFB2 possesses fluorescent properties (Dalvi, 1986; Hartley, Nesbitt, & O'Kelly, 1963), a fluorescence microscope was used to characterize the successful connection between the MNPs and AFB2, as shown in Fig. 1(A). The results indicated that when the concentrations of activated AFB2 and MNPs were equal (1 mg/mL), the fluorescent intensity reached a maximum when the volume ratio
548
X. Ma et al. / Food Control 47 (2015) 545e551
was 1:5 (MNPs to AFB2), and this intensity remained almost constant even when more AFB2 was added (depicted in Fig. 1(B)). Therefore, the optimized volume ratio for MNPs to AFB1 was determined to be 1:5. 3.2. AFB2 aptamer selection and sequence analysis The existence of a considerable number of single-stranded oligonucleotides is the basis for the successful selection of target aptamers. The ssDNA library in our experimental design consisted of a central randomized sequence of 80 nucleotides. The reaction conditions used during each of the selection steps affect the ability to obtain the correct sequence. In this study, the incubation time, washing times, PCR annealing temperature and number of cycles were investigated. An adequate incubation time will ensure full integration between ssDNA and AFB2. Complete washing is important for removing all the unbound ssDNA sequences. The PCR annealing temperature proved to be especially critical because partial hybridization of the random regions with themselves can be self-priming for Taq polymerase and lead to nonspecific high-molecular-weight PCR products. Additionally, nonspecific products might appear with increased cycles during the PCR amplification process. The optimization experimental results are shown in Figs. 2 and 3. The gel electrophoresis graph shown in Fig. 3 indicates that a single and correct band was obtained when the annealing temperature was 65 C and the number of cycles was 30. As shown in Fig. 3(A), the amount of ssDNA attached to AFB2 increased when the incubation time ranged from 30 to 120 min, and then it remained constant with only slight changes. Therefore, the optimal incubation time was determined to be 120 min. The data in Fig. 3(B) shows that the amount of ssDNA in the washing solution decreased to a very low level after two washings. To remove all the unbound ssDNA sequences, 4 washing processes were performed. After 10 selection rounds, the 30 AFB2 aptamer sequences obtained were analyzed for their structural homology using DNAMAN software and lowest energy analysis using the RNA Structure 4.2 software. The aptamers were divided into eight families, and one representative stable aptamer was selected from each group. The eight representative aptamer sequences and their dissociation constants (calculated using GraphPad Prism 5 software) are described in Table 1. 3.3. Affinity and specificity determination Aptamers can be folded to form different secondary structures, such as hairpin, hydrocarbon loop and pocket structures. These
Fig. 2. Optimization of the PCR conditions.
special structures may be intensely associated with the high affinity and specificity effects. The dissociation constant (Kd, shown in Table 1) represents the affinity for of the aptamer toward AFB2. Lower Kd values represented higher aptamer affinities to AFB2. The dissociation results showed that aptamer sequences 1, 17, and 25 had better affinities towards AFB2 than the other sequences, with Kd values of 24.25 nM, 9.83 nM, and 16.48 nM, respectively. Furthermore, aptamer 17 possessed the best affinity of the sequence. The corresponding fluorescent intensity curves with different concentrations of the aptamer sequence 17 probe are shown in Fig. 4, and the secondary structures for aptamer sequence 17 are also given. The best three aptamer sequences based on the affinity results were selected to complete the specificity experiment. The combination between AFB2-aptamer with AFB2 was defined as 100. As shown in Fig. 5, the connect effect between the AFB2-aptamer with the 5 other toxins did not exceed 18%, especially for AFB1, although its structure is extremely similar to that of AFB2. The specificity for the AFB2 aptamer was good, and the best affinity and specificity sequence were obtained with sequence 17. 3.4. Application for AFB2 aptamer and peanut oil sample detection The AFB2 aptamer with high affinity and specificity was used to form an aptamer probe. A separate FAM-labeled ssDNA possessing a complementary nucleic acid sequence toward aptamer sequences was synthesized that could hybridize with the aptamer probe. When the target AFB2 was added to the system, the aptamer was preferably bound to the AFB2, displacing the FAM-labeled ssDNA sequence. The fluorescence of the supernatant was measured after collecting the precipitate with a magnet. The fluorescent intensity varied linearly according to the different concentrations of AFB2. The scatter diagram of the fluorescent intensity versus the amount of AFB2 and the corresponding best linear calibration fit are
Fig. 1. (A) Fluorescence image of the amine-functionalized Fe3O4 linked AFB2. (B) Effect of AFB2 concentration on the magnetic nanoparticles based on fluorescent intensity. (Data was collected for at least three times and the standard deviation was given.)
X. Ma et al. / Food Control 47 (2015) 545e551
549
Fig. 3. Optimization of the incubation time (A) and washing time (B). (Data was collected for at least three times and the standard deviation was given.)
Table 1 Sequence of tested aptamers and the estimated Kd value. No.
Sequences
Kd (nM)
1 17 25 14 27 13 26 23
AGCAGCACAGAGGTCAGATGGAGCTTCCGAAGTATAAACGAATTAAGTAACGGCGGTTCTCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGCTGACACCCTGGACCTTGGGATTCCGGAAGTTTTCCGGTACCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGTGCATCGGGGTTCGATGCTAGTAAGGGCCATTCGGAATATCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGAGGGCGGCGGTCATGAGCTCAGGGGTTTAGGGACAAATCTCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGAATTTCGGATCCGGTAATGGTCCTGCATACCTTAAGTGGTCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGTAATCCAGTAACGACTCTTTTAATACTCGACTGCACTCCCCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGTTTAGGATCGAAATTCCGGTTGCAAGTTTTAACGCAACTGCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGGTCACGTACTTCTTAAAGTCGATCGCGTGCTGGTTAAATCCCTATGCGTGCTACCGTGAA
24.25±3.06 9.83±0.99 16.48±1.83 92.87±14.86 30.56±4.23 38.79±5.99 32.37±2.91 58.46±7.01
depicted in Fig. 6. A good linear relationship was obtained when the AFB2 ranged from 100 to 1800 ng/L. The linear equation was y ¼ 7.8495x þ 1662.3, with an R2 ¼ 0.9961. The detection limit was 50 ng/L. Additionally, the accuracy of AFB2 detection in realistic food commodities (peanut oil) was also evaluated by determining the recovery of AFB2 by the above constructed method using selected AFB2 aptamer, into which a known quantity of AFB2 was added. Peanuts are the most likely grain to be contaminated by A. flavus. The study on the aflatoxin content in peanut oil is of practical significance (Yu, 2012). As shown in Table 2, the recoveries were between 94.0% and 101.6%, indicating good accuracy of the proposed aptamer-based bioassay for AFB2 detection.
