Selective up-regulation of an nmda receptor subunit mrna in cultured cerebellar granule cells by K+-induced depolarization and nmda treatment

Neuron,

Vol. 12, 87-95,

January,

1994, Copyright

0 1994 by Cell Press

Selective UpRegulation of an NMDA Receptor Subunit mRNA in Cultured Cerebellar Granule Cells by K+-Induced Depolarization and NMDA Treatment Yasumasa Bessho,* Hiroyuki Nawa,+ and Shigetada Nakanishi* *Institute for Immunology Kyoto University Faculty of Medicine Kyoto 606 Japan +Beckman Neuroscience Center Cold Spring Harbor Laboratory Cold Spring Harbor, New York 11724

Summary High KCI or NMDA treatment promotes the survival of cultured neonatal cerebellar granule cells, and these cells become sensitive to NMDA toxicity after prolonged K+ depolarization. Following both treatments, the NMDA receptor increases, as assessed by fura- fluorescence analysis of NMDA receptor-mediated intracellular Ca2+ increase. Northern analysis indicates that both treatments specifically up-regulate NMDARZA subunit mRNA through an increase in resting intracellular Ca*+ concentration. Antisense oligonucleotide analysis further indicates that NMDARZA mRNA up-regulation is responsible for NMDA receptor induction. Our results demonstrate that regulation of a specific NMDA recep tor subunit mRNA governs NMDA receptor induction, which is thought to play an important role in granule cell survival and death. Introduction The N-methyl-o-aspartate (NMDA) type of glutamate receptor plays a crucial role in neuronal plasticity and neurotoxicity in the central nervous system (Monaghan et al., 1989; Nakanishi, 1992). NMDA receptors induce a long lasting change in neuronal responsiveness that is thought to underlie learning and memory, as well as neuronal cell differentiation (Bliss and Collingridge, 1993; Goodman and Shatz, 1993). These receptors are also required for survival of certain neuronal cells, but excess stimulation of NMDA receptor causes neuronal degeneration and neuronal cell death (Choi and Rothman, 1990; Goodman and Shatz, 1993). The integral channel of the NMDA receptors is highly increase in permeable to Ca2+, and the resulting intracellular Ca*+ concentration ([Ca*+]J is thought to be the key event in evoking both NMDA receptormediated neuronal plasticity and neurotoxicity (Choi and Rothman, 1990; Bliss and Collingridge, 1993). Recent molecular cloning studies have revealed that the NMDA receptor is composed of two distinct types of subunits, one termed NMDARI (NRI) and the other four termed NMDARZA-NMDAR2D (NR2A-NRZD) (Kutsuwada et al., 1992; Monyer et al., 1992; lshii et al., 1993). NRI serves as a key subunit that possesses all the properties characteristic of the NMDA receptor

(Moriyoshi et al., 1991). The NR2 subunits, on the contrary, show no NMDA receptor activity, but potentiate NMDA receptor activity in heteromeric assemblies with NRI and confer functional variability, depending on the heteromeric NR2 subunit compositions (Kutsuwada et al., 1992; Monyer et al., 1992; lshii et al., 1993). The physiological role and regulation of the different NMDA receptor subunits, however, remain to be elucidated. Primary cultures of cerebellar granule cells from neonatal rats provide a useful system to study the regulation and function of the NMDA receptor. It has been shown that K+-induced depolarization or NMDA treatment promotes the survival of cultured cerebellar granule cells and leads to an increase in functional NMDA receptors (Gallo et al., 1987; Baldzs et al., 1988, 1992; Van der Valk et al., 1991). These effects seem to be mediated through Ca*+ influx and are thought to mimic the influence of innervation received from the mossy fibers to immature postmigratory granule cells during cerebellar development (Gallo et al., 1987; Balazs et al., 1988). Furthermore, NMDA added to granule cells after prolonged depolarization is very toxic and causes granule cell death probably through excess stimulation of NMDA receptors (Cox et al., 1990). To explore the mechanisms underlying the induction of the NMDA receptor in cerebellar granule cells, we investigated expression of individual mRNAs for the NMDAreceptorsubunitsaftertreatmentofthesecells with either high KCI or NMDA. We report here that both treatments lead to specific up-regulation of NR2A mRNA through an increase in [Ca*+], in cultured cells. Wealsodescribetheanalysisofthe mechanisms underlying the up-regulation of NRZA mRNA and the role of this up-regulation in NMDA toxicity after prolonged K+ depolarization of these cells. Results Increase in Functional NMDA Receptors after Treatment of Cerebellar Granule Cells by High KCI or NMDA Primary cell cultures of cerebellar granule cells were prepared from 6-day-old rat pups (Bessho et al., 1993). In previous studies (Van der Valk et al., 1991; Balazs et al., 1992), NMDA receptor activity in cultured granule cells was determined by either directly measuring NMDA-induced electrophysiological currents or quantitating NMDA-stimulated 45Ca2+ influx. The former method, however posed some difficulty in determining quantitatively low NMDA receptor activity under noninduced conditions (Balazs et al., 1992), and the latter evaluated total changes in [Ca*+], in acell population containing some glial cells. To avoid these problems, we adopted a technique using digital fluorescence imaging to analyze [Ca*+]i changes in cells pre-

400 2

1

fB

300

$2 ?.E +

200 100

qj -

0 LLL

KCI (mM)

5

25

25

5

Nifed

_

-

30

-

-

-

-

-

100

100

-

_

-

-

100

NMDA

(PM) (PM)

AP-5 (PM)

Figure 1. Effectsof K’-Induced Depolarization ment on the Functional Expression of NMDA bellar Granule Cells

