Semaphorin3A accelerates neuronal polarity in vitro and in its absence the orientation of DRG neuronal polarity in vivo is distorted

www.elsevier.com/locate/ymcne Mol. Cell. Neurosci. 36 (2007) 222 – 234

Semaphorin3A accelerates neuronal polarity in vitro and in its absence the orientation of DRG neuronal polarity in vivo is distorted Omer Lerman, 1 Ayal Ben-Zvi, 1 Zohar Yagil, and Oded Behar ⁎ The Hubert H. Humphrey Center for Experimental Medicine and Cancer Research, The Hebrew University Faculty of Medicine, PO Box 12272, Jerusalem 91120, Israel Received 28 June 2007; accepted 2 July 2007 Available online 24 July 2007 Axon guidance cues are critical for neuronal circuitry formation. Guidance molecules may repel or attract axons directly by effecting growth cone motility, or by impinging on neuronal polarity. In Semaphorin3A null mice, many axonal errors are detected, most prominently in DRG neurons. It has been generally assumed the repellent properties of Semaphorin3A are the cause of these erroneous axonal projections. Here we show that, in semaphorin3A-null mice, the initial trajectory of neurons in the DRG is abnormal, suggesting that Semaphorin3A may instruct neuronal polarity. In corroboration, in vitro Semaphorin3A dramatically increases neuronal polarization, as indicated by GSK3β and Rac1 subcellular localization in DRG neurons. Polarization effects of Semaphorin3A are regulated by activated MAPK, as indicated by p-MAPK 42/44 polarization and the need for its activity for Rac1 and GSK3β polarization. Taken together, our findings suggest that Semaphorin3A plays a role in the formation of neuronal polarity, in addition to its classic repellent role. © 2007 Elsevier Inc. All rights reserved.

Introduction Semaphorin 3A (Sema3A) is a potent axon repellent molecule of peripheral and central nervous system neurons in vitro (Nakamura et al., 2000). In Sema3A-null mice, gross abnormalities in DRG axon projections were found. Because of its repellent effect in vitro, it is generally assumed these guidance errors occur because axons are no longer restricted to their normal paths. However, the cellular morphology of DRG neurons that exhibit axon errors has not been examined meticulously. In the central nervous system, the effects of Sema3A on neuronal morphology have been analyzed more closely. In cortical neurons, Sema3A has been shown to regulate the initial trajectory of the cortical axons and their apical dendrites (Behar et al., 1996; Polleux et al., 1998, 2000). Interestingly, although in many instances the axons reach the white matter by their normal paths, their cellular orientations

⁎ Corresponding author. Fax: +972 2 6414583. E-mail address: [email protected] (O. Behar). 1 Contributed equally to this paper. Available online on ScienceDirect (www.sciencedirect.com). 1044-7431/$ - see front matter © 2007 Elsevier Inc. All rights reserved. doi:10.1016/j.mcn.2007.07.003

and initial trajectories are aberrant (Polleux et al., 1998). These abnormalities are consistent with the proposed role for Sema3A in the formation of neuronal polarity, in addition to its well-established role as an axon-repellent molecule. In the peripheral nervous system, these results suggest that axon guidance errors may indicate a more complex role for Sema3A in neuronal development, possibly in polarity formation. Formation of a functional neuronal cell typically involves the formation of a polarized cell with a single axon and a variable number of dendrites. Using the hippocampal system as a model, numerous studies have demonstrated an intrinsic neuronal capacity to develop into a polarized cell (Bradke and Dotti, 2000). In this system, multiple neurites emerge simultaneously in seemingly random orientations. From these processes, one neurite then begins to elongate preferentially, initiating polarization (Dotti et al., 1988). Interestingly, it seems the emergence point of the future axon is not entirely random, and is in fact influenced by the position of the centrosome (de Anda et al., 2005). In contrast to the situation in vitro, various studies have indicated that the asymmetrical formation in vivo is not likely to be random, since the formation of asymmetrical axon and dendrite trajectories is directed toward their target (Halfter et al., 1985; Adler et al., 2006). Recent findings suggest that axon guidance molecules, such as Netrin and Slit, can regulate neuronal polarity, but the effects of extracellular signaling on neuronal polarity and the underlying mechanisms that facilitate them are not well understood (Adler et al., 2006; Higginbotham et al., 2006). One way in which guidance signaling can regulate neuronal polarity is by affecting signaling cascades involved in the formation of polarity, such as glycogen synthase kinase-3β (GSK3β and collapsin response mediator protein-2 (CRMP-2). In contrast to hippocampal neurons, DRG neurons initially develop a bipolar morphology with one branch growing toward the periphery and the other toward the spinal cord (Jackman and Fitzgerald, 2000). A few days later (at about E14–E15 in the mouse), the bases of the two processes fuse to form one pseudounipolar axon with a peripheral dendrite-like projection and a central axon-like branch (Barber and Vaughn, 1986). Although structurally very different from hippocampal neurons, DRG neurons must also develop a polarized structure in order to develop their two final,

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

functionally distinct, branches. The mechanisms regulating polarization, branch identity and guidance are not known. Sema3A is expressed in the surrounding tissue at very early stages of neural crest migration and DRG development (Wright et al., 1995; Giger et al., 1996; Osborne et al., 2005). This molecule is present when the neurons are generated and during their early stages of growth and polarization. Moreover, Sema3A is known to affect GSK3β and CRMP-2, two key regulators of neuronal polarity in hippocampal neurons (Eickholt et al., 2002; Brown et al., 2004; Uchida et al., 2005). In this study, we show that abnormal initial trajectories of DRG neurons are present in Sema3A-null mice and that in vitro Sema3A accelerates polarity formation and a branch-specific signaling cascade. Taken together, we propose that Sema3A plays a role in neuronal polarity for-

223

mation and that defects in this process in vivo contribute to guidance defects in DRG neurons. Results Abnormal initial trajectory of DRG neurons in Sema3A-null mice DRG neurons bifurcate, projecting one branch to the periphery through the ventral root and the other to the spinal cord through the dorsal root. To begin evaluating possible defects in cellular morphology, we tested the direction of the initial trajectory of individual neurons in wild-type DRG cells. We stained DRG sections with anti-neurofilament antibody and analyzed their initial trajectory using confocal microscopy (Fig. 1A). Each neuron with