4. Conclusion In this study, the AFB2 aptamer was successfully obtained with high affinity and specificity. SELEX technology was used for the screening process. MNPs were prepared and utilized as the carrier for the AFB2 aptamer. Combined with SELEX, the target AFB2 was incubated with an ssDNA library that was synthesized in vitro. After 10 rounds of the selection and amplification process, ssDNA sequences with high affinity and specificity to AFB2 were enriched. Their sequences, homological properties, secondary structures, dissociation constant, affinity and specificity characteristics were analyzed. The results revealed that aptamer sequence 17 exhibited the best affinity and specificity toward other sequences. Finally, the
Fig. 4. The binding saturation curve for aptamer 17 and its corresponding secondary structure.
550
X. Ma et al. / Food Control 47 (2015) 545e551
of China (Grant 21375049), the S&T Supporting Project of Jiangsu (BE2011621, BE2012614), the Research Fund for the Doctoral Program of Higher Education (20110093110002), JSCIQ_2012IK166, JUSRP51309A and NCET-11-0663. References
Fig. 5. Specificity of the AFB2 aptamer to AFB1, AFG1, AFG2, OTA and FB1. (Data was collected for at least three times and the standard deviation was given.)
Fig. 6. Scatter diagram of the increased fluorescent intensity versus AFB2 concentration. Inset is the best linear calibration curve for a portion of the AFB2 concentration. (Data was collected for at least three times and the standard deviation was given.) Table 2 Recovery results for the added AFB2 from peanut oil samples obtained by the developed methods. (Data was collected for at least three times and the standard deviation was given.) Sample no.
Initial concentration (ng/L)
Added concentration (ng/L)
Detected concentration (ng/L)
Recovery ratio (%)
0 1 2 3 4 5
0 0 0 0 0 0
0 10 20 100 500 800
0 9.40 20.32 98.63 479.0 775.2
0 94.0 101.6 98.6 95.8 96.9
selected aptamer was used for the detection of AFB2 with a detection limit of 50 ng/L. And the spiked recovery experiments in peanut oil sample showed credible results which exhibited practical value. Acknowledgment This work was supported by the National S&T Support Program of China (2012BAK08B01), the National Natural Science Foundation
Bakirdere, S., Bora, S., Bakirdere, E. G., Aydin, F., Arslan, Y., Komesli, O. T., et al. (2012). Aflatoxin species: their health effects and determination methods in different foodstuffs. Central European Journal of Chemistry, 10, 675e685. Bankole, S. A., & Adebanjo, A. (1996). Biocontrol of brown blotch of cowpea caused by Colletotrichum truncatum with Trichoderma viride. Crop Protection, 15, 633e636. Bennett, J. W., & Klich, M. (2003). Mycotoxins. Clinical Microbiology Reviews, 16, 497e498. Berezovski, M., Musheev, M., Drabovich, A., & Krylov, S. N. (2006). Non-SELEX selection of aptamers. Journal of the American Chemical Society, 128, 1410e1411. Dalvi, R. R. (1986). An overview of aflatoxicosis of poultry: its characteristics, prevention and reduction. Veterinary Research Communications, 10, 429e443. Deng, H., Li, X. L., Peng, Q., Wang, X., Chen, J. P., & Li, Y. D. (2005). Monodisperse magnetic single-crystal ferrite microspheres. Angewandte Chemie International Edition, 44, 2782e2785. Duan, N., Wu, S. J., Chen, X. J., Huang, Y. K., & Wang, Z. P. (2012). Selection and identification of a DNA aptamer targeted to Vibrio parahaemolyticus. Journal of Agricultural and Food Chemistry, 60, 4034e4038. Eaton, D. L., & Groopman, J. D. (1994). In the toxicology of aflatoxins: Human health, veterinary, and agricultural significance. San Diego, CA: Academic Press, Inc. Eric, V., & Mark, B. (2009). Amide bond formation: beyond the myth of coupling reagents. Chemical Society Reviews, 38, 606e631. Famulok, M., Hartig, J. S., & Mayer, G. (2007). Functional aptamers and aptazymes in biotechnology, diagnostics, and therapy. Chemical Reviews, 107, 3715e3743. Famulok, M., & Mayer, G. (2011). Aptamer modules as sensors and detectors. Accounts of Chemical Research, 44, 1349e1358. Fang, X., & Tan, W. H. (2010). Aptamers generated from cell-selex for molecular medicine: a chemical biology approach. Accounts of Chemical Research, 43, 48e57. Gendloff, E. H., Casal, W. L., Ram, H. P., Tai, J. H., Pestka, J. J., & Hart, L. P. (1986). Hapteneprotein conjugates prepared by the mixed anhydride method: crossreactive antibodies in heterologous antisera. Journal of Immunological Methods, 92, 15e20. Gurbay, A., Sabuncuoglu, S. A., Girgin, G., Sahin, G., Yigit, S., Yurdakok, M., et al. (2010). Exposure of newborns to aflatoxin M-1 and B-1 from mothers' breast milk in Ankara, Turkey. Food and Chemical Toxicology, 48, 314e319. Hartley, R. D., Nesbitt, B. F., & O'Kelly, J. (1963). Toxic metabolites of Aspergillus flavus. Nature, 198, 1056e1058. Heperkan, D., Somuncuoglu, S., Karbancioglu-Guler, F., & Mecik, N. (2012). Natural contamination of cyclopiazonic acid in dried figs and co-occurrence of aflatoxin. Food Control, 23, 82e86. Huang, C. J., Lin, H. I., Shiesh, S. C., & Lee, G. B. (2010). Integrated microfluidic system for rapid screening of CRP aptamers utilizing systematic evolution of ligands by exponential enrichment (SELEX). Biosensors and Bioelectronics, 25, 1761e1766. Iliuk, A. B., Hu, L., & Tao, W. A. (2011). Aptamer in bioanalytical applications. Analytical Chemistry, 83, 4440e4452. Ito, Y., Kawazoe, N., & Imanishi, Y. (2000). In vitro selected oligonucleotides as receptors in binding assays. Methods e A Companion to