5

and NMDATreatReceptors in Cere-

Cerebellar granule cells were incubated with low KCI (5 mM) or high KCI (25 mM), and with the indicated compounds for 24 hr; Nifed, nifedipine. Cells were loaded with furaacetoxymethyl ester, and NMDA receptor activity was determined by measuring NMDA receptor-mediated [Ca*‘], increase after application of 30 PM NMDA and 10 PM glycine in HEPES-buffered saline solution containing 1 PM TrX (see Experimental Procedures). NMDA receptor activity was calculated by subtracting [Caz+], levels measured prior to addition of NMDA and glycine from those measured after application of these agents. Data reprersent means f SEM of measurements from 40 cells.

loaded with the Ca*+-sensitive dye fura- and determined NMDA receptor activity by measuring [Ca*+], changes in individual granule cells after application of NMDA together with glycine in a Mg*+-free medium. We first examined the effects of K+-induced depolarization on the functional expression of NMDA receptors. In culture on day 3, granule cells were incubated with either 5 mM KCI or 25 mM KCI for 24 hr. Both low and high KCI-treated cells responded and increased [Ca;!‘], in response to NMDA application (Figure 1). This increase in [Ca*‘]i was about 3 times higher in high KCI-treated cells than in low KCItreated cells. K’-induced depolarization activatesvoltage-dependent Ca2+ channels in cultured granule cells, and the resulting increase in [Ca*‘]i is thought to be responsible for the induction of NMDA receptors (Balhzs et al., 1992). Induction of functional NMDA receptors by high KCI, in fact, was blocked bycoincubation of thevoltage-dependent Ca*+ channel blocker nifedipine during high KCI treatment (Figure 1). Furthermore, resting [Ca*+], values in granule cells grown at 5 mM KCI and at 25 mM KCI in the absence and presence of 30 PM nifedipine for 24 hr were determined to be 49.8 f 1.8, 158.4 f 12.9, and 65.4 + 2.4 nM, respectively (data not shown), thus confirming that NMDA receptor induction is mediated through the increase in [Ca*+],. We next examined the effect of NMDA treatment of granule cells on the functional expression of the NMDA receptor. Granule cells were grown at low KCI

in the presence and absence of 100 VM NMDA for 24 hr. The NMDA treatment of cultured cells increased NMDA receptor activity by about 2-fold (Figure 1). This increase was blocked by the addition of the NMDA receptor antagonist o-2-amino-5-phosphonovalerate (AP-5; 100 PM) during NMDA treatment. Resting [Ca*‘], values in cells treated with NMDA in the absence and presence of AP-5 were determined to be 143.5 + 11.1 and 48.1 +_ 3.3 nM, indicating that NMDA treatment increases [Ca”]i through the NMDA receptor. We confirmed that the characteristics of NMDA receptor activity measured by fluorescence imaging analysisconform tothe known pharmacological properties of NMDA receptors (Monaghan et al., 1989; Nakanishi, 1992). NMDA receptor activity was inhibited by increasing the Mg*+ concentration (1 mM) in the assay medium. This activity was also inhibited by the following selective antagonists of the NMDA receptor (Watkins et al., 1990): 100 PM AP-5 (an antagonist acting at the glutamate-binding site), 30 PM 7-chlorokynurenate (an antagonist acting at the modulatory glycine-binding site), and 5 PM (+)-MK-801 (a channel blocker). We thus concluded that treatment with both high KCI and NMDA results in the increase in functional expression of NMDA receptors in cerebellar granule cells. Specific Up-Regulation of NRZA mRNA by High KCI Treatment The observed induction of the NMDA receptor may result from the elevation of mRNAs for all subunits of the receptor or, alternatively, from an increase in a specific subunit mRNA. To address this question, we examined the effects of K+ depolarization on mRNA levels of individual NMDA receptor subunits by Northern blot analysis (Figure 2). RNA was extracted from granule cells treated with 5 mM KCI or 25 mM KCI for 24 hr. Hybridization bands for NRI, NR2A, and NRZB mRNAs were identified in granule cells grown under both conditions. In contrast, no obvious band for either NR2C or NR2D mRNA was detected under either condition, despite the fact that these mRNA species were expressed in the cerebellum. When mRNA levels of the different subunits were compared in cells treated with high KCI and low KCI, NR2A mRNA levels increased by 2-3 times in high KCItreated cells as compared with low KCI-treated cells. No such increase was observed for NRI mRNA, and NR2B mRNA levels slightly decreased in high KCItreated cells (about 80% of values from low KCItreated cells). mRNA for the housekeeping elongation factor la was analyzed as an internal control; there were no changes in these levels with different KCI treatmentsorwithsubsequent NMDAtreatment(data not shown). Incubation of granule cells with high KCI gradually increased NR2A mRNA levels and led to a maximal level 24 hr after high KCI treatment (Figure 3A). No such increase in NRZA mRNA levels was observed in low KCI-treated cells. In addition,. no appreciable

Specific 89

Regulation

of an NMDA

Receptor

, NRl

Figure

2. Northern

,

Blot Analysis

Total RNA used for Northern 25 mM KCI for 24 hr (lane 2), was performed by hybridization Procedures. The radioactivity for NR2A, NRLC, and NRZD

Subunit

mRNA

, NRPA ,

of mRNAs

for

NR2B --II

Different

NMDA

NR2C

Receptor

Subunits

blot analysis was isolated from granule cells treated with 5 mM KCI for 24 hr (lane I), those treated with cerebellum from 6-day-old rats (lane 3), and adult (20 weeks) cerebellum (lane 4). Northern blot analysis with cDNA probes specific for individual NMDA receptor subunits as described in Experimental of cDNA probes used was 1.5 x IO9 to 2.0 x IO4 cpm per ~g of cDNA. The autoradiographic exposure was 3 times longer than that for NRI and 2 times shorter than that for NRLB.

