- Email: [email protected]
Au-IDE MSPQC H37Rv sensor
Author’s Accepted Manuscript Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor XiaoQing Zhang, Ye Feng, QiongQiong Yao, Fengjiao He www.elsevier.com/locate/bios
PII: DOI: Reference:
S0956-5663(17)30361-5 http://dx.doi.org/10.1016/j.bios.2017.05.043 BIOS9756
To appear in: Biosensors and Bioelectronic Received date: 8 March 2017 Revised date: 11 May 2017 Accepted date: 23 May 2017 Cite this article as: XiaoQing Zhang, Ye Feng, QiongQiong Yao and Fengjiao He, Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv s e n s o r , Biosensors and Bioelectronic, http://dx.doi.org/10.1016/j.bios.2017.05.043 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor XiaoQing Zhang1, 2, Ye Feng1, QiongQiong Yao1, Fengjiao He1* 1 State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha, China, 410082 2 School of Pharmacy, Hunan University of Chinese Medicine, Changsha, China, 410208 * Corresponding author. Tel.: +86 0731 88641495 E-mail address: [email protected] Abstract A rapid and accurate detection method for Mycobacterium tuberculosis (M. tuberculosis) is essential for effectively treating tuberculosis. However, current detection methods cannot meet these clinical requirements because the methods are slow or of low specificity. Consequently, a new highly specific ssDNA aptamer against M. tuberculosis reference strain H37Rv was selected by using the whole-cell systematic evolution of ligands by exponential enrichment technique. The selected aptamer was used to construct a fast and highly specific H37Rv sensor. The probe was produced by immobilizing thiol-modified aptamer on an Au interdigital electrode (Au-IDE) of a multichannel series piezoelectric quartz crystal (MSPQC) through Au-S bonding, and then single-walled carbon nanotubes (SWCNTs) were bonded on the aptamer by π-π stacking. SWCNTs were used as a signal indicator because of their considerable difference in conductivity compared with H37Rv. When H37Rv is present, it replaces the SWCNTs because it binds to the aptamer much more strongly than SWCNTs do. The replacement of SWCNTs by H37Rv resulted in a large change in the electrical properties, and this change was detected by the MSPQC. The proposed sensor is highly selective and can distinguish H37Rv from Mycobacterium smegmatis (M. smegmatis) and Bacillus Calmette-Guerin vaccine (BCG).The detection time was 70 min and the detection limit was 100 cfu/mL. Compared with conventional methods, this new SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor was specific, rapid, and sensitive, and it holds great potential for the early detection of H37Rv in clinical diagnosis. Keywords: MSPQC, H37Rv Aptamer, Single-walled carbon nanotubes. 1
1. Introduction Tuberculosis is an infectious disease mainly caused by Mycobacterium tuberculosis. Gaps in testing for tuberculosis and reporting new cases remain major challenges. In 2015, it was estimated that of the 10.4 million new cases worldwide, only 6.1 million were detected and officially notified, leaving a shortfall of 4.3 million cases. This gap resulted from under-diagnosis in countries with major barriers to detecting M. Tuberculosis (World Health Organization, 2016). Consequently, an economical, fast, and accurate detection method for M. tuberculosis is urgently needed for the prevention and control of tuberculosis(Boehme et al., 2010). The current detection methods include culture and culture-independent methods. At present, the culture method is the gold standard for M. tuberculosis detection. However, it is time-consuming and can take up to 4–6 weeks to yield a result (Andersen et al., 2000; Tortoli et al., 2002; Mejia et al., 1999). Even automatic incubation detection systems, such as the BACTEC MGIT 960, which can shorten the detection time to 10 days, still do not meet the requirement for early clinical diagnosis. Furthermore, these tests cannot directly differentiate between M. tuberculosis and non-tuberculosis mycobacterial species (Morcillo et al., 2010). Among culture-independent methods, microscopic examination of direct smears with the Ziehl–Neelsen stain is widely used in tuberculosis diagnosis. However, this approach cannot differentiate between M. tuberculosis and non-tuberculosis mycobacterial species, because all mycobacterial species are positive on Ziehl–Neelsen staining. Moreover, immunological detection methods are not commonly used because of the intractable isolation of monoclonal antibodies and costly processing (Dheda et al., 2010; Dheda et al. 2009; Kashyap et al., 2005; Houghton et al., 2002; Feng et al., 2011). Therefore, there is an urgent need for an economical, rapid, and species-specific method for the detection of M. tuberculosis. Aptamers are single-strand oligonucleotide molecules with high affinity and high specificity to their target. They are evolved from random oligonucleotide pools by a process called the systematic evolution of ligands by exponential enrichment (SELEX) (Tuerk and Gold, 1990; Ellington and Szostak, 1990). Aptamers have been generated against a wide variety of targets, including ions, small molecules, proteins, whole cells, viruses, and peptides (Sefah et al., 2010). On the basis of their target-recognition capability, selectivity, and affinity, aptamers can be likened to antibodies. However, aptamers with unique features have more flexibility in their development and range of applications (Wang et al., 2017; Chen et al., 2017; Shamsipura et al., 2017; Laurenson et 2
al., 2011). In this paper, a new H37Rv aptamer was selected in our lab. Because of their low cost, high sensitivity, and rapid response, MSPQC sensors based on the changes of electrical parameters in the detection system are widely used in microbial analysis. Our research group has designed a series of sensors based on the MSPQC system for detecting M. Tuberculosis (He and Zhang, 2002; He et al., 2002; Ren et al., 2008; Mi et al., 2012; He et al., 2016). These sensors employed the immunological detection method (which was expensive and based on the antigen–antibody reaction), the aptamer sensor method (which needed 96 h of training based on the culture filtrate protein CFP10-ESAT6), the culture method (which was based on the detection of volatile metabolic products), and the phage amplification method (which was also dependent on training). A novel MSPQC method for the detection of M. tuberculosis that does not require training is still needed to satisfy the clinical demand. SWCNTs are one-dimensional hollow nanostructure materials that exhibit useful electrical and chemical properties (Ding, et al., 2016; Wang et al., 2013; Nguyen Quoc et al.2013; Blondeau et al., 2011). SWCNTs are biocompatible and have been employed in the detection of DNA, proteins, and microorganisms in biology and biochemistry (Xia et al., 2017; Wu et al., 2017; Yoo et al., 2017). Here SWCNTs are used as an indicator. The current work resulted in a new SWCNT/aptamer/Au-IDE MSPQC sensor that was constructed using a newly selected H37Rv aptamer for the detection H37Rv.The sensor was highly specific, rapid, and inexpensive. The detection limit of the proposed sensor was 100 cfu/ mL and the detection time was 70 min. When the proposed sensor was used to detect H37Rv in 45 clinical samples, the detection results were not significantly different to those detected by the culture method. 2. Material and methods 2.1 Materials and medium Bacteria: H37Rv (ATCC27294) was obtained from the National Institute for the Control of Pharmaceutical and Products. M. smegmatis and BCG vaccine were purchased from the Institute of Microbiology, Chinese Academy of Sciences. Staphylococcus aureus (S. aureus), Escherichia coli (E. coli), Pseudomonas aeruginosa (P. aeruginosa), and Salmonella enteritidis (S. enteritidis) were bought from the National Institute for the Control of Pharmaceutical and Biological Production. Detection medium: The medium consisted of ammonium sulfate (0.5 g), sodium hydrogen phosphate (2.5 g), potassium dihydrogen phosphate (1 g), magnesium sulfate (0.05 g), zinc sulfate (0.001 g), calcium chloride(0.0005 g) copper sulfate (0.001 g), 3