Methods in Enzymology, 22, 107e114. Jiang, Y., Jolly, P. E., Ellis, W. O., Wang, J. S., Phillips, T. D., & Williams, J. H. (2005). Aflatoxin B1 albumin adduct levels and cellular immune status in Ghanaians. International Immunology, 17, 807e814. Kamika, I., & Takoy, L. L. (2011). Natural occurrence of aflatoxin B1 in peanut collected from Kinshasa, Democratic Republic of Congo. Food Control, 22, 1760e1764. Kensler, T. W., Roebuck, B. D., Wogan, G. N., & Groopman, J. D. (2011). Aflatoxin: a 50-year odyssey of mechanistic and translational toxicology. Toxicological Sciences, 120, S28eS48. Klich, M. A. (1998). Soil fungi of some low-altitude desert cotton fields and ability of their extracts to inhibit Aspergillus flavus. Mycopathologia, 142, 97e100. Mathews, D. H., Disney, M. D., Childs, J. L., Schroeder, S. J., Zuker, M., & Turner, D. H. (2004). Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proceedings of the National Academy of Sciences of the United States of America, 101, 7287e7292. Moss, M. O. (1998). Recent studies of mycotoxins. Journal of Applied Microbiology Symposium Supplement, 84, 62Se76S. Silva, C., Raquel, G., Collins, C. H., Grespan, B., & Carla, B. (2011). Capillary liquid chromatography: state of the art and current applications. Quimica Nova, 34, 841e849. Sweeney, M. J., & Dobson, A. D. (1998). Mycotoxin production by Aspergillus, Fusarium and Penicillium species. International Journal of Food Microbiology, 43, 141e158. Tuerk, C., & Gold, L. (1990). Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 249(4968), 505e510.
X. Ma et al. / Food Control 47 (2015) 545e551 Vinkenborg, J. L., Karnowski, N., & Famulok, M. (2011). Aptamers for allosteric regulation. Nature Chemical Biology, 7, 519e527. Wu, N. J., & Thompson, R. (2006). Fast and efficient separations using reversed phase liquid chromatography. Journal of Liquid Chromatography and Related Technologies, 29, 949e988.
551
Yu, J. J. (2012). Current understanding on aflatoxin biosynthesis and future perspective in reducing aflatoxin contamination. Toxins, 4, 1024e1057. Zhou, J., Battig, M. R., & Wang, Y. (2010). Aptamer-based molecular recognition for biosensor development. Analytical and Bioanalytical Chemistry, 398, 2471e2480.
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Selection, characterization and application of aptamers targeted to Aflatoxin B2 Xiaoyuan Ma a, b, Wenfeng Wang a, Xiujuan Chen a, Yu Xia a, b, Nuo Duan a, Shijia Wu a, b, Zhouping Wang a, b, * a b
State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, Wuxi 214122, PR China Synergetic Innovation Center of Food Safety and Nutrition, Jiangnan University, Wuxi 214122, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 9 January 2014 Received in revised form 18 July 2014 Accepted 19 July 2014 Available online 12 August 2014
Aflatoxins are naturally occurring mycotoxins that can contaminate foodstuffs and consequently affect human health. In this study, the systematic evolution of ligands by exponential enrichment (SELEX) technology was used to effectively screen DNA aptamers that recognize Aflatoxin B2 (AFB2) with high affinity and specificity. AFB2 was first combined with magnetic nanoparticles, which served as carriers, and then incubated with a library of single-stranded DNA (ssDNA). The entire selection process included incubation, separation, elution, PCR amplification and single chain preparation. The selection conditions were optimized. After 10 rounds of selection, 30 aptamer sequences were obtained and enriched. Homological analysis in combination with structural analysis as well as the affinity and specificity experiments revealed that aptamer sequence 17 showed the best affinity and specificity toward AFB2. The dissociation constants value for aptamer sequence 17 was 9.83 nM. And the specificity experiment results showed the binding between AFB2 aptamer with five other toxins was very week (did not exceed 18% compared to AFB2). The selected AFB2 aptamer was used to construct a fluorescent biosensor. The assay showed a wide linear range, with the AFB2 concentration ranging from 100 ng/L to 1800 ng/L and a detection limit of 50 ng/L. Additionally, the spiked recovery experiment of AFB2 in peanut oil sample exhibited a recovery ratio between 94.0% and 101.6% which showed good accuracy of the proposed aptamer-based bioassay. © 2014 Elsevier Ltd. All rights reserved.
Keywords: SELEX Aflatoxin B2 Aptamer Bioassay
1. Introduction Aflatoxins are highly toxic, teratogenic, mutagenic and carcinogenic metabolites produced by fungi of the genus Aspergillus, mainly by the species Aspergillus flavus, Aspergillus parasiticus and Aspergillus nomius (Klich, 1998; Moss, 1998; Sweeney & Dobson, 1998). Eighteen different types of aflatoxin species have been identified while aflatoxins B1, B2, G1, G2 and M1 are the major species (Bennett & Klich, 2003). Foodstuffs can be contaminated by aflatoxins while foods are growing, being harvested and finally while they are being stored (Bankole & Adebanjo, 1996). This contamination will negatively affect not only the economy but also human health (Kamika & Takoy, 2011). Studies have revealed that aflatoxin species show immunosuppressive effects as a result of the * Corresponding author. State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, Wuxi 214122, PR China. Tel./fax: þ86 510 85917023. E-mail address: [email protected] (Z. Wang). http://dx.doi.org/10.1016/j.foodcont.2014.07.037 0956-7135/© 2014 Elsevier Ltd. All rights reserved.
