Selenium ameliorates chromium toxicity through modifications in pigment system, antioxidative capacity, osmotic system, and metal chelators in Brassica juncea seedlings

South African Journal of Botany 119 (2018) 1–10

Contents lists available at ScienceDirect

South African Journal of Botany journal homepage: www.elsevier.com/locate/sajb

Selenium ameliorates chromium toxicity through modifications in pigment system, antioxidative capacity, osmotic system, and metal chelators in Brassica juncea seedlings N. Handa a,b, S.K. Kohli a, A. Sharma a,c, A.K. Thukral a, R. Bhardwaj a,⁎, M.N. Alyemeni d, L. Wijaya d, P. Ahmad d,e,⁎ a

Department of Botanical and Environmental Sciences, Guru Nanak Dev University, Amritsar 143005, Punjab, India Department of Botany, School of Bioengineering and Biosciences, Lovely Professional University, Phagwara 144411, Punjab, India c State Key Laboratory of Subtropical Silviculture, Zhejiang A&F University, Hangzhou, 311300, China d Department of Botany and Microbiology, College of Science, King Saud University, Riyadh 11451, Saudi Arabia e Department of Botany, S.P. College, Srinagar, 190001, Jammu and Kashmir, India b

a r t i c l e

i n f o

Article history: Received 20 June 2018 Received in revised form 18 July 2018 Accepted 1 August 2018 Available online xxxx Edited by DK Tripathi Keywords: Antioxidants Brassica juncea Chromium Osmolytes Pigments Selenium Thiols

a b s t r a c t The present study was designed to understand the protective role of Selenium (Se) in Brassica juncea seedlings cultivated under chromium (Cr) stress. The seedlings were raised in Petri dishes containing solutions of Cr (300 μM) and Se (2, 4 and 6 μM) in unary and binary combinations. The 15 days old seedlings were harvested and assessed for pigments, stomatal morphology and stomatal density, total antioxidative capacity, osmolytes and metal chelators. The results showed that the seedlings treated with Cr showed a significant decrease in the contents of chlorophyll (40.95%) and carotenoids (21.38%). Cr application also caused reduction in stomatal density (42.10%) and negatively affected the morphology of stomata. Se supplementation reduced the toxicity of Cr by increasing the pigment contents and improving the morphology of leaves. Relative gene expression of chlorophyllase reduced, while that of phytoene synthase and chalcone synthase enhanced with Se application which supported the above observations. Cr stress increased the levels of lipid- and water-soluble antioxidants by 68.25 and 32.35%, respectively; however, supplementation of Se further increased their contents. Proline, glycine betaine, trehalose, and osmolality increased by 155.19, 49.18, 83.52, and 120.92%, respectively, in seedlings subjected to Cr stress. Further increment in the above parameters was observed by the application of Se to Cr-stressed seedlings. Seedlings treated with 300 μM Cr showed an increase of 27.27% in the content of total thiols, 127.27% in the content of non-protein thiols, and 21.05% in that of protein-bound thiols, and supplementation of Se showed additional an increase by 28.57, 34.00, and 26.08%, respectively, over those in the Cr-treated seedlings. In conclusion, Cr hampered the normal functioning of the B. juncea seedlings and Se application mitigated the negative impact through modulation in the contents of various osmolytes, antioxidants, and other metabolites. Thus, Se application might help the seedlings to withstand stress by strengthening their antioxidant system, osmoregulation, and metal-chelating ability. © 2018 SAAB. Published by Elsevier B.V. All rights reserved.

1. Introduction The concentration of heavy metals in urban and agricultural soils is on a continuous rise due to various natural and anthropogenic reasons. Mining and many industrial processes lead to heavy metal contamination of the soils. Industrial effluents also contain heavy metal and their oxide as nanoparticles which have toxic impacts on the plants (Rastogi et al. 2017). They enter the plant systems and ultimately produce hazardous effects on the entire food chain (Handa et al. 2018). Chromium (Cr) is one of those heavy metals, which is non-essential for the living organisms and therefore, even at trace amounts, it can ⁎ Corresponding author. E-mail addresses: [email protected] (R. Bhardwaj), [email protected] (P. Ahmad).

https://doi.org/10.1016/j.sajb.2018.08.003 0254-6299/© 2018 SAAB. Published by Elsevier B.V. All rights reserved.

produce acute effects (Handa et al. 2017, 2018). Because of its immense applications in industries, it is widely released as an industrial pollutant. Two of the most stable forms of Cr are Cr(III) and Cr(VI) with the latter being more toxic to plants (Panda and Patra 2000; Han et al. 2004). This toxicity of Cr(VI) is because of its presence in the form of oxy anions (chromate or dichromate), whereas Cr(III) usually occurs in the form of sulfates, hydroxides, and oxides or is bound to organic compounds of soil and water (Zayed and Terry 2003). Presence of Cr(VI) in soil and water affects the uptake of nutrients because of its interaction with the nutrients (Zupančič et al. 2004). In plants, the toxic effects of Cr are visible on seed germination as well as on growth and biomass production (Singh et al. 2013). A number of studies have reported such effects in Oryza sativa, Glycine max, and Triticum aestivum (Amin et al. 2014; Nagarajan and Ganesh 2014; Ghani et al. 2015). Cr toxicity also interferes with important biomolecules leading to changes in

2

N. Handa et al. / South African Journal of Botany 119 (2018) 1–10

major metabolic pathways in plants. The loss in the content of photosynthetic pigments because of Cr has been reported in plants such as Hibiscus esculentus, Catharanthus roseus, and Corchorus olitorius (Amin et al. 2013; Islamit et al. 2014; Rai et al. 2014). Exposure of plants to Cr also leads to enhanced production of reactive oxygen species (ROS), which results in altered ROS metabolism (Singh et al. 2013). Various enzymatic and non-enzymatic antioxidants in plants, whether lipid- or water-soluble, play significant roles in scavenging of ROS. It has been established in studies on plants such as T. aestivum, Solanum nigrum, Cyamopsis tetragonoloba that Cr stress also induces the osmotic system, which aids in osmoregulation by the release of compatible solutes (Datta et al. 2011; Sangwan et al. 2013; Teixeira et al. 2013). Selenium (Se), the sister element of sulfur, has become a vital candidate and has gained the status of an essential micronutrient because of its important role in normal plant growth and development (PilonSmits and Quinn 2010). The biological activity of Se is attributed to its similarity with sulfur, which allows its uptake and incorporation in important biomolecules (Pilon-Smits and Quinn 2010). The most stable forms of Se are selenate [Se(VI)] and selenite [Se(IV)], which exist abundantly in the environment (Sharma et al. 2011). Of the two forms of Se, the bioavailability of Se(VI) is higher, and hence, it is readily taken up by active processes (Terry et al. 2000; White et al. 2004). Further, Se(VI) is not accumulated in the roots of plants and is translocated to the shoots and eventually to the chloroplasts via the sulfur assimilation pathway (Läuchli 1993; Terry et al. 2000). This leads to the formation of selenocompounds, which have great biological significance. However, stress ameliorative properties against heavy metals by many compounds have been reported in earlier studies (Mohanty and Patra 2011; Choudhary et al. 2012; Song et al. 2012, 2014), investigation on the role of Se as a stress ameliorator for various abiotic stresses is an area of active research (Ahmad et al. 2016). Its exogenous application at appropriate levels has been documented to provide resistance against several stresses, including drought, temperature, UV-B, and heavy metal (Hasanuzzaman and Fujita 2011; Pukacka et al. 2011; Yao et al. 2011; Akladious 2012; Ahmad et al. 2016). Many members of the family Brassicaceae such as Brassica napus, Brassica oleracea and B. juncea are considered to be the primary accumulators of Se (Hasanuzzaman et al. 2012). Also, B. juncea can accumulate various heavy metals including Cr in its above ground parts (Sytar et al., 2015). Therefore, in the present study, B.juncea, was used as a model plant to understand the role of Se against Cr stress. The hypothesis thus tested was the ameliorative role of Se by assessing photosynthetic system, antioxidant and osmotic machinery, and metal chelating ability of B. juncea plants. 2. Materials and methods 2.1. Plant material and experimental setup The seeds of B. juncea (var. RLC 1) were sterilized with 0.01% mercuric chloride (HgCl2), soaked in distilled water for 2 h (h), and germinated in Petri dishes lined with Whatman No. 1 filter paper moistened with 3 ml solutions of sodium selenate (Na2SeO4) (2, 4, and 6 μM) and potassium chromate (K2CrO4) (300 μM), in unary and binary treatments. The concentrations of the elements were decided on the basis of preliminary experiments by obtaining the most stimulatory concentration of Se and 50% inhibitory concentration (IC50) of Cr. The treatment solutions were prepared in half strength Hoagland's nutrient medium and the experiment was conducted in triplicates with 16 h photoperiod and 25 ± 2 °C temperature. The seedlings were harvested after 15 days for the estimation of various parameters. 2.2. Plant pigments The method of Arnon (1949) was used for the estimation of total chlorophyll and carotenoids. The homogenates of seedlings were prepared in 80% acetone, and these were centrifuged at 13,000×g for 20