sodium glutamate (0.5 g), sodium citrate (0.1 g), pyridoxine hydrochloride (0.001 g), biotin (0.0005 g), ferric ammonium citrate (0.04 g), Tween-80 (0.5 g) in 1 L of distilled water. The pH value was then adjusted to 7.2 with ammonia solution and the medium was separated into 95-mL and autoclaved at 121°C for 20 min. Then, 5 mL of 10% oleic acid−dextrose−catalase were added to the bottles. SWCNTs were obtained from Timesnano (Chengdu, China) and contained 2.73 wt%-COOH functionalized groups and ≤1.5 wt% ash. The average length was 100 μm and the average diameter was 1.0 nm. Sequence: The following sequences were synthesized by Shanghai Sangon Biological Engineering Technology and Services, Co., Ltd. (Shanghai, China): aptamer library 5′-GGGAGCTCAGAATAAACGCTCAA (N35) TTCGACATGAGGCCCGGATC -3′, forward primer 5′-GGGGAGCTCAGAATAAACGCTCAA-3′, the fluorescein isothiocyanate (FITC)-labeled forward primer FITC-5′-GGGAGCTCAGAATAAACGCT CAA, the reverse primer 5′-GATCCGGGCCTCATGTCGAA-3′ The used H37Rv aptamer was exactly Aptamer 1 and the sequenc: 5′-SH-GGGAGC TCAGAATAAACGCTCAACCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTGT TCGACATGAGGCCCGGATC-3′. Apparatus: The equipment used included an Eppendorf Master Cycler/Thermal Cycler (AG5331, Germany), an ultraviolet spectrophotometer (Tianmei Techcomp UV1100, China), a fluorescence spectrophotometer (LS55, Perkin Elmer, UK), and HP4192A impedance analyzer (Hewlett Packard, USA). The MSPQC was made in our laboratory (Fengjiao et al., 2016) (see Fig. S1). 2.2 Construction of the SWCNT/aptamer/Au-IDE Probe The unmodified Au-IDE was cleaned with piranha solution (V: V = 3: 1 H2SO4/30% H2O2) for 5 s, ultrasonically cleaned with ethanol for 5 min, and then rinsed with double-distilled water. To produce the self-assembled monolayer of aptamer on the gold electrode, 10 µM of 5′-SH-aptamer with 1 µM of mercaptoethanol was incubated overnight at 4 °C, cleaned with double-distilled water, and dried using N2. The prepared aptamer/Au-IDE was incubated in a carboxylated SWCNTs for 4h. Aptamers wrapped around the SWCNTs through π-π stacking interactions between the nucleotide bases and the SWCNTs sidewalls. Free SWCNTs were washed from the aptamer-Au-IDE surface by using Tris–HCl buffer solution. The Au-IDE was then rinsed with distilled water and dried with N2. The SWCNTs/aptamer/Au-IDE was then connected to the MSPQC for the detection of H37Rv. 4
2.3 Detection procedure A total of 45 clinical sputum specimens were collected from the Hunan Institute of Tuberculosis Control (Changsha, China). 2 mL of sputum sample solution were added to 4.0 mL of 4% sodium hydroxide solution in 15 mL centrifuge tubes and the tubes were sealed with a screw cap. The samples were dispersed using a vortex oscillator at 37 °C for 15 min. 9.0 mL of sterile phosphate buffer (0.067 mol/L, pH 6.8) were added to the tubes and mixed thoroughly, the tubes were then centrifuged at 4000 rpm for 15 min.The supernatant was discarded, and the sediment was washed using 15 mL of sterile PBS buffer and Middlebrook 7H9 medium. The detection sample solution was then ready for use. A total of 1 mL of processed sample solution was added to 4 mL of detection medium. Additionally, 1 mL H37Rv (1 × 106 cfu/mL) was added to 4 mL of detection medium as the positive control, and 5 mL of detection medium without H37Rv was used as the negative control. Frequency response curves were recorded by the MSPQC system. For comparison, 1.0 mL of sample treatment solution was inoculated in growth indicator tubes of a BACTECMGIT 960 automatic detection system. All positive results were confirmed in a timely manner by acid-fast smear analysis. All experiments described here were operated in class II biological safety cabinets, and all experimental wastes and utensils were washed after autoclaving. 3. Results and discussion 3.1 The strategy of building SWCNT/Aptamer/Au-IDE MSPQC H37Rv Sensor 3.1.1 Response mechanism of MSPQC to changes in electrical parameters The Au-IDE MSPQC system produced in our laboratory consisted of three sections: (I) the data acquisition device, (II) the culture system/thermostatic device, and (III) the single oscillation circuit system (quartz crystal, culture pool, and three-stage amplifier circuit in series) as shown in Fig. S1A. The bacteria culturing detection system includes eight culture cells and eight oscillating circuits with eight 9.0-MHz AT-cut quartz crystals. The frequency shift–time response curves of the eight samples were automatically recorded simultaneously. The Au-IDE electrode was made in-house. It comprised 12 fingers with lengths of 3000 μm and widths of 100 μm; the finger spacing was 100 μm. The equivalent circuit of the SWCNT/aptamer/Au-IDE MSPQC sensor is shown in Fig. S1B (a) where block I is the equivalent circuit of the piezoelectric sensor, block II is the equivalent circuit of the modified film on the surface of the IDE, and block III is the equivalent circuit of the solution. C0, Lq, Cq ,and Rq are the piezoelectric crystal static 5
capacitance (Shen et al., 1993), the motional inductance, the motional resistance, and the motional capacitance, respectively. Cf and Rf are the film capacitance and resistance, respectively, of the IDE resulting from the modified layers. Cs and Rs, respectively, are the equivalent capacitance and resistance of the solution. To simplify the calculation, the capacitance and resistance of the Au-IDE surface and solution are, respectively, combined as the total capacitance Ct and total resistance Rt, and the equivalent circuit was simplified as Fig. S1B (b). According to Tong et al. (2014), the frequency detected by an Au-IDE MSPQC has the following relationship:
F0Cq (2 F0 Rt2Ct ARt ) F F0 1 2 2 1 2 F0C0 Rt A 4 F0 Rt Ct (C0 Ct )
(1)
Where F is the oscillation frequency of the sensor at t min and F0 is the initial oscillation frequency. Except for Ct and Rt, the parameters were almost constant in our detection system. Consequently, F f ( Rt , Ct ) dF
F F dRt dCt Rt Ct
(2)
K1
A 4 2 F0 2Ct R2 t A2 4 F0Ct Rt F F02Cq 2 2 2 2 Rt 1 2 F0C0 Rt A 4 F0 Rt Ct (C0 Ct )
(3)
K2
1 4 2 F02Ct2 Rt2 4 A F0Ct Rt F 2 2 F03Cq 2 2 2 2 Ct 1 2 F0C0 Rt A 4 F0 Rt Ct (C0 Ct )
(4)
Eq. (2) can be rewritten as:
F K1 Rt K2 Ct
(5)
According to Eq (5), the frequency shift of the proposed sensor is affected not only by the medium solution resistance but also by the capacitance. In a high-conductivity detection solution, the values of Rt and Ct are affected by the electrical properties of the modification layer on the Au-IDE surface. Consequently, changes in the electrical properties of the electrode surface result in a sensitive response of the proposed sensor. 3.1.2 The strategy of building the SWCNT/Aptamer/Au-IDE MSPQC H37Rv Sensor In SWCNT/aptamer/Au-IDE probe, the selected aptamer against H37Rv was modified onto the Au-IDE electrode surface by Au-S bonding, and SWCNTs was binded to aptamer through π-π stacking interaction between the carbon nanotubes walls and the puric and pyrimidic bases, as shown in Fig. 1. In the presence of H37Rv, the stronger 6
interaction between H37Rv and H37Rv aptamer caused SWCNTs fell off from the aptamer. On the surface of Au-IDE probe, the complex of SWCNT-aptamer was substituted by the complex of H37Rv-aptamer. This induced the electrical properties change of the electrode, and resulted in frequency shift response of SPQC, as shown in Fig. 1, curve a. If SWCNTs was not modified, the surface change of Au-IDE probe was caused by the displacement of aptamer by H37Rv-aptamer complex. As no significant electrical properties difference between aptamer and H37Rv-aptamer complex, so frequency shift response caused by reaction was not obvious. In this case, SWCNTs were used as a signal indicator because of its considerable difference in conductivity compared with H37Rv. For comparison, the response curve of SWCNT/aptamer/Au-IDE probe in a negative sample (curve b) and that of an aptamer/Au-IDE probe (i.e., no SWCNTs) in a positive sample (curve c) are shown in Fig. 1. In curve c, the Au-IDE surface covered by aptamer was modified to become a complex of aptamer-H37Rv. However, because of the only slight difference of electrical properties between the aptamer and the complex of aptamer-H37Rv, the frequency shift response was weak. Consequently, it is evident that SWCNTs greatly increase the response signal of the SWCNT/aptamer/Au-IDE sensor.
Fig.
1.