inhibition of DNA, RNA and protein synthesis through different mechanisms (Jiang et al., 2005; Kensler, Roebuck, Wogan, & Groopman, 2011). For example, aflatoxicosis may cause rapid death, while hepatocellular carcinoma develops as a chronic outcome when exposed to a high dose of aflatoxin. The U.S. Food and Drug Administration has set aflatoxin action levels in various foods and feedstuffs (Eaton & Groopman, 1994). Different methods have been established for the separation and detection of aflatoxins, including high performance liquid chromatography (HPLC), thin layer chromatography (TLC), enzyme linked immunosorbent assay (ELISA), etc (Bakirdere et al., 2012). HPLC is a widely used technique and has been coupled with different detectors during analysis (Silva, Raquel, Collins, Grespan, & Carla, 2011; Wu & Thompson, 2006). Fluorescent detectors are the most popular choice for Aflatoxins B2 and G2 because these molecules are naturally strongly fluorescent due to the high conjugation of their oxygenated structures (Gurbay et al., 2010; Heperkan, Somuncuoglu, Karbancioglu-Guler, & Mecik, 2012). Chromatographic methods require expensive instrumentation and
546
X. Ma et al. / Food Control 47 (2015) 545e551
expertise in the field of chromatography. ELISA as immunoassaybased sensors is another practical alternative for the determination of aflatoxin species. ELISA is a rapid and sensitive technique for the routine analysis of food products. Aptamers have been widely investigated as a biorecognition ligand. They are generated using an in vitro SELEX (systematic evolution of ligands by exponential enrichment) technology, which was first reported by Tuerk in 1990 (Tuerk & Gold, 1990). An aptamer is defined as the obtained oligonucleotide sequence that can bind to a wide range of target molecules, ranging from protein molecules, nucleic acids and whole bacterial cells to small molecules such as peptides, amino acids, toxins and even metal ions (Zhou, Battig, & Wang, 2010). Aptamers show a high affinity and specificity which make them ideal alternatives to antibodies for a variety of applications. Additionally, aptamers possess a small size, rapid and reproducible synthesis, simple and controllable modifications, nontoxicity, a lack of immunogenicity, etc (Famulok, Hartig, & Mayer, 2007; Fang & Tan, 2010). These attributes largely expand the scope of applications for SELEX technology (Famulok & Mayer, 2011; Iliuk, Hu, & Tao, 2011; Vinkenborg, Karnowski, & Famulok, 2011). Traditional SELEX technology consists of incubation, separation, dissociation and PCR amplification processes, which usually require 8e20 rounds of screening. After 20 years of development, the SELEX technology has been gradually developed, enriched and improved. The emerging SELEX technologies include negative screening, reverse screening, automation technology, etc (Berezovski, Musheev, Drabovich, & Krylov, 2006; Huang, Lin, Shiesh, & Lee, 2010; Ito, Kawazoe, & Imanishi, 2000). In this study, SELEX was used for the successful selection of the Aflatoxin B2 (AFB2) aptamer. Aminated Fe3O4 magnetic nanoparticles served as the carrier to fix the activated AFB2. Then, the target was incubated with an 80 bp random ssDNA library. Using 10 repeated selection and amplification rounds, consisting of incubation, washing, elution, PCR amplification, PAGE electrophoresis, purification, single-chain preparation, purification and the incubation cycle, the ssDNA sequences with a high affinity and specificity to AFB2 were obtained. This entire process, including the reaction conditions, was optimized. The ssDNA sequences were analyzed for their homology, structures, dissociation constant, affinity and specificity to finally obtain the AFB2 aptamer. 2. Materials and methods 2.1. Materials AFB2, AFB1, AFG1, AFG2, OTA, FB1, carboxymethoxylamine hemihydrochloride ((C2H5NO3)2HCl), carbodiimide (EDC, C8H17N3$HCl), sulfo-NHS acetate and polyacrylamide were purchased from Sigma (San Francisco, USA). Pyridine (C5H5N), methanol (CH2O), dimethylformamide (C3H7NO), trichloromethane (CHCl3), 1,6-hexy lenediamime (C6H16N2), ferric chloride (FeCl3$6H2O), ethylene glycol (C2H6O2), ethanol (C2H5OH), sodium chloride (NaCl), potassium chloride (KCl), calcium chloride (CaCl2), magnesium chloride hexahydrate (MgCl2), sodium hydrogen phosphate (Na2HPO4), potassium phosphate monobasic (KH2PO4), Tween 20 (C58H114O26), trishydroxymethyl aminomethane (Tris, C4H11NO3), hydrochloric acid (HCl), bromophenol blue (C19H10Br4O5S), sucrose (C12H22O11), bovine serum albumin (BSA), and petroleum ether were purchased from the Chinese Medicine Shanghai Chemical Reagent Company. Taq plus DNA polymerase, deoxy-ribonucleoside triphosphate (dNTP) and 10 PCR amplification buffer were purchased from the Shanghai Sangon Biological Science & Technology Company (Shanghai, China). Peanut oil was bought from the local supermarket. The oligonucleotide sequences were all synthesized by Shanghai Sangon Biological Science & Technology Company (Shanghai,
China). The initial ssDNA library and primers were obtained from Integrated DNA Technologies (Coralville, IA). The ssDNA library for aptamer selection: 50 -AGCAGCACAG AGGTCAGATG(N40)CCTATGCGTGCTACCGTGAA-30 ; Primer I: 50 -AGCAGCACAGAGGTCAGATG-30 ; Primer II: 50 -PO4-TTCACGGTAGCACGCATAGG-30 .