Fig. 1. Initial trajectory of some DRG neurons is abnormal in Sema3A null mice. Cryosections (15 μm) from E12.5 wild-type and Sema3A null mice embryos were stained with anti-neurofilament (A, B, D). Sections were analyzed using confocal microscopy. Abnormal initial trajectory is detected in Sema3A null mice DRG neurons. Bipolar neurons with identifiable trajectories over a series of optical sections were analyzed. Using low magnification, the position of the dorsal and ventral root of each DRG was determined. Then, at higher magnification, we tested each cell trajectory with respect to the direction of the dorsal and ventral roots. (A) Examples of wild-type (left) and Sema3A null (middle and right) DRG section are shown. Empty red arrows indicate the direction of the dorsal and ventral root exits. The filled red arrow marks an abnormal DRG exit point, laterally into the precartilage primordia. Yellow arrows indicate examples of neurons with normal trajectories. Yellow arrowheads indicate examples of neurons with abnormal trajectories. Note that in the right panel orientation appears to be distorted throughout the entire lower part of the DRG, and directed toward the abnormal exit point. (B) Quantification of neurons with abnormal trajectory is shown (Sema3A null mice, n = 106 neurons, 14 sections analyzed; wild-type DRG embryos, n = 74, 13 sections). No abnormal trajectory was found in sections of wild-type DRG embryos. (C) Low magnification of DRG section with gross anatomical abnormality. Note the additional exit point (marked with green arrow head) originating in the DRG and projecting into the precartilage primordia. The white arrows mark the normal dorsal and ventral exits from the DRG (DRG borders are marked by red dots). (D) Thirty sections with clear anatomical abnormalities, identified using low power magnification, were analyzed using confocal microscopy (as in A). Quantification of neurons with abnormal trajectory is shown.

224

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

two identifiable branches was analyzed, and the trajectories of its two branches were compared to the direction of the dorsal root and the ventral root of the DRG (Fig. 1B). In wild-type embryos (15 sections, 120 cells) we found that all trajectories were oriented in the same direction as the dorsal and the ventral roots of the DRG. In contrast, the same analysis in Sema3A-null embryos (14 sections, 106 cells) showed that 26% of the neurons had abnormal trajectories. In some cases, the initial trajectory abnormality resulted in apparent guidance errors, leading to the formation of new exit points from the DRG (in addition to the dorsal and ventral roots—see example for such anatomical malformation in Fig. 1C). To test the relationship between abnormal DRG exit points and initial trajectory defects, we analyzed 30 DRG sections with abnormal lateral defects, and examined the cellular morphology of cells adjacent to the exit point (Fig. 1D). The sections were separated to three groups: no initial trajectory defects, up to two trajectory defects and three or more cells with initial trajectory defects. In 23/ 30 cases, we detected neuronal orientation defects associated with this abnormal anatomical disorganization (Fig. 1D). From this analysis, it is clear that initial trajectory defects are associated with anatomical defects, raising the intriguing possibility that axon guidance errors may be generated in part by neuronal trajectory defects. The defect in initial neuronal trajectory detected in the DRG of Sema3A-null mice is consistent with a polarity formation defect in these cells. Therefore, we decided to test whether Sema3A can affect the polarity of DRG neurons in vitro. Asymmetric p-GSK3β accumulation near the centrosome is accelerated in response to Sema3A The formation of polarized neurons is best characterized in dissociated hippocampal neurons. These neurons initially form 3–5 buds or lamellipodia (stage 1) that give rise to highly dynamic “minor neurites” within 24 h (stage 2). By 48 h, 70% of neurons have developed a clear, polarized phenotype with a single, long process (stage 3) that will become the axon (Dotti et al., 1988). As mentioned above, DRG neurons are significantly different from hippocampal neurons, and for this reason the stages of cell polarity acquisition in these neurons must be different. In vivo, the majority of mouse DRG neurons are bipolar at E12.5–E13.5, and transform slowly to become pseudounipolar by E15.5 (Barber and Vaughn, 1986). In hippocampal neurons, the formation of axons and dendrites can be monitored in vitro using tau1 (an axon marker) and MAP2 (a dendrite marker), and the axon can be recognized based on its length and the speed of its growth. In DRG neurons, all neurites are positive for both tau1 and MAP2 (data not shown), and their neurite lengths and growth rates are similar. However, since the two processes must acquire different properties in vivo, we assumed that formation of polarity is likely to occur in this system as well. Interestingly, DRG neurons in culture go through morphological changes somewhat reminiscent of the hippocampal

system (Supplementary Fig. 1). Extensive analysis of the hippocampal system resulted in the identification of signaling components that play key roles in polarity formation. We assumed that some of the components of neuronal polarity in hippocampal neurons would also be relevant to DRG polarity. The inhibition of GSK3β activity is a key step in the formation of neuronal polarity, most importantly in the establishment of one axon. One mechanism of inhibition involves inhibitory phosphorylation of GSK3β on Serine-9 (Jiang et al., 2005; Yoshimura et al., 2005). We therefore chose to study the distribution of p-GSK3β in response to Sema3A, in order to assess its role in DRG neuronal polarization. Asymmetrical distribution of signaling proteins in the perikaryon or neurite tips was reported during the polarization program of hippocampal neurons. The levels of p-GSK3β in DRG neurite tips were not significantly different (a ratio of 1.06 ± 0.106 SD, n = 91, data not shown). Interestingly, during the initial stage of the hippocampal polarization program (stage 2+ and 3), p-GSK3β is not yet accumulated specifically at the axon tip, but is enriched asymmetrically at the Golgi-centrosome region of the cells (Gartner et al., 2006). Using anti-p-GSK3β in conjunction with β-tubulin as a control, we also noticed that in some DRG neurons there is an apparent accumulation of p-GSK3β in a specific area of the perikaryon, usually next to one of the neurites (Fig. 2A). To monitor this accumulation, we established a quantitative measurement technique based on the normalized florescence intensities of p-GSK3β on opposite sides of the cell (see Experimental methods). The number of neurons with polarized p-GSK3β distribution increased over time. No polarized cells were found at the starting point, but their numbers increased to approximately 30% after 6 h in culture (Fig. 2B). Interestingly, the number of cells with polarized p-GSK3β distribution increased significantly at this time point, when Sema3A was added to the medium (Fig. 2B). The even distribution of total protein in the perikaryon (as detected by DTAF labeling), in contrast to the formation of polarized p-GSK distribution, indicates that specific molecular sorting-retention or site-specific phosphorylation, rather than polarization as a consequence of a general process (bulk transport/retention/synthesis), is the likely explanation for p-GSK accumulation. To further characterize the polarization effect of Sema3A, we determined dose–response curves for Sema3A-induced p-GSK3β polarization, using 0, 30, 60 and 240 pM of Sema3A (Fig. 2C). Sema3A induces p-GSK3β polarization in a dose-dependent manner, at concentrations similar to those used to induce the well-characterized growth cone collapse effect of this molecule (data not shown). To test whether the effects of Sema3A are likely to be specific, we tested two additional factors with documented effects on embryonic DRG neurons and a known capacity to activate the PI3K/Akt signaling pathway, namely Insulin like growth factor (IGF) and hepatocyte growth factor (HGF) (Maina et al., 1997; Leinninger et al., 2004). Both factors did not affect p-GSK3β polarization (Fig. 2D).

