Senescence in Podospora anserina: a possible role for nucleic acid interacting proteins suggested by the sequence analysis of a mitochondrial DNA region specifically amplified in senescent cultures

Gene, 74 (1988) 387-398 Elsevier

387

GEN 02765

Senescence in Podospora anserina: a possible role for nucleic acid interacting proteins suggested by the sequence analysis of a mitocbondrial DNA region specifically amplified in senescent cultures (Recombinant DNA; intronic open reading frame; recombinant sites; class I introns)

Corinne Viemy-Jamet Centre de GtStique Molkculaire, Centre National de la Recherche Scienttifique91190, Gif sur Yvette (France) Received 5 April 1988 Accepted 7 July 1988 Received by publisher 16 September 1988

SUMMARY

In Podospora anserina, the phenomenon of senescence was previously shown to be correlated with the presence of a senescence-specific DNA (sen-DNA) resulting from the amplification of some regions (a, /?, ‘y, E) of the mitochondrial chromosome. The #?region gives rise to sen-DNAs with variable sizes and junctions which share a llOO-bp common sequence. Here we report the complete nucleotide sequence of one 4-kb fi sen-DNA. Included in the sequence are a large part of the first intron open reading frame (ORF) of the gene ND4L and three short unidentified ORFs more precisely located in the common firegion. The primary structure of the polypeptide possibly encoded by one of them is very similar to the glycine-rich domains present in various single-stranded DNA-binding proteins. The comparison of the information content of this p sen-DNA with that of other previously sequenced sen-DNAs suggests that the role in the senescence process attributed to the sen-DNAs could be related to the overproduction of a variety of proteins which interact with nucleic acids.

INTRODUCTION

In the ascomycete fungus Podospora amerina, the correlation between vegetative death (or senescence) and amplification of mitochondrial DNA sequences as tandemly repeated circular molecules of sen-DNA is clearly established; the relevance of these senCorrespondence to: Dr. C. Viemy-Jarnet, Centre de Genetique Moleculaire, Centre National de la Recherche Scientifique 91190, Gif sur Yvette (France) Tel. (1)69823145. Abbreviations: aa, amino acid(s); ATP, adenosine 5’-triphosphate; bp, base pair(s); cDNA, DNA complementary to RNA; col, cytochrome oxidase subunit 1 gene; Dapi, 4’-6’

DNAs to the arrest of growth is currently accepted (Stahl et al., 1978; Cummings et al., 1979; JametVierny et al., 1980; Viemy et al., 1982; Koll et al., 1984; Belcour and Viemy, 1986). The sen-DNAs do not result from amplification of random mtDNA sequences. On the contrary, they arise from particular non-overlapping regions called diamidine-2-phenilindole-2-HCl; HDP, helix-destabilizing protein; kb, kilobase or 1000 bp; mtDNA, mitochondrial DNA; ND4L, dehydrogenase subunit gene; nt, nucleotide(s); ORF, open reading frame; sen-DNA, senescence specific DNA; ss, single-stranded; SSB, single-stranded nucleic acid binding protein; tRNA, transfer RNA; wt, wild type.

0378-I 119/88/$03.50 0 1988 Elsevier Science Publishers B.V. (Biomedical Division)

388

yande(Belcouret al., 1981; Wrightet al., 1982; Cummings et al., 1985). In this paper, only those apex sequences recovered in senescent cultures of wt strains will be considered as sen-DNAs. The sen-DNA molecules originating in the a region are most often found in senescent cultures and always exhibit an identical 2539-bp monomer (Stahl et al., 1978; ~u~ngs et al., 1979; Belcour et al., 1981; Osiewacz and Esser, 1984). Those arising from the /I and y regions display monomers with variable sizes and junctions, sharing, however, a common sequence (Belcour et al., 1981; Wright et al., 1982a; Koll et al., 1985). Sen-DNA Eis the only representative of its category (Cu~gs et al., 1985). It was found once in a senescent culture of the wt A strain. Thus far, neither the mechanisms by which the sen-DNA molecules are generated and amplified nor those by which they could exert a lethal effect on the rny~e~~ are understood. To elucidate such mechanisms, different approaches are at present possible. The most direct approach, accounting for most of the sequencing studies performed on P. nmerina mtDNA, is to determine and to compare the informational content of various sen-DNAs. The complete nucleotide sequence of sen-DNA a (Osiewacz and Esser, 1984; Cummings et al., 1985) ands(C ummings et al., 1985) and an extensive partial sequence of the regions surrounding the junctions of one sen-DNA y (called sen-DNA /I in bogs et al., 1985) have been previously determined. Sen-DNA a is a complete group II intron of the cytochrome oxidase subunit 1 gene (co1 ) (JametVierny et al., 1984; Osiewacz and Esser, 1984; Kuck et al., 1985; Cummings et al., 1985). On the contrary, coding and noncoding regions are present in both sen-DNAs y and E. Sen-DNA E, more particularly, contains about one-half of the mosaic gene ND1 (see Fig. 1). In this paper, we present the primary structure of a 3985-bp sen-DNA originating in the /I region and that of its flanking sequences. The 3’ part of gene co1 and the 5’ part of gene ND4L - another mosaic gene - are respectively found at the 5’ - and the 3’ -end of the monomer unit. These two genes are separated by a long region which contains a tRNA arginine gene and the llOO-bp sequence common to all /I senDNAs (Koll et al., 1985). Three unidentified ORFs are present in this latter sequence. The specific and common properties of the four sequenced sen-DNAs a,/$

and their possible involvement in the development of senescence will be discussed.