Schematic
of
the
detection
mechanism
for
H37Rv
by
the
SWCNT/aptamer/IDE-MSPQC sensor. (a) Aptamer was modified with SWCNTs, and SWCNTs were displaced when H37Rv was present. (b) Aptamer was modified with SWCNTs, but no target was present. (c) Aptamer bonded with H37Rv directly without SWCNTs. 3. 2 Selection and identification of H37Rv aptamer Highly specific aptamers against inactive H37Rv were identified by running 14 rounds of selection with whole-cell SELEX from a 78-nt DNA library containing 35-nt random bases (see section S2 in the Supporting Information). For the initial four rounds, positive selection only was adopted to enrich the ssDNA pool with binding aptamers. The 7
following rounds were performed using alternate negative and positive selection steps. The ssDNA concentration decreased with the increase in screening cycles. After 14 selection rounds, the remaining aptamers had strong affinities for H37Rv. The amounts of ssDNA pools and H37Rv added in each round are shown in Table S1 in the Supplementary Information. The enrichment of H37Rv-specific aptamers was calculated during the selection process. The ratio of aptamers against H37Rv was less than 2% in the first four rounds, but this figure steadily increased from round 6 to round 14, and reached 12.5%, as shown in Figure S2. From the fifth round, negative selections were accepted. Consequently, the ratio increased rapidly and reached as high as 14%. The ratio appeared to reach a steady state from round 13 to round 14. Therefore, the last eluted ssDNA aptamers obtained from the 14 selection rounds were sorted, cloned, and sequenced, as described in section S2.1 in the Supporting Information. As shown in Table S2, twelve independent inserts were acquired. It should be noted that the nucleotide sequence for aptamer 1 appeared 25 times. This clearly demonstrated that Aptamer 1 had increased affinity with each round, and this finding was validated by using flow cytometry (see section S3 in the Supporting Information). Figure S3 in the Supporting Information shows that the affinity was enhanced with increasing screening rounds. The dissociation constant (Kd), which represents binding affinities, was determined using a fluorescence spectrophotometer. This was performed by incubating FITC-labeled aptamers (ranging from 20 to 200 nM) with H37Rv (106 cfu/mL) with gentle rotation in a shaker in 500 μL of selection buffer at 37°C for 45 min, as described in section S4 in the Supporting Information. Aptamer 1 (Kd = 37 4 nM) had the highest binding affinity, as shown in Table S2 in the Supporting Information. Nonlinear regression analyses of the selected aptamers are shown in Fig. S4 in the Supporting Information. Consequently, Aptamer 1 was selected for use in further experiments. 3.3. Electrochemical impedance characterization of SWCNT/aptamer/Au-IDE probe The impedance characteristics of the SWCNT/aptamer/Au-IDE probe were investigated using an HP-4192A LF impedance analyzer. The results are shown in Fig. 2. Curve (a) shows the impedance characterization of the unmodified Au-IDE, curve (b) shows the Au-IDE modified with aptamer, curve (c) shows the Au-IDE modified with aptamer and SWCNTs, curve (d) shows the modified Au-IDE on which SWCNTs have been displaced by H37Rv, curve (e) shows H37Rv/aptamer/Au-IDE, where H37Rv reacted directly with aptamer, without SWCNTs. The diameter of the semicircle in curve (b) was larger than that in curve (a), which 8
indicates that the Au-IDE had been successfully modified by the aptamer. In curve (c), the diameter of the semicircle was markedly smaller than that in curve (b). This indicates that SWCNTs had successfully bonded to the aptamer/Au-IDE probe, and, consequently, the characteristics of the probe had changed because of the excellent electrical properties of SWCNTs. The diameter of the semicircle in curve (d) was much larger than that in curve (c). This fact indicates that when SWCNTs were displaced by H37Rv, the impedance of the probe surface increased. Obviously, the impedance difference between curve e and curve b was smaller than the impedance difference between curve d and curve c, indicating that the use of SWCNTs can improve the assay sensitivity greatly.
Fig. 2. Electrochemical impedance spectroscopy of the different modified electrodes: (a) bare
Au-IDE,
(b)
aptamer/Au-IDE,
(c)
SWCNT/aptamer/Au-IDE,
(d)
H37Rv/aptamer/Au-IDE with the SWCNTs displaced in the presence of H37Rv, (e) H37Rv/aptamer/Au-IDE, i.e., H37Rv was reacted with aptamer with no SWCNTs present. 3.4 Factors affecting the response of proposed sensor 3.4.1 The effect of concentration of SWCNTs on H37Rv detection The effect of the SWCNTs concentration (used in the production of the probe) on the response of the proposed sensor for 106 cfu/ mL H37Rv was investigated. SWCNTs at 1, 2, 4, and 5 g/L were used to modify the Au-IDE MSPQC. The corresponding frequency shifts were 35, 86, 154, and 156 Hz, respectively. When the concentration of SWCNTs was increased to 5 g/L, the frequency shift did not increase further. This fact indicates that the combination of SWCNTs and aptamer 1 had become saturated. Consequently, the SWCNT concentration used in the follow experiments was 5 g/L. 9
3.4.2 Identification of criteria for a positive sample To identify the criteria that define a positive sample, the detection medium and ten H37Rv-negative samples containing other bacterial species were analyzed by the probe. The value of the frequency shift of the detection medium without bacteria was 5–10 Hz. For the 10 samples containing non-target bacteria, the frequency shifts were 30, 15, 20, 18, 19, 22, 17, 14, 18, and 16 Hz, respectively. The ten samples were as follows: a mixture of BCG (0.4 mL), S. aureus (0.3 mL), and M. smegmatis (0.3 mL); E. coli alone (1 mL); a mixture of M. smegmatis (0.5 mL) and E. coli (0.5 mL); a mixture of S. enteritidis (1 mL) and S. aureus (0.5 mL); S. aureus alone (1 mL); a mixture of BCG (0.5 mL) and M. smegmatis (0.5 mL); BCG alone (1 mL); S. enteritidis alone (1 mL); M. smegmatis alone (1 mL); and P. aeruginosa alone (1 mL). The concentration of all bacteria was 1 × 106 cfu / mL. The 99% confidence interval of frequency shifts in these negative samples was 4–34 Hz. Samples with frequency shifts of less than 34 Hz were judged to be negative, otherwise, samples were judged to be positive. 3.4.3. Effects of H37Rv concentration on the response curve and the detection limit of the proposed detector The detector response curves for different H37Rv concentrations are shown in Fig. 3. All response curves exhibited the same overall shape, but had different frequency shifts. The change in concentration of H37Rv resulted in the change of the amount of H37Rv-complex, and consequently Rt and Ct changed. In the initial phase, the frequency shift increased with time. This was caused by the specific interaction between aptamer 1 and H37Rv. The SWCNTs that covered the probe surface were gradually replaced by H37Rv. As indicated by Eq (5), the frequency shift increased significantly as a result. After the interaction between aptamer 1 and H37Rv was complete, the surface remained unchanged and the frequency shift reached its plateau. The detection process was finished within 70 min. The ΔF value increased linearly with the log of H37Rv concentrations in the range 1×103–1×107 cfu/mL. The associated regression equation was ΔF = 24.955×logC – 6.137, r2 = 0.985. Different concentrations of H37Rv samples were evaluated three times. The relative standard deviation values were between 0.5% and 3.2%. For concentrations greater than 1×107 cfu/mL, the response curve became nonlinear, indicating that the surface had become saturated with bacteria. The limit of detection was 100 cfu/mL. This value was estimated using 3×(SD/k), where SD is the standard deviation of the
10
measurement signal for the blank sample, and k is the slope of the analytical curve in the linear region.
Fig. 3. A. Frequency shift response curve for different concentrations of H37Rv (a) 0, (b)1×103, (c) 1×104, (d)1×105, (e)1×106,and (f)1×107 cfu/mL of H37Rv in detection medium. B. Calibration curve for the frequency change and H37Rv concentration (logarithmic scale). Error bars indicate standard deviation (n = 3). 3.5. Selectivity of the SWCNT/aptamer/Au-IDE MSPQC sensor To evaluate the selectivity of the proposed sensor to H37Rv, a series of potential interfering bacteria, namely, E. coli, P. aeruginosa, M. smegmatis, S. aureus, and BCG, each at concentrations of 106 cfu/mL were analyzed by the proposed sensor, the detection results are shown in Fig. 4. None of the frequency shifts elicited by the interfering bacteria exceeded 34 Hz. This means that many types of experimental bacteria [including bacillus (E. coli, P. aeruginosa) and coccus (S. aureus)] do not interfere with the current H37Rv detector. In particular, neither BCG nor M. smegmatis, which are non-pathogenic mycobacteria, interfered with the detection of H37Rv. We therefore concluded that the proposed sensor can distinguish pathogenic and non-pathogenic bacteria.
