- Email: [email protected]
Selection of reference genes for real-time polymerase chain reaction analysis in tissues from Bombus terrestris and Bombus lucorum of different ages
Analytical Biochemistry 397 (2010) 118–120
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
Selection of reference genes for real-time polymerase chain reaction analysis in tissues from Bombus terrestris and Bombus lucorum of different ages Darina Hornˇáková 1, Petra Matoušková 1,2, Jirˇí Kindl, Irena Valterová, Iva Pichová * Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic, 166 10 Prague 6, Czech Republic
a r t i c l e
i n f o
Article history: Received 9 July 2009 Available online 12 September 2009
a b s t r a c t Quantitative real-time polymerase chain reaction (PCR) is an accurate and sensitive technique for gene expression analysis. However, it requires data normalization using reference genes. Here we assessed the stability of eight reference genes in the labial gland and fat body of the bumblebees Bombus terrestris and Bombus lucorum of different ages. To date, no reference genes have been identified for these species. Our data show that arginine kinase (AK) and phospholipase A2 (PLA2) are the most stable genes in both tissues of B. terrestris. The most stable genes for the labial gland and fat body of B. lucorum were found to be elongation factor 1a (EEF1A) and PLA2. Ó 2009 Elsevier Inc. All rights reserved.
Quantitative real-time polymerase chain reaction (PCR)3 is a rapid and reliable method for the detection and quantification of messenger RNA (mRNA) transcription levels of genes expressed during different biological processes. Improvements to the PCR instrumentation have caused an increase in the use of this method, which detects transcript expression levels with a high degree of sensitivity. However, biological variability of samples and technical factors associated with sample preparation (e.g. quantity of starting material, RNA extraction, reverse transcription methods) require identification of reference genes (RGs) to be used as internal controls for correct quantification of gene expression. Optimal RGs should be expressed at constant levels in different tissues of a given organism as well as at all stages of the organism’s life. To find the most suitable RGs for different organisms or tissues, careful studies evaluating the stability of the gene candidates must be undertaken. Indeed, several reports are available showing the unreliability of some of the most commonly used RGs due to differences in their behavior in various tissues [1]. The bumblebees Bombus terrestris and Bombus lucorum are important agricultural pollinators as well as ecological model species. Communication in these social species is, to a great extent, based on production of pheromones. In contrast to the vast library of available information on the biosynthesis of pheromones in bee* Corresponding author. Fax: +420 220183556. E-mail address: [email protected] (I. Pichová). 1 These authors contributed equally to this work. 2 Present address: School of Biosciences, University of Exeter, Exeter EX4 4QD, UK. 3 Abbreviations used: PCR, polymerase chain reaction; mRNA, messenger RNA; RG, reference gene; AK, arginine kinase; EEF1A, elongation factor 1a; ACTB, b-actin; RPL13, ribosomal protein L13; TUB, a-tubulin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RPP2, acidic ribosomal protein P2; PLA2, phospholipase A2; RPS18, ribosomal protein S18; RP49, ribosomal protein 49; TBP, TATA binding protein. 0003-2697/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2009.09.019
