Selective upregulation of endothelin converting enzyme-1a in the human failing heart

Journal of Cardiac Failure Vol. 6 No. 4 2000

Experimental Studies

Selective Upregulation of Endothelin Converting Enzyme-1a in the Human Failing Heart ADVIYE ERGUL, MD, PhD, ASHLEY L. GRUBBS, BS, YUHUA ZHANG, MD, FRANCIS G. SPINALE, MD, PhD Charleston, South Carolina

ABSTRACT Background: Increased plasma levels of endothelin-1 (ET-1) occur with congestive heart failure (CHF), but the components of the enzymatic activation of ET-1 in the myocardium remain to be defined. Accordingly, endothelin converting enzyme-1 (ECE-1) activity and expression in normal and failing heart were examined. Methods and Results: Left ventricular (LV) tissue samples were obtained from patients undergoing heart transplantation because of dilated cardiomyopathy (DCM) and ischemic cardiomyopathy (ICM) and from normal donor hearts. The gene expression of ET-1 precursor and ECE-1a was upregulated 4- and 3-fold, respectively, in the failing heart. ECE-1 activity (fmol/mg protein per hour) was augmented from 2,291 ⫾ 257 in normal tissue samples to 5,507 ⫾ 666 in DCM samples and to 7,435 ⫾ 682 in ICM samples (P ⬍ .05). Phosphoramidon and a specific ECE-1 inhibitor, FR901533, inhibited ECE-1 activity by over 90%. However, inhibitors of neutral endopeptidase (thiorphan) and matrix metalloproteases (batimistat) did not affect the conversion of big ET-1 to ET-1. Conclusions: This study showed that the biosynthetic pathway of ET-1 is activated in LV myocardium in the failing heart, and the myocardial processing of big ET-1 is highly specific for ECE-1. Key words: congestive heart failure, myocardium, cardiomyopathy.

Endothelin-1 (ET-1), a peptide that influences a number of cardiovascular processes, is generated from posttranslational processing of a precursor protein, preproET-1 (PPET-1) to big ET-1, which is further

processed to biologically active ET-1 by endothelin converting enzyme (ECE-1) (1). A number of cell types, including endothelial cells, vascular smooth muscle cells, and myocytes, have been shown to synthesize ET-1, suggesting that these cells possess the processing enzymes (1– 4). Whether ECE-1 activity is present in the human myocardium and whether alterations occur with pathological states associated with elevated ET-1 levels such as congestive heart failure (CHF), however, remains unclear. Furthermore, there are 4 splice variants of ECE-1 (5), and the expression of the most common subisoforms ECE-1a and ECE-1c has been reported to be regulated differentially under pathological conditions (6,7). The activity and expression of ECE-1 subisoforms in human myocardium, however, remain to be defined. A

From the Division of Cardiothoracic Surgery, Medical University of South Carolina, Charleston, South Carolina. Supported in part by an American Lung Association of South Carolina Career Investigator Award (A.E.), Charleston, SC; American Diabetes Association Research Award (A.E.), New York, NY; and National Institutes of Health grant no. HL57952 (F.G.S.), Bethesda, Maryland. Manuscript received April 10, 2000; revised manuscript received June 19, 2000; revised manuscript accepted June 20, 2000. Reprint requests: Adviye Ergul, MD, PhD, Division of Cardiothoracic Surgery, 770 MUSC Complex, Suite 625, PO Box 250778, 114 Doughty Street, Charleston, SC 29425. Copyright © 2000 by Churchill Livingstone威 1071-9164/00/0604-0005$10.00/0 doi:10.1054/jcaf.2000.19227

314

Myocardial ECE-1 Expression ●

recent study reported that matrix metalloproteinase-2 can also process big ET-1 (8). Matrix metalloproteinases (MMPs) are a family of enzymes that are responsible for extracellular collagen degradation and remodeling, and increased myocardial MMP activity has been reported to occur with CHF (9,10). Therefore, the first aim of the present study was to determine ECE-1 activity and ECE-1 subisoform expression profile in normal and failing human heart. The second aim was to investigate whether MMPs contribute to the processing of big ET-1 to bioactive ET-1.