MATERIALS AND METHODS

(a) Podosporu anserinu strains and mitochondrial DNA The s wt strain of P. anserinuof mating type ( - ) was grown as previously described (Cummings et al.,

6 kb --4

-2.3

kb

kb

-1.7kb

abc Fig. 1. Hoe111 restriction patterns of the mtDNA of (a) a young culture; (b) and (c), two independent senescent cultures of the wt s mating type ( - ) strain. The digestion of the DNA by the endonuclease was performed in 10 mM Tris*HCl, pH 7.5, 10 mM MgCl,, 50 mM NaCI in a total volume of 10 yl. Electrophoresis of the DNA fragments was carried out in a 1% agarose gel containing ethidium bromide at a final concentration of 0.5 pg/ml. Tbe fi sen-DNAs present in lanes b and c were designated sen-DNA #G and sen-DNA j?K, respectively (Belcour et al., 1981). The monomer of sen-DNA jIG is constituted of two Hue111 fragments of 2.3 and 4 kb, that of senDNA flK of two fragments of 2.3 and 1.7 kb. The upper intense 6-kb fragment visible in lane c corresponds to a y sen-DNA (unpublished results).

389

1979; Belcour and Begel, 1977) for the isolation of mtDNA. The mtDNA was prepared in Dapi-CsCl gradients according to the method of Cummings et al. (1979).

RESULTS AND DISCUSSION

(a) Cloning of the sen-DNA FK monomer and its localization on the mtDNA restriction map

(b) Nucleotide sequencing

The 3985bp b sen-DNA (referred to as sen-DNA /.IK in Belcour et al., 1981) was recovered from a senescent culture of the wt strain s ( - ) together with another sen-DNA further identified by hybridization as belonging to the y family (Fig. 1). The presence of a unique BamHI site in the monomer of sen-DNA /IK allowed its easy cloning in pBR325. Another B sen-DNA, 6.3 kb long, referred to as sen-DNA /IG in Belcour et al. (1981) (Fig. 1) was obtained during the same period from another independent senescent culture of the same strain and cloned at the BumHI site of pBR322. A restriction study of these two p sen-DNAs, as well as a comparison of their respective restriction patterns with that of the mtDNA, revealed that the monomer of sen-DNA /IK is completely included in that of sen-DNA PG. However, their respective junctions with the mt chromosome

Plasmid DNA was isolated according to Clewell and Helinski (1969). Plasmid DNA was then cleaved with restriction endonucleases and the fragments were labelled at their 5’ ends with [Y-~~P]ATP in a reaction catalyzed by T4 polynucleotide kinase. Double-stranded end-labelled DNA fragments were either subjected to a second restriction cleavage or denatured and the two strands separated by polyacrylamide gel electrophoresis. End-labelled ss fragments were eluted from the gel and sequenced by the method of Maxam and Gilbert (1980).

a

, 1

I

&

I

1

I

II

Haslll

-I1

III

0

r’,’ I ,’ #’ #’ ,’

#’ #’ IV

I

0b

/

/

/

/

I

8bl2

1

19 Ia

--._

LJ

\r

*

5

--._

I

lq7/llIglII

%I

TH

III

II 12

HM I I I

8s

I 4 I;1

&I

--._ -.

2

I'ZJ7 18"

L

uuu

I

Ul

8 ‘.._P -.._

--._ -.._

HH MB

3

1

*. -_

- - ._ - -. . .

I

I

V

Fig. 2. Localization of the monomers of sen-DNAs j?K and fiG on the linearized Hue111 restriction map of the 94-kb mt chromosome. I: Schematic localization of some sen-DNAs. The region common to all /I sen-DNAs is darkened. Cummings’ (1985) nomenclature is given in parentheses when different from ours. II and III: Hoe111 restriction map and localization of some genes: A6 and A8 for subunits of ATPase; col and co3 for subunits 1 and 3 of cytochrome oxidase; NDI, ND2 and ND3 for subunits of NADH dehydrogenase; IrRNA and srRNA for large and small rRNAs. Starred symbols indicate genes that are known to contain intron(s). The numbers refer to the restriction fragments classed according to size (Wright et al., 1982). Data come from: Jamet-Viemy et al., 1984; Cummings et al., 1985a, Turcker et al., 1987b; and unpublished works (D.J. Cummings, personal communication). IV: Magnified representation offragments HueIII-8b, 12 and 1 and position of some restriction sites: B, BarnHI; Bg, BglII; H, HindHI; M, MspI; T, TuqI. V: Precise localization of sen-DNAs fl (upper) and /?G (lower). The /l sen-DNA common region is darkened.