tles and moths, little is known about the pheromone biosynthesis in bumblebees. Moreover, the type and quantity of pheromone produced vary with the age of B. terrestris, and the labial gland undergoes age-dependent ultrastructural and physiological changes [2]. The pheromone components may be synthesized de novo in the cephalic region of the labial gland from acetate units or from common lipids in the fat body tissue and transported by hemolymph to the labial gland for further modifications [3,4]. In the current study, therefore, the validation of RGs for potential age-dependent gene expression analyses was performed in the labial gland and fat body of bumblebees. A set of genes, commonly used in other organisms as RGs, was validated (Table 1). We considered several criteria for selection of candidate genes: (i) involvement of gene products in different cellular functions to reduce possible errors caused by coregulation of different genes and (ii) function of the candidate genes as RGs in different organisms. Sequences of only two genes, arginine kinase (AK) and elongation factor 1a (EEF1A), from both bumblebees were publicly accessible in databases from previous phylogenetic studies [5]. Partial nucleotide sequences of the b-actin (ACTB), ribosomal protein L13 (RPL13), a-tubulin (TUB), phospholipase A2, glyceraldehyde-3phosphate dehydrogenase (GAPDH), and acidic ribosomal protein P2 (RPP2) genes were determined by PCR using degenerate primers designed by an alignment of sequences for particular genes from different insect species (see Table 1 in Supplementary material). Total RNA was isolated from dissected labial glands and fat bodies of the B. lucorum males of the age from pharate imago up to 20 days and of the B. terrestris males from pharate imago up to 12 days of adult life (for experimental procedures, see Supplementary material). Expression levels of RGs were analyzed using relative quantification (DCt method) [6]. The amplification efficiencies (E) and correlation coefficients (R2) of the RGs were generated using
119
Notes & Tips / Anal. Biochem. 397 (2010) 118–120
Table 1 Selected candidate reference genes and GenBank accession numbers or references, annealing temperatures, amplification efficiencies, regression coefficients, primers, and amplicon lengths used for the genes. Gene
Full gene name
AK
Arginine kinase
Species GenBank accession number or reference (B. terrestris/B. lucorum)
terr/ luc EEF1A Elongation factor terr/ luc 1a PLA2 Phospholipase terr/ A2 luc TUB a-Tubulin terr/ luc GADPH Glyceraldehyde- terr/ 3-phosphate luc dehydrogenase ACTB b-Actin terr luc RPL13 Ribosomal terr protein L13 luc RPP2 Acidic ribosomal terr protein P2 luc
Annealing E temperature (%) (°C)
R2
Forward primer
Reverse primer
Amplicon length (bp)
AF492888/AF492887
50/52
104 0.995 TGTCGGTATCTACGCGCCTG
TTGGTGGATGCTTGTCAGTC
112
AF492955/AF492954
50/52
94
CACAAATGCTACCGCAACAG
187
FN391388/FN391381
50/52
102 0.992 GGTCACACCGAAACCAGATT
TCGCAACACTTCGTCATTTC
114
FN391382/FN391383
50/52
100 0.996 TGATCTTGCCAAGGTACAGC
ACGAATGCACGTTTAGCGTA
117
FN391384/FN421446
50/52
95
0.992 TTTTGAAATCGTTGAGGGTCTT
CCATCACGCCATAACTTTCC
96
FN391379 FN391380 FN391387 FN391386 DN048379 FN391385
50 52 50 52 50 52
102 103 102 X X 90
0.997 0.992 0.996 X X 0.998
AGCGTATAGCGAAAGTACAGC 77 GAAGCGTATAGCGAAAGCAC 79 CTTCACAGGTCTTGGTGCAA 83 CTTCACAGGTCTTGGTGCAA 83 TCAGATTCTTCTTTCGCTGGT 106 CGATTCTTCTTTCGCTGGTT 106
0.994 AGAATGGACAAACCCGTGAG
TGACGCAGATTATGTTTGAA TGACGCAGATTATGTTTGAA GGTTTAACCAGCCAGCTAGAAA GGTTTAACCAACCAGCTAGAAAA TTGGTGGTGGTGTAGCTGTT TTGGTGGTGGTGTAGCTGTT
X: value was not measured.
Fig. 1. Selection of the most suitable reference genes for normalization in the labial gland (A) and fat body (B) of B. terrestris and in the labial gland (C) and fat body (D) of B. lucorum using geNorm analysis. Stepwise exclusion of the least stable genes was conducted via calculation of the average expression stability (M). The M value was calculated for each gene, and the least stable gene with the highest M value was automatically excluded for the next round of calculations. The x axis from left to right indicates the ranking of the genes according to their expression stability.