min at 4 °C. For estimation of the chlorophyll content, the absorbance of the supernatant was recorded at 645 and 663 nm, whereas for carotenoids, the absorbance was recorded at 480 and 510 nm in the UV-visible range using a spectrophotometer (UV-Visible PC Based Double Beam Spectrophotometer, Systronics 2202). The content of anthocyanins was determined following the protocol of Mancinelli (1984). The homogenates of seedlings were extracted using a mixture of methanol, distilled water, and hydrochloric acid (HCl) in the ratio 79:20:1. The supernatants were collected after centrifugation, and the absorbance was spectrophotometrically measured at 530 and 657 nm. The xanthophyll content was determined following the method of Lawrence (1990). Dry and powdered seedling samples were immersed in an extraction mixture (30 ml) consisting of hexane, acetone, absolute alcohol, and toluene (10:7:6:7) and were shaken for 10–15 min (min). This was followed by the addition of 2 ml of 40% methanolic potassium hydroxide and vigorous shaking. The mixture was heated at 56 °C in a water bath and incubated for 1 h in the dark at room temperature. An additional 30 ml of hexane was added, and the reaction mixture was shaken well. Thereafter, the volume was made upto 100 ml by the addition of 10% sodium sulfite (Na2SO3), and the mixture was vigorously shaken for 1 min. The reaction mixture was incubated for another 1 h, and the two phases were allowed to separate. After the incubation, the upper phase was removed, and its volume was made upto 50 ml by adding hexane. The absorbance of this phase was spectrophotometrically determined at 474 nm. 2.3. Stomatal morphology and stomatal density Scanning electron microscope (SEM) (EvoLS 10, Carl Zeiss) was used to study the morphology and density of stomata on the lower surface of cotyledonary leaves of 15-days-old B. juncea seedlings. The density was calculated by determining the number of stomata mm−2 of leaf area. 2.4. Total antioxidative capacity The antioxidative capacities of lipid- and water-soluble antioxidants in B. juncea seedlings were determined using an antioxidant analyzer (PHOTOCHEM BU, Analytik Jena). For the determination of lipid-soluble antioxidants, the seedling samples were prepared in absolute methanol by homogenization and centrifugation under ice-cold conditions. An aliquot of 10 μl of supernatant was taken and diluted with 490 μl of methanol. For water-soluble antioxidants, the seedling samples were prepared in 50 mM Tris buffer (pH 10) under similar conditions, and dilutions were made as in the case of lipid-soluble antioxidants. Both lipid- and water-soluble antioxidants were estimated using standard reagent kits provided by Analytik Jena, in which free radicals are generated and then scavenged by the antioxidants present in the plant extract. The instrument uses photochemiluminescence method to detect the decrease in the fluorescence intensity. The calibration curves obtained using standards were used to quantify the antioxidative capacities. 2.5. Free proline The estimation of free proline was done according to the method of Bates et al. (1973). The seedling samples were homogenized in 3% sulfosalicylic acid and centrifuged at 13,000× g for 20 min. Equal volumes of supernatant and acid ninhydrin (1.56 g of ninhydrin in 37.5 ml glacial acetic acid and 25 ml of 6 M ortho-phosphoric acid) were taken and boiled in a water bath for 1 h. The reaction mixture was cooled immediately to terminate the reaction. This was followed by addition of toluene and vortexing of the mixture. The mixture was kept at room temperature, and the absorbance of toluene layer was recorded at 520 nm spectrophotometrically.

N. Handa et al. / South African Journal of Botany 119 (2018) 1–10

2.6. Glycine betaine Glycine betaine was estimated by the protocol given by Grieve and Grattan (1983). The dried and powdered seedling samples were extracted with toluene–water mixture for 24 h at 25 °C. To 0.5 ml of the extract, 1 ml of 2 N HCl and 0.1 ml of potassium triiodide (KI3) were added followed by shaking of the reaction mixture for 90 min under ice-cold conditions. Thereafter, 2 ml of ice-cold water with 10 ml of 1,2-dichloroethane at -10 °C was added and was followed by passing a stream of fresh air. Upon separation of two layers, the lower organic layer was used to record the absorbance at 365 nm spectrophotometrically.

3

Table 1 Primers used for qRT-PCR (Sharma et al. 2016). Gene name

Primer sequence

actin

Forward primer 5’CTTGCACCTAGCAGCATGAA3’ Reverse primer 5’GGACAATGGATGGACCTGAC3’ Forward primer 5’GAATATCCGGTGGTGATGCT3’ Reverse primer 5’TCCGCCGTTGATTTTATCTC3’ Forward primer 5’TGGGTTGGTAAGGGCTGTAG3′ Reverse primer 5’CGCTCGAAGACACAACACTC3′ Forward primer 5’CAAGGCGGAGAAGATGAGAG3’ Reverse primer 5’CATCTTCCGCAGACTTCCTC3’

CHLASE PSY CHS

CHLASE: Chlorophyllase; PSY: Phytoene synthase; CHS: Chalcone synthase.

2.7. Trehalose content The content of trehalose was estimated by the method of Trevelyan and Harrison (1956). The dried seedling samples were extracted with 80% ethanol. The extract (0.1 ml) was mixed with 0.5 M trichloroacetic acid (2 ml). To 1 ml of this reaction mixture, 4 ml of anthrone reagent [0.2 g anthrone in 100 ml 95% sulfuric acid (H2SO4)] was added. Upon appearance of a yellow color, the absorbance was recorded at 620 nm spectrophotometrically. 2.8. Osmolality Osmolality of B. juncea seedlings was estimated by vapor pressure osmometer (Vapro model 5600). Osmolality is the total concentration of dissolved solute particles in 1 kg of the solvent. The fresh seedling samples were frozen at -20 °C for 2 h and then thawed at room temperature. The plant sap was extracted by squeezing a few seedlings using a clean syringe. The sap was collected and 10 μl was loaded in vapor pressure osmometer for taking the readings.

2.11. Statistical analysis Self-coded programs in Microsoft Excel were used for statistical analysis. The homogeneity of the data was tested by using Shapiro– Wilk Normality Test (Shapiro and Wilk 1965). The data were then subjected to one-way ANOVA and Tukey's honestly significant difference (HSD) to check the significance of differences among the mean values. The data were also analyzed by multiple linear regression analysis (Bailey 1995; Sokal and Rohlf 1969) as per the equation: Y = a + b1X1 + b2X2, where Y was the parameter of study, and X1and X2 corresponded to Cr and Se concentrations in binary combinations, respectively. The partial regression coefficients due to Cr and Se were designated as b1 and b2, respectively, and the β-regression coefficients due to Cr and Se were denoted as β1 and β2, respectively.

3. Results 2.9. Metal chelating compounds 3.1. Plant pigments Total thiols were determined following the method described by Sedlak and Lindsay (1968). The seedling extracts were prepared in 20 mM ascorbate buffer containing 20 mM ethylenediaminetetraacetic acid (EDTA). The extract (0.5 ml) was mixed with 200 mM Tris HCl (2.4 ml) and 0.1 ml of 10 mM 5,5′-dithiobis-(2-nitrobenzoic acid). The reaction mixture was incubated at room temperature for 15 min for development of color and the absorbance was noted spectrophotometrically at 412 nm. For non-protein thiols, fresh seedling samples were homogenized in 5% sulfosalicylic acid and centrifuged at 13,000×g for 20 min. The supernatant was mixed with 0.1 M potassium phosphate buffer (pH 7), 0.5 M EDTA, and 1 mM 5′- dithiobis-(2-nitrobenzoic acid). This was followed by incubation of the reaction mixture for 10 min, and the absorbance was noted spectrophotometrically at 412 nm (Del Longo et al. 1993). An extinction coefficient of 13,100 M−1 cm−1 was used for calculation of both the total and non-protein thiols. The content of protein-bound thiols was calculated by subtracting the content of non-protein thiols from that of total thiols. 2.10. Gene expression studies Whole seedling was used to extract RNA by using trizol method with the instruction provided by Invitrogen. This RNA was used to form cDNA by reverse transcription with RNA to cDNA kit by Invitrogen. Primers used for studying the gene expression of chlorophyllase (CHLASE), phytoene synthase (PSY) and chalcone synthase (CHS) are mentioned in the Table 1 and actin was used as an internal control. This was followed by quantitative real-time polymerase chain reaction (qRTPCR) with StepOne real-time detector from Applied Biosystems and Power SYBR Green PCR Master Mix. The whole experiment was carried out in three replicates and fold change in the expression was estimated with the method given by Livak and Schmittgen (2001).