Methods Materials Synthetic MMP inhibitor (Batimistat) was provided by British Biotech, Inc (Oxford, England). ECE inhibitor (FR901533) was a gift from Fujisawa Pharmaceuticals (Osaka, Japan). Thiorphan and phosphoramidon were purchased from Sigma Chemical Co (St Louis, MO). Tissue Source Human left ventricular (LV) myocardium was obtained from explanted hearts from patients undergoing heart transplantation secondary to ischemic (ICM, n ⫽ 10) and idiopathic dilated (DCM, n ⫽ 10) cardiomyopathy at the Medical University of South Carolina, Charleston, SC. Diagnosis of ICM or DCM was based on clinical and echocardiographic examination. After induction of cardioplegic arrest, the hearts were removed and stored in cold Kreb’s buffer. LV free wall was then dissected into smaller sections, snap-frozen in liquid nitrogen, and stored at ⫺80°C until used. Normal LV (n ⫽ 5) myocardium samples were obtained from donor hearts used for valve harvest (Cryolife Inc, Kennesaw, GA). Patient consent was obtained in all cases. Expression Studies by Reverse Transcription Polymerase Chain Reaction Ribonucleic acid (RNA) was extracted from myocardial tissue samples with RNeasy kit from Qiagen (Va-

Ergul et al

lencia, CA). First strand complementary DNA (cDNA) synthesis was performed with 1 ␮g of total RNA and oligo(dT)12-18 primers by using AMV reverse transcriptase (Promega, Madison, WI). The cDNAs were then analyzed by standard and quantitative reverse transcription polymerase chain reaction (RT-PCR) techniques. The amplification primers and conditions are given in Table 1. The PCR was carried out in a reaction mixture containing 20 mmol/L Tris-HCl (pH 8.5), 50 mmol/L KCl, 1.5 mmol/L MgCl2, 0.2 mmol/L each dNTP, 500 nmol/L of each sense and antisense primer, 3 ␮L first strand cDNA, and 2.5 units of Taq DNA polymerase. To determine the linear range for the generation of desired PCR products, various PCR cycles (20 to 40) were initially used for amplification. Based on these results, amplification step was set for 30 cycles in the subsequent PCR runs. To ensure that equivalent cDNA template was used in each reaction, amplification of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as internal control. The PCR products underwent electrophoresis on 2% agarose gels, and image was captured with Image-Pro software (Media Cybernetics, Silver Spring, MD). The density of PCR products was then analyzed by Gel-Pro Analyzer software (Media Cybernetics, Silver Spring, MD) and normalized over GAPDH expression. The internal standard for quantitative RT-PCR was generated by deleting a 32 base pair (bp) sequence from PPET-1 cDNA (bases 30 to 62), which yielded a 241 bp PCR product. For ECE-1a, internal standard was constructed by inserting a 125 bp sequence of bovine ECE-1a into the XmaI site of human ECE-1a, which resulted in a 234 bp PCR product. After gel electrophoresis and ethidium bromide staining, the intensity of the bands was quantified as previously described and plotted as a ratio of target/internal standard versus internal standard concentration. The amount of target cDNA was calculated by extrapolating from the intersection of the curve with a ratio of 1.0 down to the x-axis. Tissue ET-1 Measurement Myocardial ET-1 content was determined by using an extraction method. Briefly, 1 g tissue was weighed and

Table 1. Primer Sequences and Conditions Used in PCR Amplifications Primer PPET-1(F) PPET-1(R) ECE-1a(F) ECE-1a(R) ECE-1c(F) ECE-1c(R) GAPDH(F) GAPDH(R)

315

Sequence

Expected Size (bp)

Conditions

ATGGATTATTTCTCATGATTTTC CTTGGACCTAGGGCTTCCAAGTCC ATGCCTCTCCAGGGCCTGGGC AGTTCACCTGCAGGGAAGGAG ATGATGTCGACGTACAAGCGG CACCTGCAGGCCGTTGGGGTA GCAAATTCCATGGCACCGTCA GTCATACCAGAAATGAGCTT

273

95°C, 180 sec; 63°C, 90 sec; 72°C, 60 sec 95°C, 180 sec; 60°C, 90 sec; 72°C, 60 sec 95°C, 180 sec; 60°C, 90 sec; 72°C, 60 sec 95°C, 180 sec; 58°C, 90 sec; 72°C, 60 sec

108 93 784

PPET-1, preproendothelin-1; ECE, endothelin converting enzyme; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; F, forward; R, reverse.