of various antagonists on the induction of NR2A mRNA in high KCI-treated cells (Figure 4). Nifedipine blocked the increase in NR2A mRNA levels elicited by high KCI treatment. The addition of a high concentration of Mg*’ (11 mM), which is a nonselective Ca*+ channel blocker, similarly inhibited the elevation of NR2A mRNA levels in high KCI-treated cells (data not shown).Thevoltage-dependent Na’channel inhibitor tetrodotoxin (TTX) inhibits postsynaptic transmission and prevents secondary neurotransmitter release from cultured neurons (Narahashi, 1974). However, this antagonist had no effect on the up-regulation of NR2A mRNA (data not shown). Similarly, neither the a-amino3-hydroxy+methyl4isoxazolepropionate (AMPA)/kainate receptor antagonist 6-cyano-7-nitroquinoxaline2,3-dione (CNQX), nor the NMDA receptor antagonist AP-5, added either alone or together with CNQX, inhibited K+-induced elevation of NRZA mRNA. The results thus indicated that the increase in [Ca”]i through the activation of voltage-dependent Ca*+ channels is responsible for the specific induction of NR2A mRNA.

change in NRI mRNA levels was found in cells treated with either low KCI or high KCI throughout this experimental period. Dose dependence analysis indicated that KCI increased NR2A mRNA levels half-maximally at 22 mM KCI and maximally at about 35 mM KCI (Figure 3B). NRI mRNA levels did not increase at higher concentrations of up to 50 mM KCI. The results presented here thus indicated that high KCI treatment of granulecells specifically up-regulatesexpressionof NR2A mRNA among the family of the NMDA receptor subunits.

Mechanism of K+-Induced Up-Regulation of NRZA mRNA Elevated K+concentrations in the culture medium induce chronic membrane depolarization. However, depolarization is also known to liberate stored neurotransmitters from cultured neurons (Gallo et al., 1982). To investigate the mechanisms underlying the upregulation of NR2A mRNA, we examined the effects

B

A

Figure 3. Time Courses and DoseResponse Curves of K+-induced Depolarization Effects on NRI and NR2A mRNA Levels

300

300 -7 ;

NR2D

200

200

4 9a E

100

0 10

20

30

Time (hours)

40

50

0’

”

10

I

20

(

30

KCI (mM)

1

40

t

50

(A) Granule cells were incubated with low KCI (5 mM) (circles) or high KCI (25 mM) (squares) and harvested at the indicated times for Northern blot analysis of NRI mRNA (closed circles and squares) and NRZA mRNA (open circles and squares). mRNA levels were determined by radioactivity measurements of hybridization bands from Northern blot analysis. Data represent means + SEM of 3 experiments. (6) Granule cells were incubated with the indicated concentrations of KCI for 24 hr, and levels of NRl mRNA (closed squares) and NR2A mRNA (open squares) were determined by Northern blot analysis. mRNA levels in cells incubated with 5 mM KCI were used as a control value (100%). Data represent means + SEM of 2 experiments.

Neuron 90

T 6 4 z 2

300

2

200

E

150

E

100

a s

NMDA receptor per se is responsible for the upregulation of NR2A mRNA during NMDA treatment. The prolonged activation of the NMDA receptor has been shown to increase resting [Ca*+], in cultured granule cells (see above). It can thus be concluded that the specific induction of NR2A mRNA is caused by the increase in [Ca*‘]i in both K+-induced depolarization and NMDA treatment of granule cell culture.

250

50

z

Contribution of NRZA mRNA in Induction of the Functional NMDA Receptor An antisense oligonucleotide complementary to a given mRNA sequence is useful for dissecting the involvement of the specific mRNA in a certain physiological function. This strategy was used to determine whetherthe up-regulation of NR2A mRNA indeed participates in the induction of functional NMDA receptors in K+-depolarized granule cells. Two nonoverlapping 28mer antisense oligonucleotides of NR2A mRNA (AS-1 covering the translation initiation site and AS-2 corrresponding to the N-terminal protein-coding region) and a control oligonucleotide containing 7 mismatch nucleotides in the AS-1 sequence (MAS) were synthesized. Granule cells were cultured with high KCI in the presence and absence of these oligonucleotides for 24 hr, and NMDA receptor activity in the resultant cells was determined by fluorescence imaging measurement of NMDA-induced [Ca”]i changes. incubation with both AS-1 and AS-2 prevented the induction of functional NMDA receptor in high KCItreated cells (Figure6A). No such inhibition of NMDA receptor induction was observed following incubation with the mismatch oligonucleotide. Because the nucleotide sequence divergence of both AS-1 and AS-2 from the corresponding regions of the other NMDA receptor subunits is much greater (8-16 nucleotide mismatches per 20 nucleotides) than that between AS-l and MAS, it is very unlikely that

0 KCI (mM)

5 25

5 25

5 25

5 25

Nifed

AP-5

CNQX

5 25 AP-5 c&x

Figure 4. Effects of Various in NR2A mRNA Levels

Antagonists

on K+-Induced

Increase

Cultures were incubated with either low KCI (5 mM; open bars) or high KCI (25 mM; closed bars) with 30 RM nifedipine (Nifed), 100 PM AP-5,20 uM CNQX, or 100 RM AP-5 plus 20 PM CNQX for 24 hr. NR2A mRNA levels were determined by Northern blot analysis. NR2A mRNA levels in cells treated with low KCI in the absence of antagonist were used as a control value (100%). Data represent means 1 SEM of 2 experiments.