120
Notes & Tips / Anal. Biochem. 397 (2010) 118–120
the slopes of the standard curves. The regression coefficients (R2) were similar for all of the genes, and the efficiencies of the quantitative PCR amplifications ranked between 90 and 104% for all tested genes (Table 1). GeNorm and NormFinder were used to evaluate the expression stability of the RGs. The ranking of the selected genes of both bumblebee species was first analyzed by geNorm, which calculates the gene expression stability measure (M), representing the average pairwise variation of a given gene with respect to all other selected genes [6]. The most stable genes found in the labial gland and the fat body of B. terrestris were phospholipase A2 (PLA2) and AK (Fig. 1A and B). In B. lucorum, the EEF1A and PLA2 genes emerged as the most stable in both tissues (Fig. 1C and D). To investigate the optimal number of RGs, the pairwise variation (V) between two sequential normalization factors containing an increasing number of genes was calculated. The desired cutoff value of 0.15 was reached in both tissues for the two best scoring genes, and the addition of the third gene did not significantly affect the reliability of the selected RGs in B. terrestris (see Fig. 1a and b in Supplementary material). The addition of the third gene was unnecessary for B. lucorum (see Fig. 1c and d in Supplementary material). Identification of the optimal normalization gene among a set of candidates can also be performed using NormFinder [7], which ranks the expression stability value of a given gene within a set of selected candidates, thereby enabling the determination of a gene ranking order. This analysis identified PLA2 and AK as the most stable genes in the labial gland of both bumblebees (see Table 2 in Supplementary material), in good agreement with results obtained by geNorm for B. terrestris. However, the ranking of AK for the B. lucorum labial gland appears to be different from the results of geNorm, AK in B. lucorum is still ranked as the stable RG. NormFinder analysis for the candidate genes in the fat body of both species corresponds well to the calculations of geNorm (see Table 3 in Supplementary material). Phospholipase A2 is not a commonly used RG; however, it was proved here to be a suitable RG. This enzyme, which is responsible for releasing the fatty acid moiety from the sn2 position of phospholipids, may play an important role in lipid metabolism of bumblebees. However, its precise function remains to be elucidated. Numerous studies have shown that many of the RGs used as standards to normalize gene targets are regulated, and their expressions vary under different experimental conditions [1]. ACTB, commonly used as an RG for various tissues and organisms [8– 10], was among the most unstable genes we found in all of the analyzed samples from both bumblebee species. Several other studies have also shown that the use of this particular gene for normalization is unreliable [11,12]. In contrast to these findings, ACTB, GAPDH, and ribosomal protein S18 (RPS18) were identified as the most stable genes during RG validation work with the honeybee Apis mellifera, tested in the context of a bacterial challenge with Escherichia coli [13]. In validation analysis of RGs in the honeybee performed by Lourenco and coworkers [14], ACTB, ribosomal protein 49 (RP49), EEF1A, and TATA binding protein (TBP) were selected as the most stable genes. These results demonstrate the need to thoroughly validate candidate RG expression because the transcription levels and stabilities of the candidate RGs can vary significantly from species to species and from tissue to tissue [15]. In summary, we have found the PLA2 and AK genes to be most stable in both tissues from B. terrestris and found the EEF1A and PLA2 genes to be most stable in both tissues from B. lucorum. These
120