316 Journal of Cardiac Failure Vol. 6 No. 4 December 2000 homogenized in 12.5 mL of homogenization buffer that consisted of 1 N NaOH, 0.15 trifluoroacetic acid, 1% formic acid, 1% NaCl. After centrifugation at 1,500g for 30 minutes, the protein content in the supernatant was measured with the Bradford Protein Assay from Bio-Rad Laboratories (Hercules, CA). ET-1 levels were determined by using an ET-1–specific enzyme-linked immunoassay (ELISA) kit from American Research Products (Belmont, MA). The sensitivity of the assay was 0.6 to 10 fmol/mL. The crossreactivities of the antibodies used were reported to be less than 1% with big ET-1 (1 to 38) and big ET-1 (22 to 38), less than 5% with ET-3, and 100% with ET-2. The intraassay and interassay variability of the kit was reported to be 3.3% and 3.5%, respectively, by the manufacturer. Pulmonary ET-1 content was expressed as femtomoles per milligrams of protein. Myocardial Membrane Preparation Heart tissue (1 g) was homogenized in Buffer A (20 mmol/L Tris-HCl [pH 7.4], 20 ␮mol/L pepstatin A, 1 mmol/L phenylmethylsulfonylfluoride (PMSF), and 250 mmol/L sucrose). After an initial centrifugation at 1,000g for 10 minutes, the resulting supernatant was centrifuged at 100,000g for 60 minutes. The pellet was resuspended in 500 ␮L Buffer A, and membrane aliquotes were stored at ⫺80°C. The protein content in the membrane preparation was measured with the Bradford Protein Assay.

ECE-1a, and ECE-1c in normal, ICM, and DCM heart tissue were analyzed by the Student t test. All statistical procedures were performed using the Prism software (GraphPad Software, San Diego, CA). Results are presented as mean ⫾ standard error of the mean (SEM). Values of P ⬍ .05 were considered to be statistically significant.

Results Expression of PPET-1 and ECE-1 Subisoforms Standard RT-PCR analysis showed expression of PPET-1, ECE-1a, and ECE-1c subisoforms in human LV tissue (Fig. 1A). The densitometric analysis of PCR products revealed that messenger RNA (mRNA) for PPET-1 was increased 3-fold in DCM and ICM samples as compared with control samples (Fig. 1B). The expression profile of ECE-1 subisoforms showed that ECE-1a is upregulated in the failing LV, whereas there was no detectable change in ECE-1c expression (Fig. 1A and B).

Measurement of ECE-1 Activity Enzyme activity was determined by incubating 30 ␮g myocardial membrane preparations with big ET-1 (0.1 ␮mol/L) in 50 ␮L reaction buffer (0.1 mol/L sodium phosphate buffer [pH 6.8] and 0.5 mol/L NaCl) for 1 hour at 37°C. To determine whether cleavage of big ET-1 by the membrane fractions is specific for ECE-1, enzyme reactions were repeated in the presence of a set of inhibitors. These included phosphoramidon (100 ␮mol/L), a nonspecific ECE inhibitor; thiorphan (100 ␮mol/L), a nonspecific neutral endopeptidase inhibitor that does not inhibit ECE activity; a specific ECE inhibitor (100 ␮mol/L), FR901533; and a matrix metalloprotease inhibitor (100 ␮mol/L), Batimistat. The reaction was terminated with 50 ␮L of 5 mmol/L ethylenediaminetetraacetic acid (EDTA), and the mixture was assayed for ET-1 by an ELISA kit as previously described. All assays were performed in duplicate. Data Analysis Values obtained for ECE-1 activity (femtomoles of ET-1 per milligrams of protein per hour) in normal, ICM, and DCM heart membranes were compared using the Student t test. Similarly, expression levels of PPET-1,

Fig. 1. (A) Representative standard RT-PCR analysis for PPET-1, ECE-1a, and ECE-1c mRNA in LV tissue from normal, ICM, and DCM samples. (B) Densitometric analysis of the PCR products normalized to GAPDH showed increased PPET-1 and ECE-1a mRNA levels in ICM and DCM tissue (*P ⬍ .05 v control).