The contents of total chlorophylls and carotenoids declined by 41.85 and 34.75%, respectively in the seedlings grown in solution containing 300 μM Cr as compared to those in the untreated control seedlings. The application of Se caused the recovery of the contents of photosynthetic pigments, signifying its protective property. Compared to Crtreated seedlings, the seedlings cultivated under binary combinations of Cr and Se showed a significant rise of 50% in total chlorophyll and of 24.56% in carotenoid contents. The maximum increase in the content of pigments was observed at 4 μM of Se. The concentration of 6 μM Se, however, caused a reduction in the contents of pigments, whether given alone or in binary combinations with Cr (Table 2). ANOVA and multiple regression analysis revealed that the F-ratios and correlation coefficients were significant. The β-regression coefficients for Cr were negative for both chlorophyll and carotenoids contents, which signified its damaging effect on the pigments. The β-regression coefficients for Se, however, were also negative for total chlorophyll content, which suggested that Se at higher concentrations can exert a negative effect whereas it has protective effect at lower concentrations (Table 2). The contents of anthocyanins and xanthophylls in seedlings showed a significant increase in Cr treatment. Relative to the controls, the seedlings cultivated in Cr solutions showed enhanced contents of anthocyanins (27.93%) and xanthophylls (62.12%). The supplementation of 2 μM Se in binary combination with Cr resulted in a further increase of 12.91% in the anthocyanin content and in a decrease of 28.92% in the xanthophyll content (Table 2). Both F-ratios and correlation coefficients were significant, which indicated a significant effect of the treatments on the contents of both the pigments. The β-regression coefficients of Cr for both anthocyanins and xanthophylls were positive, which supported the above observations. The βregression coefficients of Se were positive for anthocyanins but were negative for xanthophylls (Table 2).

4

N. Handa et al. / South African Journal of Botany 119 (2018) 1–10

Table 2 Effect of binary combinations of Se and Cr on pigments and stomatal density of 15 days old seedlings of B. juncea. Concentrations (μM) Cr

Total chlorophyll (μg g−1 FW)

Carotenoids (μg g−1 FW)

Anthocyanins (μg g−1 FW)

Xanthophylls (mg g−1 DW)

Stomatal density (no. of stomata mm−2)

31.67 ± 2.05ab 34.13 ± 1.36a 33.30 ± 1.30a 21.77 ± 1.50c 18.43 ± 0.85c 22.06 ± 1.21c 27.53 ± 1.07b 19.97 ± 3.27c 39.31** 4.903

17.47 ± 0.72a 16.0 ± 0.10ab 14.63 ± 1.45bc 13.80 ± 0.43cd 11.40 ± 0.32e 13.50 ± 0.20cde 15.17 ± 0.40bc 12.47 ± 1.18de 19.88** 2.128

12.96 ± 0.256c 12.84 ± 0.616c 13.23 ± 1.241c 13.64 ± 0.415c 16.58 ± 0.572b 18.72 ± 0.323a 18.17 ± 0.225a 17.92 ± 0.563a 54.05** 1.179

4.33 ± 0.22b 4.00 ± 0.64b 4.48 ± 0.67b 2.31 ± 0.59c 7.02 ± 0.85a 4.99 ± 0.64b 4.76 ± 0.59b 4.43 ± 0.22b 15.74** 1.66

247.39 ± 13.0a 264.76 ± 7.5a 260.42 ± 13.0a 195.31 ± 13.0b 143.23 ± 13.02c 173.61 ± 7.5bc 186.62 ± 15.0b 160.59 ± 19.9bc 37.95** 37.59

r 0.692⁎⁎⁎

β1 −0.670

β2 −0.176

0.649⁎⁎ 0.958⁎⁎⁎ 0.892⁎⁎⁎ 0.843⁎⁎⁎

−0.609 0.949 0.655 −0.834

−0.222 0.133 −0.605 −0.117

Se

0 0 0 2 0 4 0 6 300 0 300 2 300 4 300 6 F-ratio (df 7,16) HSD

Multiple regression analysis Parameter Multiple regression equations Total Y = 31.51–0.026 X1–0.474 X2 chlorophyll Carotenoids Y = 16.05–0.0078 X1–0.19 X2 Anthocyanins Y = 12.729 + 0.0156 X1 + 0.147 X2 Xanthophylls Y = 4.626 + 0.0059 X1–0.365 X2 Stomatal Y = 249.13–0.232 X1–2.388 X2 density

Data presented in mean ± S.D. of three replicates. Means superscribed by the same letter are not significantly different from each other using one-way analysis of variance (ANOVA) and Tukey's honestly significant difference (HSD). Significant at ***p ≤ .001, **p ≤ .01. Y = Parameter under study; X1 = μM Cr; X2 = μM Se; r = Correlation coefficient; β1 = β-regression coefficient for Cr; β2 = β-regression coefficient for Se. Abbreviations: μM: Micromoles; μg: Microgram; mg: Milligram; g: Gram; mm: Millimeter; FW: Fresh Weight; DW: Dry Weight.

3.2. Stomatal morphology and density Deformation in the stomatal shapes on the ventral surface of the cotyledonary leaves was observed at 300 μM of Cr concentration (Fig. 1). Cr was also responsible for reduction in the stomatal density by 42.10% as compared to the controls. The application of Se in binary combinations alleviated the Cr stress by improving both

the stomatal morphology and density (Fig. 1). The maximum improvement in the stomatal density (30.26%) was observed in binary combination of 4 μM Se and 300 μM Cr. The concentration of 6 μM Se, alone as well as in combination with Cr, resulted in low stomatal density (Table 2). Therefore, the β-regression coefficients were negative for both Cr and Se in linear model of multiple regression (Table 2).

Fig. 1. Morphology of stomata in cotyledonary leaves of 15-days old Brassica juncea plants cultivated under (a) control, (b) control with 4 μM Se, (c) 300 μM Cr and (d) 300 μM Cr with 4 μM Se.

N. Handa et al. / South African Journal of Botany 119 (2018) 1–10

5

μM) resulted in further increases of 25.35 and 24.03% in the contents of total thiols and protein-bound thiols, respectively. However, for non-protein thiols, Se (6 μM) in combination with Cr (300 μM), caused a 42.24% increase in content (Table 4). The F-ratios and correlation coefficients were significant and the β-regression coefficients for Cr and Se showed positive values (Table 4).

3.3. Total antioxidative capacity The total antioxidative capacity of lipid- and water-soluble antioxidants showed a significant increase of 68.25 and 31.48%, respectively in the seedlings grown with 300 μM Cr over that in the control seedlings. The seedlings cultivated under combination of Se and Cr showed further increase in antioxidant capacities. The maximum increase of 10.38 and 43.45% in lipid- and water-soluble antioxidants, respectively, was observed with 4 μM Se as compared to the antioxidative capacity in Cr-treated seedlings (Table 3). The significant effects of the treatments were confirmed by F-ratios and correlation coefficients. The β-regression coefficients for Cr and Se were positive for both lipid- and watersoluble antioxidants (Table 3).

3.6. Gene expression studies Treatments of Se and Cr aided in modulating the gene expression of CHLASE, PSY and CHS. CHLASE showed a significant upregulation of 366.3% in its expression in the Cr treated seedlings with respect to untreated control seedlings. The expression of PSY, however, was observed to be downregulated with Cr application by 28.6%, while CHS expression showed an upregulation by 73.13%. Se application at 4 μM in combination with 300 μM Cr downregulated its expression by 46.92% when compared to Cr-treated seedlings. On the other hand, the same concentration of Se caused an increase of PSY and CHS expression by 425.2 and 209.4%, respectively. The statistical analysis of the data by one-way ANOVA and multiple linear regression supported the significance of the observations. The β-regression coefficients for Se in all the cases indicated its stress alleviating properties (Table 5; Fig. 2).

3.4. Osmolytes The contents of free proline, glycine betaine, and trehalose increased by 154.83, 49.18, and 83.51%, respectively, in seedlings cultivated under Cr stress compared to their contents in the control seedlings. The osmolality was also observed to enhance significantly by 120.93% in response to Cr, relative to that in the untreated seedlings. The supplementation of Se in binary combination with Cr aided in overcoming Cr stress by further increasing the contents of osmolytes. In comparison to Cr-treated seedlings, the combination of Se at 4 μM and Cr at 300 μM increased proline by 40.97%, glycine betaine by 27.47%, and trehalose by 47.76%. The osmolality, however, was observed to decrease with Se supplementation in comparison to the seedlings treated with Cr only (Table 3). The statistical analysis by ANOVA and correlation coefficients of multiple linear regression showed significant effect of treatments on the osmolytes. The β-regression coefficients for both Cr and Se for all the osmolytes confirmed positive effects of Cr and Se on the contents of osmolytes and supported the observations (Table 3).