intron

co1

ATGTTAATTTTGCTAACGGTGAAGCCTTATGTGTTTTCTTAATGCAGAAAATAGAAGGGT

CGCTGCGAAGCCAAAAATGTACCCTCATGTAAGGTAATACCGTGGAAACCAAAGCAAATA

AATTCCACAATTTATTGGCGAGTAGGATCCGTAGAGACTAAACGTGACAATCAAAAGTTT

ATTAAGTTAAACGATTAGATAAGTTATAGTCCGATCCACTGCGTGAGCAGTGTTGTATGT

361

421

461

541

ATAGGGGTTAACGTAACTttCTTCCCTCAACATTTCtTAGGTCTACAAGGAATGCCTAGA

AGAATTAGCGA??ACCCTGATGCATTTGCAGGTTGAAATttAATAAGTAGtTTTGGGTCA

ATAATAAGTGTAGTAGCTGCATGATTATTTTTGTATATTGTATACTTACAATTAGTTGAA

GGAGAATATGCAGG?AGATTCCCTTGAT?AAACccTCAAttCTATACAGAtACTTTACAA

GCTCTTCTAAATAGAAGTTATCCTAGT?TAGAA?GAGCTTTAAGTAGCCCACCAAAACCT

CATGCTTTCGTAAGTCTTCCTTTACAATCGAATATATTAAGAAGTTTATTTTA

AAGAGACTATTTTTGCTATTAAGGGTGTCTTAATAAAATGAACTTTAACTAGTAAACGTA

AAGCCCAAGCTCATAtTGTAAATACTACCTTAAAAAGTAGtATCTtACATAAATTTAAAG

1141

1201

1261

1321

1381

1441

1501

1561

1621

AAAATGTTAGGTTTAAATTATAATATGATTCTATCTAAAGTACAATTCTGAATACTTTTC

1061

TAGAATA~~AAGGTAAAGATATAG~~~AAA~AAT~GAAAAATTAT~T~AT

excm co1 TACGTTTTAAGTATGGGTGCTGTGTTTGCAATGTTTAGCGGTTGATACTTCTGAATACCT

961

1021

TAAATAAAACTATATACATTCGGGACGAAGTCCCGAATATTACCTTAATATGATACTTAT

CCTTTTAATAAAAGCTTTATAATTAAAGTAGGTTCAGAGACTAAACATCAAATATCTTTT

781

ATTCTTACGCGAGCGAGGAGCTTGCGTCCTATAGGTTTAACTAATCAAAAAAAATACCAT

GCTTGGCTGCTGATTCTTATtATCAAGGTGAACTCGAACGATATAACCTTCGTTAAGTtA

721

641

GTTAAATTTAATATAGAAAATATTAAATTTGTTCTTCTGCATTTTGACAAATTGCTGGAA

661

901

AAAAAAAAATTTTTGAGCAATCTTCT?

601 1E

AAAAAtTTCATACGttTttCGGTAAAAtTtACTTTAGGACTTttATCTAAAGCTAACC?A

3e1

9

TCCTTAAAAAAATTCCATCAAAAGCTTTCTTAGTAAGTGTCGTGTTGTCATGTCACCATG

241

intron

co1

9

!lG

TTTAA

ATTTTCAC

AACTGGGCCATTA

GtACTAttAAAAATAATCTCtCATT~~ACtAACTATCCTTTATTTGGTGAAAAATTAGAG

161

exon co1 CTTACTATGTAGTTGC

GAAATAAAGTtAGAAATCCTtACGGTAAATtCTATGCAGTAGAGA?ATATAAAAAAGAAA

CGATAGGGCAAAA?GAtGATCTT?ACtTAATtGAAGC?AtTAAACtGTAt?TTGAAtcAA

CC~~~~~~~f~~~~~~~d~~~~ttGttttTCGAtAAGAAAAtCtAAtAACCAttC??ttT

121

61

1

I

orf y

orf

z . . ..VP

TTATTTATGTTAAACCCTATAAGTTATATTAATAACTGACAGCGCGGTGCTATATATAGC GUCGCGCCGCCSZ~~T~~TGTAATAAATTTTACA

2521 2581

CATATAATATTCTGGATTTTTAAGTTTTAGTTTTAGACGCAGA~:~~~~~~~AAGGCGC GAGCTCTAAATGTAATAGTAGCCCTCTACTACTTCGAGCTTGCGCGCCCGGCTCAGTAAA AAAAATTTTTTATGTGCATAAACATGTATGTGGATAAATAAATTTAAATATGTTGCAGTC TGTGCGCGTAACTTTTTAAGTAATAAATTCATAACCAGGAGATGCATCATAATGGTGGGT ATCAtTTAAATGAGCGTGGTAGGGGCTTATTTACCGCACGGTATAAGGTTACTTT