Myocardial ECE-1 Expression ●

Ergul et al

317

Fig. 2. (A) A representative quantitative RT-PCR experiment for PPET-1 and ECE-1a expression. Increasing concentrations of internal standards for PPET-1 (5 to 100 ng) and ECE-1a (1 to 50 ng) were used to compete 1 ␮g of total RNA extracted from myocardial tissue. PCR products were separated on 2% agarose gel to distinguish target PPET-1 (273 bp) from standard PPET-1 (241 bp). The target ECE-1a and standard ECE-1a products were 109 and 243 bp, respectively. (B) The intensity of the PCR products was measured by densitometry, and a regression analysis of the ratio of target/standard versus concentration of internal standard was constructed for PPET-1 with r2 values of 0.8559, 0.8957, and 0.8054 for normal, ICM, and DCM samples, respectively. (C) Corresponding values for the analysis of ECE-1a expression were 0.7819, 0.9426, and 0.8666. The dotted horizontal lines indicate the point of equivalence between the target and the internal standard. Results in (B) are given as mean ⫾ SEM of 3 individual experiments (*P ⬍ .05 v normal).

The results of quantitative RT-PCR for PPET-1 and ECE-1a are given in Fig. 2. The target cDNA and internal standard were amplified with the same set of primers, and the intensity of PCR products was quantified. The ratio of target to internal standard was plotted against the known concentration of internal standard used in the reactions. The amount of PPET-1 and ECE-1a cDNAs was 100 ⫾ 3 ng and 46 ⫾ 1 ng, respectively, in the failing heart, whereas corresponding values in normal samples were 51 ⫾ 4 ng and 26 ⫾ 3 ng. These results indicated that the both PPET-1 and ECE-1a mRNA were increased by approximately 2-fold in ICM and DCM samples, confirming the findings of standard RT-PCR experiments. Tissue ET-1 Levels To determine whether increased PPET-1 expression is accompanied by elevated peptide levels, myocardial ET-1 content was measured. As shown in Fig. 3, ET-1

Fig. 3. ET-1 levels in normal, ICM, and DCM LV myocardium were measured by ET-1 specific ELISA. Myocardial ET-1 was increased in both ICM and DCM tissue (*P ⬍ .05 v normal).

318 Journal of Cardiac Failure Vol. 6 No. 4 December 2000

Fig. 4. (A) The conversion of big ET-1 to ET-1 by ECE-1 in membranes prepared from normal (n ⫽ 5), ICM (n ⫽ 10), and DCM (n ⫽ 10) myocardial tissue was increased in ICM and DCM samples (*P ⬍ .05 v normal). In the presence of (B) 100 ␮mol/L thiorphan, and (C) Batimistat, enzyme activity remained unchanged. (D) Phosphoramidon and (E) FR901533 significantly inhibited the enzyme activity as compared with enzyme activity measured in the absence of any inhibitors (#P ⬍ .05).

levels were increased by approximately 3-fold in both ICM and DCM myocardial tissue. ECE-1 Activity ECE activity was increased by nearly 3-fold in ICM samples and 2-fold in DCM samples (Fig. 4A). ECE activity in normal, ICM, and DCM samples remained unchanged in the presence of thiorphan, a metalloprotease inhibitor that does not affect ECE activity (Fig. 4B), and Batimistat, a matrix metalloprotease inhibitor (Fig. 4C). The nonspecific ECE inhibitor, phosphoramidon, decreased ECE activity by approximately 90% in both normal and CHF membranes (Fig. 4D). A selective ECE-1 inhibitor also inhibited enzyme activity by over 90% (Fig. 4E). These results strongly suggest that the enzyme activity measured is specific for ECE-1.

Discussion Plasma ET-1 levels are increased in patients and animal models of CHF (4,11,12). Although myocytes have been shown to synthesize ET-1 (4), the enzymatic pathway responsible for the activation of big ET-1 in the myocardium remains unexplored. Therefore, the current study investigated the subisoform specific expression of ECE-1 in normal and failing human myocardium and has shown that PPET-1 and ECE-1a mRNA, as well as tissue ET-1 and ECE-1 activity, are increased in CHF. Moreover, by using inhibitors of other enzymes, such as