2.2. The connection between Aflatoxin B2 and aminated magnetic nanoparticles Activation of AFB2 was conducted as described by Morgan (Gendloff et al., 1986) with some modifications. Four hundred microliters of AFB2 (2.5 mg/mL, dissolved in N,N-dimethylformamide), 2 mg of carboxymethoxylamine hemihydrochloride and 12 mL of a mixed solution (2 mL of water, 2 mL of pyridine and 8 mL of methanol) were added to a round-bottom flask for oil bath refluxing at 85 C (3 h). The solvent was removed by distillation using a rotary evaporator. The resulting precipitate was dissolved in 1 mL of chloroform. Thin-layer chromatography was used to compare the activated AFB2 with the standard AFB2 (the volume ratio of the developing agent was methanol:chloroform ¼ 1:9). Then, the chloroform was removed by distillation, and the activated AFB2 was dissolved in N,N-dimethylformamide for further use. Aminated magnetic nanoparticles were prepared as described by Deng et al. (2005) with some modifications: 6.5 g of 1,6hexanediamine, 2.0 g of anhydrous sodium acetate and 1.0 g of FeCl3$6H2O were dissolved in 30 mL of ethylene glycol with vigorous stirring at 50 C for 1 h until the solution became clear, at which time it was transferred to an autoclave. The autoclave was placed in an oven for completion of the reaction (198 C, 6 h) and subsequently cooled to room temperature. The liquid in the reaction vessel was washed 3 times with water and ethanol and then dried at 50 C, forming a powder. The powder was dissolved in a PBS-T buffer for further use. The connection between AFB2 and aminated magnetic nanoparticles was conducted under the amidation reaction using EDC (catalyzer) and sulfo-NHS (stabilizer) which referred to published work (Eric & Mark, 2009). One milliliter of EDC (5 mg/mL) was added dropwise to the activated AFB2 and heated at 37 C for 5 min to form unstable intermediate product. The aminated magnetic nanoparticles were added to avoid light reaction at 37 C for 3 h. Then, 1 mL of sulfo-NHS acetate (10 mg/mL) was added for subsequent reactions (2 h). Under the amidation reaction, the reaction product (AFB2 covered on the surface of magnetic nanoparticles) was collected magnetically and dissolved in a PBS-T buffer at 4 C for further use (AFB2-MNPs). 2.3. The Aflatoxin B2 aptamer selection SELEX was carried out using a procedure based on previous work (Duan, Wu, Chen, Huang, & Wang, 2012). A random ssDNA library at a concentration of 2 nmol (second round begins with each addition of 200 pmol) was added to 500 mL of BB buffer (pH 7.0:100 mmol/L NaCl, 20 mmol/L TriseHCl pH 7.6, 2 mmol/L MgCl2, 5 mmol/L KCl, 1 mmol/L CaCl2 and 0.02% Tween 20) and placed in a water bath at 95 C for 5 min and then in an ice bath for 5 min. Afterwards, 200 mL of the AFB2-MNPs was collected from the bottom of the tube, and the supernatant was discarded. The ice bath product was then added for incubation at 37 C for 2 h. A magnet was used to remove the supernatant. The precipitant was washed five times with 1 mL of BB buffer. Then, the elution buffer, 1 PCR (100 mL), was placed in the water bath for 5 min and then in the ice bath for 5 min. The eluent was collected using a magnet. This
X. Ma et al. / Food Control 47 (2015) 545e551
elution process was repeated, and the eluents were combined for the PCR amplification template. The bare MNPs were used as negative control to incubated with the DNA pool aiming to reduce the DNA sequences which can bind to MNPs. The PCR amplification conditions were as follows: 5 mL of PCR template, 1 mL of primer I, 1 mL of primer II, 1 mL of dNTP, 5 mL of 10 PCR buffer, 36.5 mL of sterile water, 0.5 mL of Taq enzyme, 95 C for 5 min, 95 C for 30 s, 60 C for 40 s, 72 C for 30 s, repeated 30 cycles, 72 C for 7 min and 12 C for 2 min. The polyacrylamide gel electrophoresis was used to characterize the PCR amplification product. This aptamer selection process was repeated for 10 rounds. 2.4. Cloning, sequencing and analysis for the Aflatoxin B2 aptamer The product from the final round of the PCR amplification was cloned and sequenced by the Shanghai Sangon Biotech Company, China. Structural information of the 30 AFB2-aptamer sequences obtained was analyzed using DNAMAN (a highly integrated molecular biology application software which was developed by Lynnon Biosoft Company, USA) and RNA Structure 4.2 software (a Windows program for the prediction and analysis of RNA secondary structure). The affinity experiment was conducted as follows. Eight AFB2aptamer sequences with low energy levels and stable structures were synthesized with biotin labeled aptamers by the Shanghai Sangon Biotech Company, China. The biotin labeled aptamers (20 mol/L, 40 mL) were connected with avidin-modified Fe3O4 MNPs (1 mg/mL, 100 mL) to form the aptamer probe and were then diluted to concentrations of 10 nM, 20 nM, 40 nM, 60 nM, 80 nM, 100 nM, 120 nM and 150 nM using the BB buffer. Fe3O4 MNPs were then blocked with a blocking buffer (1% BSA in PBS) for 1 h at room temperature to prevent the appearance of false positive signals (matrix effect). The excess BSA was removed by magnetic separation. Then, AFB2 was added to yield a final concentration of 1000 ng/L. The mixture was incubated at 37 C for 1 h. The supernatant was removed by magnetic separation, and the precipitate was washed 5 times with BB buffer. Then, the fluorescent intensity was measured. 2.5. Specificity and sensitivity analysis of AFB2 aptamer The three aptamers with the best affinities were selected to perform the specificity experiment. First, a 50 pM aptamer probe was prepared and the Fe3O4 MNPs were blocked with a blocking buffer as described in Section 2.4. The aptamer probe were then incubated with 50 pM AFB2, AFB1, AFG1, AFG2, FB1 and OTA at 37 C for 1 h. The supernatant was removed by magnetic separation, and the precipitate was washed 5 times with BB buffer. Then, the fluorescent intensity was measured. 2.6. Detection of AFB2 using AFB2 aptamer The AFB2 aptamer with the best affinity and specificity was used for the detection application. Then, 300 mL aptamer probe combined with FAM-labeled (FAM refers to carboxy fluorescein. It is a kind of commonly used fluorophores for labeling.) ssDNA (1 mg/ mL) with the complementary sequences and 700 mL of varying concentrations of AFB2 (50 ng/L, 90 ng/L, 100 ng/L, 300 ng/L, 500 ng/L, 800 ng/L, 1000 ng/L, 1300 ng/L, 1500 ng/L, 1800 ng/L, and 2000 ng/L) were incubated at 37 C for 1 h. Among which, the blocking step was conducted as described in Section 2.4. The supernatant was collected by magnetic separation and washed with BB buffer before measuring the fluorescence generated from the fluorophore FAM. The fluorescent intensity was measured by F7000 fluorescence spectrophotometer (Hitachi, Japan).