4. Discussion The application of Cr drastically affected the contents of photosynthetic pigments (total chlorophyll and carotenoids) in the seedlings of B. juncea. This reduction is due to the negative effect of Cr on the enzymes, δ-aminolevulinic acid dehydratase and protochlorophyllide reductase, which are involved in chlorophyll biosynthesis (Ganesh et al. 2008). Mg and N, which are integral parts of the chlorophyll molecule, are unable to get absorbed because of Cr stress could be another reason for the decreased pigment content (Sela et al. 1989). In addition, in the present study, the distorted stomatal morphology and low stomatal density in the leaves were observed in response to Cr, which indicated impaired gas exchange, and thus, confirmed the above observations. Another reason for lower chlorophyll content in the present study could be the upregulation of CHLASE which encodes for chlorophyllase in response to Cr. Also, PSY is one of the enzymes in biosynthetic

3.5. Metal chelating compounds The contents of total thiols, non-protein thiols and protein-bound thiols were observed to increase by 30.88, 127.23, and 19.49%, respectively, in the seedlings grown under 300 μM Cr compared to their contents in the control seedlings. Co-application of Se (4 μM) and Cr (300

Table 3 Effect of binary combinations of Se and Cr on total antioxidative capacity and osmotic system of 15 days old seedlings of B. juncea. Concentrations (μM) Cr

Lipid-soluble antioxidants (μM g−1 FW)

Water-soluble antioxidants (μM g−1 FW)

Free proline (μg g−1 FW)

Glycine betaine (mg g−1 DW)

Trehalose (mg g−1 DW)

Osmolality (mOsm kg−1)

1.26 ± 0.018e 1.67 ± 0.034d 1.99 ± 0.029c 2.06 ± 0.038bc 2.12 ± 0.039b 2.24 ± 0.061a 2.34 ± 0.036a 2.07 ± 0.035bc 253.18** 0.107

3.43 ± 0.09g 3.54 ± 0.03fg 3.64 ± 0.05ef 3.77 ± 0.03e 4.51 ± 0.06d 5.84 ± 0.06b 6.47 ± 0.06a 5.61 ± 0.12c 935.14** 0.193

15.41 ± 2.47e 19.86 ± 2.08de 21.12 ± 1.10de 24.54 ± 1.95d 39.27 ± 2.23c 46.92 ± 2.13b 55.36 ± 1.89a 38.24 ± 3.51c 121.92** 6.395

0.61 ± 0.039d 0.63 ± 0.033cd 0.71 ± 0.036cd 0.74 ± 0.033c 0.91 ± 0.059b 1.02 ± 0.050b 1.16 ± 0.051a 0.91 ± 0.039b 58.39** 0.124

24.64 ± 2.3f 26.00 ± 1.3ef 31.79 ± 2.3de 37.74 ± 2.d 45.22 ± 1.8c 56.28 ± 2.84b 66.82 ± 3.4a 50.83 ± 1.1bc 128.4** 6.508

183.00 ± 3.6f 192.67 ± 2.5f 181.67 ± 2.08f 261.33 ± 10.7e 404.33 ± 4.1a 304.00 ± 5.5d 320.00 ± 5.5c 374.67 ± 4.5b 773.35** 15.419

r 0.823⁎⁎⁎ 0.926⁎⁎⁎ 0.918⁎⁎⁎ 0.897⁎⁎⁎ 0.916⁎⁎⁎ 0.897⁎⁎⁎

β1 0.684 0.892 0.908 0.876 0.871 0.891

β2 0.459 0.251 0.139 0.189 0.286 0.103

Se

0 0 0 2 0 4 0 6 300 0 300 2 300 4 300 6 F-ratio (df 7,16) HSD

Multiple regression analysis Parameter Lipid-soluble antioxidants Water-soluble antioxidants Free proline Glycine betaine Trehalose Osmolality

Multiple regression equations Y = 1.543 + 0.0015 X1 + 0.0671 X2 Y = 3.212 + 0.0067 X1 + 0.1267 X2 Y = 17.68 + 0.0824 X1 + 0.8504 X2 Y = 0.627 + 0.00108 X1 + 0.0156 X2 Y = 24.601 + 0.0825 X1 + 1.814 X2 Y = 193.34 + 0.467 X1 + 3.775 X2

Data presented in mean ± S.D. of three replicates. Means superscribed by the same letter are not significantly different from each other using one-way analysis of variance (ANOVA) and Tukey's honestly significant difference (HSD). Significant at ***p ≤ .001, **p ≤ .01. Y = Parameter under study; X1 = μM Cr; X2 = μM Se; r = Correlation coefficient; β1 = β-regression coefficient for Cr; β2 = β-regression coefficient for Se. Abbreviations: μM: Micromoles; μg: Microgram; mg: Milligram; g: Gram; FW: Fresh Weight; DW: Dry Weight; mOsm: Milliosmomole; kg: Kilogram.

6

N. Handa et al. / South African Journal of Botany 119 (2018) 1–10

Table 4 Effect of binary combinations of Se and Cr on total thiols, non-protein thiols and protein bound thiols of 15 days old seedlings of B. juncea. Concentrations (μM) Cr

Se

0 0 0 0 300 300 300 300 F-ratio (df 7,16) HSD

0 2 4 6 0 2 4 6

Multiple regression analysis Parameter Total thiols Non-protein thiols Protein bound thiols

Total thiols (mM g−1 FW)

Non-protein thiols (mM g−1 FW)

Protein bound thiols (mM g−1 FW)

0.217 ± 0.003e 0.231 ± 0.005e 0.251 ± 0.004d 0.264 ± 0.003d 0.284 ± 0.005c 0.307 ± 0.009b 0.356 ± 0.005a 0.293 ± 0.006bc 187.5** 0.016

0.022 ± 0.003d 0.029 ± 0.001cd 0.030 ± 0.003cd 0.037 ± 0.003c 0.051 ± 0.005b 0.064 ± 0.005a 0.067 ± 0.004a 0.072 ± 0.004a 85.9** 0.0103

0.195 ± 0.007e 0.202 ± 0.007d 0.221 ± 0.002bcd 0.226 ± 0.004bc 0.233 ± 0.009bc 0.243 ± 0.012b 0.289 ± 0.007a 0.22 ± 0.01cd 40.4** 0.022

Multiple regression equations Y = 0.223 + 0.0023 X1 + 0.0059X2 Y = 0.0212 + 0.00011 X1 + 0.0028 X2 Y = 0.202 + 0.00011 X1 + 0.003 X2

r 0.881⁎⁎⁎ 0.979⁎⁎⁎ 0.679⁎⁎⁎

β1 0.824 0.916 0.634

β2 0.312 0.346 0.242

Data presented in mean ± S.D. of three replicates. Means superscribed by the same letter are not significantly different from each other using one-way analysis of variance (ANOVA) and Tukey's honestly significant difference (HSD). Significant at ***p ≤ .001, **p ≤ .01. Y = Parameter under study; X1 = μM Cr; X2 = μM Se; r = Correlation coefficient; β1 = β-regression coefficient for Cr; β2 = β-regression coefficient for Se. Abbreviations: μM: Micromoles; mM: Millimoles; g: Gram; FW: Fresh Weight.

pathway of carotenoids and its reduced expression in the present study due to Cr could be the reason for reduced carotenoids content. The contents of anthocyanins and xanthophylls showed an increase with Cr stress. Anthocyanin production under stress might be because of activation of glutathione-S-transferase, whereas violaxanthin, which is a xanthophyll, acts as a precursor for abscisic acid biosynthesis that is further involved in oxidative stress protection (Marrs and Walbot 1997; Milborrow 2001). The present study also showed an increased expression of CHS which is involved in anthocyanin biosynthesis, which might be a reason for its enhanced content in response to Cr. Zou et al. (2009) and Datta et al. (2011) in their studies on Zea mays and T. aestivum, respectively, reported that Cr application resulted in decreased chlorophyll content. Similarly, a study on Cr-stressed Pistia stratiotes showed a dose-dependent decrease of chlorophyll (Dan et al. 2016). A report on Saccharum also showed reduction in chlorophyll and carotenoid contents in response to Cr (Jain et al. 2016). The contents of pigments in B. juncea seedlings showed a significant increase upon Se application. The probable increase in respiration rate due to Se application might be the reason for the increased biosynthesis of photosynthetic pigments (Germ et al. 2005). Also, in the present study, Se aided in downregulating CHALSE and upregulating PSY and CHS even in the binary combination with Cr thereby, indicating the role of Se in protection of the pigment machinery of the plants. Besides, increase in the content of carotenoids in response to Se application is also an indication of the stress protective property of Se because of the involvement of carotenoids in quenching of singlet oxygen species and other free radicals (Collins 2001). Carotenoids also aid in maintaining the stability of proteins in light harvesting complex and thylakoid membranes (Gill et al. 2011; Niyogi et al. 2001). The electron microscopic analysis also showed that Se, whether alone or in binary combination with Cr, helped in

Table 5 One way-analysis of variance (ANOVA), Tukey's honestly significant difference (HSD) and multiple regression analysis of relative gene expression of CHLASE, PSY and CHS. Parameter F(df-3,11) CHLASE PSY CHS

HSD

Regression equations

16.933** 1.920 Y = 1.534 + 0.0087 X1–0.28 X2 27.164** 1.196 Y = 0.521 + 0.0022 X1 + 0.519 X2 33.590** 1.573 Y = 0.192 + 0.0078 X1 + 0.502 X2

r

β1

β2

0.869*** 0.798 −0.345 0.873*** 0.268 0.832 0.852*** 0.648 0.554

Y = Parameter under study; X1 = μM Cr; X2 = μM Se; r = Correlation coefficient; β1 = βregression coefficient for Cr; β2 = β-regression coefficient for Se. Significant at ***p ≤ .001, **p ≤ .01. Abbreviations: CHLASE: Chlorophyllase; CHS: Chalcone synthase.