neutral endopeptidase (NEP) and MMP-2, that have been shown to cleave big ET-1 (8,13), we provided evidence that the processing of big ET-1 to ET-1 in the myocardium is specifically mediated by ECE-1. These results indicate that a selective upregulation of ECE-1a subisoform accompanies increased myocardial ET-1 synthesis in CHF. A number of experimental and clinical studies have reported increased myocardial levels of ET-1 (14,15). Circulating big ET-1 levels are also elevated in CHF and are strongly related to the survival of patients (16,17). Therefore, the enzymatic processing of big ET-1 is an important regulatory step in the biosynthesis of ET-1 (7,18). Only one other study investigated myocardial ECE-1 activity in the setting of CHF and reported that there was no difference in ECE-1 activity between DCM and normal LV samples (19). In this past study, however, the saturating level (10 ␮mol/L) of big ET-1 was used in the enzyme activity assays. By using a substrate concentration at the linear range of dose-response experiments (0.1 ␮mol/L), the current study showed that ECE-1 activity is elevated approximately 3-fold in the failing LV samples, and this increase may contribute to the conversion of inactive big ET-1 to active ET-1, leading to elevated local peptide levels. There are 4 subisoforms of ECE-1 that are generated by the alternative splicing of the same gene product and cannot be distinguished by enzyme activity assays (6,20). Thus, we used RT-PCR to study the expression of ECE-1 subisoforms and showed that ECE-1a mRNA is selectively increased in the myo-

Myocardial ECE-1 Expression ●

cardium with the development of CHF. Future studies investigating the presence of ECE-1 subisoforms in the myocardium by immunohistochemical studies are warranted and will provide information with respect to localization of ECE-1 subisoforms on cardiac myocytes and surrounding connective tissue. In a recent study, Fernandez-Patron et al reported that vascular MMP-2 can cleave big ET-1 between Gly32Leu33 residues, and the resulting peptide ET-1[1-31] is also a potent vasoconstrictor (8). MMP-2 belongs to an endogenous family of enzymes responsible for extracellular collagen degradation and remodeling (21). There are a number of MMP species that display differences in substrate specificity and abundance in various tissues (21). Alterations in MMP activity have been reported in both clinical and experimental forms of CHF that are associated with LV remodeling (10,22). Thomas et al reported that MMP-3 and MMP-9 abundance was increased by approximately 5- and 4-fold, respectively, in the human failing heart caused by DCM (10). Based on these observations, the current study investigated whether increased MMP activity can contribute to the activation of big ET-1. By using a synthetic metalloproteinase inhibitor (Batimistat), we showed that inhibition of MMPs did not affect the myocardial conversion of big ET-1 to ET-1. In addition to ECE-1 and MMP-2, another enzyme has been reported to process big ET-1 to ET-1 and smaller fragments is NEP that are widely expressed in the vascular wall (13,23). Therefore, we tested whether the presence of a NEP inhibitor (thiorphan) would influence the conversion rate of big ET-1 in the normal and failing heart and showed that NEP does not contribute to the activation of big ET-1. Our findings that only ECE-1 inhibitors, phosphoramidon and FR901533, decrease the enzymatic activity provide further support that the myocardial enzyme activity measured in normal and CHF samples is specific for ECE-1. In summary, the results of the present study showed for the first time that the expression and activity of ECE-1a is selectively upregulated in the LV myocardial tissue obtained from patients with DCM and ICM. The increased ECE-1 activity may contribute to elevated myocardial ET-1 levels that occur in CHF.

References 1. Yanagisawa M, Kurihara H, Kimura S, Tomobe Y, Kobayashi M, Mitsui Y, Yazaki Y, Goto K, Masaki T: A novel potent vasoconstrictor peptide produced by vascular endothelial cells. Nature 1988;332:411–5 2. Glassberg MK, Ergul A, Wanner A, Puett D: Endothelin promotes mitogenesis in airway smooth muscle cells. Am J Respir Cell Mol Biol 1994;10:316 –21 3. Miyauchi T, Masaki T: Pathophysiology of endothelin in

4.

5.

6.

7.

8.