547
2.7. Peanut oil sample detection Peanut oil bought from the local supermarket was used for the food sample detection. First, different concentrations of AFB2 were added to the oil sample to make their final concentrations at 0 ng/L, 10 ng/L, 20 ng/L, 100 ng/L, 500 ng/L, 800 ng/L 4 g oil sample dispersed in 20 mL petroleum ether was placed in a separating funnel. Then 20 mL methanol/water (the volume ratio was 55:45) solution was added for full shaking. After standing stratification, the lower methanol/water layer was collected in an evaporating dish. Another 5 mL methanol/water solution was used for extraction once again. The lower methanol/water layer was merged with the first extraction process. Then the evaporating dish was place in a fuming cupboard for evaporating dryness under a 65 C water bath. BB buffer was used to dissolve the dry residue after evaporation. At last, it was used as real sample for detection using the above constructed method. Among which, the blocking step of Fe3O4 MNPs was conducted as described in Section 2.4 to prevent the matrix effect. 2.8. Statistical analysis All the analytical performance was repeated for at least three times to ensure the stability and reliability of the data. The screened aptamer sequences were analyzed for their structural homology using DNAMAN software (Lynnon Biosoft Company, USA) and lowest energy analysis using the RNA Structure 4.2 software (a Windows version for the prediction and analysis of RNA secondary structure developed by Mathews et al., 2004). The dissociation constants were calculated using GraphPad Prism 5 software (GraphPad Software, San Diego, USA). 3. Results and discussion 3.1. Activation of AFB2 and the connection to aminated MNPs The selection of aptamers for small molecules is relatively difficult because target materials and small molecules are difficult to separate using conventional separation methods, such as centrifugation and capillary electrophoresis, thus influencing the subsequent experiment. Generally, small molecules must be immobilized on a carrier for screening. AFB2 does not possess amino, carboxyl, hydroxyl or other active groups; therefore, activation treatment is necessary before it is immobilized onto a carrier. The C3 position of the cyclopentanone molecule was used as the active site, and the carbonyl group was converted to a carboxyl group. Magnetic nanoparticles have been widely used in the bioanalytical field for their good biocompatibility, simple operation, high sensitivity, and their high enrichment of samples under the effect of an external magnetic field, etc. Therefore, aminated magnetic Fe3O4 nanoparticles were prepared as the carrier for AFB2 using a hydrothermal method. The diameter of the nanoparticles was approximately 25e50 nm, and they exhibited a spherical morphology with single-crystal structures. AFB2 carboxyl compounds can rapidly react with EDC (which was played as activating reagents) to form unstable intermediate compounds and subsequently react with amino groups in the Fe3O4 nanoparticles to form a stable product (AFB2-MNPs). Because AFB2 possesses fluorescent properties (Dalvi, 1986; Hartley, Nesbitt, & O'Kelly, 1963), a fluorescence microscope was used to characterize the successful connection between the MNPs and AFB2, as shown in Fig. 1(A). The results indicated that when the concentrations of activated AFB2 and MNPs were equal (1 mg/mL), the fluorescent intensity reached a maximum when the volume ratio
548
X. Ma et al. / Food Control 47 (2015) 545e551
was 1:5 (MNPs to AFB2), and this intensity remained almost constant even when more AFB2 was added (depicted in Fig. 1(B)). Therefore, the optimized volume ratio for MNPs to AFB1 was determined to be 1:5. 3.2. AFB2 aptamer selection and sequence analysis The existence of a considerable number of single-stranded oligonucleotides is the basis for the successful selection of target aptamers. The ssDNA library in our experimental design consisted of a central randomized sequence of 80 nucleotides. The reaction conditions used during each of the selection steps affect the ability to obtain the correct sequence. In this study, the incubation time, washing times, PCR annealing temperature and number of cycles were investigated. An adequate incubation time will ensure full integration between ssDNA and AFB2. Complete washing is important for removing all the unbound ssDNA sequences. The PCR annealing temperature proved to be especially critical because partial hybridization of the random regions with themselves can be self-priming for Taq polymerase and lead to nonspecific high-molecular-weight PCR products. Additionally, nonspecific products might appear with increased cycles during the PCR amplification process. The optimization experimental results are shown in Figs. 2 and 3. The gel electrophoresis graph shown in Fig. 3 indicates that a single and correct band was obtained when the annealing temperature was 65 C and the number of cycles was 30. As shown in Fig. 3(A), the amount of ssDNA attached to AFB2 increased when the incubation time ranged from 30 to 120 min, and then it remained constant with only slight changes. Therefore, the optimal incubation time was determined to be 120 min. The data in Fig. 3(B) shows that the amount of ssDNA in the washing solution decreased to a very low level after two washings. To remove all the unbound ssDNA sequences, 4 washing processes were performed. After 10 selection rounds, the 30 AFB2 aptamer sequences obtained were analyzed for their structural homology using DNAMAN software and lowest energy analysis using the RNA Structure 4.2 software. The aptamers were divided into eight families, and one representative stable aptamer was selected from each group. The eight representative aptamer sequences and their dissociation constants (calculated using GraphPad Prism 5 software) are described in Table 1. 3.3. Affinity and specificity determination Aptamers can be folded to form different secondary structures, such as hairpin, hydrocarbon loop and pocket structures. These
Fig. 2. Optimization of the PCR conditions.