genes can be used for quantification of mRNA transcription levels of genes expressed during bumblebee age development. The identified genes may also suffice as normalization genes for use with different tissues or life stages of other bumblebee species, but the rank order of gene stability as reported in the current study must first be validated. Acknowledgments This research was financially supported by a grant from the Czech Science Foundation (203/09/1446) and by projects LC 531, 2B06007, and Z4 055 0506 from the Ministry of Education of the Czech Republic. The authors thank V. Ptácˇek (Masaryk University, Brno) for insect rearing and Markéta Foley for language consulting. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ab.2009.09.019. References [1] C. Tricarico, P. Pinzani, S. Bianchi, M. Paglierani, V. Distante, M. Pazzagli, S.A. Bustin, C. Orlando, Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies, Anal. Biochem. 309 (2002) 293–300. [2] J. Sobotnik, B. Kalinova, L. Cahlikova, F. Weyda, V. Ptacek, I. Valterova, Agedependent changes in structure and function of the male labial gland in Bombus terrestris, J. Insect Physiol. 54 (2008) 204–214. [3] P. Matouskova, A. Luxova, J. Matouskova, P. Jiros, A. Svatos, I. Valterova, I. Pichova, A delta 9 desaturase from Bombus lucorum males: investigation of the biosynthetic pathway of marking pheromones, ChemBioChem 9 (2008) 2534– 2541. [4] A. Luxová, I. Valterová, K. Stránsky´, O. Hovorka, A. Svatoš, Biosynthetic studies on marking pheromones of bumblebee males, Chemoecology 13 (2003) 81–87. [5] A. Kawakita, T. Sota, J.S. Ascher, M. Ito, H. Tanaka, M. Kato, Evolution and phylogenetic utility of alignment gaps within intron sequences of three nuclear genes in bumble bees (Bombus), Mol. Biol. Evol. 20 (2003) 87–92. [6] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F. Speleman, Accurate normalization of real-time quantitative RT–PCR data by geometric averaging of multiple internal control genes, Genome Biol. 3 (2002) RESEARCH0034. [7] C.L. Andersen, J.L. Jensen, T.F. Orntoft, Normalization of real-time quantitative reverse transcription–PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets, Cancer Res. 64 (2004) 5245–5250. [8] B.M. Pri-Tal, J.M. Brown, M.A. Riehle, Identification and characterization of the catalytic subunit of phosphatidylinositol 3-kinase in the yellow fever mosquito Aedes aegypti, Insect Biochem. Mol. Biol. 38 (2008) 932–939. [9] A.P. Lourenco, M.S. Zufelato, M.M. Bitondi, Z.L. Simoes, Molecular characterization of a cDNA encoding prophenoloxidase and its expression in Apis mellifera, Insect Biochem. Mol. Biol. 35 (2005) 541–552. [10] F.D. Guerrero, Cloning of a horn fly cDNA, HialphaE7, encoding an esterase whose transcript concentration is elevated in diazinon-resistant flies, Insect Biochem. Mol. Biol. 30 (2000) 1107–1115. [11] R. Perez, I. Tupac-Yupanqui, S. Dunner, Evaluation of suitable reference genes for gene expression studies in bovine muscular tissue, BMC Mol. Biol. 9 (2008) 79. [12] X. Zhang, L. Ding, A.J. Sandford, Selection of reference genes for gene expression studies in human neutrophils by real-time PCR, BMC Mol. Biol. 6 (2005) 4. [13] B. Scharlaken, D.C. de Graaf, K. Goossens, M. Brunain, L.J. Peelman, F.J. Jacobs, Reference gene selection for insect expression studies using quantitative realtime PCR: the head of the honeybee, Apis mellifera, after a bacterial challenge, J. Insect Sci. 8 (2008) 33. [14] L.P. Lourenco, A. Mackert, A. Dos Santos Cristino, Z.L.P. Simoes, Validation of reference genes for gene expression studies in the honey bee, Apis mellifera, by quantitative real-time RT/PCR, Apidologie 39 (2008) 372–385. [15] O. Thellin, W. Zorzi, B. Lakaye, B. De Borman, B. Coumans, G. Hennen, T. Grisar, A. Igout, E. Heinen, Housekeeping genes as internal standards: use and limits, J. Biotechnol. 75 (1999) 291–295.
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
Selection of reference genes for real-time polymerase chain reaction analysis in tissues from Bombus terrestris and Bombus lucorum of different ages Darina Hornˇáková 1, Petra Matoušková 1,2, Jirˇí Kindl, Irena Valterová, Iva Pichová * Institute of Organic Chemistry and Biochemistry, Academy of Sciences of the Czech Republic, 166 10 Prague 6, Czech Republic
a r t i c l e
i n f o
Article history: Received 9 July 2009 Available online 12 September 2009
a b s t r a c t Quantitative real-time polymerase chain reaction (PCR) is an accurate and sensitive technique for gene expression analysis. However, it requires data normalization using reference genes. Here we assessed the stability of eight reference genes in the labial gland and fat body of the bumblebees Bombus terrestris and Bombus lucorum of different ages. To date, no reference genes have been identified for these species. Our data show that arginine kinase (AK) and phospholipase A2 (PLA2) are the most stable genes in both tissues of B. terrestris. The most stable genes for the labial gland and fat body of B. lucorum were found to be elongation factor 1a (EEF1A) and PLA2. Ó 2009 Elsevier Inc. All rights reserved.