Up-Regulation of NRZA mRNA by NMDA Treatment NMDA treatment of granule cells grown in low KC1 (5 mM) increased NR2A mRNA levels with a half-maximal effective concentration of around 20 PM NMDA (Figure 5A), which was consistent with the value determined for the cloned NMDA receptor (Ishii et al., 1993). NMDA treatment, however, did not result in induction of NRI mRNA (Figure 5A) and slightly reduced NR2B mRNA levels (about 80%) (data not shown). The increase in NR2A mRNA was completely blocked by the addition of AP-5 during NMDA treatment (Figure 5B). Neither nifedipine nor TTX showed a blocking effect, indicating that the activation of the

A 200 ‘;; 6 2 z s!

150

+-if -Ad . ... .

. ,......

100

.... ...* . .. .... A

5

250

5

200

z

150

E a

100

E 1u

g

50

50

E 0

Figure 5. Dose-Response Curves of NMDA Effects on NRI and NR2A mRNA Levels and Effects of Various Antagonists on NMDAInduced Increase in NRZA mRNA Levels

B -g

E

I

3

10

30

100

NMDA (PM)

300

0 NMDA

(A) Granule cells were incubated with the indicated concentrations of NMDA in low KCI (5 mM) for 24 hr, and levels of NRI mRNA (closed triangles) and NR2A mRNA (open triangles) were determined by Northern blot analysis. Data represent means f SEM of 2 experiments. mRNA levels without addition of NMDA were used as a control value (100%). (B) Cultures were incubated with low KCI in the absence (open bar) or presence (closed bars) of the indicated compounds for 24 hr: 100 HIM NMDA, 100 uM AP-5, 30 uM nifedipine (Nifed), 10 t.tM lTX. NRZA mRNA levels in cells without addition of any of the above compounds were used as a control value (100%). Data represent means * SEM of 2 experiments.

11111 -

+

+

+

+

AP-5

Nifed

TTX

Specific

Regulation

of an NMDA

Receptor

Subunit

mRNA

91

oligonucleotide. In contrast, no such reduction was observed in NRI protein levels. The results presented here thus demonstrated that the up-regulation of of NRZA mRNA indeed contributes to the induction the functional NMDA receptor during K’-induced depolarization of cultured granule cells.

KCl(mM)

5

25

5

25

AS-1

5

25

AS-2

5

25

MAS

B

KCl(mM)

5 25 25 25 25 ‘;Bv, v)tna

au8

Figure 6. Effects of Antisense and Mismatch Antisense Oligonucleotides of NR2A mRNA on K+-Induced Elevation of NMDA Receptor Activity and NRI and NRZA Protein Levels (A) Granulecells were incubated with low KCI (5 mM; open bars) or high KCI (25 mM; closed bars) in the absence or presence of nonoverlapping antisense oligonucleotides (AS-1 and AS-2) or mismatch antisense oligonucleotide (MAS) of the NR2A mRNA sequence (IO PM each). After a 24 hr incubation, NMDA receptor activitywasdetermined by measuring the[Ca*+li increaseelicited byadditionof 30pMNMDAandlOL~Mglycinein HEPES-buffered saline solution containing 1 uM TTX (see Experimental Procedures). NMDA receptor activity was calculated by subtracting [Ca2’], levels measured prior to addition of NMDA and glycine from those measured after application of the agents. (6) Granule cells were incubated with 5 mM or 25 mM KCI in the presence or absence of the indicated oligonucleotides (10 PM each) for 24 hr, and NR2A and NRI protein levels in membrane fractions were determined by Western blot analysis as described in Experimental Procedures.

theantisenseoligonucleotides interfered with synthesis of other NMDA receptor subunits. To confirm the selective inhibition of NR2A subunit synthesis by the antisense oligonucleotides, NRI and NR2A protein levels in granule cell membrane fractions were determined by Western blot analysis using antibodies specificforthe respective receptor subunits. This analysis gave rise to immunoreactive bands at the positions expected for the NRI subunit (- 120 kd) and the NRZA subunit (-160 kd) (Figure 6B), and these bands disappeared with preadsorption of the antibodies with the corresponding antigens (data not shown). As can be seen in Figure 6B, NR2A protein levels were much higher in membrane fractions from high KCI-treated cells than in those from low KCI-treated cells. More importantly, NR2A protein levels were greatly reduced by the addition of either AS-l or AS-2 during K+ depolarization, but not by addition of the mismatch MAS

Properties of Granule Cells and Levels of NMDA Receptor Subunit mRNAs after Prolonged K+ Depolarization The mechanisms underlying the up-regulation of NR2A mRNA correlate well with those reported for the survival of granule cells under K+ depolarization and NMDA treatment (Gallo et al., 1987; Balazs et al., 1988). It was also reported by Cox et al. (1990) that NMDA is very toxic to cultured granule cells after prolonged K+ depolarization, probably through excess stimulation of elevated NMDA receptor. We investigated NRZA mRNA induction and its possible relation to the alteration of granule cell properties after prolonged K+ depolarization. When cell viability was analyzed in cultures following low and high KCI treatments, there was no appreciable change in cell survival after a 24 hr incubation (Figure 7A). Survival of granule cells was maintained by continuous exposure to high KCI for 5 days; this was in marked contrast with the massive cell death after a 5 day incubation in low KCI (Figure 7A). No NMDA toxicity was seen in cells incubated with low or high KCI for 24 hr (Figure 7B). However, as reported by Cox et al. (1990), NMDA toxicity as well as differential responses to various glutamate analogs changed markedly in cells treated with low or high KCI. In high KCI-treated cells, NMDA was toxic, whereas kainate was not. In low KCI-treated cells, kainate was toxic, whereas NMDA was not. When mRNA levels of different NMDA receptor subunits were analyzed in cells treated with low or high KCI for 5 days, NRI and NR2B mRNA levels slightly increased after high KCI treatment, but NR2A mRNA levels were again more specifically and remarkably elevated (Figure 7C). Thus, the specific up-regulation of NRZA mRNA is maintained during prolonged K+ depolarization. We then examined whether the specific expression of NR2A mRNA is required for NMDA toxicity. Granule cells were cultured with high KCI for 5 days, and during the last 3 days, these cells were grown in the presence