restoring the morphology as well as the density of stomata that lead to better gaseous exchange and photosynthesis. The study is backed by several earlier studies that suggest the role of Se as a stress ameliorator (Ahmad et al. 2016). A study conducted on Ni-stressed Lactuca sativa showed enhanced contents of chlorophylls, carotenoids, and anthocyanins with low doses of Se (Hawrylak et al. 2007). The plants of B. oleracea subjected to Cd stress and T. aestivum subjected to UV-B radiation, showed increased contents of chlorophyll a and chlorophyll b with the application of Se (Pedrero et al. 2008; Yao et al. 2011). In another study on Cd-stressed Helianthus annuus, Se supplementation caused an increase in the contents of chlorophyll a, chlorophyll b, and carotenoids (Saidi et al. 2014). Total antioxidative capacity of plants includes all antioxidants involved in scavenging of ROS produced as a result of stress. These antioxidants might be enzymatic or non-enzymatic and might be soluble in either water or lipids. Superoxide dismutase (SOD) and catalase (CAT) are key antioxidant enzymes involved in scavenging of superoxide anions and hydrogen peroxide (H2O2). Apart from these, ascorbate–glutathione antioxidant pathway, which is comprised of both enzymatic antioxidants, like ascorbate peroxidase (APOX), guaiacol peroxidase (POD), glutathione peroxidase (GPOX), dehydroascorbate reductase (DHAR), monodehydroascorbate reductase (MDHAR), and glutathione reductase (GR), and non-enzymatic antioxidants (ascorbate and reduced glutathione) functions in the conversion of H2O2 to water (Arora et al. 2002; Asada 2006; Noctor and Foyer 1998). Tocopherols, phenols, flavonoids, and many other such antioxidants are also involved in fortification of plant resistance towards stress. In the present study, lipid- and water-soluble antioxidants showed significant increase in response to Cr. Such an increase might be because of the activation of antioxidative defense system in response to stress. The effects of heavy metals on individual antioxidants, however, have been reported in several plants (Rasool et al. 2013; Ahmad et al. 2015), but to our knowledge, this is the first report of the use of antioxidant analyzer and analysis of total antioxidative capacity with respect to heavy metal stress. The application of Cr on Z. mays seedlings was reported to increase the activities of SOD, CAT, and peroxidase in roots as well as in leaves (Zou et al. 2009). Similarly, the roots and leaves of barley plants also showed increased activities of SOD, CAT, APOX, GR, and peroxidase in response to Cr application (Ali et al. 2011). In a study on Phaseolus aureus, arsenic (As) treatment led to increased activities of SOD, CAT, APOX, GR, and glutathione-S-transferase. The study also showed increased contents of ascorbate and glutathione (Malik et al. 2012). Das et al. (2014) showed that Cd toxicity in Marsilea minuta caused an increase in both the activity of CAT and the ratio of reduced to oxidized

N. Handa et al. / South African Journal of Botany 119 (2018) 1–10

(a)

(b) 6

7

CHS

Relative gene expression

7 Relative gene expression

7

5 4 3 2 1 0

6

CHLASE

5 4 3 2 1 0

Relative gene expression

(C) 5 4.5 4 3.5 3 2.5 2 1.5 1 0.5 0

PSY

Fig. 2. Relative gene expressions of (A) CHLASE, (B) PSY and (C) CHS in 15 days old B. juncea seedlings under the effect of binary combinations of Se and Cr.

glutathione (GSH/GSSG) in a dose-dependent manner. In the present study, Se application to the Cr-stressed seedlings caused a further increase in the total antioxidant capacity. This indicates the role of Se in strengthening the plant defense system, which provided resistance to Cr stress. The results of this study is supported by studies on Allium sativum (Kapoor et al. 2012), B. napus (Hasanuzzaman et al. 2012), Olea europaea (Proietti et al. 2013) and B. juncea (Handa et al. 2017) which showed enhanced activities of CAT, GPOX, MDHAR, DHAR, and GR, as well as the contents of ascorbate and GSH in response to Se application. In the present study, Cr application to the seedlings caused an increase in the content of osmolytes. Gopal et al. (2009) showed that in Spinacia oleracea, physiological availability of water decreases because of Cr stress, which leads to reduced water potential, further resulting in water stress. The conditions of water stress trigger the accumulation of compatible solutes also known as osmolytes, which include proline, betaines, trehalose, polyols, and fructans (Smirnoff 1998). These osmolytes primarily control the osmotic homeostasis but they may also exert protective effects on biomolecules (Smirnoff 1998). The contents of free proline, glycine betaine, and trehalose were observed to increase in response to Cr application. Heavy metal stress also induces the activation of Δ1-pyrroline-5-carboxylate synthase which is involved in the biosynthesis of proline. The enzyme exhibits glutamate kinase-like activities and has a regulatory role in heavy metal stress (Pérez-Arellano et al. 2010). In addition, Székely et al. (2008) reported that knockout of the gene encoding Δ1-pyrroline-5-carboxylate synthase in Arabidopsis thaliana resulted in a reduction in proline synthesis as well as in ROS accumulation. The results of the present study are in coherence with those in studies on G. max, Camellia sinensis, and B. napus, which show increased proline content in response to Cr stress

(Ganesh et al. 2009; Najafian et al. 2012; Tang et al. 2012). Glycine betaine is synthesized with the help of enzymes choline monooxygenase and betaine aldehyde dehydrogenase by oxidizing choline, and these are activated under the stressful conditions (Rhodes and Hanson 1993; Wani et al. 2013). Earlier studies on Savinia natans and Marsilea minuta which showed increased content of glycine betaine in response to heavy metal stress (Dhir et al. 2012; Das et al. 2014), supported the present work. Increase in the content of trehalose may be attributed to overexpression of trehalos-6-phosphate in response to several abiotic stresses as demonstrated in studies conducted on transgenic plants (Almeida et al. 2005). A study on tobacco plants engineered with trehalose-6-phosphate gene showed more resistance to Cu and Cd stress (Martins et al. 2013). Another study on rice seedlings by Mostofa et al. (2015) established that pretreatment of trehalose not only enhanced the endogenous trehalose contents but also ameliorated the toxicity induced by Cu stress. Se application, in the present study, aided in increasing the contents osmolytes. The accumulation of proline with Se application might be because of the alterations in nitrogen metabolism and its assimilation, and changes in the expression of gene encoding proline or hormonal status of plants (Ardebili et al. 2015). Proline plays a significant role in controlling oxidative damage as it reacts with hydroxyl radical and scavenges singlet oxygen species (Alia et al. 2001). Further, proline can form chelates with metal ions to help in fighting heavy metal stress (Khattab 2004). Similar results of proline accumulation in response to Se were also reported in salt-stressed Cucumis sativus plants (Hawrylak-Nowak 2009), UV-B-stressed T. aestivum plants (Yao et al. 2011), and drought-stressed wheat plants (Nawaz et al. 2015). Glycine betaine has also been reported to show protective effects on biomembranes, photosynthetic pigments, and protein structure. It also aids in reducing

8

N. Handa et al. / South African Journal of Botany 119 (2018) 1–10

ROS accumulation as well as upregulating the stress protective genes (Sakamoto and Murata 2002; Chen and Murata 2008). For trehalose, it has been postulated that Se has the ability to increase the activity of amylase leading to the conversion of starch to sugars (Malik et al. 2010), which might be the probable reason for increased trehalose content. In addition, several studies have shown the effect of Se in increasing the photosynthesis contents and the photosynthetic rates (Yao et al. 2011; Proietti et al. 2013; Saidi et al. 2014). Enhanced photosynthesis might also be one of the reasons for the increased trehalose content. The protective effects of trehalose have been attributed to its ability of membrane stabilization and protein protection by preventing the oxidation by H2O2 (Luo et al. 2008). These results showed conformity with those of the studies on P. aureus, B. napus, and T. aestivum, which showed increased contents of soluble sugars with Se application (Malik et al. 2010; Hajiboland and Keivanfar 2012; Nawaz et al. 2015). Osmotic pressure due to the presence of solutes in the fluids of the living systems regulates the movement of solutes across the biomembranes. The magnitude of osmotic pressure depends on the number of solute particles present in the solvent. Thus, we estimated osmolality, which is a measure of total concentration of the solutes in fluids. The application of Cr to B. juncea seedlings resulted in increased osmolality. These results also supported the spectroscopic studies of proline, glycine betaine, and trehalose. The probable reason for such a response might be the increased degradation of starch or enhanced synthesis of sugars (Lee et al. 2008). Se application to the Cr-stressed B. juncea seedlings, on the contrary, caused a reduction in the osmolality relative to that in the Cr-treated seedlings. However, compared to that in control seedlings, the osmolality of seedlings cultivated under binary combinations was significantly higher. Thiols are significantly involved in metal chelation, therefore, they form an important group that helps in alleviating heavy metal stress (Oukarroum 2016). Cr application, in the present investigation, caused an increase in the contents of total thiols, non-protein thiols, and protein-bound thiols. Heavy metal stress has been postulated to influence the sulfur reduction pathway, causes changes in sulfur uptake and transport, and activates the enzymes involved (Herbette et al. 2006; Rausch and Wachter 2005). Earlier studies on As-stressed Pteris vittata and Cd-stressed Gracilaria dura have been reported to increase the contents of non-protein thiols (Kumar et al. 2012; Srivastava et al. 2009). The plants of Z. mays subjected to Cu stress showed increased levels of total thiols and protein-bound thiols in a dose-dependent manner (Aly and Mohamed 2012). Se supplementation in binary combinations with Cr, in the present study, enhanced the resistance of B. juncea seedlings against Cr-stress by causing additional increase in the contents of total thiols, non-protein thiols, and protein bound thiols. Increased levels of thiols might lead to enhanced metal chelating ability of plants and demonstrate stress ameliorative property of Se. These observations are coherent with those on As-stressed P. aureus plants in which the content of total thiols was reported to increase with Se supplementation (Malik et al. 2012). Similarly, G. dura also showed stress protective property of Se, as it caused an increase in the content of non-protein thiols, thus, enhancing the resistance against Cd stress (Kumar et al. 2012). 5. Conclusions In conclusion, Cr negatively affects the metabolic activities of B. juncea, which were restored by Se application. Se application showed its protective effects on photosynthetic pigments and gene expression studies confirmed the spectrophotometric observations. The SEM studies also clearly indicated the positive effects of Se against Cr toxicity on morphology and density of stomata, which further confirmed its imperative role in efficient gas exchange for both photosynthesis and respiration. Exogenous application of Se was also observed to enhance the lipid- and water-soluble antioxidants, which further indicated its role in alleviating oxidative damage. The positive effect of Se in maintaining