11
Fig. 4. The specific response to H37Rv is compared with that to other bacterial strains. (a) Blank (b) E. coli, (c) P. aeruginosa, (d) M. smegmatis, (e) S. aureus, (f) BCG, (g) H37Rv. The concentration for all bacteria was 1×106 cfu/mL. 3.6. Detection of clinical samples Forty-five clinical sputum samples were analyzed using three detection methods in a double-blind trial. The methods used were the newly developed SWCNT/aptamer/Au-IDE MSPQC sensor, the L-J slant culture method, and the BACTEC MGIT 960 automated system. Clinical samples were pretreated using the method described in section 2.3. The sensitivity and specificity of the SWCNT/aptamer/Au-IDE MSPQC sensor were evaluated by using the results from the L-J slant culture method. The sensitivity was 86% (12/14) and the specificity was 90% (28/31), as shown in Table 1. The results for the 45 clinical samples obtained using the BACTEC MGIT 960 system and the SWCNT/aptamer/Au-IDE MSPQC sensor were analyzed using the chi-squared test for pair-count data, as shown in Table 2. According to the value of the chi-squared test ( 2 32 02.05 ), there was a strong correlation between the results detected by the BACTEC MGIT 960 system and the SWCNT/aptamer/Au-IDE MSPQC sensor. There was no significant difference between the two methods at the p = 0.05 level ( 2 0.5 02.05 ). The mean detection times for the SWCNT/aptamer/IDE-MSPQC sensor and the BACTEC MGIT 960 system were 71 min and 13.1 days, respectively. These results demonstrated that the proposed MSPQC method is accurate, rapid, and simple to use. Table 1. SWCNT/aptamer/Au-IDE MSPQC sensor results for 45 clinical samples evaluated against the results of the culture method.
SWCNT/Aptamer/Au -IDEMSPQC sensor
Culture Method
total
+
-
+
12
3
15
-
2
28
30
total
14
31
45
Table 2. SWCNT/aptamer/Au-IDE MSPQC sensor results for 45 clinical samples compared with those of the BACTEC MGIT 960 system.
SWCNT/Aptamer/Au -IDEMSPQC sensor +
BACTEC960MGIT +
-
12
2
12
total 14
-
0
31
31
total
12
33
45
4. Conclusions A novel, highly specific H37Rv aptamer with an affinity of Kd = 374 nM was selected using an improved whole-cell SELEX system. It was successfully used with MSPQC to construct SWCNTs/Aptamer/Au-IDE MSPQC H37Rv Sensor and can excellently detect H37Rv in 70 min and distinguish H37Rv from M. Smegmatis, BCG. The detection limit was 100 cfu/mL. The proposed method could be improved by selecting more suitable aptamer and better sample handling. The developed method offer a path for the detection in early detection of M. tuberculosis. Acknowledgments This research work was supported by the National Natural Science Foundation of China (No. 21275042) and the Hunan Province Science and Technology Plan Project (No. 2015JC3072). References Andersen, P., Munk, M. E., Pollock J. M., Doherty T. M., 2000. Lancet. 356, 1099-1104. Blondeau, P., Xavier Rius-Ruiz, F., Düzgün, A., Riu, J., Xavier Rius, F., 2011. Mater. Sci. Eng. C. 31, 1363–1368. Boehme, C. C., Pamela, M. D., Nabeta, M. D., Doris Hillemann, Ph. D., Mark, P., Nicol, Ph. D., Shubhada Shenai, Ph. D., Fiorella Krapp, M.D., Jenny Allen, B. Tech., Rasim Tahirli, M. D., Robert Blakemore, B. S., Roxana Rustomjee, M. D., Ph.D., Ana Milovic, M.S., Martin Jones, Ph.D., Sean M. O'Brien, Ph. D., David, H., Persing, M.D., Ph.D., Sabine Ruesch-Gerdes, M.D., Eduardo Gotuzzo, M. D., Camilla Rodrigues, M. D., David Alland, M. D., and Mark D. Perkins, M. D., 2010, 363(11): 1005-1015. Chen, M., Gan, Ning., Li,T. H., Wang, Y., Xu, Q., Chen, Y. J., 2017. Anal. Chim. Acta. 2017, 968, 30-39. Dheda K., Davids V., Lenders L., Roberts T., Meldau R., Ling D., Brunet L., Zyl Smit R.V., Peter J., Green, C., Badri, M., Sechi, L., Sharma, S., Hoelscher, M., Dawson, R., Whitelaw, A., Blackburn, J., Pai, M., Zumla, A., 2010. PLoS One. 5, e9848. Dheda, K., Van-ZylSmit, R. N., Sechi, L. A., Badri, M., Meldau, R., Symons, G., Khalfey, H., Carr, I., Maredza, A., Dawson, R., Wainright, H., Whitelaw, A., Bateman, E. D., Zumla, A., 2009. PLoS One. 4, e4689. 13
Ding, J. F., Li, Zh., Lefebvre, J., Du, X. M., Malenfant, Patrick R. L., 2016, J. Phys. Chem. C. 120, 21946−21954. Ellington, A. D., Szostak, J. W., 1990. Nature. 346, 818-822. Feng, T.T., Shou, C. M., Shen, L., Qian, Y., Wu, Z. G., Fan, J., Zhang, Y. Z., Tang, Y. W., Wu, N. P., Lu, H. Z., Yao, H. P., 2011. Int J Tuberc Lung Dis. 15, 804-810. He, F. J., Xiong, Y. C., Liu, J., Tong, F. F., Yan, D. Y., 2016. Biosens. Bioelectron. 77, 799-804. He, F.J., Zhang, L.D., 2002. Analytical Sciences 18, 397–402. He, F.J., Zhang, L.D., Zhao, J.W., 2002. Sensors and Actuators B. 85, 284–290. Houghton, R. L., Lodes, M. J., Dillon, D. C., Reynolds, L. J., Day, C. H., McNeill, P. D., Hendrickon, R. C., 2002. Clin. Diagn. Lab. Immunol. 9, 883-891. Kashyap, R. S., Dobos, K. M., Belisle, J. T., Purohit, H. J., Chandark, N. H., Taori, G. M., Daginawdlo, H. F., 2005. Clin. Diagn. Lab.Immunol. 12, 752-758. Laurenson, S., Pett, M. R., Hoppe-Seyler, K., Denk, C., Hoppe-Seyler F., Coleman, N., Ferrigno, P. K., 2011. Anal. Biochem. 410, 161-170. Mejia, G. I.; Castrillon, L.; Trujillo, H.; Robledo, 1999. J. A. Int. J. Tuberc. Lung. Dis. 1999, 3, 138-142. Mi, X. W., He, F. J., Xiang, M. Y., Lian, Y., Yi, S. L., 2012. Anal. Chem. 84, 939-946. Morcillo, N., Imperiale, B., Di Giulio, B., 2010. International Journal of Tuberculosis and Lung Disease 14, 1169–1175. Nguyen Quoc D., Patil, D., Jung, H., Kim, J., Kim, D., 2013. Sens.Actuators B: Chem. 183, 381–387. Ren, J. L., He, F. J., Yi, S. L., Cui, X. Y., 2008. Biosens. Bioelectron. 4, 403-409. Sefah, K., Shangguan, D., Xiong, X. L., O’Donoghue, M. B., Tan, W. H., 2010. Nat. Protoc., 5(6), 1169-1185. Shamsipura M., Pashabadia, A., Molaabasib, F., Hosseinkhanic, S., 2017. Biosens. Bioelectron. 90, 195-202. Shen, D. Z., Li, Z. Y., Nie, L. H., Yao, S. Z., 1993. Anal. Chim. Acta. 280, 209–216. Tong, F. F., Lian, Y., Zhou, H., Shi, X. H., He, F. J., 2014. Anal. Chem. 86, 10415−10421. Tortoli, E., Benedetti, M., Fontanelli, A., Simontli, M. T., 2002. J. Clin. Microbiol. 40, 607 -610. Tuerk, C., Gold, L., 1990. Sci. 249, 505-510. Wang, J. C., Guo, J. J., Zhang, J. J., Zhang, W. J., Zhang, Y. Z., 2017. Biosens. Bioelectron. 95, 100-105. 14
Wang, B., Zheng, J., He, Y., Sheng, Q., 2013. Sens. Actuators B: Chem. 186, 417–422. World Health Organization, 2015. WHO report 2015: Global tuberculosis report. World Health Organization. World Health Organization, 2016. WHO report 2016: Global tuberculosis report. World Health Organization. Wu, F., Su, L., Yu, P., Mao, L.Q., 2017. J. Am. Chem. Soc. 139 (4), 1565–1574. Xia,Y. K., Liu, M. M., Wang, L. L., Yan, A., He, W. H., Chen, M., Lan, J. M., Xu,J. X., Guan, L. H.,Chen, J. H., 2017. Biosens. Bioelectron. 92, 8-15. Yoo, M. S., Shin, M., Kim, Y. H., Jang, M., Choi,Y. E., Park, S. J., Choi, J. H., Lee, J.Y., Park, C. H., 2017. Chemosphere. 175, 269-274. Zelada-Guillén, G. A., Riu, Jordi., Düzgün, A., Rius, F. X., 2009, Angew. Chem. Int. Ed. 48, 7334 –7337.