or

absence

of

the

antisense

or

mismatch

oligonucletoide. Granule cells partially died with the addition of the oligonucleotides, and the extent of cell death (about 30%) was similar with the antisense and mismatch oligonucleotide treatments. Notably, NMDA toxicity was markedly different between cells treated with the antisense oligonucleotides and those treated with the mismatch oligonucleotide (Figure 7D). Granule cells cultured in the presence of the antisense oligonucleotides were considerably resistant to NMDA toxicity, whereas those cells treated with the mismatch oligonucleotide were very sensitive to NMDA toxicity, comparable to untreated granule cells. This

Neuron 92

A

120~

‘;; 5 5

B

100

40

7 5 a .= g .s 2

20

J

80

.2 2 3

60

5 0

0

Figure 7. Effects of Prolonged K+ Depolarization on Granule Cell Survival, Sensitivity to Glutamate Receptor Agonists, and mRNA Levels of Different NMDA Subunits

1207 100

-

80

-

604020. o-

KCI

5mM

days

1

5

25mM 1

KCI

25mM 1 5

days

5

sz”

5 2! .e

IZ.2

C

600

‘i; a H B a, ii E

1

500 400 300 200 loo

KCI (mM)

5 25 NR1

5 25 NR2A

5 25

-

NRSB

AS-1

AS-2

MAS

(A) Granule cells prepared 3 days after plating were further grown in low KCI (5 mM) or high KCI (25 mM) for 24 hr (open bars) or 5 days (closed bars), and round granule cellswerecounted.Thecell number immediately before changing KCI concentrations was taken as 100%. Data represent means f SEM of 8 (24 hr) or 3 (5 days) experiments. (B) Granule cells grown in low KCI (5 mM) or high KCI (25 mM) for 24 hr as described above were exposed to 500 PM NMDA (open bars) for 30 min, or further grown for 5 days under both conditions and then exposed to 500 uM NMDA (closed bars) or 100 uM kainate (hatched bars) for 30 min. Cell viability after treatment with these receptor agonists was measured by fluorescein diacetate staining. The cell number in cultureexposed tonoagonistwasusedasa control value(lOO%). Data represent means f SEM of 3 experiments. (C) Granule cells were incubated with low KCI (5 mM; open bars) or high KCI (25 mM; closed bars) for 5 days, and levels of NRI, NR2A, and NR2B mRNAs were determined by Northern blot analysis. No appreciable NRZC or NR2D mRNA was detected in the different KCI treatments were taken as a control

analysis of either low or high KCI treatment. mRNA levels in cells immediately before value (100%). Data represent means f SEM of 2 experiments. (D) Granule cells were cultured in 25 mM KCI for 2 days and further grown in the presence AS-1 or AS-2, or the MAS mismatch oligonucleotide (IO uM each) for 3 days. Cell survival that of untreated cells, was as follows: AS-l, 73% f 5%; AS-2, 70% * 3%; and MAS, 64% by measuring variability of oligonucleotide-treated and -untreated cells after exposure viable cell number immediatelv before exposure to NMDA was taken as 100% for each 4 determinations.

result indicated that the up-regulation of NR2A mRNA is indeed necessary for induction of NMDA toxicity in granule cells. However, as noted above, granule cells depolarized for 24 hr were found to be insensitive to NMDA toxicity in spite of the fact that NR2A mRNAwas potently induced during this period. Thus, this investigation strongly suggests that the upregulation of NRZA mRNA is important, but may not be sufficient, for the alteration of granule cell functions after prolonged K+ depolarization. Discussion

The involvement of NMDA receptors in the survival and death of neuronal cells has been characterized in detail in culture by K+-induced depolarization or NMDA treatment of neonatal cerebellar granule cells (Gallo et al., 1987; Balazs et al., 1988, 1992; Cox et al., 1990; Van der Valk et al., 1991). These effects are thought to mimic the influenceof physiological stimulation of immaturecerebellargranulecellsduringcerebellar development (Gallo et al., 1987; Balazs et al., 1988). Recent molecular studies have revealed that different heteromeric assemblies of the multiple NMDA

or absence of antisense oligonucleotides after oligonucleotide treatment, relative to f 3%. NMDA toxicity was then determined to 500 uM NMDA, as described in (B). The treatment. Data represent means t SEM of

receptor subunits confer variability in the electrophysiological and pharmacological properties of NMDA receptors. The important question regarding NMDA receptors is thus which NMDA receptor subunits areexpressed and regulated in thedevelopment of neuronal cells.This investigation demonstratesthat both K+-induceddepolarization and NMDAtreatment selectively up-regulate NR2A mRNA levels among the mRNAs for the multiple NMDA receptor subunits and result in an increase in the functional expression of the NMDA receptor. Our observation of functional induction of the NMDA receptor is consistent with previous reports by Van der Valk et al. (1991) and Bal6zs et al. (1992), who assessed this problem by measuring 45Ca2+ influx as well as NMDA-induced electrophysiological currents in K+-depolarized cells. Furthermore, our antisense oligonucleotide analysis indicates that the increase in NR2A mRNA is responsible for NMDA receptor induction in granule cells following K+ depolarization. These results provide evidence indicating that the specific regulation of an NMDA receptor subunit plays an important role in the functional expression of NMDA receptors. This investigation also demonstrates that the in-