special structures may be intensely associated with the high affinity and specificity effects. The dissociation constant (Kd, shown in Table 1) represents the affinity for of the aptamer toward AFB2. Lower Kd values represented higher aptamer affinities to AFB2. The dissociation results showed that aptamer sequences 1, 17, and 25 had better affinities towards AFB2 than the other sequences, with Kd values of 24.25 nM, 9.83 nM, and 16.48 nM, respectively. Furthermore, aptamer 17 possessed the best affinity of the sequence. The corresponding fluorescent intensity curves with different concentrations of the aptamer sequence 17 probe are shown in Fig. 4, and the secondary structures for aptamer sequence 17 are also given. The best three aptamer sequences based on the affinity results were selected to complete the specificity experiment. The combination between AFB2-aptamer with AFB2 was defined as 100. As shown in Fig. 5, the connect effect between the AFB2-aptamer with the 5 other toxins did not exceed 18%, especially for AFB1, although its structure is extremely similar to that of AFB2. The specificity for the AFB2 aptamer was good, and the best affinity and specificity sequence were obtained with sequence 17. 3.4. Application for AFB2 aptamer and peanut oil sample detection The AFB2 aptamer with high affinity and specificity was used to form an aptamer probe. A separate FAM-labeled ssDNA possessing a complementary nucleic acid sequence toward aptamer sequences was synthesized that could hybridize with the aptamer probe. When the target AFB2 was added to the system, the aptamer was preferably bound to the AFB2, displacing the FAM-labeled ssDNA sequence. The fluorescence of the supernatant was measured after collecting the precipitate with a magnet. The fluorescent intensity varied linearly according to the different concentrations of AFB2. The scatter diagram of the fluorescent intensity versus the amount of AFB2 and the corresponding best linear calibration fit are
Fig. 1. (A) Fluorescence image of the amine-functionalized Fe3O4 linked AFB2. (B) Effect of AFB2 concentration on the magnetic nanoparticles based on fluorescent intensity. (Data was collected for at least three times and the standard deviation was given.)
X. Ma et al. / Food Control 47 (2015) 545e551
549
Fig. 3. Optimization of the incubation time (A) and washing time (B). (Data was collected for at least three times and the standard deviation was given.)
Table 1 Sequence of tested aptamers and the estimated Kd value. No.
Sequences
Kd (nM)
1 17 25 14 27 13 26 23
AGCAGCACAGAGGTCAGATGGAGCTTCCGAAGTATAAACGAATTAAGTAACGGCGGTTCTCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGCTGACACCCTGGACCTTGGGATTCCGGAAGTTTTCCGGTACCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGTGCATCGGGGTTCGATGCTAGTAAGGGCCATTCGGAATATCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGAGGGCGGCGGTCATGAGCTCAGGGGTTTAGGGACAAATCTCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGAATTTCGGATCCGGTAATGGTCCTGCATACCTTAAGTGGTCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGTAATCCAGTAACGACTCTTTTAATACTCGACTGCACTCCCCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGTTTAGGATCGAAATTCCGGTTGCAAGTTTTAACGCAACTGCCTATGCGTGCTACCGTGAA AGCAGCACAGAGGTCAGATGGTCACGTACTTCTTAAAGTCGATCGCGTGCTGGTTAAATCCCTATGCGTGCTACCGTGAA
24.25±3.06 9.83±0.99 16.48±1.83 92.87±14.86 30.56±4.23 38.79±5.99 32.37±2.91 58.46±7.01
depicted in Fig. 6. A good linear relationship was obtained when the AFB2 ranged from 100 to 1800 ng/L. The linear equation was y ¼ 7.8495x þ 1662.3, with an R2 ¼ 0.9961. The detection limit was 50 ng/L. Additionally, the accuracy of AFB2 detection in realistic food commodities (peanut oil) was also evaluated by determining the recovery of AFB2 by the above constructed method using selected AFB2 aptamer, into which a known quantity of AFB2 was added. Peanuts are the most likely grain to be contaminated by A. flavus. The study on the aflatoxin content in peanut oil is of practical significance (Yu, 2012). As shown in Table 2, the recoveries were between 94.0% and 101.6%, indicating good accuracy of the proposed aptamer-based bioassay for AFB2 detection.
4. Conclusion In this study, the AFB2 aptamer was successfully obtained with high affinity and specificity. SELEX technology was used for the screening process. MNPs were prepared and utilized as the carrier for the AFB2 aptamer. Combined with SELEX, the target AFB2 was incubated with an ssDNA library that was synthesized in vitro. After 10 rounds of the selection and amplification process, ssDNA sequences with high affinity and specificity to AFB2 were enriched. Their sequences, homological properties, secondary structures, dissociation constant, affinity and specificity characteristics were analyzed. The results revealed that aptamer sequence 17 exhibited the best affinity and specificity toward other sequences. Finally, the
Fig. 4. The binding saturation curve for aptamer 17 and its corresponding secondary structure.
550
X. Ma et al. / Food Control 47 (2015) 545e551
of China (Grant 21375049), the S&T Supporting Project of Jiangsu (BE2011621, BE2012614), the Research Fund for the Doctoral Program of Higher Education (20110093110002), JSCIQ_2012IK166, JUSRP51309A and NCET-11-0663. References
Fig. 5. Specificity of the AFB2 aptamer to AFB1, AFG1, AFG2, OTA and FB1. (Data was collected for at least three times and the standard deviation was given.)
Fig. 6. Scatter diagram of the increased fluorescent intensity versus AFB2 concentration. Inset is the best linear calibration curve for a portion of the AFB2 concentration. (Data was collected for at least three times and the standard deviation was given.) Table 2 Recovery results for the added AFB2 from peanut oil samples obtained by the developed methods. (Data was collected for at least three times and the standard deviation was given.) Sample no.