Fig. 2. Polarization of p-GSK3β is accelerated in the presence of Sema3A. To determine polarity, we measured the normalized florescence intensities of p-GSK3β on opposite sides of the cell (see Experimental methods). The average ratio of these measurements, in neurons below the threshold polarity value of 1.2, was 1.087 ± 0.007 S.E.M. The average ratio for cells above the threshold was 1.499 ± 0.083 S.E.M. Polarization results represent mean ± S.E.M. of three independent experiments (n ≥ 140 neurons A–D). (A) Neurons were stained with both anti β-tubulin and anti-p-GSK3β. Examples of a neuron with nonpolarized distribution of p-GSK3β (upper panel) or polarized distribution of p-GSK3β (lower panel). Scale bar 25 μm. (B) DRG neurons treated with 100 pM Sema3A (black bars). Control cultures had no Sema3A added (empty bars). The cells were stained with anti-p-GSK3β and analyzed at times 0, 0.5 h, 1.5 h and 5 h following Sema3A stimulation. (C) DRG neurons were treated with 0, 30, 60 and 240 pM Sema3A, and the number of polarized neurons was determined 5 h later. (D) DRG neurons were treated with 25 ng/ml IGF, 20 ng/ml HGF, or 100 pM Sema3A. Control cultures had no ligand added. (E) Neurons were grown for 5 h, stained for both γ-tubulin and p-GSK3β and analyzed using confocal microscopy (n = 60 neuron). A representative optical section is shown.

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

As mentioned above, in stage-2+ and stage 3 hippocampal neurons, GSK3β is asymmetrically localized at one location in the perikaryon (Gartner et al., 2006). This localization was shown to be in the Golgi region and it is involved in polarized traffic. To test whether we can detect any resemblance between the DRG and the hippocampal system with respect to the polarity program, we tested

225

whether accumulation of polarized p-GSK3β is also localized at the Golgi-centrosome region (both the centrosome and Golgi are localized at the same pole in hippocampal neurons; de Anda et al., 2005). To test this we used the centrosome marker γ-tubulin (Fig. 2E). By double staining, we found that p-GSK3β is localized at the same pole as the centrosome.

226

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

Sema3A-induced polarization of p-GSK3β in the perikaryon is preceded by the early polarization of total GSK3β Although GSK3β inhibition is a critical event in the development of neuronal polarity, Serine-9 phosphorylation is not the only mechanism regulating its activity. For instance, it has recently been shown that neuronal polarization occurs even in the absence of GSK3β phosphorylation of Serine-9 (Gartner et al., 2006). We therefore tested the localization of total GSK3β in DRG neurons (Fig. 3A). As with p-GSK3β, we detected similar levels of this protein in all neurites (data not shown), but in some neurons the antibody recognized an accumulation of GSK3β in one pole of the perikaryon. To test for dynamic changes in the distribution of this molecule, we monitored total GSK3β distribution patterns at 0.5, 1.5 and 5 h after treatment (with or without the addition of Sema3A), and found that Sema3A induces GSK3β accumulation at one pole of the soma as early as 0.5 h after its introduction to the culture (Fig. 3B). From these results, it is apparent that GSK3β accumulation at one pole of the soma is an earlier event than p-GSK3β accumulation. It should be noted that, at early time points, cells with polar GSK3β distribution exhibit a slight trend of p-GSK3β polarization (Fig. 3E). However, when quantified, this trend was shown to be below the polarity threshold as determined by discriminate analysis, never exceeding a 1.17 ratio (see Experimental methods). To test whether the effects of Sema3A on GSK3β are likely to be specific we tested IGF and HGF. Both factors were unable to affect GSK3β polarization, indicating that Sema3A effects on polarization are likely to represent a specific response (Fig. 3C). Sema3A has been shown to activate GSK3β in the breast cancer cell line MDA-MB 231, as well as in cultured E7 chick embryonic DRG growth cones (Eickholt et al., 2002). In light of these findings, we tested whether Sema3A also affects the protein levels of GSK3β in sensory neurons shortly after plating (Fig. 3D). We found that Sema3A has no effect on the protein levels of pGSK3β or total GSK3β, indicating that, at this developmental stage (up to 6 h post-plating), Sema3A only affects the localization of this protein. To test whether p-GSK3β and GSK3β are co-localized at the same pole of the soma, we double-stained both proteins. From this experiment, it is clear both proteins are enriched at the same pole (Fig. 3E).

Inhibition of Sema3A signaling blocks induction of GSK3β neuronal polarity Green tea component (−)-epigallocatechin gallate (EGCG) has been shown to be a strong inhibitor of Sema3A repulsion activity (Terman et al., 2002). We used this inhibitor to test whether blocking Sema3A signaling would inhibit polarization of p-GSK3β

or GSK3β itself (Fig. 4). EGCG at a concentration of 10 μM was sufficient to block the polarity of p-GSK3β (Fig. 4A) and GSK3β (Fig. 4B). Using Western blots, we found that EGCG had no effect on GSK or p-GSK protein levels (data not shown). Sema3A induces Rac1 polarization to one neurite In hippocampal neurons, the polarization of GSK3β in the perikaryon is involved in regulation of polarized traffic to the axon. This type of polarized traffic is likely responsible for neuritespecific localization of signaling molecules, as was recently shown with Ras, which localizes to the neurite destined to become the future axon (Oinuma et al., 2007). Ras is a member of the Rho family small GTPase, which is part of the positive feedback loop involved in neuronal polarization (Yoshimura et al., 2006). Other small GTPase family members are involved in neuronal polarity. One such molecule is Rac1 (Nishimura et al., 2005; WatabeUchida et al., 2006). Rac1 is known to be involved in Sema3A signaling in DRG neurons (Jin and Strittmatter, 1997; Vastrik et al., 1999). Because of this connection between Rac1, neuronal polarity and Sema3A activity, we chose to test the possibility of neuritespecific localization of Rac1 in our system, and the effects of Sema3A on its localization (Fig. 5). Thirty minutes after Sema3A stimulation, Rac1 staining is barely detectible (data not shown). At 1.5 h (2.5 h after plating), Rac1 staining is stronger, and in the majority of non-treated cells distributed symmetrically. However, 40% of the neurons in control cultures had only one neurite containing Rac1 (Fig. 5A). At this same time point, in cultures stimulated with Sema3A, Rac1 was detected in only one neurite in 66% of the neurons (Fig. 5B). This difference is highly significant ( p b 10− 4, as determined by a Pearson Chi-square test). By 5 h after treatment, all neurons (treated and untreated) exhibited polarized Rac1 distribution, while after 22 h in culture Rac1 was evenly distributed in all neurons. In addition to its localization to one neurite, the distribution of Rac1 was also polarized in the perikaryon adjacent to this neurite. In addition, the pole containing concentrated Rac1 was also found to contain the centrosome (as determined by co-staining with γ-tubulin, data not shown). We therefore concluded that both Rac1 and GSK3β are localized at the same pole of the neuron. To test whether Sema3A signaling mediates Rac1 polarity, we examined the effect of EGCG on this process. As shown in Fig. 5C, only 25% of neurons grown for 1.5 h with or without Sema3A in the presence of EGCG are polarized, indicating that Sema3A is an important signaling molecule with regard to the accelerated polarization of DRG neurons in culture. Sema3A increases the polarization of activated MAPK 42/44 How can Sema3A regulate GSK3β polarization? Since PI3KAkt signaling is involved in the regulation of GSK3β in