Specific 93

Regulation

of an NMDA

Receptor

Subunit

mRNA

crease in [Ca*+]i is a key event leading to up-regulation of NR2A mRNA after Kc-induced depolarization or NMDA treatment. The K+-induced elevation of NR2A mRNA was prevented by the selective voltage-dependent Ca*+channel antagonist nifedipine as well as the nonselective antagonist Mg*‘. In contrast, neither lTX nor several antagonists of ionotropic glutamate receptors interfered with the increase in NR2A mRNA under K’-induced depolarization. These results indicate that the elevation of NR2A mRNA levels is evoked by the increase in [CaI+]i through the activation of voltagedependent Ca*+ channels rather than the action of neurotransmitters released from depolarized cultured cells. The up-regulation of NR2A mRNA in NMDA-treated cells is also mediated through [Ca2’l, increase as a result of the direct activation of the NMDA receptor. These characteritics of the upregulation of NR2A mRNA correlate well with those observed for the survival of granule cells under K+induced depolarization and NMDA treatment (Callo et al., 1987; Baldzs et al., 1988). To verify the involvement of NMDA receptor induction in granule cell survival, we attempted to determine whether the NR2A antisense oligonucleotide interferes with NMDApromoted survival of granule cells. However, the oligonucleotides (both antisense and mismatch antisense), added together with NMDA, were found to be very toxic to granule cells, and this toxicity did not allow us to perform experiments in this direction. However, the good correlation described above strongly suggests that intracellular Ca2+ transduction plays acritical role in the survival of cerebellar granule cells through the regulation of expression of NR2A mRNA. Franklin and Johnson (1992) proposed a hypothesis to account for the differentiating effects of [Ca2+]i on neuronal cell survival and neuronal cell death. This hypothesis holds that [Ca*+b modestly elevated above normal resting levels promotes neuronal cell survival, whereas substantially elevated [Ca*+]i is toxic to neuronal cells and leads to neuronal cell death. Because NR2A mRNA levels are elevated in cultured granule cells after prolonged K+ depolarization, excess stimulation of the NMDA receptor by agonist would result in a substantial increase in [Ca*+]i and would thus lead to granule cell death. In this investigation, we indeed demonstrated that up-regulation of NRZA mRNA is indispensable for granule cells’ becoming sensitive to NMDA toxicity after prolonged K+ depolarization. However, we also found that NMDA is toxic after prolonged K+depolarization, but not for short term depolarization despite the fact that the NMDA receptor is significantly induced under both conditions. It is thus likely that up-regulation of NR2A mRNA is necessary, but may not be sufficient, for NMDA-mediated toxicity in granule cells after K+ depolarization. Up-regulation of the NMDA receptor subunit is very specific for NR2A in cultured granule cells. Interestingly, however, NR2C mRNA is most highly expressed

in granule cells of the adult cerebellum (Ishii et al., 1993; see also Figure I), suggesting that NR2C mRNA is up-regulated in later stages during development, probaby through a different mechanism. Developmental changes in expression of the subunit composition of transmitter-gated ion channels have also been reported for nicotinic acetylcholine and glycine receptors (Mishinaet al., 1986; Betz, 1990). In both cases, subunit switching changes channel kinetics and is thought to ensure rapid control of neuronal transmissionintheadultanimal(Mishinaetal.,1986;Takahashi et al., 1992). Interestingly, the NRllNR2A and NRl/ NR2C hetero-oligomers have been shown to bedifferent in the effectiveness of their interaction with both agonists (glutamate and NMDA) and antagonists (Kutsuwada et al., 1992; Monyer et al., 1992; lshii et al., 1993). Furthermore, the NRl/NR2A hetero-oligomer is more sensitive to Mg2’ blockade than the NRWNR2C hetero-oligomer. It is thus tempting to speculate that developmental changes in receptor properties due to differential expression of multiple NR2 subunits may have an important role in neuronal development and brain functions. Experimental

Procedures

Materials Materials were purchased from the following sources: CNQX, AP-5, and 7-chlorokynurenate from Tocris Neuramin; -TX and nifedipine from Wako Chemicals Inc.; MK-801 from Research Biochemicals Inc.; NMDA and ionomycin from Sigma; furaacetoxymethyl ester from Dojin; kainate and fluorescein diacetate from Nacalai Tesque; peroxidase-labeled second antibody from Cappel; Western blot chemiluminescence reagent from DuPont NEN. Two antisense oligonucleotides, AS-1 (CAATCTCCCCATGGTCCCCA) corrresponding to nucleotide residues -8 to 12 and AS-2 (CCAAGlTCGCGlTCTGTCAC) representing nucleotide residues 136 to 155 of the NR2A mRNA sequence, and a mismatch antisense oligonucleotide (GATACTCCCCATCGTCCCCTI in the AS-1 region were chemically synthesized by incorporating phosphorothioate nucleotides into these sequences. Antibodies against the NRl and NR2A subunits were kind gifts from R. L. Huganir (Johns Hopkins University School of Medicine) and T. Saido (Tokyo Metropolitan Institute of Medical Science), respectively. Cerebellar Granule Cell Cultures Primary cell cultures of cerebellar granule cells were prepared from 6-day-old Sprague-Dawley rat pups as described previously (Bessho et al., 1993). Briefly, cerebella were chopped, treated with 0.25 mg/ml trypsin and 12.5 pg/ml DNase I at 37OC for 20 min, and triturated with the following plating medium. Cells were plated with Dulbecco’s modified Eagle’s medium (DMEM) containing 10% fetal bovine serum, 4 mM glutamine, 100 U/ml penicillin, and 100 pg/ml streptomycin on plastic dishes coated with poly+lysine. One hour after plating, the medium was replaced with DMEM containing 5 mM KCI, 2 mM glutamine, 100 @ml bovine serum albumin, 1 mM sodium pyruvate, IO mM HEPES (pH 7.4), 100 U/ml penicillin, and 100 pglml streptomycin and N2 nutrient mixture (100 pg/ml human transferrin, 100 FM putrescine, 30 nM sodium selenite, 5 pg/ml bovine insulin, 20 nM progesterone) (Bottenstein and Sato, 1979). Cytosine arabinofuranoside (5 PM) was added to the culture at 24 hr after plating to inhibit the growth of nonneuronal cells. Cultures were used for experiments 3 days after plating. In general, the resultant cultures contained less than 10% nonneuronal cells such as glial and endothelial cells.