15
PII: DOI: Reference:
S0956-5663(17)30361-5 http://dx.doi.org/10.1016/j.bios.2017.05.043 BIOS9756
To appear in: Biosensors and Bioelectronic Received date: 8 March 2017 Revised date: 11 May 2017 Accepted date: 23 May 2017 Cite this article as: XiaoQing Zhang, Ye Feng, QiongQiong Yao and Fengjiao He, Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv s e n s o r , Biosensors and Bioelectronic, http://dx.doi.org/10.1016/j.bios.2017.05.043 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Selection of a new Mycobacterium tuberculosis H37Rv aptamer and its application in the construction of a SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor XiaoQing Zhang1, 2, Ye Feng1, QiongQiong Yao1, Fengjiao He1* 1 State Key Laboratory of Chemo/Biosensing and Chemometrics, College of Chemistry and Chemical Engineering, Hunan University, Changsha, China, 410082 2 School of Pharmacy, Hunan University of Chinese Medicine, Changsha, China, 410208 * Corresponding author. Tel.: +86 0731 88641495 E-mail address: [email protected] Abstract A rapid and accurate detection method for Mycobacterium tuberculosis (M. tuberculosis) is essential for effectively treating tuberculosis. However, current detection methods cannot meet these clinical requirements because the methods are slow or of low specificity. Consequently, a new highly specific ssDNA aptamer against M. tuberculosis reference strain H37Rv was selected by using the whole-cell systematic evolution of ligands by exponential enrichment technique. The selected aptamer was used to construct a fast and highly specific H37Rv sensor. The probe was produced by immobilizing thiol-modified aptamer on an Au interdigital electrode (Au-IDE) of a multichannel series piezoelectric quartz crystal (MSPQC) through Au-S bonding, and then single-walled carbon nanotubes (SWCNTs) were bonded on the aptamer by π-π stacking. SWCNTs were used as a signal indicator because of their considerable difference in conductivity compared with H37Rv. When H37Rv is present, it replaces the SWCNTs because it binds to the aptamer much more strongly than SWCNTs do. The replacement of SWCNTs by H37Rv resulted in a large change in the electrical properties, and this change was detected by the MSPQC. The proposed sensor is highly selective and can distinguish H37Rv from Mycobacterium smegmatis (M. smegmatis) and Bacillus Calmette-Guerin vaccine (BCG).The detection time was 70 min and the detection limit was 100 cfu/mL. Compared with conventional methods, this new SWCNT/aptamer/Au-IDE MSPQC H37Rv sensor was specific, rapid, and sensitive, and it holds great potential for the early detection of H37Rv in clinical diagnosis. Keywords: MSPQC, H37Rv Aptamer, Single-walled carbon nanotubes. 1
1. Introduction Tuberculosis is an infectious disease mainly caused by Mycobacterium tuberculosis. Gaps in testing for tuberculosis and reporting new cases remain major challenges. In 2015, it was estimated that of the 10.4 million new cases worldwide, only 6.1 million were detected and officially notified, leaving a shortfall of 4.3 million cases. This gap resulted from under-diagnosis in countries with major barriers to detecting M. Tuberculosis (World Health Organization, 2016). Consequently, an economical, fast, and accurate detection method for M. tuberculosis is urgently needed for the prevention and control of tuberculosis(Boehme et al., 2010). The current detection methods include culture and culture-independent methods. At present, the culture method is the gold standard for M. tuberculosis detection. However, it is time-consuming and can take up to 4–6 weeks to yield a result (Andersen et al., 2000; Tortoli et al., 2002; Mejia et al., 1999). Even automatic incubation detection systems, such as the BACTEC MGIT 960, which can shorten the detection time to 10 days, still do not meet the requirement for early clinical diagnosis. Furthermore, these tests cannot directly differentiate between M. tuberculosis and non-tuberculosis mycobacterial species (Morcillo et al., 2010). Among culture-independent methods, microscopic examination of direct smears with the Ziehl–Neelsen stain is widely used in tuberculosis diagnosis. However, this approach cannot differentiate between M. tuberculosis and non-tuberculosis mycobacterial species, because all mycobacterial species are positive on Ziehl–Neelsen staining. Moreover, immunological detection methods are not commonly used because of the intractable isolation of monoclonal antibodies and costly processing (Dheda et al., 2010; Dheda et al. 2009; Kashyap et al., 2005; Houghton et al., 2002; Feng et al., 2011). Therefore, there is an urgent need for an economical, rapid, and species-specific method for the detection of M. tuberculosis. Aptamers are single-strand oligonucleotide molecules with high affinity and high specificity to their target. They are evolved from random oligonucleotide pools by a process called the systematic evolution of ligands by exponential enrichment (SELEX) (Tuerk and Gold, 1990; Ellington and Szostak, 1990). Aptamers have been generated against a wide variety of targets, including ions, small molecules, proteins, whole cells, viruses, and peptides (Sefah et al., 2010). On the basis of their target-recognition capability, selectivity, and affinity, aptamers can be likened to antibodies. However, aptamers with unique features have more flexibility in their development and range of applications (Wang et al., 2017; Chen et al., 2017; Shamsipura et al., 2017; Laurenson et 2
al., 2011). In this paper, a new H37Rv aptamer was selected in our lab. Because of their low cost, high sensitivity, and rapid response, MSPQC sensors based on the changes of electrical parameters in the detection system are widely used in microbial analysis. Our research group has designed a series of sensors based on the MSPQC system for detecting M. Tuberculosis (He and Zhang, 2002; He et al., 2002; Ren et al., 2008; Mi et al., 2012; He et al., 2016). These sensors employed the immunological detection method (which was expensive and based on the antigen–antibody reaction), the aptamer sensor method (which needed 96 h of training based on the culture filtrate protein CFP10-ESAT6), the culture method (which was based on the detection of volatile metabolic products), and the phage amplification method (which was also dependent on training). A novel MSPQC method for the detection of M. tuberculosis that does not require training is still needed to satisfy the clinical demand. SWCNTs are one-dimensional hollow nanostructure materials that exhibit useful electrical and chemical properties (Ding, et al., 2016; Wang et al., 2013; Nguyen Quoc et al.2013; Blondeau et al., 2011). SWCNTs are biocompatible and have been employed in the detection of DNA, proteins, and microorganisms in biology and biochemistry (Xia et al., 2017; Wu et al., 2017; Yoo et al., 2017). Here SWCNTs are used as an indicator. The current work resulted in a new SWCNT/aptamer/Au-IDE MSPQC sensor that was constructed using a newly selected H37Rv aptamer for the detection H37Rv.The sensor was highly specific, rapid, and inexpensive. The detection limit of the proposed sensor was 100 cfu/ mL and the detection time was 70 min. When the proposed sensor was used to detect H37Rv in 45 clinical samples, the detection results were not significantly different to those detected by the culture method. 2. Material and methods 2.1 Materials and medium Bacteria: H37Rv (ATCC27294) was obtained from the National Institute for the Control of Pharmaceutical and Products. M. smegmatis and BCG vaccine were purchased from the Institute of Microbiology, Chinese Academy of Sciences. Staphylococcus aureus (S. aureus), Escherichia coli (E. coli), Pseudomonas aeruginosa (P. aeruginosa), and Salmonella enteritidis (S. enteritidis) were bought from the National Institute for the Control of Pharmaceutical and Biological Production. Detection medium: The medium consisted of ammonium sulfate (0.5 g), sodium hydrogen phosphate (2.5 g), potassium dihydrogen phosphate (1 g), magnesium sulfate (0.05 g), zinc sulfate (0.001 g), calcium chloride(0.0005 g) copper sulfate (0.001 g), 3