Fig. 3. Sema3A accelerates polarization of total GSK3β in DRG neurons. To determine polarity, we measured the normalized florescence intensities of GSK3β on opposite sides of the cell (see Experimental methods). The average ratio of these measurements, in neurons below the threshold polarity value of 1.2, was 1.073 ± 0.015 S.E.M. The average ratio for cells above the threshold was 1.494 ± 0.014 S.E.M. Polarization results represent mean ± S.E.M. of three independent experiments (n ≥ 140 neurons, A–D). (A) Neurons were stained with both anti β-tubulin and anti-GSK3β. Example of a neuron with non-polarized distribution of p-GSK3β (upper panel) or with polarized distribution of GSK3β (lower panel). Scale bar 25 μm. (B) DRG neurons treated with 100 pM Sema3A (black bars). Control cultures had no Sema3A added (empty bars). The cells were stained with anti-GSK3β and analyzed at times 0, 0.5 h, 1.5 h and 5 h following Sema3A stimulation. (C) DRG neurons were treated with 25 ng/ml IGF, 20 ng/ml HGF or 100 pM Sema3A. Control cultures had no ligand added. (D) Sema3A has no effect on GSK3β or p-GSK3β protein levels. Neurons were grown and treated as in A. Protein was extracted and tested by Western blot for GSK3β, p-GSK3β and actin levels at the indicated time points. (E) Co-localization of p-GSK3β and GSK3β. Neurons were grown for 1.5 h, or 5 h, fixed and stained with antip-GSK3β and anti-GSK3β antibodies (n = 60 neuron). Note that the two proteins are localized at the same pole of the cell.

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

hippocampal neurons, we tested distribution of p-Akt and Akt in our system (Fig. 6B, Supplementary Fig. 2). Since GSK3β polarization is detected at 1.5 h after Sema3A stimulation, we examined Akt distribution at 0.5 and 1.5 h following Sema3A

227

treatment. We observed no polarization of the total Akt distribution (Supplementary Fig. 2) or activated Akt in DRG neurons (Fig. 6B). Since some recent studies have reported a link between GSK3β and MAPK (Hetman et al., 2002; Goold and Gordon-Weeks,

228

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

levels of MAPK and p-MAPK by Western blotting (Fig. 6E). Our results show that Sema3A has no effect on MAPK activation, suggesting the involvement of another signaling molecule, possibly NGF, which is responsible for its activation. Our experiments indicate that both GSK3β and p-MAPK are polarized in DRG neurons in response to Sema3A. We next tested whether these two molecules are localized at the same, or opposite, poles of the neuron. Using double staining for p-MAPK and GSK3β, we found that both molecules localize at the same side of the cell (data not shown). Therefore Rac1, GSK3β, p-GSK3β and p-MAPK are all localized at the Golgi-centrosome region of the neuron. MAPK 42/44 activation is necessary for Sema3A-induced localization of Rac1 and GSK3β

Fig. 4. Sema3A inhibitor blocks Sema3A-iduced GSK3β polarization. EGCG (10 μM) was added 30 min after plating. Sema3A (100 pM) was added at time = 0 (black bars). Control cultures had no Sema3A added (empty bars). The cells were grown for an additional period of 5 h, fixed and stained with anti-p-GSK3β (A) or anti-GSK3β(B), and analyzed for polarized distribution. Polarization results represent mean ± S.E.M. of three independent experiments (n ≥ 140 neurons).

2005), we also tested the localization of this protein in DRG neurons. MAPK 42/44 is not distributed in a polarized manner in DRG neurons (Supplementary Fig. 2). However, as early as time zero, about 30% of neurons were polarized with regard to activated MAPK (p-MAPK). Following 0.5 h in culture, about 40% of neurons were polarized. Incubation with Sema3A increased the amount of polarized neurons to about 55% of the total neurons (examples of polar and non-polar neurons are shown in Fig. 6A, and quantification is shown in Fig. 6C). This difference is statistically significant ( p = 0.0013, as determined by a Pearson Chi-square test). Following 1.5 h in culture, about 45% of untreated neurons were polarized, and 70% of Sema3A-treated neurons were polarized. By 5 h after treatment, the level of polarized neurons decreased to about 40% of treated, as well as untreated, neurons. To test whether the effect of Sema3A is likely to be specific, we tested IGF and HGF. Both factors were unable to affect p-MAPK polarization indicating that Sema3A effects on polarization are likely to represent specific response (Fig. 6D). To test whether Sema3A affects the level of MAPK activation, in addition to its effects on localization, we evaluated the total

Since the polarization of activated MAPK 42/44 is a relatively early event in the polarization of DRG neurons, we wondered whether its activity could be important for Sema3A-iduced GSK3β or Rac1 polarization. To test this, we used U0126, a selective and highly potent inhibitor of mitogen-activated protein kinases 1 and 2 (also known as MEK1 and MEK2), the immediate upstream activators of MAPK 42/44. We first tested the effect of this inhibitor on p-GSK3β polarization (Fig. 7A). The MEK inhibitor reduced Sema3A-induced polarization of p-GSK3β to about 25% of the neurons, which is less than the level observed in the untreated control. As another control, we tested whether inhibition of one of the other major MAPK pathways (p38 and JNK) would have any effect on neuronal polarization. To accomplish this we used the JNK inhibitor SP600125 and the p38 inhibitor SB203580. Neither inhibitor affected Sema3A-induced p-GSK3β polarization in DRG neurons. We then tested whether U0126 also blocks Sema3A-induced polarization of total GSK3β protein (Fig. 7B). As expected, the MEK inhibitor blocked Sema3A-induced total GSK3β polarization. Finally, we tested the effect of the MEK inhibitor on Rac1 polarization (Fig. 7C). Again, we observed a significant block in Sema3A-induced localization of Rac1. Taken together, these results indicate that the Sema3A-dependent localization effect is mediated via the localized activity of MAPK 42/44. Discussion Our results indicate that in Sema3A null mice some of the neurons project processes on an abnormal initial trajectory. We suggest that this phenotype is consistent with polarity defects, a possibility that is corroborated by our finding that Sema3A accelerates the formation of DRG neuron polarity in vitro. Sema3A stimulation increases the number of neurons with an asymmetrical distribution of activated MAPK, and the subsequent asymmetry of GSK3β and Rac1, at the same pole as the centrosome. Neuronal polarity in DRG neurons Formation of neuronal polarity, one of the earliest steps in neuronal differentiation, is best characterized in hippocampal neurons. In culture, neurons follow an intrinsic program leading to neuronal polarity (Arimura and Kaibuchi, 2005). Although DRG neurons are very different from hippocampal neurons in terms of their developmental program, morphology and function, we assumed these cells must also undergo polarization. Moreover,