3161 3241 3301

TAATGTCTTATCCTAC

3121

P

CGCTACGGACGTTGTTTTATAAGTtCGAGTCTTATACACA?C

tRNAarg GTGTGTTAGTTTAATGGCAAAACATGG

3061

+ 3001

P GGAGGAGGTCCTCCTCCTCCTCTAAATAAAA

2941

2881

2621

2761

2781

GCATACAGACATAATTCGTCAGTACGTCATGCAAACATATGTACTGACGAAGTATGTC~

ATTTTATTCAATTATATTTTAG~AAAATATAGCGGATATTATAAATTTCTA

2461

2641

AGTGGATCAACAGCAGCTAAATTTATTTCGGAACTAGTTAATAAATGACCCAAACTTTTT

nlM6,

pm3

+;GTCTCTT

mexo,

GGGTAAGGGGTCTGGTTCTGGATTTTGGGGGGG~~~~TT~~~~GGAGAG

GGTAGTTCAGG~~~~GA~~~~GA~~~~AA~~~~AA~~~~AATGGAGATCCTAATATATCA

9

2401

ACGACGAT

chi-like

2341

2261

ATCTGACAGTAAATTTGAGGCGCAAGCTC

MGAAACGTTGGAGATGGAGAATCTGCACAACCAGCTAAAAGGGTCAAAGAAAGATTCTG

2161 2221

TAATTGTGAAGCTGAAGCATCAAATAACAA

AGATACATCCAAATGGATAAAAGATATACCTGTAGTTCCCAGGACAAGGGCTGAATCTGA ATCTACCCATGAACCTATACCATCTAGCAGTAGGAGTGAAGCTAT~~~~GAACCT~

GT~GTAAAAGAGATAT~A~GGAAGAATTAA~~AA~AA~ITAGAAGGGA

2041

+

2101

GATTGGTATGTATTA

CAGTACAAGCAGGTCCTGAAGGGGGGATGACGA 44 GATGACTCGTCCTGTTGGGGAAGCTTCTACCGAAAATCTTAATCGCTATTTATCT ACGAGCTGATAGAGAGGATCATCAAAATAGGGACAACTTAGAGAAAGATGATCA ATCAAGCATCATTACAATTATCATA

1961

1921

1661

1601

CTTCTGGTCGTCTATTAGCATTAACAAGAGGTCCAAATAATAATCCTAATCTTTCTAATT CTAATAACCCTGAATACGAAGAGACTATGGCTGATTCAAATTCTGATCATCCTAATGATG

1661 1741

cxon ND41

AAATTATTCTTATTCACATTTTAATTTATTACCTACAATTTCACGGCGAAGTCGTAATTT

3661

TAGAGTTAGTGATATAACTAGTTTAAATAATATAATTATACCTCATTTTGAAAAGTATAC

ATTAATAACTAATAAATATAAAGATTTTATAATATTTAAACAAATTGTATCGTTAATGTC

AGAAAACAAACATACTACTTTAGAAGGGTTAAAAGAAATTTTAGAATATAGAGCATCTCT

TAATTGAGGTTTATCTAAAAATTTAAAGGAATCTTTTCCTTCAATGGTACCAGTTAAAAG

AGTCGAAATTGAGGATAATATATTAAGTAATTTACCTTCTAAC~~~~~~~~~~~~~~:~~

*********I*** AGCAGGAGAATCCAATTTTTTTATAACTATATCTGGTAATAAAGTATGATTACGTTTTTC

TATAGCTCAAGACTCAAGAGATATATTGTTATTAAAAAGTTTAGTTGAATTTTTTAATTG

TGGTTATATAGCTCAATATAAAAACCGTAAAGTATGTGAATTTATAGTTACAAAAATTAA

TGATATAATTATATATATAATTCTTTT

4681

4141

47.61

4261

4321

4361

4441

4501

52

Fig. 3. Complete nucleotide sequence of sen-DNA /?K and of its flanking regions. The sequence of the non-transcribed strand is shown. Nucleotide position is given in the left-hand margin. Identifiable genes, intron sequences and unidentified ORFs are marked by square brackets. The conserved decapeptide encoding sequences are marked by asterisks. The b common region (from nt + 1495 to + 2657) is indicated by a large round bracket on the right margin. Repeated sequences and most important palindromes are marked by thick and thin arrows, respectively. The putative sites for RNA processing are indicated by small black triangles. The 1l-bp sequence also present at the junctions of sen-DNA Eis indicated by open squares. The motifs TGGT are noted by black dots. The ‘lT.TA repeated pentanucleotides are shown by horizontal two-headed arrows. The sites of DNA rearrangement observed in mutants mex3, mex6 and in plasmid YPMP during autoreplication in yeast are indicated by bent vertical arrows. The junctions of sen-DNA /?K with the mt chromosome are indicated by Jl and J2.