sodium glutamate (0.5 g), sodium citrate (0.1 g), pyridoxine hydrochloride (0.001 g), biotin (0.0005 g), ferric ammonium citrate (0.04 g), Tween-80 (0.5 g) in 1 L of distilled water. The pH value was then adjusted to 7.2 with ammonia solution and the medium was separated into 95-mL and autoclaved at 121°C for 20 min. Then, 5 mL of 10% oleic acid−dextrose−catalase were added to the bottles. SWCNTs were obtained from Timesnano (Chengdu, China) and contained 2.73 wt%-COOH functionalized groups and ≤1.5 wt% ash. The average length was 100 μm and the average diameter was 1.0 nm. Sequence: The following sequences were synthesized by Shanghai Sangon Biological Engineering Technology and Services, Co., Ltd. (Shanghai, China): aptamer library 5′-GGGAGCTCAGAATAAACGCTCAA (N35) TTCGACATGAGGCCCGGATC -3′, forward primer 5′-GGGGAGCTCAGAATAAACGCTCAA-3′, the fluorescein isothiocyanate (FITC)-labeled forward primer FITC-5′-GGGAGCTCAGAATAAACGCT CAA, the reverse primer 5′-GATCCGGGCCTCATGTCGAA-3′ The used H37Rv aptamer was exactly Aptamer 1 and the sequenc: 5′-SH-GGGAGC TCAGAATAAACGCTCAACCCTGCGGGGCTGCCCGATATGTGTCCAAGTGGTGT TCGACATGAGGCCCGGATC-3′. Apparatus: The equipment used included an Eppendorf Master Cycler/Thermal Cycler (AG5331, Germany), an ultraviolet spectrophotometer (Tianmei Techcomp UV1100, China), a fluorescence spectrophotometer (LS55, Perkin Elmer, UK), and HP4192A impedance analyzer (Hewlett Packard, USA). The MSPQC was made in our laboratory (Fengjiao et al., 2016) (see Fig. S1). 2.2 Construction of the SWCNT/aptamer/Au-IDE Probe The unmodified Au-IDE was cleaned with piranha solution (V: V = 3: 1 H2SO4/30% H2O2) for 5 s, ultrasonically cleaned with ethanol for 5 min, and then rinsed with double-distilled water. To produce the self-assembled monolayer of aptamer on the gold electrode, 10 µM of 5′-SH-aptamer with 1 µM of mercaptoethanol was incubated overnight at 4 °C, cleaned with double-distilled water, and dried using N2. The prepared aptamer/Au-IDE was incubated in a carboxylated SWCNTs for 4h. Aptamers wrapped around the SWCNTs through π-π stacking interactions between the nucleotide bases and the SWCNTs sidewalls. Free SWCNTs were washed from the aptamer-Au-IDE surface by using Tris–HCl buffer solution. The Au-IDE was then rinsed with distilled water and dried with N2. The SWCNTs/aptamer/Au-IDE was then connected to the MSPQC for the detection of H37Rv. 4
2.3 Detection procedure A total of 45 clinical sputum specimens were collected from the Hunan Institute of Tuberculosis Control (Changsha, China). 2 mL of sputum sample solution were added to 4.0 mL of 4% sodium hydroxide solution in 15 mL centrifuge tubes and the tubes were sealed with a screw cap. The samples were dispersed using a vortex oscillator at 37 °C for 15 min. 9.0 mL of sterile phosphate buffer (0.067 mol/L, pH 6.8) were added to the tubes and mixed thoroughly, the tubes were then centrifuged at 4000 rpm for 15 min.The supernatant was discarded, and the sediment was washed using 15 mL of sterile PBS buffer and Middlebrook 7H9 medium. The detection sample solution was then ready for use. A total of 1 mL of processed sample solution was added to 4 mL of detection medium. Additionally, 1 mL H37Rv (1 × 106 cfu/mL) was added to 4 mL of detection medium as the positive control, and 5 mL of detection medium without H37Rv was used as the negative control. Frequency response curves were recorded by the MSPQC system. For comparison, 1.0 mL of sample treatment solution was inoculated in growth indicator tubes of a BACTECMGIT 960 automatic detection system. All positive results were confirmed in a timely manner by acid-fast smear analysis. All experiments described here were operated in class II biological safety cabinets, and all experimental wastes and utensils were washed after autoclaving. 3. Results and discussion 3.1 The strategy of building SWCNT/Aptamer/Au-IDE MSPQC H37Rv Sensor 3.1.1 Response mechanism of MSPQC to changes in electrical parameters The Au-IDE MSPQC system produced in our laboratory consisted of three sections: (I) the data acquisition device, (II) the culture system/thermostatic device, and (III) the single oscillation circuit system (quartz crystal, culture pool, and three-stage amplifier circuit in series) as shown in Fig. S1A. The bacteria culturing detection system includes eight culture cells and eight oscillating circuits with eight 9.0-MHz AT-cut quartz crystals. The frequency shift–time response curves of the eight samples were automatically recorded simultaneously. The Au-IDE electrode was made in-house. It comprised 12 fingers with lengths of 3000 μm and widths of 100 μm; the finger spacing was 100 μm. The equivalent circuit of the SWCNT/aptamer/Au-IDE MSPQC sensor is shown in Fig. S1B (a) where block I is the equivalent circuit of the piezoelectric sensor, block II is the equivalent circuit of the modified film on the surface of the IDE, and block III is the equivalent circuit of the solution. C0, Lq, Cq ,and Rq are the piezoelectric crystal static 5
capacitance (Shen et al., 1993), the motional inductance, the motional resistance, and the motional capacitance, respectively. Cf and Rf are the film capacitance and resistance, respectively, of the IDE resulting from the modified layers. Cs and Rs, respectively, are the equivalent capacitance and resistance of the solution. To simplify the calculation, the capacitance and resistance of the Au-IDE surface and solution are, respectively, combined as the total capacitance Ct and total resistance Rt, and the equivalent circuit was simplified as Fig. S1B (b). According to Tong et al. (2014), the frequency detected by an Au-IDE MSPQC has the following relationship:
F0Cq (2 F0 Rt2Ct ARt ) F F0 1 2 2 1 2 F0C0 Rt A 4 F0 Rt Ct (C0 Ct )
(1)
Where F is the oscillation frequency of the sensor at t min and F0 is the initial oscillation frequency. Except for Ct and Rt, the parameters were almost constant in our detection system. Consequently, F f ( Rt , Ct ) dF
F F dRt dCt Rt Ct
(2)
K1
A 4 2 F0 2Ct R2 t A2 4 F0Ct Rt F F02Cq 2 2 2 2 Rt 1 2 F0C0 Rt A 4 F0 Rt Ct (C0 Ct )
(3)
K2
1 4 2 F02Ct2 Rt2 4 A F0Ct Rt F 2 2 F03Cq 2 2 2 2 Ct 1 2 F0C0 Rt A 4 F0 Rt Ct (C0 Ct )
(4)
Eq. (2) can be rewritten as:
F K1 Rt K2 Ct
(5)
According to Eq (5), the frequency shift of the proposed sensor is affected not only by the medium solution resistance but also by the capacitance. In a high-conductivity detection solution, the values of Rt and Ct are affected by the electrical properties of the modification layer on the Au-IDE surface. Consequently, changes in the electrical properties of the electrode surface result in a sensitive response of the proposed sensor. 3.1.2 The strategy of building the SWCNT/Aptamer/Au-IDE MSPQC H37Rv Sensor In SWCNT/aptamer/Au-IDE probe, the selected aptamer against H37Rv was modified onto the Au-IDE electrode surface by Au-S bonding, and SWCNTs was binded to aptamer through π-π stacking interaction between the carbon nanotubes walls and the puric and pyrimidic bases, as shown in Fig. 1. In the presence of H37Rv, the stronger 6
interaction between H37Rv and H37Rv aptamer caused SWCNTs fell off from the aptamer. On the surface of Au-IDE probe, the complex of SWCNT-aptamer was substituted by the complex of H37Rv-aptamer. This induced the electrical properties change of the electrode, and resulted in frequency shift response of SPQC, as shown in Fig. 1, curve a. If SWCNTs was not modified, the surface change of Au-IDE probe was caused by the displacement of aptamer by H37Rv-aptamer complex. As no significant electrical properties difference between aptamer and H37Rv-aptamer complex, so frequency shift response caused by reaction was not obvious. In this case, SWCNTs were used as a signal indicator because of its considerable difference in conductivity compared with H37Rv. For comparison, the response curve of SWCNT/aptamer/Au-IDE probe in a negative sample (curve b) and that of an aptamer/Au-IDE probe (i.e., no SWCNTs) in a positive sample (curve c) are shown in Fig. 1. In curve c, the Au-IDE surface covered by aptamer was modified to become a complex of aptamer-H37Rv. However, because of the only slight difference of electrical properties between the aptamer and the complex of aptamer-H37Rv, the frequency shift response was weak. Consequently, it is evident that SWCNTs greatly increase the response signal of the SWCNT/aptamer/Au-IDE sensor.
Fig.
1.