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

229

Fig. 5. Rac1 polarization is accelerated in response to Sema3A. Neurons were analyzed for Rac1 polarized distribution at the indicated time points. The cells were stained with anti-Rac1 antibody. (A) An example of polarized distribution is shown. Note the specific staining of Rac1 only in one branch and the one pole of the neuron that is close to the positive branch (arrows indicate position of all neurites). This picture was generated using confocal microscopy. A representative optical section is shown. (B) Quantitative analysis of Rac1 polarization following stimulation with Sema3A. The results represents mean ± S.E.M. of three independent experiments (n = 150 neurons, ⁎p b 10− 4). (C) Sema3A inhibitor blocks Sema3A-induced Rac1 polarization. Neurons were treated with EGCG (10 μM) as in Fig. 4. The neurons were grown for an additional period of 1.5 h after Sema3A (black bars), or control (empty bars), and stained with anti-Rac1 antibody (data presented in both B and C were generated by the same experiment and therefore share the same controls, n ≥ 140 neurons).

some of the signaling molecules involved in polarization might be shared by both systems. Two major signaling cascades are implicated in hippocampal neuronal polarity (Yoshimura et al., 2006). One cascade is the phosphoinositide-3 kinase (PI3K), Akt, GSK3β, CRMP-2, and the other involves cdc42 signaling to Rac1 via the Par3/Par6/atypical protein kinase C (aPKC) polarity complex (Banker, 2003; Arimura et al., 2004; Schwamborn and Puschel, 2004; Jiang et al., 2005; Nishimura et al., 2005; Watabe-Uchida et al., 2006). Here we show evidence of the involvement of representatives of these two pathways in DRG neuronal polarity as well. First, we find GSK3β polarization in DRG neurons. GSK3β localization in the perikaryon is at the same pole as the centrosome, similar to the localization of this protein in stage 2+ and stage 3 hippocampal neurons, where it was shown to regulate polarized transport into the future axon (Gartner et al., 2006). We also found polarized distribution of Rac1 in DRG neurons in the early stages of development. Since in hippocampal neurons Rac1 is involved in axon specification (stage 3), it is tempting to speculate that Rac1-specific localization is part of the differentiation of this branch to an axon-like process. However, since in DRG neurons both the axon-like and dendrite-like processes grow significant distances (in contrast to hippocampal neurons,

where the axon is notably longer than the dendrites; Dotti et al., 1988), the difference between axon and dendrite is expected to be less significant than in hippocampal neurons. Indeed, later stages of neuronal polarization differ in DRG and hippocampal neurons. For instance, we observed an accumulation of GSK3β in all branches, and not just in one neurite (the future axon), as reported in hippocampal neurons. Moreover, accepted dendrite (MAP2) and axon (Tau1) markers are not useful in differentiating between the two branches of the DRG neuron since they seem to recognize both branches (data not shown).

Sema3A-treatment accelerates polarization of DRG neurons in vitro In this study, we find that the addition of Sema3A onto freshly plated DRG neurons accelerates the accumulation of activated MAPK, but not total MAPK, at the same pole of the perikaryon as the centrosome-Golgi, and that this effect is blocked by a Sema3A inhibitor. This effect is specific as demonstrated by the inability of IGF and HGF to elicit a similar acceleration of the polarity program. However, another signaling molecule is likely to activate

230

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

Fig. 6. Polarized distribution of activated MAPK is accelerated by Sema3A. To determine polarity, we measured the normalized florescence intensities of pMAPK 42/44 on opposite sides of the cell (see Experimental methods). The average ratio of these measurements, in neurons below the threshold polarity value of 1.2, was 1.072 ± 0.005 S.E.M. The average ratio for cells above this threshold was 1.563 ± 0.052 S.E.M. (A, B) Neurons were stained with both anti β-tubulin and anti-p-MAPK 42/44 (A) or anti β-tubulin and anti-p-Akt (B). Example of a neuron with non-polarized distribution of p-MAPK 42/44 (A, upper panel) or polarized distribution of p-MAPK 42/44 (A, lower panel). Only p-MAPK appears polarized in these cells. Scale bar: 25 μm. (C) Quantitative analysis of polarized p-MAPK 42/44 at time 0, 0.5 h, 1.5 h and 5 h following Sema3A stimulation. The cells were stained with anti-p-MAPK 42/44 antibody and DTAF. The result represents mean ± S.E.M. of three independent experiments (n = 155, ⁎p = 0.0013). (D) DRG neurons were treated with 25 ng/ml IGF, 20 ng/ml HGF or 100 pM Sema3A. Control cultures had no ligand added. (E) No change is detected in the protein levels of activated MAPK following Sema3A stimulation. DRG neurons were grown and treated as in Fig. 6C. Protein was extracted and tested using Western blot for p-Akt, p-MAPK 42/44 and actin levels at the indicated time points.

MAPK since the addition of Sema3A has no effect on the total levels of MAPK activation. The most likely candidate that might lead to the activation of MAPK in this system is NGF, which is present in our culture and necessary for DRG neuron survival.