AAATTATTTTTATAATGTTGGATATATATCCACCCTAAAGGGTGGATCTACGGTTGAATT

3901

4621

3981

384

3761

3721

TTTGGGTATTTTAGTTGCTTTCTATA

3601

1

AATCGGTCAAACTTATGCTATTTATATAATAGTTGTTGCAGGTGCAGAATCTGCTATAGG

3541

intron ND41 TTAATTAACTCTCCTGATAAAAATCCAAGATC

AATAATGCTAT?AGCTATAACA??CCTAA?A??GG?AAGTTCAC?TAA?ATGGA?GATAT

34.51

9

AGGAA?TTTAGGATTCGTA?TAAATAGAAAAAATATTATATTAATGCTTAT?TCAA?TGA

3421

TGAATATTACCTTAATACTTTTTTTAAT

AAATAATTTACAAACTTTTAATATTTTCGC

3361

. . .. ....

........

Aspergihs

P. anrerina translated nucleotide sequence starts at nt position + 3392 in Fig. 3. The mt code has been used. The amino acid sequence of the tirst exon is in bold letters; that of the tirst intron is in normal letters. Amino acids not conserved among the two organisms are indicated by heavy dots.

(lower line) and N. crassa (upper line) as deduced from the nucleotide sequence. The

Fig, 4. Comparison of the N-terminal amino acid sequences of NDlL from P. unserina

YXNWKEFl3/lXNDIIMIP------YINWCZFlXKINXIMIL-----.

9

ISKINDRS?ZIEFRVSDITSIIP~QLI~~LVIE'KQIVS~ IS~TWE'R'~ITSUWIIIp~TNKYI?~~IFKQ~LEENK

D

GsGpm-SeHTw~ --YS~IS~RT~~~ . ..

.

~TFLILVSSLWC)D IMUU!WLILVSSLNbflD

IIa2mAIYIIVVUaESAIGLFuL~INsPvluip~NYSGDPApPs IIWIIAIYI~~ VAF~WNSPD~R~JYS.

mITLILFLImIIadLIs~

BNCTLILFLIGIINLISIE

392 at different positions of fragments HueIII-8b and HueIII- 1 (Fig. 2). Such data allowed us to identify, then to sequence (1) the fragments of sen-DNA /lG containing the junctions of sen-DNA /_?Kwith the mtDNA, and (2) a fragment of sen-DNA #?K containing its excision-junction site. occur

(b) Anatomy of sen-DNA flK: intronic and exonic sequences

The complete nucleotide sequence of sen-DNA /?K and that of the mtDNA regions flanking its junctions are presented in Fig. 3. We have already reported that the fragment HaeIII-12 of the mtDNA contains the 3’ end of gene co1 (Fig. 2) (JametViemy et al., 1984). The upstream junction of senDNA /3K is also located in this fragment; more precisely, in the penultimate intron of gene col, 3 bp upstream from a UAA codon terminating the ORF included in this intron. Although the 5’ part of this intron is not yet sequenced, the presence in the ORF of a sequence encoding a characteristic decapeptide suggests that this intron belongs to group I (Davies et al., 1982; Michel and Dujon, 1983; Waring and Davies, 1984) and therefore encodes a putative RNA maturase (Jacq et al., 1980; Lazowska et al., 1980). By comparing our sequence with that of the region NDIL-ND5 of Neurospora crassa (Nelson and Macino, 1987a; 1987b), we established that the downstream junction of sen-DNA fiK interrupts the ORF of the first group I intron of gene ND4L encoding one subunit of the NADH dehydrogenase. Fig. 4 shows the nearly perfect homology between the ND4L first exon of N. crassu and that of P. anserina. In N. crassa the position of the ND4L first intron was determined by sequencing the cDNA made from the spliced RNA. It appears quite clear in Fig. 4 that the first intron of ND4L occurs at the same position in both fungi. The N. crussa intron contains a 1116-bp ORF in phase with the preceding exon. Although not completely sequenced, the P. anserina intronic ORF displays strong homology with the N. crussa one, except in the two short regions which precede the two characteristic decapeptide-encoding sequences and in the 36-bp G + C-rich palindromic region which is absent in P. anserina. This homology is significantly higher than that detected among the ORFs of different group I mtDNA introns, in particular higher than

that of 32% found between the ORFs of the ND4L intron, the ND5 first intron and the 012 second intron of N. crassa (Morelli and Ma&o, 1984). Although the ND4L genes of N. crassa and P. anserina appear to be very similar, we did not find in P. anserina a sequence homologous to the untranslated 86-bp one, which in the mature transcript of N. crassa, precedes the coding sequence. In other respects, the ‘core’ part of the ND4L intron of P. anserina has not yet been sequenced. It would be of interest to do so to see whether it presents, as is the case in N. crussu, a strong homology with the ribosomal intron of Tetrahymena thermophila (Kan and Gall, 1982; Michel et Dujon, 1983; Cech et al., 1983). Between the 3’ end of the /3 common region and the 5’ end of gene ND4L lie 736 bp in which the only encoding sequence detected thus far is that of a tRNA arginine gene. This tRNA gene, which starts at nt position + 2974, displays 60% homology with the tRNA*‘@ of Saccharomyces cerevisiue (Fig. 6; Bonitz and Tzagoloff, 1980). From previously published data (Cummings et al., 1985), we know that a tRNAq” sequence is present a few bp upstream from gene col. The organization of the genes in this region thus appears to be very similar to that of N. crassu since it was established that in this fungus the gene co1 is also delimited by both tRNAQ” and tRNA*‘g (Burger et al., 1985; De Vries et al., 1985). This fact could suggest that in P. anserina as in N. crassa, tRNA sequences serve as