NeWOIl 94

Measurements of NMDA Receptor Activity Cerebellar granule cells were plated on glass coverslips coated with poly-o-lysine. Cells were loaded with 2 JIM furaacetoxymethyl ester for 30 min in the growth medium, rinsed, and allowed to sit for 30 min at 37OC in the growth medium before CaZ+ measurements. After washing with HEPES-buffered saline solution (20 mM HEPES [pH 7.41, 115 mM NaCI, 5.4 mM KCI, 1 mM CaCI,, 13.8 mM glucose), cells were incubated with HEPESbuffered salinesolutioncontainingl uMlTX.Theglasscoverslip was placed on a thermostated stage (maintained at 37OC). NMDA and glycine dissolved in HEPES-buffered saline solution containing 1 pM TTX (37OC) were applied to the cells. Furawas loaded homogeneously into round cerebellar granule cells, and fluorescence intensity did not change significantly for at least 2 hr after loading. The furafluorescence intensity was imaged in a microscope equipped with epifluorescence optics and a Hamamatsu SIT camera C2400. Paired recordings were made at 5 s intervals, and images at 340 and 380 nm were stored in a Hamamatsu digital image processor (Argus-50). The level of [Caz+], was calculated from a ratio of fluorescence intensities obtained with excitation at 340 and 380 nm on a pixel basis as in follows: [Ca2’], = Ko[R - R,,,)IfR max - R) x (F380,dF380,i.)] which K9, the dissociation constant for fura-2/Ca*+, is 224 nM (Grynkiewicz et al., 19851, Rmi, is the ratio obtained under the Ca2+-free condition in the presence of 10 mM ECTA, R,,. is the ratio obtained under the Caz+-saturated condition in the presence of 10 pfvt ionomycin, and F380,, and F380,,, represent the fluorescence values at 380 nm in the presence of EGTA and ionomycin, respectively. In our experimental conditions, R,,. = 0.32, R mal = 5.23, and F38O,,,IF380,,. = 4.57.

Acknowledgments

Northern Blot Analysis Total RNA was extracted from cultures using the guanidinium thiocyanate method (Chomczynski and Sacchi, 1987). Northern blot analysis was performed as described previously (Bessho et al., 1993). DNA probes for different NMDA receptor subunits were prepared from the following cDNA clones (Moriyoshi et al., 1991; lshii et al., 1993): NRI (nucleotide residues 769-2369 of pN60), NR2A (residues 1507-1953 of pNR2A), NR2B (residues 1567-1956 of pNRZB), NR2C (residues 3135-3887 of pNR2C), and NR2D (residues 3971-4543 of pNR2D). Radioactivity of hybridization-positive bands from Northern blot analysis was measured with a Bioimage Analyzer (BAS2000; Fuji Co.).

Betz, H. (1990). Ligand-gated acid receptor superfamily.

lmmunoblot Analysis lmmunoblot analysis was performed as described (Harlow and Lane, 1988). Crude membrane preparations (10 ug of protein) from cultured cerebellar granule cells were separated on 10% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes. The membrane proteins were reacted with affinity-purified antibodies against NRl (Tingley and Huganir, 1993) or NRZA; both antibodies were raised against the C-terminal sequencesof the respective subunits, and theaffinity purification and preadsorption of these antibodies were carried out by incubation with thecorresponding C-terminal sequences. The peroxidase-labeled second antibody and Western blot chemiluminescence reagent were used to visualize reacted bands. Toxicity Assay Toxicity of glutamate receptor agonists was measured as described by Cox et al. (1990). Granule cells were incubated at 37OC for 40 min in incubation buffer (8.6 mM HEPES [pH 7.4],154 mM NaCI, 5.6 mM KCI, 1 mM MgC&, 2.3 mM CaCl& Agonists were then added, and cells were incubated for 30 min. After incubation with agonists, the buffer was changed to an incubation buffer containing 5 &ml fluorescein diacetate and 5.6 mM glucose as described by Favaron et al. (1988). After a 5 min incubation, cells were examined by fluorescence microscopy. Small round cells retainingfluorescein were regarded as living granule cells, and their numbers were counted in randomly chosen fields.

We are grateful to Drs. S. Nagata, R. L. Huganir, and T. Saido for their kind gifts of the elongation factor la cDNA, the anti-NRl antibody, and the anti-NWA antibody, respectively. This work was supported in part by research grants from the Ministry of Education, Science and Culture of Japan, the Ministry of Health and Welfare, theyamanouchi Foundation for Research on Metabolic Disorders, and the Senri Life Science Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC Section 1734 solely to indicate this fact. Received

June

15, 1993; revised

October

4, 1993.

References Balazs, R., Jorgensen, 0. S., and Hack, N. (1988). N-Methyl-oaspartate promotes the survival of cerebellar granule cells in culture. Neuroscience 27, 437-451. Balazs, R., Resink, A., Hack, N., Van der Valk, J. B. F., Kumar, K. N., and Michaelis, E. (1992). NMDA treatment and K+-induced depolarization selectively promote the expression of an NMDApreferring class of the ionotropic glutamate receptors in cerebellar granule neurones. Neurosci. Lett. 737, 109113. Bessho, Y., Nawa, H., and Nakanishi, S. (1993). quisqualate regulate exprression of metabotropic ceptor mRNA in cultured cerebellar granulecells. 60, 253-259.