Following localization of activated MAPK, it seems that GSK3β is recruited to one pole, where it co-localizes with the centrosome, and Rac1 is recruited to the same pole and to the adjacent neurite branch. Since an inhibitor of the MAPK pathway

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

blocks the localization of both proteins, it seems that localized MAPK signaling is needed in order for this to occur. Inhibition of MAPK results in the distribution of Rac1 to all branches, suggesting

231

that MAPK activity can either block synthesis or transport of Rac1 to other parts of the cell, or somehow induce specific transport to one region of the neuron. GSK3β inhibition is a critical event in the development of neuronal polarity. One mechanism by which GSK3β is inhibited is Serine-9 phosphorylation. However, this is not the only mechanism regulating its activity since it has recently been shown that neuronal polarization occurs even in the absence of Serine-9 GSK3β phosphorylation (Gartner et al., 2006). In our system, GSK3β is localized to one pole in the majority of neurons as early as 30 min following Sema3A stimulation. Interestingly, p-GSK3β (Serine-9) polar accumulation occurs only 5 h following Sema3A stimulation. Although it is apparent that p-GSK3β begins to accumulate in a polar manner at 1.5 h, the ratio between the two poles at this time is well below the threshold levels we determined. Since we do not detect major changes in the levels of p-GSK3β/ total GSK3β using Western blot, it is possible that p-GSK3β from other parts of the neuron is trafficked in an asymmetrical manner and accumulates in the same location in the perikaryon. Axon guidance and neuronal polarity

Fig. 7. MAPK activity is necessary for Sema3A-induced localization of GSK3β and Rac1. Neurons were grown with the MEK inhibitor U0126 (10 μM), the p38 inhibitor SB203580 (10 μM), the JNK inhibitor SP600125 (5 μM) or untreated culture, in the presence (black bars) or absence (empty bars) of Sema3A (100 pM). The cells were grown for an additional period of 5 h (A, B) or 1.5 h (C), fixed and stained with anti-p-GSK3β (A), anti-GSK3β (B) or anti-Rac1 (C), and analyzed for polarized distribution. The results represent mean ± S.E.M. of three independent experiments, n ≥ 140 neurons.

Although an intrinsic program seems to be responsible for neuronal polarity, recent evidence suggests that this program is also regulated in vivo by extracellular signals (Adler et al., 2006; Higginbotham et al., 2006; Sosa et al., 2006; Yoshimura et al., 2006; Zolessi et al., 2006). A few studies of axonogenesis in vivo suggest that neurons usually extend their first stable process on the exact trajectory that will eventually be taken by the axon. For instance, developing avian retinal ganglion cells project their axons directly toward the optic nerve, with a marked trajectory even before the growth cone forms (Halfter et al., 1985). Such observations suggest that guidance information might direct the earliest stage of neuronal asymmetry formation. Indeed, a few recent studies suggest that guidance molecules can regulate neuronal polarity. For example, in C. elegans, UNC-6/Netrin induces neuronal asymmetry and defines the site of axon formation (Adler et al., 2006). Another example is found in the primary olfactory bulb, where Slit-mediated signaling is able to reorient the centrosome, followed by nuclear translocation in the reverse direction (Higginbotham et al., 2006). How would polarity defects manifest with regard to neuronal phenotype? One likely phenotype would be the perturbation of the initial trajectory of the axon or dendrite tree. Indeed, we find that in wild-type DRG neurons the initial trajectory of one branch is directed toward the dorsal root exit point of the DRG, and the initial trajectory of the other branch is directed toward the ventral root exit point. In marked contrast, some neurons in Sema3A null mice exhibit a disoriented initial trajectory. This abnormal initial trajectory is likely a result of a defect in the polarity program, partly randomizing the direction of polarization. Consistent with our findings, Sema3A has been shown to regulate the initial trajectory of cortical axons and their apical dendrites (Polleux et al., 1998; Behar et al., 1996; Polleux et al., 2000). Interestingly, although their initial trajectory is aberrant, the axons eventually reach the white matter in many instances, according to their normal path (Polleux et al., 1998). In light of our finding that Sema3A affects DRG polarity, it seems that the role of Sema3A in the cortical system could be related to the regulation of neuronal polarity. Sema3A is an important guidance molecule for DRG neurons in vitro and in vivo. Can polarity defects give rise to axon guidance errors? In the DRG, for instance, one branch is required to grow ventrally, reach the periphery and eventually function as a

232

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

dendrite-like structure, while the other projection needs to form the dorsal branch, enter the spinal cord and eventually develop axonlike properties. Problems in polarity formation will result in initial trajectory defects, which will lead to abnormal directional growth. In this case the likelihood that axons will stray from their normal pathway and exit the DRG through abnormal exit points is increased. Indeed we see a correlation between the presence of neurons with abnormal initial trajectories and the adjacent formation of abnormal DRG lateral exit points.

Neuronal culture

Experimental methods

Immunohistochemistry

Materials

E13 DRG neurons were fixed in 4% paraformaldehyde and 10% sucrose. Cells were incubated overnight at 4 °C with primary antibodies. All antibodies were diluted in PBS containing 5% serum and 0.1% Triton X-100. The cells were washed the following day and incubated with Cy3-, Cy2- and Cy5-conjugated antibodies (Jackson Immunoresearch Laboratories, Jackson, PA, USA) for double-staining experiments and processed for visualization using standard protocols.

NGF was obtained from Sigma (St. Louis, MO, USA). HGF and IGF were obtained from CytoLab Ltd. (Rechovot, Israel). Protease inhibitor cocktail was obtained from Roche Diagnostics (Mannheim, Germany), Matrigel from BD Biosciences (Franklin Lakes, NJ, USA) and rhodamine phalloidin and Opti-MEM from Invitrogen (Carlsbad, CA, USA). Tissue culture reagents were purchased from Biological Industries (Kibbutz Beit Haemek, Israel). All other reagents were purchased from Sigma (St. Louis, MO, USA). Antibodies p-GSK3β (Ser9 phosphorylation), GSK3β, MAPK 42/44, pMAPK 42/44 (Threonine 202 and Tyrosine 202 of human MAP kinase) and p-Akt (Ser473) were purchased from Cell Signaling Technology (Danvers, MA, USA). Anti-γ-tubulin was purchased from Sigma (St. Louis, MO, USA), anti-Rac1 was purchased from BD Biosciences (San Jose, CA, USA), and anti β-tubulin E-7 (developed by Michael Klymkowsky) and Anti-neurofilament 3A10 (developed by Thomas M. Jesell and Jane Dodd) were obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by the University of Iowa, Department of Biological Sciences, Iowa City, IA, USA. Secondary antibodies were obtained from Jackson Immunoresearch Laboratories, Inc. (Jackson, PA, USA).

E13.5 DRG neurons were dissociated and grown in the presence of 10 ng/ml NGF, as previously described (Ben-Zvi et al., 2006). Sema3A was added 1 h after plating (defined as t = 0). Inhibitors were added 30 min before the addition of Sema3A (30 minutes after plating). Each experiment included three wells for each treatment and experiments were repeated at least three times on separate days.