Quantitative real-time polymerase chain reaction (PCR)3 is a rapid and reliable method for the detection and quantification of messenger RNA (mRNA) transcription levels of genes expressed during different biological processes. Improvements to the PCR instrumentation have caused an increase in the use of this method, which detects transcript expression levels with a high degree of sensitivity. However, biological variability of samples and technical factors associated with sample preparation (e.g. quantity of starting material, RNA extraction, reverse transcription methods) require identification of reference genes (RGs) to be used as internal controls for correct quantification of gene expression. Optimal RGs should be expressed at constant levels in different tissues of a given organism as well as at all stages of the organism’s life. To find the most suitable RGs for different organisms or tissues, careful studies evaluating the stability of the gene candidates must be undertaken. Indeed, several reports are available showing the unreliability of some of the most commonly used RGs due to differences in their behavior in various tissues [1]. The bumblebees Bombus terrestris and Bombus lucorum are important agricultural pollinators as well as ecological model species. Communication in these social species is, to a great extent, based on production of pheromones. In contrast to the vast library of available information on the biosynthesis of pheromones in bee* Corresponding author. Fax: +420 220183556. E-mail address: [email protected] (I. Pichová). 1 These authors contributed equally to this work. 2 Present address: School of Biosciences, University of Exeter, Exeter EX4 4QD, UK. 3 Abbreviations used: PCR, polymerase chain reaction; mRNA, messenger RNA; RG, reference gene; AK, arginine kinase; EEF1A, elongation factor 1a; ACTB, b-actin; RPL13, ribosomal protein L13; TUB, a-tubulin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; RPP2, acidic ribosomal protein P2; PLA2, phospholipase A2; RPS18, ribosomal protein S18; RP49, ribosomal protein 49; TBP, TATA binding protein. 0003-2697/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2009.09.019
tles and moths, little is known about the pheromone biosynthesis in bumblebees. Moreover, the type and quantity of pheromone produced vary with the age of B. terrestris, and the labial gland undergoes age-dependent ultrastructural and physiological changes [2]. The pheromone components may be synthesized de novo in the cephalic region of the labial gland from acetate units or from common lipids in the fat body tissue and transported by hemolymph to the labial gland for further modifications [3,4]. In the current study, therefore, the validation of RGs for potential age-dependent gene expression analyses was performed in the labial gland and fat body of bumblebees. A set of genes, commonly used in other organisms as RGs, was validated (Table 1). We considered several criteria for selection of candidate genes: (i) involvement of gene products in different cellular functions to reduce possible errors caused by coregulation of different genes and (ii) function of the candidate genes as RGs in different organisms. Sequences of only two genes, arginine kinase (AK) and elongation factor 1a (EEF1A), from both bumblebees were publicly accessible in databases from previous phylogenetic studies [5]. Partial nucleotide sequences of the b-actin (ACTB), ribosomal protein L13 (RPL13), a-tubulin (TUB), phospholipase A2, glyceraldehyde-3phosphate dehydrogenase (GAPDH), and acidic ribosomal protein P2 (RPP2) genes were determined by PCR using degenerate primers designed by an alignment of sequences for particular genes from different insect species (see Table 1 in Supplementary material). Total RNA was isolated from dissected labial glands and fat bodies of the B. lucorum males of the age from pharate imago up to 20 days and of the B. terrestris males from pharate imago up to 12 days of adult life (for experimental procedures, see Supplementary material). Expression levels of RGs were analyzed using relative quantification (DCt method) [6]. The amplification efficiencies (E) and correlation coefficients (R2) of the RGs were generated using
119
Notes & Tips / Anal. Biochem. 397 (2010) 118–120
Table 1 Selected candidate reference genes and GenBank accession numbers or references, annealing temperatures, amplification efficiencies, regression coefficients, primers, and amplicon lengths used for the genes. Gene
Full gene name
AK
Arginine kinase
Species GenBank accession number or reference (B. terrestris/B. lucorum)
terr/ luc EEF1A Elongation factor terr/ luc 1a PLA2 Phospholipase terr/ A2 luc TUB a-Tubulin terr/ luc GADPH Glyceraldehyde- terr/ 3-phosphate luc dehydrogenase ACTB b-Actin terr luc RPL13 Ribosomal terr protein L13 luc RPP2 Acidic ribosomal terr protein P2 luc
Annealing E temperature (%) (°C)
R2
Forward primer
Reverse primer
Amplicon length (bp)
AF492888/AF492887
50/52
104 0.995 TGTCGGTATCTACGCGCCTG
TTGGTGGATGCTTGTCAGTC
112
AF492955/AF492954
50/52
94
CACAAATGCTACCGCAACAG
187
FN391388/FN391381
50/52
102 0.992 GGTCACACCGAAACCAGATT
TCGCAACACTTCGTCATTTC
114
FN391382/FN391383
50/52
100 0.996 TGATCTTGCCAAGGTACAGC
ACGAATGCACGTTTAGCGTA
117
FN391384/FN421446
50/52
95
0.992 TTTTGAAATCGTTGAGGGTCTT
CCATCACGCCATAACTTTCC
96
FN391379 FN391380 FN391387 FN391386 DN048379 FN391385
50 52 50 52 50 52
102 103 102 X X 90
0.997 0.992 0.996 X X 0.998
AGCGTATAGCGAAAGTACAGC 77 GAAGCGTATAGCGAAAGCAC 79 CTTCACAGGTCTTGGTGCAA 83 CTTCACAGGTCTTGGTGCAA 83 TCAGATTCTTCTTTCGCTGGT 106 CGATTCTTCTTTCGCTGGTT 106
0.994 AGAATGGACAAACCCGTGAG
TGACGCAGATTATGTTTGAA TGACGCAGATTATGTTTGAA GGTTTAACCAGCCAGCTAGAAA GGTTTAACCAACCAGCTAGAAAA TTGGTGGTGGTGTAGCTGTT TTGGTGGTGGTGTAGCTGTT
X: value was not measured.