Glutamate and glutamate re 1. Neurochem.

ion channels in the brain: Neuron .5, 383-392.

Bliss, T. V. P., and Collingridge, of memory: long-term potentiation 367, 31-39.

the amino

C. L. (1993). A synaptic in the hippocampus.

Bottenstein, J. E., and Sato, G. H. (1979). Growth blastoma cell line in serum-free supplemented Natl. Acad. Sci. USA 76, 514-517.

model Nature

of a rat neuromedium. Proc.

Choi, D. W., and Rothman, S. M. (1990). The role 01 glutamate neurotoxicity in hypoxic-ischemic neuronal death. Annu. Rev. Neurosci. 13, 171-182. Chomczynski, RNA isolation form extraction.

P., and Sacchi, N. (1987). Single-step method by acid guanidinium thiocyanate-phenol-chloroAnal. Biochem. 162, 156-159.

of

Cox, J. A., Felder, C. C., and Henneberry, R. C. (1990). Differential expression of excitatory amino acid receptor subtypes in cultured cerebellar neurons. Neuron J, 941-947. Favaron, M., Manev, H., Alho, H., Bertolino, M., Ferret, B., Cuidotti, A., and Casta, E. (1988). Cangliosides prevent glutamate and kainate neurotoxicityin primary neuronal culturesof neonatal rat cerebellum and cortex. Proc. Natl. Acad. Sci. USA&, 73517355. Franklin, grammed calcium.

J. L., and Johnson, E. M., Jr. (1992). Suppression of proneuronal death by sustained elevation of cytoplasmic Trends Neurosci. 75, 501-508.

Gallo, V., Ciotti, M. T., Coletti, A., Aloisi, F., and Levi, C. (1982). Selective release of glutamate from cerebellar granule cells differentiating in culture. Proc. Natl. Acad. Sci. USA 79 7919-7923. Callo, V., Kingsbury, A., Baldzs, R., and Jorgensen, 0. S. (1987). The role of depolarization in the survival and differentiation of cerebellar granule cells in culture. J. Neurosci. 7, 2203-2213. Goodman, C. S., and Shatz, C. J. (1993). Developmental mechanisms that generate precise patterns of neuronal connectivity. Cell 7ZNeuron 70 (SuppI.), 77-98. Grynkiewicz, G., Poenie, M., and Tsien, R. Y. (1985). A new generationof CaZ+indicatorswithgreatlyimprovedfluorescenceproperties. J. Biol. Chem. 260, 3440-3450.

Specific 95

Regulation

of an NMDA

Receptor

Subunit

mRNA

Harlow, E., and Lane, D. (1988). Antibodies: A Laboratory Manual (Cold Spring Harbor, NewYork: Cold Spring Harbor Laboratory), pp. 471-510. Ishii, T., Moriyoshi, K., Sugihara, H., Sakurada, K., Kadotani, H., Yokoi, M., Akazawa, C., Shigemoto, R., Mizuno, N., Masu, M., and Nakanishi, S. (1993). Molecularcharacterization of the family of the N-methyl-o-aspartate receptor subunits. J. Biol. Chem. 268, 2836-2843. Kutsuwada, T., Kashiwabuchi, N., Mori, H., Sakimura, shiya, E., Araki, K., Meguro, H., Masaki, H., Kumanishi, kawa, M., and Mishina, M. (1992). Molecular diversity NMDA receptor channel. Nature 358, 36-41.

K., KuT., Araof the

Mishina, M., Takai, T., Imoto, K., Noda, M., Takahashi, T., and Numa, S. (1986). Molecular distinction between fetal and adult forms of muscle acetylcholine receptor. Nature 327, 406-411. Monaghan, D. T., Bridges, R. J., and Cotman, C. W. (1989). The excitatory amino acid receptors: their classes, pharmacology, and distinct properties in the function of the central nervous system. Annu. Rev. Pharmacol. Toxicol. 29, 365-402. Monyer, H., Sprengel, R., Schoepfer, R., Herb, A., Higuchi, M., Lomeli, H., Burnashev, N., Sakmann, B., and Seeburg, P. H. (1992). Heteromeric NMDA receptors: molecular and functional distinction of subtypes. Science 256, 1217-1221. Moriyoshi, K., Masu, M., Ishii, T., Shigemoto, R., Mizuno, and Nakanishi, S. (1991). Molecular cloning and characterization of the rat NMDA receptor. Nature 354, 31-37.

N.,

Nakanishi, S. (1992). Molecular diversity of glutamate receptors and implications for brain function. Science 258, 597-603. Narahashi, membranes.

T. (1974). Chemicals as tools Physiol. Rev. 54, 813-889.

in the study

of excitable

Takahashi, T., Momiyama,A., Hirai, K., Hishinuma, F., and Akagi, H. (1992). Functional correlation of fetal and adult forms of glytine receptors with developmental changes in inhibitory synaptic receptor channels. Neuron 9, 1155-1161. Tingley, W. C., Roche, K. W., Thompson, A. K., and Huganir, R. L. (1993). Regulation of NMDA receptor phosphorylation by alternative splicing of the C-terminal domain. Nature 364, 70-73. Van der Valk, J. B. F., Resink, A., and Ballzs, R. (1991). Membrane depolarization and the expression of glutamate receptors in cerebellar granule cells. Eur. J. Pharmacol. 207, 247-250. Watkins, J. C., Krogsgaard-Larsen, P., and Honor& T. (1990). Structure-activity relationships in the development of excitatory amino acid receptor agonists and competitive antagonists. Trends Pharmacol. Sci. 77. 25-33.