Microscopy Confocal microscopy Staining was analyzed using a laser-scanning confocal microscope (Olympus IX70). Images were collected through a 100× oil objective (NA 1.4) at room temperature using confocal acquisition software (Fluoview, Olympus, Hamburg, Germany). The interval between imaged optical sections was 0.2–0.3 μm. Fluorescent microscopy Unless otherwise indicated, all pictures presented were taken using Olympus BX51, 100×, NA1.3. Sema3A and control Partially purified Sema3A was made and tested as previously described (Ben-Zvi et al., 2006).

Inhibitors

Western blot analysis

Green tea component (−)-epigallocatechin gallate (EGCG), MEK1/2 inhibitor U0126 and the PI3K inhibitor LY294002 were purchased from Sigma (St. Louis, MO, USA). The p38 inhibitor SB203580 was purchased from A.G. Scientific (San Diego, CA, USA). The JNK inhibitor II SP600125 was purchased from EMD Biosciences (San Diego, CA, USA).

DRG cultures were harvested in lysis buffer (1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 150 mM NaCl, 10 mM buffered phosphate, pH 7.2, 2 mM EDTA, 50 mM NaF, 0.2 mM orthovanadate and protease inhibitor cocktail). Cells were collected with a cell scraper, passed six times through a pipette tip, vortexed and incubated on ice for 15 min. The lysates were then centrifuged at 20,000×g for 15 min and pellets were discarded. The protein concentration of each sample was determined using Bradford Reagent (Sigma, St. Louis, MO, USA). Samples containing 20 mg protein were boiled in 1× SDS sample buffer, separated by SDS10% polyacrylamide gel electrophoresis (PAGE) and blotted onto PVDF membranes (Millipore Billerica, MA, USA). The membranes were incubated in 5% fat-free milk and TBST (10 mM Tris–HCl, pH 7.4, 150 mM NaCl, 0.1% Tween 20) for 1 h and then in 5% BSA and TBST containing various dilutions of primary antibodies for 18 h at 4 °C. The membranes were washed three times with TBST for 5 min before and after each incubation with secondary antibody. The proteins were detected with an appropriate secondary antibody (1 h; RT) coupled to horseradish peroxidase-conjugated goat anti-rabbit or anti-mouse antibody and

Animals ICR mice were obtained from Harlan Laboratories (Rehovot, Israel). Pregnant mice were obtained following overnight mating (day of vaginal plug is defined as embryonic day 0.5). We used E12.5 and E13.5 embryos in our study. Sema3A-null mice have been described previously (Behar et al., 1996). Sema3A embryos were genotyped using the following PCR primers: 5′ TGATGGCGAAAAGACTGTGT, 5′ CACACGCACAGAGGAATC and 5′ ACCAAATTAAGGGCCAGCTC. Animal handling adhered strictly to national and institutional guidelines for animal research and received the approval of the ethics committee of our institution.

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

visualized by chemiluminescence according to the manufacturer's instructions (Pierce, West Pico, CA, USA). Quantification of neuronal polarity Neuronal polarity was tested with regard to the neurite tips and Perikaryon. Quantification method is based on double labeling with 0.0002% DTAF (to stain total proteins) and anti-p-GSK, antip-GSK, anti-p-MAPK, anti-MAPK or anti-p-Akt. To determine polarization in the Perikaryon, we measured a small and constant area starting at the axon hillock in both sides of the cell. The normalized florescence intensity for each molecule tested taken from one side of the cell and then divided by the opposite side of the same cell. A result above a ratio of 1.2 was defined as polar. This threshold was defined using discriminate analysis of polar and non-polar cells. Correct classification (83% or higher) and Cohen's Kappa (0.6554 or higher) were determined in three test cases (GSK3β, p-GSK3β, p-MAPK 42/44) with p-values b 0.0001. Intensity in neurite tips was tested using the same principles. Statistical analysis The significance levels for all experiments were determined using the Pearson Chi-square test. We used the actual number of cells (polar and non-polar), from three individual experiments for our analyses (performed using StatXact, Cytel Software Corporation, Cambridge, MA, USA). In all cases, the presented p-value was calculated using the chi-square test for combined probabilities. Acknowledgments We are grateful to Dr. Norman Grover (Department of Experimental Medicine, the Hebrew University) for helpful advice regarding the statistical analyses. This work was supported by a grant from the Israel Science Foundation (grant number 573/04). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.mcn.2007.07.003. References Adler, C.E., Fetter, R.D., Bargmann, C.I., 2006. UNC-6/Netrin induces neuronal asymmetry and defines the site of axon formation. Nat. Neurosci. 9, 511–518. Arimura, N., Kaibuchi, K., 2005. Key regulators in neuronal polarity. Neuron 48, 881–884. Arimura, N., Menager, C., Fukata, Y., Kaibuchi, K., 2004. Role of CRMP-2 in neuronal polarity. J. Neurobiol. 58, 34–47. Banker, G., 2003. Pars, PI 3-kinase, and the establishment of neuronal polarity. Cell 112, 4–5. Barber, R.P., Vaughn, J.E., 1986. Differentiation of dorsal root ganglion cells with processes in their synaptic target zone of embryonic mouse spinal cord: a retrograde tracer study. J. Neurocytol. 15, 207–218. Behar, O., Golden, J.A., Mashimo, H., Schoen, F.J., Fishman, M.C., 1996. Semaphorin III is needed for normal patterning and growth of nerves, bones and heart. Nature 383, 525–528. Ben-Zvi, A., Yagil, Z., Hagalili, Y., Klein, H., Lerman, O., Behar, O., 2006. Semaphorin 3A and neurotrophins: a balance between apoptosis and survival signaling in embryonic DRG neurons. J. Neurochem. 96, 585–597.