the osmotic homeostasis as well as activation of thiols in Cr-stressed seedlings also showed its potential to enhance the ability of B. juncea seedlings to combat heavy metal stress effectively. The results, therefore, indicate that Se can be effectively used as a mitigating agent against Cr stress. Conflict of interest The authors declare that no conflict of interest exists among the authors. Acknowledgement The authors extend their appreciation to the Deanship of Scientific Research at King Saud University, Riyadh, Saudi Arabia for funding the research group No (RG-1438-039). The University Grants Commission, India is also acknowledged for their support. References Ahmad, P., Sarwat, M., Bhat, N.A., Wani, M.R., Kazi, A.G., Tran, L.-S.P., 2015. Alleviation of cadmium toxicity in Brassica juncea L. (czern. & coss.) by calcium application involves various physiological and biochemical strategies. PLoS ONE 10:e0114571. https://doi. org/10.1371/journal.pone.0114571. Ahmad, P., Abdel Latef, A.A., Hashem, A., Abd_Allah, E.F., Gucel, S., L-SP, Tran, 2016. Nitric oxide mitigates salt stress by regulating levels of osmolytes and antioxidant enzymes in chickpea. Frontiers in Plant Science 7. https://doi.org/10.3389/fpls.2016.00347. Akladious, S.A., 2012. Influence of different soaking times with selenium on growth, metabolic activities of wheat seedlings under low temperature stress. African Journal of Biotechnology 11, 14792–14804. Ali, S., Zeng, F., Qiu, B., Cai, S., Qiu, L., Wu, F., Zhang, G., 2011. Interactive effects of aluminum and chromium stresses on the uptake of nutrients and the metals in barley. Soil Science and Plant Nutrition 57:68–79. https://doi.org/10.1080/ 00380768.2010.549444. Alia, P., Mohanty, P., Matysik, J., 2001. Effect of proline on the production of singlet oxygen. Amino Acids 21, 195–200. Almeida, A.M., et al., 2005. Transformation of tobacco with an Arabidopsis thaliana gene involved in trehalose biosynthesis increases tolerance to several abiotic stresses. Euphytica 146:165–176. https://doi.org/10.1007/s10681-005-7080-0. Aly, A.A., Mohamed, A.A., 2012. The impact of copper ion on growth, thiol compounds and lipid peroxidation in two maize cultivars (Zea mays L.) grown in vitro. Australian Journal of Crop Science 6, 541. Amin, H., Arain, B.A., Amin, F., Surhio, M.A., 2013. Phytotoxicity of chromium on germination, growth and biochemical attributes of Hibiscus esculentus L. American Journal of Plant Sciences 04:2431–2439. https://doi.org/10.4236/ajps.2013.412302. Amin, H., Arain, B.A., Amin, F., Surhio, M.A., 2014. Analysis of growth response and tolerance index of Glycine max (L.) Merr. under hexavalent chromium stress. Advancements in Life Sciences 1, 231–241. Ardebili, Z., Ardebili, N., Jalili, S., Safiallah, S., 2015. The modified qualities of basil plants by selenium and/or ascorbic acid. Turkish Journal of Botany 39, 401–407. Arnon, D.I., 1949. Copper enzymes in isolated chloroplasts. Polyphenoloxidase in Beta vulgaris. Plant Physiology 24, 1. Arora, A., Sairam, R., Srivastava, G., 2002. Oxidative stress and antioxidative system in plants. Current Science 82, 1227–1238. Asada, K., 2006. Production and scavenging of reactive oxygen species in chloroplasts and their functions. Plant Physiology 141:391–396. https://doi.org/10.1104/ pp.106.082040. Bailey, N.T.J., 1995. Statistical methods in biology. 3rd edn. Cambridge University Press (CUP) https://doi.org/10.1017/s0025315400018403. Bates, L.S., Waldren, R.P., Teare, I.D., 1973. Rapid determination of free proline for waterstress studies. Plant and Soil 39:205–207. https://doi.org/10.1007/bf00018060. Chen, T.H.H., Murata, N., 2008. Glycinebetaine: an effective protectant against abiotic stress in plants. Trends in Plant Science 13:499–505. https://doi.org/10.1016/j. tplants.2008.06.007. Choudhary, S.P., Kanwar, M., Bhardwaj, R., Yu, J.Q., Tran, L.S., 2012. Chromium stress mitigation by polyamine-brassinosteroid application involves phytohormonal and physiological strategies in Raphanus sativus L. PLoS ONE 7, e33210. Collins, A.R., 2001. Carotenoids and genomic stability. Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 475:21–28. https://doi.org/10.1016/ s0027-5107(01)00071-9. Dan, P.K., Mandal, S., De, A.K., Mandal, S., 2016. Studies on the toxicity of chromium (VI) to Pistia stratiotes L. Plant and its removal. International Journal of Current Microbiology and Applied Sciences 5:975–982. https://doi.org/10.20546/ijcmas.2016.505.103. Das, K., Mandal, C., Ghosh, N., Dey, N., Adak, M.K., 2014. Responses of Marsilea minuta L. to cadmium stress and assessment of some oxidative biomarkers. American Journal of Plant Sciences 05:1467–1476. https://doi.org/10.4236/ajps.2014.510162. Datta, J., Bandhyopadhyay, A., Banerjee, A., Mondal, N., 2011. Phytotoxic effect of chromium on the germination, seedling growth of some wheat (Triticum aestivum L.) cultivars under laboratory condition. Journal of Agricultural Science and Technology 7, 395–402.