9.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

Ergul et al

319

the cardiovascular system. Annu Rev Physiol 1999;61: 391– 415 Thomas PB, Liu ECK, Webb ML, Mukherjee R, Spinale FG: Evidence of the endothelin-1 autocrine loop in cardiac myocytes: Relation to contractile function with congestive heart failure. Am J Physiol 1996;40:H2629 –73 Schweizer A, Valdenaire O, Nelbock P, Deuschle U, Edwards JDM, Stumpf JG, Loffler B: Human endothelin converting enzyme (ECE-1): Three isoforms with distinct subcellular localizations. Biochem J 1997;328:871–7 Valdenaire O, Rohrbacher E, Mattei M-G: Organization of the gene encoding the human endothelin-converting enzyme (ECE-1). J Biol Chem 1995;270:29794 – 8 Turner AJ, Barnes K, Schweizer A, Valdenaire O: Isoforms of endothelin converting enzyme: Why and where? Trends in Pharmacological Sciences 1998;19:483– 6 Fernandez-Patron C, Radomski MW, Davidge ST: Vascular matrix metalloproteinase-2 cleaves big endothelin-1 yielding a novel vasoconstrictor. Circ Res 1999;85:906 –11 Stetler-Stevenson WG: Dynamics of matrix turnover during pathologic remodeling of the extracellular matrix. Am J Pathol 1996;148:1345–50 Thomas CV, Coker ML, Zellner JL, Handy JR, Crumbley III AJ, Spinale FG: Increased matrix metalloproteinase activity and selective upregulation in LV myocardium from patients with end-stage dilated cardiomyopathy. Circulation 1998;97:1708 –15 Stewart DJ, Cernacek P, Costello KB, Rouleau JL: Elevated endothelin-1 in heart failure and loss of normal response to postural change. Circulation 1992;85:510 –7 Wei CM, Lerman A, Rodeheffer RJ, McGregor CGA, Brandt RR, Wright S, Heublein DM, Kao PC, Edwards WD, JC, Burnett J: Endothelin in human congestive heart failure. Circulation 1994;89:1580 – 6 Rubanyi GM, Polokoff MA: Endothelins: Molecular biology, biochemistry, pharmacology, physiology, and pathophysiology. Pharmacol Rev 1994;46:325– 415 Kiowski W, Sutsch G, Hunziker P, Muller P, Kim J, Oechslin E, Schmitt R, Jones R, Bertel O: Evidence of endothelin-1-mediated vasoconstriction in severe chronic heart failure. Lancet 1995;346:732– 6 Spinale FG, Walker JD, Mukherjee R, Iannini JP, Keever AT, Gallagher KP: Concomitant endothelin receptor subtype-A blockade during progression of pacing-induced congestive heart failure in rabbits. Circulation 1997;95: 1918 –29 Pacher R, Stanek B, Hulsmann M: Prognostic impact of big endothelin-1 plasma concentrations compared with invasive hemodynamic evaluation in severe heart failure. Am J Cardiol 1996;27:633– 41 Stanek B, Frey B, Berger R, Hartter E, Pacher P: Value of sequential big endothelin plasma concentrations to predict rapid worsening of chronic heart failure. Transplant Proc 1999;31:155–7 Xu D, Emoto N, Giaid A, Slaughter C, Kaw S, deWit D, Yanagisawa M: A membrane-bound metalloprotease that catalyzes the proteolytic activation of big endothelin-1. Cell 1994;78:473– 85 Zolk O, Quattek J, Sitzler G, Schrader T, Nickenig G, Schnabel P, Shimada K, Takahashi M, Bohm M: Expres-

320 Journal of Cardiac Failure Vol. 6 No. 4 December 2000 sion of endothelin-1, endothelin-converting enzyme, and endothelin receptors in chronic heart failure. Circulation 1999;99:2118 –23 20. Valdenaire O, Lepailleur-Enouf D, Egidy G, Thouard A, Barret A, Vranckx R, Tougard C, Michel JB: A fourth isoform of endothelin converting enzyme (ECE-1) is generated from an additional promoter: Molecular cloning and characterization. Eur J Biochem 1999;264:341–9 21. Woessner JF: The matrix metalloproteinase family, in

Parks WC, Mecham RP (eds): Matrix Metalloproteinases. San Diego, CA, Academic Press, 1998, pp 1–15 22. Tyagi SC, Kumar S, Voelker DJ, Reddy HK, Janicki JS, Curtis JJ: Differential gene expression of extracellular matrix components in dilated cardiomyopathy. J Cell Biochem 1996;63:185–98 23. Chen HH, Burnett JCJ: The natriuretic peptides in heart failure: Diagnostic and therapeutic potentials. Proc Assoc Am Physicians 1999;111:406 –16