ORF-X

LINE'STSG DAPNDDBASK&S*

ORF-Y

GRKRDITEEZINRREDTSRDDWPRTMESESTEEP IPSSSFsEAIGEPvPSD~ GEiSAQP-*

ORF-Z

SSB

SNmNPEmETMmSNS

TAAKJ?ISELVNKWPKLFILIUXIADIINF*

WGGGAPAGGNIGGGEPE-EEP-S GGAES

SSB-1

Fig. 5. Amino acid sequences of the polypeptides encoded by the three unidentified ORFs present in the /I common region and of the glycine-rich domains of the E. coli SSB protein and of the yeast SSB-1 protein as deduced from the nucleotide sequence. The positions of the nucleotide sequences corresponding to ORF-X, ORF-Y and ORF-Z are indicated in Fig. 3.

393

3’ 5’

OH

Ql G rC

G-U U-A G=C II -

A

C= G G=C

Fig. 6. Secondary structure of the tRNA& of P. anserina. This tRNA lies between nt positions + 2974 and + 3043 in Fig. 3. The regions of homology with the tRNAAr@ of yeast (Booitz and Tzagoloff, 1980) are boxed.

punctuation signals for the processing of precursor transcripts of the co2 region (Burger et al., 1985; Breitenberger et al., 1985). This hypothesis is strengthened by the presence upstream (+ 2753) and downstream ( + 3 103) from the tRNA*‘g gene of the sequences ATTATATTTT and AATATATT’IT. These sequences are quite similar and correspond to the AATATATTIT one which, in yeast, serves as processing site when immediately adjacent to a tRNA or to a G + C cluster (Franscisi et al., 1987). (c) /I sen-DNA common sequence

Just downstream from gene co1 begins a nearly 1lOO-bpregion which has been shown to be common to the 13 sen-DNAs B studied up to now (Koll et al., 1985). However, this sequence clearly exhibits original properties (Fig. 3). (1) At nt positions + 1598 and + 2 157 are found two direct repeats which differ by only 5 out of 35 bp and include at their respective 3’ ends the sequence GGCGCAAGCTC. This 11-bp sequence was previously identified downstream from both excision sites of sen-DNA E (Cummings et al., 1985) and also at or near most excision sites of subgenomic circular molecules found in various longevity mutants (Turcker et al., 1987a). It was consequently proposed for playing a part in sen-DNA excision (Turcker et al., 1987b).

(2) A short sequence, CAACCAGC, almost identi-

cal to the complement (CCACCAGC) of the chi sequence (GCTGGTGG) (Smith, 1983), is present at position + 2250. (3) At 47 bp downstream from the &-like sequence begins a nearly lOO-bp region in which the motif TGGT is repeated eight times. (4) A 30-bp palindromic sequence starts at nt position + 2561 and is followed by (5) a 35-bp region in which the pentanucleotide TT.TA is repeated seven times. Some help in interpreting these sequencing data is provided by complementary results concerning some mutants selected as resuming from senescence. Koll et al. (1987) have established that in the longevity mutants mex3 and mex6, some rearrangements of the mtDNA organization, leading to the presence of several populations of molecules, have occurred. Mutant mex3 contains at least two rearrangements, one at the beginning of one 35-bp repeat, the other in the lOO-bp sequence rich in TGGT motifs (Fig. 3). This latter region also includes one rearrangement affecting mutant mex6 and, moreover, was shown to be reorganized during autoreplication of plasmid YPM/?l in yeast (Sainsard-Chanet and Begel, 1986). These data therefore suggest that the potentiality for stimulating recombination could be one salient feature of the fi common region. On the other hand, three short ORFs (Figs. 3 and 5) displaying a bias against codons ending in G or C comparable to that found in mt DNA coding regions of various fungi, including P. anserina (Table I), have been identified in the /3 common region. Thus far, however, no homology between the ORF-encoded polypeptides and other mt proteins has been found. ORF-X and ORF-Y are separated by 171 bp, but there is an overlap of one bp between ORF-Y and ORF-Z. Since the nucleotide sequence in this region has been determined by both the Maxam and Gilbert (1980) and the Sanger et al. (1977) method, the existence of such a frameshift is difficult to contest. To this point, however, the example of Trypanosoma brucei in which the mt gene co& although containing a frameshift, is expressed through an RNA editing process (Benne et al., 1986) is worth recalling. ORF-Z, the only one of the three ORFs that starts with an ATG codon, appears very particular in that it includes the TGGT-rich sequence and codes for a polypeptide containing a 40-aa glycine-rich portion. Glycine-rich domains have been previously identi-