Schematic
of
the
detection
mechanism
for
H37Rv
by
the
SWCNT/aptamer/IDE-MSPQC sensor. (a) Aptamer was modified with SWCNTs, and SWCNTs were displaced when H37Rv was present. (b) Aptamer was modified with SWCNTs, but no target was present. (c) Aptamer bonded with H37Rv directly without SWCNTs. 3. 2 Selection and identification of H37Rv aptamer Highly specific aptamers against inactive H37Rv were identified by running 14 rounds of selection with whole-cell SELEX from a 78-nt DNA library containing 35-nt random bases (see section S2 in the Supporting Information). For the initial four rounds, positive selection only was adopted to enrich the ssDNA pool with binding aptamers. The 7
following rounds were performed using alternate negative and positive selection steps. The ssDNA concentration decreased with the increase in screening cycles. After 14 selection rounds, the remaining aptamers had strong affinities for H37Rv. The amounts of ssDNA pools and H37Rv added in each round are shown in Table S1 in the Supplementary Information. The enrichment of H37Rv-specific aptamers was calculated during the selection process. The ratio of aptamers against H37Rv was less than 2% in the first four rounds, but this figure steadily increased from round 6 to round 14, and reached 12.5%, as shown in Figure S2. From the fifth round, negative selections were accepted. Consequently, the ratio increased rapidly and reached as high as 14%. The ratio appeared to reach a steady state from round 13 to round 14. Therefore, the last eluted ssDNA aptamers obtained from the 14 selection rounds were sorted, cloned, and sequenced, as described in section S2.1 in the Supporting Information. As shown in Table S2, twelve independent inserts were acquired. It should be noted that the nucleotide sequence for aptamer 1 appeared 25 times. This clearly demonstrated that Aptamer 1 had increased affinity with each round, and this finding was validated by using flow cytometry (see section S3 in the Supporting Information). Figure S3 in the Supporting Information shows that the affinity was enhanced with increasing screening rounds. The dissociation constant (Kd), which represents binding affinities, was determined using a fluorescence spectrophotometer. This was performed by incubating FITC-labeled aptamers (ranging from 20 to 200 nM) with H37Rv (106 cfu/mL) with gentle rotation in a shaker in 500 μL of selection buffer at 37°C for 45 min, as described in section S4 in the Supporting Information. Aptamer 1 (Kd = 37 4 nM) had the highest binding affinity, as shown in Table S2 in the Supporting Information. Nonlinear regression analyses of the selected aptamers are shown in Fig. S4 in the Supporting Information. Consequently, Aptamer 1 was selected for use in further experiments. 3.3. Electrochemical impedance characterization of SWCNT/aptamer/Au-IDE probe The impedance characteristics of the SWCNT/aptamer/Au-IDE probe were investigated using an HP-4192A LF impedance analyzer. The results are shown in Fig. 2. Curve (a) shows the impedance characterization of the unmodified Au-IDE, curve (b) shows the Au-IDE modified with aptamer, curve (c) shows the Au-IDE modified with aptamer and SWCNTs, curve (d) shows the modified Au-IDE on which SWCNTs have been displaced by H37Rv, curve (e) shows H37Rv/aptamer/Au-IDE, where H37Rv reacted directly with aptamer, without SWCNTs. The diameter of the semicircle in curve (b) was larger than that in curve (a), which 8
indicates that the Au-IDE had been successfully modified by the aptamer. In curve (c), the diameter of the semicircle was markedly smaller than that in curve (b). This indicates that SWCNTs had successfully bonded to the aptamer/Au-IDE probe, and, consequently, the characteristics of the probe had changed because of the excellent electrical properties of SWCNTs. The diameter of the semicircle in curve (d) was much larger than that in curve (c). This fact indicates that when SWCNTs were displaced by H37Rv, the impedance of the probe surface increased. Obviously, the impedance difference between curve e and curve b was smaller than the impedance difference between curve d and curve c, indicating that the use of SWCNTs can improve the assay sensitivity greatly.
Fig. 2. Electrochemical impedance spectroscopy of the different modified electrodes: (a) bare
Au-IDE,
(b)
aptamer/Au-IDE,
(c)
SWCNT/aptamer/Au-IDE,
(d)
H37Rv/aptamer/Au-IDE with the SWCNTs displaced in the presence of H37Rv, (e) H37Rv/aptamer/Au-IDE, i.e., H37Rv was reacted with aptamer with no SWCNTs present. 3.4 Factors affecting the response of proposed sensor 3.4.1 The effect of concentration of SWCNTs on H37Rv detection The effect of the SWCNTs concentration (used in the production of the probe) on the response of the proposed sensor for 106 cfu/ mL H37Rv was investigated. SWCNTs at 1, 2, 4, and 5 g/L were used to modify the Au-IDE MSPQC. The corresponding frequency shifts were 35, 86, 154, and 156 Hz, respectively. When the concentration of SWCNTs was increased to 5 g/L, the frequency shift did not increase further. This fact indicates that the combination of SWCNTs and aptamer 1 had become saturated. Consequently, the SWCNT concentration used in the follow experiments was 5 g/L. 9
3.4.2 Identification of criteria for a positive sample To identify the criteria that define a positive sample, the detection medium and ten H37Rv-negative samples containing other bacterial species were analyzed by the probe. The value of the frequency shift of the detection medium without bacteria was 5–10 Hz. For the 10 samples containing non-target bacteria, the frequency shifts were 30, 15, 20, 18, 19, 22, 17, 14, 18, and 16 Hz, respectively. The ten samples were as follows: a mixture of BCG (0.4 mL), S. aureus (0.3 mL), and M. smegmatis (0.3 mL); E. coli alone (1 mL); a mixture of M. smegmatis (0.5 mL) and E. coli (0.5 mL); a mixture of S. enteritidis (1 mL) and S. aureus (0.5 mL); S. aureus alone (1 mL); a mixture of BCG (0.5 mL) and M. smegmatis (0.5 mL); BCG alone (1 mL); S. enteritidis alone (1 mL); M. smegmatis alone (1 mL); and P. aeruginosa alone (1 mL). The concentration of all bacteria was 1 × 106 cfu / mL. The 99% confidence interval of frequency shifts in these negative samples was 4–34 Hz. Samples with frequency shifts of less than 34 Hz were judged to be negative, otherwise, samples were judged to be positive. 3.4.3. Effects of H37Rv concentration on the response curve and the detection limit of the proposed detector The detector response curves for different H37Rv concentrations are shown in Fig. 3. All response curves exhibited the same overall shape, but had different frequency shifts. The change in concentration of H37Rv resulted in the change of the amount of H37Rv-complex, and consequently Rt and Ct changed. In the initial phase, the frequency shift increased with time. This was caused by the specific interaction between aptamer 1 and H37Rv. The SWCNTs that covered the probe surface were gradually replaced by H37Rv. As indicated by Eq (5), the frequency shift increased significantly as a result. After the interaction between aptamer 1 and H37Rv was complete, the surface remained unchanged and the frequency shift reached its plateau. The detection process was finished within 70 min. The ΔF value increased linearly with the log of H37Rv concentrations in the range 1×103–1×107 cfu/mL. The associated regression equation was ΔF = 24.955×logC – 6.137, r2 = 0.985. Different concentrations of H37Rv samples were evaluated three times. The relative standard deviation values were between 0.5% and 3.2%. For concentrations greater than 1×107 cfu/mL, the response curve became nonlinear, indicating that the surface had become saturated with bacteria. The limit of detection was 100 cfu/mL. This value was estimated using 3×(SD/k), where SD is the standard deviation of the
10
measurement signal for the blank sample, and k is the slope of the analytical curve in the linear region.
Fig. 3. A. Frequency shift response curve for different concentrations of H37Rv (a) 0, (b)1×103, (c) 1×104, (d)1×105, (e)1×106,and (f)1×107 cfu/mL of H37Rv in detection medium. B. Calibration curve for the frequency change and H37Rv concentration (logarithmic scale). Error bars indicate standard deviation (n = 3). 3.5. Selectivity of the SWCNT/aptamer/Au-IDE MSPQC sensor To evaluate the selectivity of the proposed sensor to H37Rv, a series of potential interfering bacteria, namely, E. coli, P. aeruginosa, M. smegmatis, S. aureus, and BCG, each at concentrations of 106 cfu/mL were analyzed by the proposed sensor, the detection results are shown in Fig. 4. None of the frequency shifts elicited by the interfering bacteria exceeded 34 Hz. This means that many types of experimental bacteria [including bacillus (E. coli, P. aeruginosa) and coccus (S. aureus)] do not interfere with the current H37Rv detector. In particular, neither BCG nor M. smegmatis, which are non-pathogenic mycobacteria, interfered with the detection of H37Rv. We therefore concluded that the proposed sensor can distinguish pathogenic and non-pathogenic bacteria.