N. Handa et al. / South African Journal of Botany 119 (2018) 1–10 Del Longo, O.T., González, C.A., Pastori, G.M., Trippi, V.S., 1993. Antioxidant defences under hyperoxygenic and hyperosmotic conditions in leaves of two lines of maize with differential sensitivity to drought. Plant and Cell Physiology 34, 1023–1028. Dhir, B., Nasim, S.A., Samantary, S., Srivastava, S., 2012. Assessment of osmolyte accumulation in heavy metal exposed Salvinia natans. International Journal of Botany 8: 153–158. https://doi.org/10.3923/ijb.2012.153.158. Ganesh, K.S., Baskaran, L., Rajasekaran, S., Sumathi, K., Chidambaram, A.L.A., Sundaramoorthy, P., 2008. Chromium stress induced alterations in biochemical and enzyme metabolism in aquatic and terrestrial plants. Colloids and Surfaces B: Biointerfaces 63:159–163. https://doi.org/10.1016/j.colsurfb.2007.11.016. Ganesh, K.S., Baskaran, L., Chidambaram, A., Sundaramoorthy, P., 2009. Influence of chromium stress on proline accumulation in soybean (Glycine max L. Merr.) genotypes. Global Journal of Environmental Research 3, 106–108. Germ, M., Kreft, I., Osvald, J., 2005. Influence of UV-B exclusion and selenium treatment on photochemical efficiency of photosystem II, yield and respiratory potential in pumpkins (Cucurbita pepo L.). Plant Physiology and Biochemistry 43:445–448. https://doi. org/10.1016/j.plaphy.2005.03.004. Ghani, A., Khan, I., Umer, S., Ahmed, I., Mustafa, I., Mohammad, N., 2015. Response of wheat (Triticum aestivum) to exogenously applied chromium: effect on growth, chlorophyll and mineral composition. Journal of Environmental & Analytical Toxicology 5, 573. Gill, S.S., Khan, N.A., Anjum, N.A., Tuteja, N., 2011. Amelioration of cadmium stress in crop plants by nutrients management: morphological, physiological and biochemical aspects. Plant Stress 5, 1–23. Gopal, R., Rizvi, A.H., Nautiyal, N., 2009. Chromium alters iron nutrition and water relations of spinach. Journal of Plant Nutrition 32:1551–1559. https://doi.org/10.1080/ 01904160903094313. Grieve, C.M., Grattan, S.R., 1983. Rapid assay for determination of water soluble quaternary ammonium compounds. Plant and Soil 70:303–307. https://doi.org/10.1007/ bf02374789. Hajiboland, R., Keivanfar, N., 2012. Selenium supplementation stimulates vegetative and reproductive growth in canola (Brassica napus L.) plants. Acta Agriculturae Slovenica 99. https://doi.org/10.2478/v10014-012-0002-7. Han, F.X., Sridhar, B.B.M., Monts, D.L., Su, Y., 2004. Phytoavailability and toxicity of trivalent and hexavalent chromium to Brassica juncea. New Phytologist 162:489–499. https://doi.org/10.1111/j.1469-8137.2004.01027.x. Handa, N., Kohli, S.K., Thukral, A.K., Arora, S., Bhardwaj, R., 2017. Role of Se (VI) in counteracting oxidative damage in Brassica juncea L. under Cr (VI) stress. Acta Physiologiae Plantarum 39, 51. Handa, N., Kohli, S.K., Thukral, A.K., Bhardwaj, R., Alyemeni, M.N., Wijaya, L., Ahmad, P., 2018. Protective role of selenium against chromium stress involving metabolites and essential elements in Brassica juncea L. seedlings. 3. Biotechnology 8, 66. Hasanuzzaman, M., Fujita, M., 2011. Selenium pretreatment upregulates the antioxidant defense and methylglyoxal detoxification system and confers enhanced tolerance to drought stress in rapeseed seedlings. Biological Trace Element Research 143: 1758–1776. https://doi.org/10.1007/s12011-011-8998-9. Hasanuzzaman, M., Hossain, M.A., Fujita, M., 2012. Exogenous selenium pretreatment protects rapeseed seedlings from cadmium-induced oxidative stress by upregulating antioxidant defense and methylglyoxal detoxification systems. Biological Trace Element Research 149:248–261. https://doi.org/10.1007/s12011-012-9419-4. Hawrylak, B., Matraszek, R., Szymańska, M., 2007. Response of lettuce (Lactuca Sativa L.) to selenium in nutrient solution contaminated with nickel. Vegetable Crops Research Bulletin 67. https://doi.org/10.2478/v10032-007-0031-7. Hawrylak-Nowak, B., 2009. Beneficial effects of exogenous selenium in cucumber seedlings subjected to salt stress. Biological Trace Element Research 132:259–269. https://doi.org/10.1007/s12011-009-8402-1. Herbette, S., et al., 2006. Genome-wide transcriptome profiling of the early cadmium response of Arabidopsis roots and shoots. Biochimie 88:1751–1765. https://doi.org/ 10.1016/j.biochi.2006.04.018. Islamit, M.K., Khanam, S., Lee, S.Y., Alam, I., Huhl, M.R., 2014. The interaction of arsenic (As) and chromium (Cr) influences growth and antioxidant status in tossa jute ('Corchorus olitorius'). Plant Omics 7, 499. Jain, R., Singh, S., Singh, A., Singh, S., Tripathi, P., Chandra, A., Solomon, S., 2016. Study on physio-biochemical attributes and metallothionein gene expression affected by chromium (VI) in sugarcane (Saccharum spp. hybrid). Journal of Environmental Biology 37, 375. Kapoor, R., Nasim, S.A., Dhir, B., Mujib, A., 2012. Selenium treatment alters phytochemical and biochemical activity of in vitro-grown tissues and organs of Allium sativum L. In Vitro Cellular & Developmental Biology-Plant 48, 411–416. Khattab, H., 2004. Metabolic and oxidative responses associated with exposure of Eruca sativa (rocket) plants to different levels of selenium. International Journal of Agriculture and Biology 6, 1101–1106. Kumar, M., Bijo, A.J., Baghel, R.S., Reddy, C.R.K., Jha, B., 2012. Selenium and spermine alleviate cadmium induced toxicity in the red seaweed Gracilaria dura by regulating antioxidants and DNA methylation. Plant Physiology and Biochemistry 51:129–138. https://doi.org/10.1016/j.plaphy.2011.10.016. Läuchli, A., 1993. Selenium in plants: uptake, functions, and environmental toxicity. Botanica Acta 106:455–468. https://doi.org/10.1111/j.1438-8677.1993.tb00774.x. Lawrence, J., 1990. Determination of total xanthophyll and marigold oleoresin. Journal of Association of Official Analytical Chemists 2, 970–975. Lee, B.-R., et al., 2008. Water-deficit accumulates sugars by starch degradation-not by de novo synthesis-in white clover leaves (Trifolium repens). Physiologia Plantarum 134: 403–411. https://doi.org/10.1111/j.1399-3054.2008.01156.x. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method. Methods 25, 402–408.

9

Luo, Y., Li, W.-M., Wang, W., 2008. Trehalose: protector of antioxidant enzymes or reactive oxygen species scavenger under heat stress? Environmental and Experimental Botany 63:378–384. https://doi.org/10.1016/j.envexpbot.2007.11.016. Malik, J.A., et al., 2010. Promotion of growth in mungbean (Phaseolus aureus Roxb.) by selenium is associated with stimulation of carbohydrate metabolism. Biological Trace Element Research 143:530–539. https://doi.org/10.1007/s12011-010-8872-1. Malik, J.A., Goel, S., Kaur, N., Sharma, S., Singh, I., Nayyar, H., 2012. Selenium antagonises the toxic effects of arsenic on mungbean (Phaseolus aureus Roxb.) plants by restricting its uptake and enhancing the antioxidative and detoxification mechanisms. Environmental and Experimental Botany 77:242–248. https://doi.org/ 10.1016/j.envexpbot.2011.12.001. Mancinelli, A.L., 1984. Photoregulation of anthocyanin synthesis: VIII. Effect of light pretreatments. Plant Physiology 75:447–453. https://doi.org/10.1104/pp.75.2.447. Marrs, K.A., Walbot, V., 1997. Expression and RNA splicing of the maize glutathione Stransferase bronze2 gene is regulated by cadmium and other stresses. Plant Physiology 113:93–102. https://doi.org/10.1104/pp.113.1.93. Martins, L.L., et al., 2013. Response to oxidative stress induced by cadmium and copper in tobacco plants (Nicotiana tabacum) engineered with the trehalose-6-phosphate synthase gene (AtTPS1). Acta Physiologiae Plantarum 36:755–765. https://doi.org/ 10.1007/s11738-013-1453-0. Milborrow, B.V., 2001. The pathway of biosynthesis of abscisic acid in vascular plants: a review of the present state of knowledge of ABA biosynthesis. Journal of Experimental Botany 52:1145–1164. https://doi.org/10.1093/jexbot/52.359.1145. Mohanty, M., Patra, H.K., 2011. Effect of Cr and chelating agents on growth, pigment status, proline content and chromium bioavailability in rice seedlings. International Journal of Biotechnology Applications 3, 91–96. Mostofa, M.G., Hossain, M.A., Fujita, M., Tran, L.-S.P., 2015. Physiological and biochemical mechanisms associated with trehalose-induced copper-stress tolerance in rice. Scientific Reports:5 https://doi.org/10.1038/srep11433. Nagarajan, M., Ganesh, K.S., 2014. Effect of chromium on growth, biochemicals and nutrient accumulation of paddy (Oryza sativa L.). International Letters of Natural Sciences 23:63–71. https://doi.org/10.18052/www.scipress.com/ilns.23.63. Najafian, M., Kafilzadeh, F., Azad, H.N., Tahery, Y., 2012. Toxicity of chromium (Cr) on growth, ions and some biochemical parameters of Brassica napus L. World Applied Sciences Journal 16, 1104–1109. Nawaz, F., Ashraf, M.Y., Ahmad, R., Waraich, E.A., Shabbir, R.N., Bukhari, M.A., 2015. Supplemental selenium improves wheat grain yield and quality through alterations in biochemical processes under normal and water deficit conditions. Food Chemistry 175:350–357. https://doi.org/10.1016/j.foodchem.2014.11.147. Niyogi, K.K., Shih, C., Soon Chow, W., Pogson, B.J., Dellapenna, D., Björkman, O., 2001. Photoprotection in a zeaxanthin- and lutein-deficient double mutant of Arabidopsis. Photosynthesis Research 67, 139–145. Noctor, G., Foyer, C.H., 1998. Ascorbate and glutathione: Keeping active oxygen under control. Annual Review of Plant Physiology and Plant Molecular Biology 49: 249–279. https://doi.org/10.1146/annurev.arplant.49.1.249. Oukarroum, A., 2016. Alleviation of metal-induced toxicity in aquatic plants by exogenous compounds: a mini-review. Water, Air, & Soil Pollution 227. https://doi.org/10.1007/ s11270-016-2907-y. Panda, S., Patra, H., 2000. Does chromium (III) produce oxidative damage in excised wheat leaves? Journal of Plant Biology 27, 105–110. Pedrero, Z., Madrid, Y., Hartikainen, H., Cámara, C., 2008. Protective effect of selenium in broccoli (Brassica oleracea) plants subjected to cadmium exposure. Journal of Agricultural and Food Chemistry 56:266–271. https://doi.org/10.1021/jf072266w. Pérez-Arellano, I., Carmona-Álvarez, F., Martínez, A.I., Rodríguez-Díaz, J., Cervera, J., 2010. Pyrroline-5-carboxylate synthase and proline biosynthesis: From osmotolerance to rare metabolic disease. Protein Science 19:372–382. https://doi.org/10.1002/pro.340. Pilon-Smits, E.A., Quinn, C.F., 2010. Selenium metabolism in plants. Cell biology of metals and nutrients. Springer, pp. 225–241. Proietti, P., Nasini, L., Del Buono, D., D'Amato, R., Tedeschini, E., Businelli, D., 2013. Selenium protects olive (Olea europaea L.) from drought stress. Scientia Horticulturae 164:165–171. https://doi.org/10.1016/j.scienta.2013.09.034. Pukacka, S., Ratajczak, E., Kalemba, E., 2011. The protective role of selenium in recalcitrant Acer saccharium L. seeds subjected to desiccation. Journal of Plant Physiology 168, 220–225. Rai, V., Tandon, P.K., Khatoon, S., 2014. Effect of chromium on antioxidant potential of Catharanthus roseus varieties and production of their anticancer alkaloids: vincristine and vinblastine. BioMed Research International 2014:1–10. https://doi.org/10.1155/ 2014/934182. Rasool, S., Ahmad, A., Siddiqi, T.O., Ahmad, P., 2013. Changes in growth, lipid peroxidation and some key antioxidant enzymes in chickpea genotypes under salt stress. Acta Physiologiae Plantarum 35, 1039–1050. Rastogi, A., Zivcak, M., Sytar, O., Kalaji, H.M., He, X., Mbarki, S., Brestic, M., 2017. Impact of metal and metal oxide nanoparticles on plant: a critical review. Frontiers in Chemistry 5, 78. Rausch, T., Wachter, A., 2005. Sulfur metabolism: a versatile platform for launching defence operations. Trends in Plant Science 10, 503–509. Rhodes, D., Hanson, A., 1993. Quaternary ammonium and tertiary sulfonium compounds in higher plants. Annual Review of Plant Biology 44, 357–384. Saidi, I., Chtourou, Y., Djebali, W., 2014. Selenium alleviates cadmium toxicity by preventing oxidative stress in sunflower (Helianthus annuus) seedlings. Journal of Plant Physiology 171:85–91. https://doi.org/10.1016/j.jplph.2013.09.024. Sakamoto, A., Murata, N., 2002. The role of glycine betaine in the protection of plants from stress: clues from transgenic plants. Plant, Cell and Environment 25:163–171. https:// doi.org/10.1046/j.0016-8025.2001.00790.x. Sangwan, P., Kumar, V., Khatri, R.S., Joshi, U.N., 2013. Chromium (VI) induced biochemical changes and gum content in cluster bean (Cyamopsis tetragonoloba L.) at different