394

TABLE I Percentage of G + C in different positions of the codons of ORF-X, ORF-Y and ORF-Z as compared with that of known coding sequences of P. anserrk mtDNA. G + C percentage in a noncodiig sequence is given for comparison Name and sixen of sequence

% of G-Cb in

position

second position

third position

44 42 42 41 45 42

44 42 43 40 35 44

12 16 14 19 18 14

29

34

36

first

159-bp ORF-X 291-bp ORF-Y 219-bp ORF-2 476bp co1 exon 235bp ND4L exon 900-bp ND4L intron (one ORF) 370-bp co1 intron (no ORF)

a The positions of all the sequences are indicated in Fig. 3. ORF-X, GRF-Y and ORF-Z are bracketed. The 238-bp co1 exon is between nt positions + 1018 and + 1494; the 370-bp co1 intron is between nt positions + 647 and f 1017; the 235-bp ND4L exon is between nt positions + 3392 and + 3627; the 900-bp ND4L intron is between nt positions + 3628 and + 4528. b Corresponds for each nucleotide sequence to the percentage of codons with a G or a C in I&t, second or third position.

f&d in various ss DNA-binding proteins, such as the SSB protein of ~~c~~c~~~ coli (Sancar et al., 198 I), the SSB-1 protein of yeast (Campbell et al,, 1986), and the HDP protein of rat (Cobianchi et al., 1986). The last protein contains more particularly a 124-aa sequence in which the ammo acid content (11 y0 asparagine, 15% serine and 40% glycine) is very similar to that of the glycine-rich sequence of the P. umerina ORF. A %O-kDa glycine-rich DNAbinding protein has also been identified in yeast mitochondria (Caron et al., 1979; Jong et al., 1985) but has been shown to be coded by the nucleus (Caron et al., 1979). In other respects, unassigned reading frames encoding for polypeptides with unusually high levels of glycines have been identitied in the maxi-circles of T. brucei mtDNA. Transcripts mapping in these DNA regions have been isolated. The sequence of one of them was, moreover, shown to differ from that of the DNA by insertion of a varying number of T residues at different positions of the 3’ terminus (Benne et al., 1983).

Although we are at present unable to decide whether the three ORFs belong to the same gene and whether the gene is fictions, the data presented above lead us to speculate that in P. unserina the fl common region encodes for a protein which displays afEmity for the DNA and could therefore be involved in the senescence process.

(d) Junction sequences of sen-DNA fi The presence of coding and noncoding regions in its monomer makes sen-DNA /?K more similar to the sen-DNAs y and Ethan to sen-DNA u, which corresponds exclusively to an intron. Both sen-DNA y and s, while having di%rent sequences, exhibit direct repeats of 9 and 11 bp, respectively, downstream from their junctions with the mt chromosome (Cummings et al., 1985). Six-bp direct repeats are also present near the junctions of sen-DNA /?K (Fig. 7). However their nucleotide sequences and their positions relative to the junctions (5 bp upstream from the 5’ junction and 3 bp downstream from the 3’ one) are different from what is observed for senDNAs y and E (Fig. 7). In other respects, sen-DNA /?K does not exhibit any homology with the junction sequences of sen-DNA u, which are exactly those of the intron.

a

(C!ICP

ATA?LX%lTIXSATAAT&3ZAlVA J2

J-l

Fig. 7. Comparison of the boundaries of diierent sen-DNAs. In each case, the sequence of the mtDNA corresponding to the limits ofthe sen-DNA monomer is represented: upper line = left limit; lower tine = right limit. Jl and J2 = junction sites of the sen-DNA. The direct repeats are underlined. The data concerning the sen-DNAs a, y and e are from ~gs et al. (198Sa). The positions of the different sen-DNAs are presented in Fig. 2, section I. The nt positions of the Jl and 52 junctions of the sen-DNA b are given in parentheses; they correspond to those indicated in Fig. 3.

395

The only point common to the four sequenced sen-DNAs becomes apparent after comparing the excision junction sequence of each of them with that of the mtDNA regions surrounding their respective monomers: whatever the modalities involved, the autonomization of the four sen-DNAs occurred without any change in the nucleotide sequence. (e) Formation of first molecule of sen-DNA

Up to now, there is no evidence for an excision of a fast molecule of sen-DNA at the DNA level. The only argument supporting this hypothesis is the presence, downstream from both termini of senDNAs y and e, of short direct repeats which might allow a cross-over excision mechanism analogous to that used for excision of phage I (Campbell, 1962). Such a mechanism has also been put forward for explaining the formation of some tandemly arranged rho- of yeast (Bonitz et al., 1980). On the contrary, the position of the direct repeats present near the junctions of sen-DNA /?K and the absence of direct repeats at the junctions of sen-DNA c1are hardly consistent with a looping-out excision mechanism. This fact, together with the absence of any common or consensus sequence at the sites where the four sen-DNAs originate, suggests a diversity in the mechanisms generating different families of sen-DNAs. We must particularly keep in mind the hypothesis prompted by the homology between the tl ORF encoded protein and some viral reverse transcriptases (Michel and Lang, 1985), of reverse transcription of an intronic circular RNA molecule. (f) Amplification