11
Fig. 4. The specific response to H37Rv is compared with that to other bacterial strains. (a) Blank (b) E. coli, (c) P. aeruginosa, (d) M. smegmatis, (e) S. aureus, (f) BCG, (g) H37Rv. The concentration for all bacteria was 1×106 cfu/mL. 3.6. Detection of clinical samples Forty-five clinical sputum samples were analyzed using three detection methods in a double-blind trial. The methods used were the newly developed SWCNT/aptamer/Au-IDE MSPQC sensor, the L-J slant culture method, and the BACTEC MGIT 960 automated system. Clinical samples were pretreated using the method described in section 2.3. The sensitivity and specificity of the SWCNT/aptamer/Au-IDE MSPQC sensor were evaluated by using the results from the L-J slant culture method. The sensitivity was 86% (12/14) and the specificity was 90% (28/31), as shown in Table 1. The results for the 45 clinical samples obtained using the BACTEC MGIT 960 system and the SWCNT/aptamer/Au-IDE MSPQC sensor were analyzed using the chi-squared test for pair-count data, as shown in Table 2. According to the value of the chi-squared test ( 2 32 02.05 ), there was a strong correlation between the results detected by the BACTEC MGIT 960 system and the SWCNT/aptamer/Au-IDE MSPQC sensor. There was no significant difference between the two methods at the p = 0.05 level ( 2 0.5 02.05 ). The mean detection times for the SWCNT/aptamer/IDE-MSPQC sensor and the BACTEC MGIT 960 system were 71 min and 13.1 days, respectively. These results demonstrated that the proposed MSPQC method is accurate, rapid, and simple to use. Table 1. SWCNT/aptamer/Au-IDE MSPQC sensor results for 45 clinical samples evaluated against the results of the culture method.
SWCNT/Aptamer/Au -IDEMSPQC sensor
Culture Method
total
+
-
+
12
3
15
-
2
28
30
total
14
31
45
Table 2. SWCNT/aptamer/Au-IDE MSPQC sensor results for 45 clinical samples compared with those of the BACTEC MGIT 960 system.
SWCNT/Aptamer/Au -IDEMSPQC sensor +
BACTEC960MGIT +
-
12
2
12
total 14
-
0
31
31
total
12
33
45
4. Conclusions A novel, highly specific H37Rv aptamer with an affinity of Kd = 374 nM was selected using an improved whole-cell SELEX system. It was successfully used with MSPQC to construct SWCNTs/Aptamer/Au-IDE MSPQC H37Rv Sensor and can excellently detect H37Rv in 70 min and distinguish H37Rv from M. Smegmatis, BCG. The detection limit was 100 cfu/mL. The proposed method could be improved by selecting more suitable aptamer and better sample handling. The developed method offer a path for the detection in early detection of M. tuberculosis. Acknowledgments This research work was supported by the National Natural Science Foundation of China (No. 21275042) and the Hunan Province Science and Technology Plan Project (No. 2015JC3072). References Andersen, P., Munk, M. E., Pollock J. M., Doherty T. M., 2000. Lancet. 356, 1099-1104. Blondeau, P., Xavier Rius-Ruiz, F., Düzgün, A., Riu, J., Xavier Rius, F., 2011. Mater. Sci. Eng. C. 31, 1363–1368. Boehme, C. C., Pamela, M. D., Nabeta, M. D., Doris Hillemann, Ph. D., Mark, P., Nicol, Ph. D., Shubhada Shenai, Ph. D., Fiorella Krapp, M.D., Jenny Allen, B. Tech., Rasim Tahirli, M. D., Robert Blakemore, B. S., Roxana Rustomjee, M. D., Ph.D., Ana Milovic, M.S., Martin Jones, Ph.D., Sean M. O'Brien, Ph. D., David, H., Persing, M.D., Ph.D., Sabine Ruesch-Gerdes, M.D., Eduardo Gotuzzo, M. D., Camilla Rodrigues, M. D., David Alland, M. D., and Mark D. Perkins, M. D., 2010, 363(11): 1005-1015. Chen, M., Gan, Ning., Li,T. H., Wang, Y., Xu, Q., Chen, Y. J., 2017. Anal. Chim. Acta. 2017, 968, 30-39. Dheda K., Davids V., Lenders L., Roberts T., Meldau R., Ling D., Brunet L., Zyl Smit R.V., Peter J., Green, C., Badri, M., Sechi, L., Sharma, S., Hoelscher, M., Dawson, R., Whitelaw, A., Blackburn, J., Pai, M., Zumla, A., 2010. PLoS One. 5, e9848. Dheda, K., Van-ZylSmit, R. N., Sechi, L. A., Badri, M., Meldau, R., Symons, G., Khalfey, H., Carr, I., Maredza, A., Dawson, R., Wainright, H., Whitelaw, A., Bateman, E. D., Zumla, A., 2009. PLoS One. 4, e4689. 13
Ding, J. F., Li, Zh., Lefebvre, J., Du, X. M., Malenfant, Patrick R. L., 2016, J. Phys. Chem. C. 120, 21946−21954. Ellington, A. D., Szostak, J. W., 1990. Nature. 346, 818-822. Feng, T.T., Shou, C. M., Shen, L., Qian, Y., Wu, Z. G., Fan, J., Zhang, Y. Z., Tang, Y. W., Wu, N. P., Lu, H. Z., Yao, H. P., 2011. Int J Tuberc Lung Dis. 15, 804-810. He, F. J., Xiong, Y. C., Liu, J., Tong, F. F., Yan, D. Y., 2016. Biosens. Bioelectron. 77, 799-804. He, F.J., Zhang, L.D., 2002. Analytical Sciences 18, 397–402. He, F.J., Zhang, L.D., Zhao, J.W., 2002. Sensors and Actuators B. 85, 284–290. Houghton, R. L., Lodes, M. J., Dillon, D. C., Reynolds, L. J., Day, C. H., McNeill, P. D., Hendrickon, R. C., 2002. Clin. Diagn. Lab. Immunol. 9, 883-891. Kashyap, R. S., Dobos, K. M., Belisle, J. T., Purohit, H. J., Chandark, N. H., Taori, G. M., Daginawdlo, H. F., 2005. Clin. Diagn. Lab.Immunol. 12, 752-758. Laurenson, S., Pett, M. R., Hoppe-Seyler, K., Denk, C., Hoppe-Seyler F., Coleman, N., Ferrigno, P. K., 2011. Anal. Biochem. 410, 161-170. Mejia, G. I.; Castrillon, L.; Trujillo, H.; Robledo, 1999. J. A. Int. J. Tuberc. Lung. Dis. 1999, 3, 138-142. Mi, X. W., He, F. J., Xiang, M. Y., Lian, Y., Yi, S. L., 2012. Anal. Chem. 84, 939-946. Morcillo, N., Imperiale, B., Di Giulio, B., 2010. International Journal of Tuberculosis and Lung Disease 14, 1169–1175. Nguyen Quoc D., Patil, D., Jung, H., Kim, J., Kim, D., 2013. Sens.Actuators B: Chem. 183, 381–387. Ren, J. L., He, F. J., Yi, S. L., Cui, X. Y., 2008. Biosens. Bioelectron. 4, 403-409. Sefah, K., Shangguan, D., Xiong, X. L., O’Donoghue, M. B., Tan, W. H., 2010. Nat. Protoc., 5(6), 1169-1185. Shamsipura M., Pashabadia, A., Molaabasib, F., Hosseinkhanic, S., 2017. Biosens. Bioelectron. 90, 195-202. Shen, D. Z., Li, Z. Y., Nie, L. H., Yao, S. Z., 1993. Anal. Chim. Acta. 280, 209–216. Tong, F. F., Lian, Y., Zhou, H., Shi, X. H., He, F. J., 2014. Anal. Chem. 86, 10415−10421. Tortoli, E., Benedetti, M., Fontanelli, A., Simontli, M. T., 2002. J. Clin. Microbiol. 40, 607 -610. Tuerk, C., Gold, L., 1990. Sci. 249, 505-510. Wang, J. C., Guo, J. J., Zhang, J. J., Zhang, W. J., Zhang, Y. Z., 2017. Biosens. Bioelectron. 95, 100-105. 14
Wang, B., Zheng, J., He, Y., Sheng, Q., 2013. Sens. Actuators B: Chem. 186, 417–422. World Health Organization, 2015. WHO report 2015: Global tuberculosis report. World Health Organization. World Health Organization, 2016. WHO report 2016: Global tuberculosis report. World Health Organization. Wu, F., Su, L., Yu, P., Mao, L.Q., 2017. J. Am. Chem. Soc. 139 (4), 1565–1574. Xia,Y. K., Liu, M. M., Wang, L. L., Yan, A., He, W. H., Chen, M., Lan, J. M., Xu,J. X., Guan, L. H.,Chen, J. H., 2017. Biosens. Bioelectron. 92, 8-15. Yoo, M. S., Shin, M., Kim, Y. H., Jang, M., Choi,Y. E., Park, S. J., Choi, J. H., Lee, J.Y., Park, C. H., 2017. Chemosphere. 175, 269-274. Zelada-Guillén, G. A., Riu, Jordi., Düzgün, A., Rius, F. X., 2009, Angew. Chem. Int. Ed. 48, 7334 –7337.
15