233

Bradke, F., Dotti, C.G., 2000. Establishment of neuronal polarity: lessons from cultured hippocampal neurons. Curr. Opin. Neurobiol. 10, 574–581. Brown, M., Jacobs, T., Eickholt, B., Ferrari, G., Teo, M., Monfries, C., Qi, R.Z., Leung, T., Lim, L., Hall, C., 2004. Alpha2-chimaerin, cyclin-dependent kinase 5/p35, and its target collapsin response mediator protein-2 are essential components in semaphorin 3A-induced growth-cone collapse. J. Neurosci. 24, 8994–9004. de Anda, F.C., Pollarolo, G., Da Silva, J.S., Camoletto, P.G., Feiguin, F., Dotti, C.G., 2005. Centrosome localization determines neuronal polarity. Nature 436, 704–708. Dotti, C.G., Sullivan, C.A., Banker, G.A., 1988. The establishment of polarity by hippocampal neurons in culture. J. Neurosci. 8, 1454–1468. Eickholt, B.J., Walsh, F.S., Doherty, P., 2002. An inactive pool of GSK-3 at the leading edge of growth cones is implicated in Semaphorin 3A signaling. J. Cell Biol. 157, 211–217. Gartner, A., Huang, X., Hall, A., 2006. Neuronal polarity is regulated by glycogen synthase kinase-3 (GSK-3beta) independently of Akt/PKB serine phosphorylation. J. Cell Sci. 119, 3927–3934. Giger, R.J., Wolfer, D.P., De Wit, G.M., Verhaagen, J., 1996. Anatomy of rat semaphorin III/collapsin-1 mRNA expression and relationship to developing nerve tracts during neuroembryogenesis. J. Comp. Neurol. 375, 378–392. Goold, R.G., Gordon-Weeks, PR., 2005. The MAP kinase pathway is upstream of the activation of GSK3beta that enables it to phosphorylate MAP1B and contributes to the stimulation of axon growth. Mol. Cell. Neurosci. 28, 524–534. Halfter, W., Deiss, S., Schwarz, U., 1985. The formation of the axonal pattern in the embryonic avian retina. J. Comp. Neurol. 232, 466–480. Hetman, M., Hsuan, S.L., Habas, A., Higgins, M.J., Xia, Z., 2002. ERK1/2 antagonizes glycogen synthase kinase-3beta-induced apoptosis in cortical neurons. J. Biol. Chem. 277, 49577–49584. Higginbotham, H., Tanaka, T., Brinkman, B.C., Gleeson, J.G., 2006. GSK3beta and PKCzeta function in centrosome localization and process stabilization during Slit-mediated neuronal repolarization. Mol. Cell. Neurosci. 32, 118–132. Jackman, A., Fitzgerald, M., 2000. Development of peripheral hindlimb and central spinal cord innervation by subpopulations of dorsal root ganglion cells in the embryonic rat. J. Comp. Neurol. 418, 281–298. Jiang, H., Guo, W., Liang, X., Rao, Y., 2005. Both the establishment and the maintenance of neuronal polarity require active mechanisms: critical roles of GSK-3beta and its upstream regulators. Cell 120, 123–135. Jin, Z., Strittmatter, S.M., 1997. Rac1 mediates collapsin-1-induced growth cone collapse. J. Neurosci. 17, 6256–6263. Leinninger, G.M., Backus, C., Uhler, M.D., Lentz, S.I., Feldman, E.L., 2004. Phosphatidylinositol 3-kinase and Akt effectors mediate insulinlike growth factor-I neuroprotection in dorsal root ganglia neurons. FASEB J. 18, 1544–1546. Maina, F., Hilton, M.C., Ponzetto, C., Davies, A.M., Klein, R., 1997. Met receptor signaling is required for sensory nerve development and HGF promotes axonal growth and survival of sensory neurons. Genes Dev. 11, 3341–3350. Nakamura, F., Kalb, R.G., Strittmatter, S.M., 2000. Molecular basis of semaphorin-mediated axon guidance. J. Neurobiol. 44, 219–229. Nishimura, T., Yamaguchi, T., Kato, K., Yoshizawa, M., Nabeshima, Y., Ohno, S., Hoshino, M., Kaibuchi, K., 2005. PAR-6-PAR-3 mediates Cdc42-induced Rac activation through the Rac GEFs STEF/Tiam1. Nat. Cell Biol. 7, 270–277. Oinuma, I., Katoh, H., Negishi, M., 2007. R-Ras controls axon specification upstream of glycogen synthase kinase-3beta through integrin-linked kinase. J. Biol. Chem. 282, 303–318. Osborne, N.J., Begbie, J., Chilton, J.K., Schmidt, H., Eickholt, B.J., 2005. Semaphorin/neuropilin signaling influences the positioning of migratory neural crest cells within the hindbrain region of the chick. Dev. Dyn. 232, 939–949.

234

O. Lerman et al. / Mol. Cell. Neurosci. 36 (2007) 222–234

Polleux, F., Giger, R.J., Ginty, D.D., Kolodkin, A.L., Ghosh, A., 1998. Patterning of cortical efferent projections by semaphorin–neuropilin interactions. Science 282, 1904–1906. Polleux, F., Morrow, T., Ghosh, A., 2000. Semaphorin 3A is a chemoattractant for cortical apical dendrites. Nature 404, 567–573. Schwamborn, J.C., Puschel, A.W., 2004. The sequential activity of the GTPases Rap1B and Cdc42 determines neuronal polarity. Nat. Neurosci. 7, 923–929. Sosa, L., Dupraz, S., Laurino, L., Bollati, F., Bisbal, M., Caceres, A., Pfenninger, K.H., Quiroga, S., 2006. IGF-1 receptor is essential for the establishment of hippocampal neuronal polarity. Nat. Neurosci. 9, 993–995. Terman, J.R., Mao, T., Pasterkamp, R.J., Yu, H.H., Kolodkin, A.L., 2002. MICALs, a family of conserved flavoprotein oxidoreductases, function in plexin-mediated axonal repulsion. Cell 109, 887–900. Uchida, Y., Ohshima, T., Sasaki, Y., Suzuki, H., Yanai, S., Yamashita, N., Nakamura, F., Takei, K., Ihara, Y., Mikoshiba, K., Kolattukudy, P., Honnorat, J., Goshima, Y., 2005. Semaphorin3A signalling is mediated via sequential Cdk5 and GSK3beta phosphorylation of CRMP2: implication of common phosphorylating mechanism un-

derlying axon guidance and Alzheimer's disease. Genes Cells 10, 165–179. Vastrik, I., Eickholt, B.J., Walsh, F.S., Ridley, A., Doherty, P., 1999. Sema3A-induced growth-cone collapse is mediated by Rac1 amino acids 17–32. Curr. Biol. 9, 991–998. Watabe-Uchida, M., John, K.A., Janas, J.A., Newey, S.E., Van Aelst, L., 2006. The Rac activator DOCK7 regulates neuronal polarity through local phosphorylation of stathmin/Op18. Neuron 51, 727–739. Wright, D.E., White, F.A., Gerfen, R.W., Silos-Santiago, I., Snider, W.D., 1995. The guidance molecule semaphorin III is expressed in regions of spinal cord and periphery avoided by growing sensory axons. J. Comp. Neurol. 361, 321–333. Yoshimura, T., Arimura, N., Kaibuchi, K., 2006. Signaling networks in neuronal polarization. J. Neurosci. 26, 10626–10630. Yoshimura, T., Kawano, Y., Arimura, N., Kawabata, S., Kikuchi, A., Kaibuchi, K., 2005. GSK-3beta regulates phosphorylation of CRMP-2 and neuronal polarity. Cell 120, 137–149. Zolessi, F.R., Poggi, L., Wilkinson, C.J., Chien, C.B., Harris, W.A., 2006. Polarization and orientation of retinal ganglion cells in vivo. Neural. Develop. 1, 2.