Fig. 1. Selection of the most suitable reference genes for normalization in the labial gland (A) and fat body (B) of B. terrestris and in the labial gland (C) and fat body (D) of B. lucorum using geNorm analysis. Stepwise exclusion of the least stable genes was conducted via calculation of the average expression stability (M). The M value was calculated for each gene, and the least stable gene with the highest M value was automatically excluded for the next round of calculations. The x axis from left to right indicates the ranking of the genes according to their expression stability.
120
Notes & Tips / Anal. Biochem. 397 (2010) 118–120
the slopes of the standard curves. The regression coefficients (R2) were similar for all of the genes, and the efficiencies of the quantitative PCR amplifications ranked between 90 and 104% for all tested genes (Table 1). GeNorm and NormFinder were used to evaluate the expression stability of the RGs. The ranking of the selected genes of both bumblebee species was first analyzed by geNorm, which calculates the gene expression stability measure (M), representing the average pairwise variation of a given gene with respect to all other selected genes [6]. The most stable genes found in the labial gland and the fat body of B. terrestris were phospholipase A2 (PLA2) and AK (Fig. 1A and B). In B. lucorum, the EEF1A and PLA2 genes emerged as the most stable in both tissues (Fig. 1C and D). To investigate the optimal number of RGs, the pairwise variation (V) between two sequential normalization factors containing an increasing number of genes was calculated. The desired cutoff value of 0.15 was reached in both tissues for the two best scoring genes, and the addition of the third gene did not significantly affect the reliability of the selected RGs in B. terrestris (see Fig. 1a and b in Supplementary material). The addition of the third gene was unnecessary for B. lucorum (see Fig. 1c and d in Supplementary material). Identification of the optimal normalization gene among a set of candidates can also be performed using NormFinder [7], which ranks the expression stability value of a given gene within a set of selected candidates, thereby enabling the determination of a gene ranking order. This analysis identified PLA2 and AK as the most stable genes in the labial gland of both bumblebees (see Table 2 in Supplementary material), in good agreement with results obtained by geNorm for B. terrestris. However, the ranking of AK for the B. lucorum labial gland appears to be different from the results of geNorm, AK in B. lucorum is still ranked as the stable RG. NormFinder analysis for the candidate genes in the fat body of both species corresponds well to the calculations of geNorm (see Table 3 in Supplementary material). Phospholipase A2 is not a commonly used RG; however, it was proved here to be a suitable RG. This enzyme, which is responsible for releasing the fatty acid moiety from the sn2 position of phospholipids, may play an important role in lipid metabolism of bumblebees. However, its precise function remains to be elucidated. Numerous studies have shown that many of the RGs used as standards to normalize gene targets are regulated, and their expressions vary under different experimental conditions [1]. ACTB, commonly used as an RG for various tissues and organisms [8– 10], was among the most unstable genes we found in all of the analyzed samples from both bumblebee species. Several other studies have also shown that the use of this particular gene for normalization is unreliable [11,12]. In contrast to these findings, ACTB, GAPDH, and ribosomal protein S18 (RPS18) were identified as the most stable genes during RG validation work with the honeybee Apis mellifera, tested in the context of a bacterial challenge with Escherichia coli [13]. In validation analysis of RGs in the honeybee performed by Lourenco and coworkers [14], ACTB, ribosomal protein 49 (RP49), EEF1A, and TATA binding protein (TBP) were selected as the most stable genes. These results demonstrate the need to thoroughly validate candidate RG expression because the transcription levels and stabilities of the candidate RGs can vary significantly from species to species and from tissue to tissue [15]. In summary, we have found the PLA2 and AK genes to be most stable in both tissues from B. terrestris and found the EEF1A and PLA2 genes to be most stable in both tissues from B. lucorum. These