10

N. Handa et al. / South African Journal of Botany 119 (2018) 1–10

developmental stages. Journal of Botany 2013:1–8. https://doi.org/10.1155/2013/ 578627. Sedlak, J., Lindsay, R.H., 1968. Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman's reagent. Analytical Biochemistry 25:192–205. https://doi.org/10.1016/0003-2697(68)90092-4. Sela, M., Garty, J., Tel-Or, E., 1989. The accumulation and the effect of heavy metals on the water fern Azolla filiculoides. New Phytologist 112:7–12. https://doi.org/10.1111/ j.1469-8137.1989.tb00302.x. Shapiro, S.S., Wilk, M.B., 1965. An analysis of variance test for normality (complete samples). Biometrika 52:591–611. https://doi.org/10.1093/biomet/52.3-4.591. Sharma, S., Bansal, A., Dogra, R., Dhillon, S.K., Dhillon, K.S., 2011. Effect of organic amendments on uptake of selenium and biochemical grain composition of wheat and rape grown on seleniferous soils in northwestern India. Journal of Plant Nutrition and Soil Science 174, 269–275. Sharma, A., Thakur, S., Kumar, V., Kanwar, M.K., Kesavan, A.K., Thukral, A.K., Bhardwaj, R., Alam, P., Ahmad, P., 2016. Pre-sowing seed treatment with 24-epibrassinolide ameliorates pesticide stress in Brassica juncea L. through the modulation of stress markers. Frontiers in Plant Science 7, 1569. Singh, H.P., Mahajan, P., Kaur, S., Batish, D.R., Kohli, R.K., 2013. Chromium toxicity and tolerance in plants. Environmental Chemistry Letters 11, 229–254. Smirnoff, N., 1998. Plant resistance to environmental stress. Current Opinion in Biotechnology 9:214–219. https://doi.org/10.1016/s0958-1669(98)80118-3. Sokal, R.R., Rohlf, J.F., 1969. Biometry. The principles and practice of statistics in biological research. WH Freeman and Co, San Francisco. Song, W., Zheng, A., Shao, H., Chu, L., Brestic, M., Zhang, Z., 2012. The alleviative effect of salicylic acid on the physiological indices of the seedling leaves in six different wheat genotypes under lead stress. Plant Omics 5, 486–493. Song, W.Y., Yang, H.C., Shao, H.B., Zheng, A.Z., Brestic, M., 2014. The alleviative effects of salicylic acid on the activities of catalase and superoxide dismutase in malting barley (Hordeum uhulgare L.) seedling leaves stressed by heavy metals. CLEAN–Soil, Air, Water 42, 88–97. Srivastava, M., Ma, L.Q., Rathinasabapathi, B., Srivastava, P., 2009. Effects of selenium on arsenic uptake in arsenic hyperaccumulator Pteris vittata L. Bioresource Technology 100:1115–1121. https://doi.org/10.1016/j.biortech.2008.08.026. Sytar, O., Brestic, M., Taran, N., Zivcak, M., 2015. Plants used for biomonitoring and phytoremediation of trace elements in soil and water. In: Ahmad, P. (Ed.), Plant

metal interaction: emerging remediation techniques. Elsevier, Amsterdam, Netherlands, pp. 361–384. Székely, G., et al., 2008. Duplicated P5CS genes of Arabidopsis play distinct roles in stress regulation and developmental control of proline biosynthesis. The Plant Journal 53, 11–28. Tang, J., Xu, J., Wu, Y., Li, Y., Tang, Q., 2012. Effects of high concentration of chromium stress on physiological and biochemical characters and accumulation of chromium in tea plant (Camellia sinensis L.). African Journal of Biotechnology 11, 2248–2255. Teixeira, J., Ferraz, P., Almeida, A., Verde, N., Fidalgo, F., 2013. Metallothionein multigene family expression is differentially affected by Chromium (III) and (VI) in Solanum nigrum L. plants. Food and Energy Security 2:130–140. https://doi.org/10.1002/ fes3.26. Terry, N., Zayed, A., De Souza, M., Tarun, A., 2000. Selenium in higher plants. Annual Review of Plant Biology 51, 401–432. Trevelyan, W.E., Harrison, J.S., 1956. Studies on yeast metabolism. 5. The trehalose content of baker's yeast during anaerobic fermentation. Biochemical Journal 62:177–183. https://doi.org/10.1042/bj0620177b. Wani, H., Singh, B., Athokpam, H., Javed, I., 2013. Compatible solute engineering in plants for abiotic stress tolerance-role of glycine betaine. Current Genomics 14, 157–165. White, P., Bowen, H.C., Parmaguru, P., Fritz, M., Spracklen, W.P., Spiby, R.E., Meacham, M. C., Mead, A., Harriman, M., Trueman, L.J., Smith, B.M., 2004. Interactions between selenium and sulphur nutrition in Arabidopsis thaliana. Journal of Experimental Botany 55, 1927–1937. Yao, X., Chu, J., He, X., Ba, C., 2011. Protective role of selenium in wheat seedlings subjected to enhanced UV-B radiation. Russian Journal of Plant Physiology 58:283–289. https://doi.org/10.1134/s1021443711020257. Zayed, A.M., Terry, N., 2003. Chromium in the environment: factors affecting biological remediation. Plant and Soil 249, 139–156. Zou, J., Yu, K., Zhang, Z., Jiang, W., Liu, D., 2009. Antioxidant response system and chlorophyll fluorescence in chromium (VI)-treated Zea mays L. seedlings. Acta Biologica Cracoviensia Series Botanica 51, 23–33. Zupančič, M., Bukovec, N., Milačič, R., Ščančar, J., 2004. Comparison of various phosphate stabilisation agents for the immobilisation of Ni and Zn in sewage sludge. Water, Air, & Soil Pollution 156:57–69. https://doi.org/10.1023/b:wate.0000036789.07619.b6.