Initial concentration (ng/L)
Added concentration (ng/L)
Detected concentration (ng/L)
Recovery ratio (%)
0 1 2 3 4 5
0 0 0 0 0 0
0 10 20 100 500 800
0 9.40 20.32 98.63 479.0 775.2
0 94.0 101.6 98.6 95.8 96.9
selected aptamer was used for the detection of AFB2 with a detection limit of 50 ng/L. And the spiked recovery experiments in peanut oil sample showed credible results which exhibited practical value. Acknowledgment This work was supported by the National S&T Support Program of China (2012BAK08B01), the National Natural Science Foundation
Bakirdere, S., Bora, S., Bakirdere, E. G., Aydin, F., Arslan, Y., Komesli, O. T., et al. (2012). Aflatoxin species: their health effects and determination methods in different foodstuffs. Central European Journal of Chemistry, 10, 675e685. Bankole, S. A., & Adebanjo, A. (1996). Biocontrol of brown blotch of cowpea caused by Colletotrichum truncatum with Trichoderma viride. Crop Protection, 15, 633e636. Bennett, J. W., & Klich, M. (2003). Mycotoxins. Clinical Microbiology Reviews, 16, 497e498. Berezovski, M., Musheev, M., Drabovich, A., & Krylov, S. N. (2006). Non-SELEX selection of aptamers. Journal of the American Chemical Society, 128, 1410e1411. Dalvi, R. R. (1986). An overview of aflatoxicosis of poultry: its characteristics, prevention and reduction. Veterinary Research Communications, 10, 429e443. Deng, H., Li, X. L., Peng, Q., Wang, X., Chen, J. P., & Li, Y. D. (2005). Monodisperse magnetic single-crystal ferrite microspheres. Angewandte Chemie International Edition, 44, 2782e2785. Duan, N., Wu, S. J., Chen, X. J., Huang, Y. K., & Wang, Z. P. (2012). Selection and identification of a DNA aptamer targeted to Vibrio parahaemolyticus. Journal of Agricultural and Food Chemistry, 60, 4034e4038. Eaton, D. L., & Groopman, J. D. (1994). In the toxicology of aflatoxins: Human health, veterinary, and agricultural significance. San Diego, CA: Academic Press, Inc. Eric, V., & Mark, B. (2009). Amide bond formation: beyond the myth of coupling reagents. Chemical Society Reviews, 38, 606e631. Famulok, M., Hartig, J. S., & Mayer, G. (2007). Functional aptamers and aptazymes in biotechnology, diagnostics, and therapy. Chemical Reviews, 107, 3715e3743. Famulok, M., & Mayer, G. (2011). Aptamer modules as sensors and detectors. Accounts of Chemical Research, 44, 1349e1358. Fang, X., & Tan, W. H. (2010). Aptamers generated from cell-selex for molecular medicine: a chemical biology approach. Accounts of Chemical Research, 43, 48e57. Gendloff, E. H., Casal, W. L., Ram, H. P., Tai, J. H., Pestka, J. J., & Hart, L. P. (1986). Hapteneprotein conjugates prepared by the mixed anhydride method: crossreactive antibodies in heterologous antisera. Journal of Immunological Methods, 92, 15e20. Gurbay, A., Sabuncuoglu, S. A., Girgin, G., Sahin, G., Yigit, S., Yurdakok, M., et al. (2010). Exposure of newborns to aflatoxin M-1 and B-1 from mothers' breast milk in Ankara, Turkey. Food and Chemical Toxicology, 48, 314e319. Hartley, R. D., Nesbitt, B. F., & O'Kelly, J. (1963). Toxic metabolites of Aspergillus flavus. Nature, 198, 1056e1058. Heperkan, D., Somuncuoglu, S., Karbancioglu-Guler, F., & Mecik, N. (2012). Natural contamination of cyclopiazonic acid in dried figs and co-occurrence of aflatoxin. Food Control, 23, 82e86. Huang, C. J., Lin, H. I., Shiesh, S. C., & Lee, G. B. (2010). Integrated microfluidic system for rapid screening of CRP aptamers utilizing systematic evolution of ligands by exponential enrichment (SELEX). Biosensors and Bioelectronics, 25, 1761e1766. Iliuk, A. B., Hu, L., & Tao, W. A. (2011). Aptamer in bioanalytical applications. Analytical Chemistry, 83, 4440e4452. Ito, Y., Kawazoe, N., & Imanishi, Y. (2000). In vitro selected oligonucleotides as receptors in binding assays. Methods e A Companion to Methods in Enzymology, 22, 107e114. Jiang, Y., Jolly, P. E., Ellis, W. O., Wang, J. S., Phillips, T. D., & Williams, J. H. (2005). Aflatoxin B1 albumin adduct levels and cellular immune status in Ghanaians. International Immunology, 17, 807e814. Kamika, I., & Takoy, L. L. (2011). Natural occurrence of aflatoxin B1 in peanut collected from Kinshasa, Democratic Republic of Congo. Food Control, 22, 1760e1764. Kensler, T. W., Roebuck, B. D., Wogan, G. N., & Groopman, J. D. (2011). Aflatoxin: a 50-year odyssey of mechanistic and translational toxicology. Toxicological Sciences, 120, S28eS48. Klich, M. A. (1998). Soil fungi of some low-altitude desert cotton fields and ability of their extracts to inhibit Aspergillus flavus. Mycopathologia, 142, 97e100. Mathews, D. H., Disney, M. D., Childs, J. L., Schroeder, S. J., Zuker, M., & Turner, D. H. (2004). Incorporating chemical modification constraints into a dynamic programming algorithm for prediction of RNA secondary structure. Proceedings of the National Academy of Sciences of the United States of America, 101, 7287e7292. Moss, M. O. (1998). Recent studies of mycotoxins. Journal of Applied Microbiology Symposium Supplement, 84, 62Se76S. Silva, C., Raquel, G., Collins, C. H., Grespan, B., & Carla, B. (2011). Capillary liquid chromatography: state of the art and current applications. Quimica Nova, 34, 841e849. Sweeney, M. J., & Dobson, A. D. (1998). Mycotoxin production by Aspergillus, Fusarium and Penicillium species. International Journal of Food Microbiology, 43, 141e158. Tuerk, C., & Gold, L. (1990). Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science, 249(4968), 505e510.
X. Ma et al. / Food Control 47 (2015) 545e551 Vinkenborg, J. L., Karnowski, N., & Famulok, M. (2011). Aptamers for allosteric regulation. Nature Chemical Biology, 7, 519e527. Wu, N. J., & Thompson, R. (2006). Fast and efficient separations using reversed phase liquid chromatography. Journal of Liquid Chromatography and Related Technologies, 29, 949e988.
551
Yu, J. J. (2012). Current understanding on aflatoxin biosynthesis and future perspective in reducing aflatoxin contamination. Toxins, 4, 1024e1057. Zhou, J., Battig, M. R., & Wang, Y. (2010). Aptamer-based molecular recognition for biosensor development. Analytical and Bioanalytical Chemistry, 398, 2471e2480.