120
genes can be used for quantification of mRNA transcription levels of genes expressed during bumblebee age development. The identified genes may also suffice as normalization genes for use with different tissues or life stages of other bumblebee species, but the rank order of gene stability as reported in the current study must first be validated. Acknowledgments This research was financially supported by a grant from the Czech Science Foundation (203/09/1446) and by projects LC 531, 2B06007, and Z4 055 0506 from the Ministry of Education of the Czech Republic. The authors thank V. Ptácˇek (Masaryk University, Brno) for insect rearing and Markéta Foley for language consulting. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ab.2009.09.019. References [1] C. Tricarico, P. Pinzani, S. Bianchi, M. Paglierani, V. Distante, M. Pazzagli, S.A. Bustin, C. Orlando, Quantitative real-time reverse transcription polymerase chain reaction: normalization to rRNA or single housekeeping genes is inappropriate for human tissue biopsies, Anal. Biochem. 309 (2002) 293–300. [2] J. Sobotnik, B. Kalinova, L. Cahlikova, F. Weyda, V. Ptacek, I. Valterova, Agedependent changes in structure and function of the male labial gland in Bombus terrestris, J. Insect Physiol. 54 (2008) 204–214. [3] P. Matouskova, A. Luxova, J. Matouskova, P. Jiros, A. Svatos, I. Valterova, I. Pichova, A delta 9 desaturase from Bombus lucorum males: investigation of the biosynthetic pathway of marking pheromones, ChemBioChem 9 (2008) 2534– 2541. [4] A. Luxová, I. Valterová, K. Stránsky´, O. Hovorka, A. Svatoš, Biosynthetic studies on marking pheromones of bumblebee males, Chemoecology 13 (2003) 81–87. [5] A. Kawakita, T. Sota, J.S. Ascher, M. Ito, H. Tanaka, M. Kato, Evolution and phylogenetic utility of alignment gaps within intron sequences of three nuclear genes in bumble bees (Bombus), Mol. Biol. Evol. 20 (2003) 87–92. [6] J. Vandesompele, K. De Preter, F. Pattyn, B. Poppe, N. Van Roy, A. De Paepe, F. Speleman, Accurate normalization of real-time quantitative RT–PCR data by geometric averaging of multiple internal control genes, Genome Biol. 3 (2002) RESEARCH0034. [7] C.L. Andersen, J.L. Jensen, T.F. Orntoft, Normalization of real-time quantitative reverse transcription–PCR data: a model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets, Cancer Res. 64 (2004) 5245–5250. [8] B.M. Pri-Tal, J.M. Brown, M.A. Riehle, Identification and characterization of the catalytic subunit of phosphatidylinositol 3-kinase in the yellow fever mosquito Aedes aegypti, Insect Biochem. Mol. Biol. 38 (2008) 932–939. [9] A.P. Lourenco, M.S. Zufelato, M.M. Bitondi, Z.L. Simoes, Molecular characterization of a cDNA encoding prophenoloxidase and its expression in Apis mellifera, Insect Biochem. Mol. Biol. 35 (2005) 541–552. [10] F.D. Guerrero, Cloning of a horn fly cDNA, HialphaE7, encoding an esterase whose transcript concentration is elevated in diazinon-resistant flies, Insect Biochem. Mol. Biol. 30 (2000) 1107–1115. [11] R. Perez, I. Tupac-Yupanqui, S. Dunner, Evaluation of suitable reference genes for gene expression studies in bovine muscular tissue, BMC Mol. Biol. 9 (2008) 79. [12] X. Zhang, L. Ding, A.J. Sandford, Selection of reference genes for gene expression studies in human neutrophils by real-time PCR, BMC Mol. Biol. 6 (2005) 4. [13] B. Scharlaken, D.C. de Graaf, K. Goossens, M. Brunain, L.J. Peelman, F.J. Jacobs, Reference gene selection for insect expression studies using quantitative realtime PCR: the head of the honeybee, Apis mellifera, after a bacterial challenge, J. Insect Sci. 8 (2008) 33. [14] L.P. Lourenco, A. Mackert, A. Dos Santos Cristino, Z.L.P. Simoes, Validation of reference genes for gene expression studies in the honey bee, Apis mellifera, by quantitative real-time RT/PCR, Apidologie 39 (2008) 372–385. [15] O. Thellin, W. Zorzi, B. Lakaye, B. De Borman, B. Coumans, G. Hennen, T. Grisar, A. Igout, E. Heinen, Housekeeping genes as internal standards: use and limits, J. Biotechnol. 75 (1999) 291–295.