of the sen-DNAs

Reverse transcription of RNA molecules could also, at least in the case of cl, account for the amplification of the sen-DNAs. It is, however, difficult to correlate with recent data showing that the splicing product of intron Qis a,lariat (Schmidt et al., 1987). On the contrary, reverse transcription appears unlikely for amplifying sen-DNAs B or e, since the intronic ORFs they contain do not seem to encode proteins with a reverse transcriptase activity. A simple alternative hypothesis is that amplification of the sen-DNA molecules proceeds because they have autoreplicative properties. In this view, the region common to all B sen-DNAs seems a good candidate

for containing an origin of replication. We have identified in this common region a 30-bp palindromic sequence (position + 2561, Fig. 3) able to exhibit a hairpin secondary structure more or less comparable to that of other putative mt origins of replication (Lazarus and Ktintzel, 1981; de Zamaroczy et al., 1984). However, until we have an experimental way to decide whether a sequence can autonomously replicate in mitochondria, we shall not be able to ascertain that this hairpin really corresponds to an origin of replication. (g) What is the lethal effect of sen-DNAs?

On the one hand, as previously emphazised, our sequencing data, together with the molecular analysis of the mtDNA rearrangements identified in longevity mutants (Koll et al., 1987) suggest that the/Icommon region displays recombinogenic properties. These properties might be partly responsible for the toxicity in the particular case of the sen-DNAs 4. Amplitlcation of the /?common sequence in senescent cultures could lead to a disorganization of the mtDNA, already observed by us (Belcour and Viemy, 1986), which would not be compatible with survival of the mycelium. Most of the DNA rearrangements identitied in the /? common region have occurred inside or near to a TGGT motif(Fig. 3). This observation can be related to the identification of a consensus sequence GGTGGT near the excision/insertion region of (1) several petite mutants of yeast whose monomer is not bounded by direct repeats and (2) the short internal surampliflcations found in some petites able to transmit markers with high efficiency (P. Netter and S. Robineau, submitted for publication). We can therefore suggest that in P.anserina, as in yeast, the motif TGGT (also present in the chi sequence) is a target for enzyme(s) involved in mtDNA recombination. On the other hand, the synthesis of a toxic amount of a protein displaying afIimity for nucleic acids appears for the moment the only hypothesis accounting for the lethal effect of all categories of senDNAs. We have seen that the only factor common to sen-DNAs a, E and y (Cummings, personal communication) is the presence of an intronic ORF. In addition to their RNA maturase function, intronencoded proteins may have endonuclease, recom-

396

binase and reverse transcriptase activities (Kotylak et al., 1985; Jacquier and Dujon, 1985; Macreadie et al., 1985). Intron a belongs to group II, whereas the two first introns of ND1 present in sen-DNA E belong to group I. Even if the encoded proteins display different modes of action, nucleic acids are their potential substrates and we can postulate that their overproduction would damage the mt genome. SenDNA /3K does not contain a complete intronic ORF and (unless one speculates that the chimaeric intronic ORF formed in the circular sen-DNA /3K is functional or that sen-DNA /?K, the shortest one of the /?family, is not fully representative of its category) it does not encode for a maturase-like protein. However, we now have some indication that the /? common region might encode for a DNA-binding protein whose overproduction, as well as that of maturases, could completely modify the mitochondrial physiology and could be responsible for cellular death in the case where /I sen-DNAs are amplified in a senescent culture. To study in senescent cultures the toxic overproduction of proteins with nucleic acids as substrates requires more sophisticated experiments. Those concerning the co1 first intron encoded protein are in progress in our laboratory.

ACKNOWLEDGEMENTS

I thank particularly Dr. L. Belcour, Dr. F. Koll and A. Joliot for helpful discussions and continuous encouragement, Dr. F. Michel for his help in interpreting the intronic sequences and Dr. J. Beisson for critical reading of the manuscript. This work was supported by the C.N.R.S. and by a grant from INSERM No. 861002.

REFERENCES Belcour, L. and Begel, 0.: Mitochondrial genes in Podospora anserina: recombination and linkage. Molec. Gen. Genet. 153 (1977) 11-21. Belcour, L., Begel, O., MO&, M.O. and Viemy, C.: Mitochondrial DNA amplification in senescent cultures of Podospora anserina: variability between the retained, amplified sequences. Curr. Genet. 3 (1981) 13-21.

Belcour, L. and Viemy, C.: Variable DNA splicing sites of a mitochondrial intron: relationship to the senescence process in Podospora. EMBO J. 5 (1986) 609-614. Benne, R., De Vries, B.F., Van den Burg, J. and Klaver, B.: The nucleotide sequence of a segment of Trypanosoma brucei mitochondrial maxi-circle DNA that contains the gene for apocytochrome b and some unusual unassigned reading frames. Nucleic Acids Res. 11 (1983) 6925-6941. Benne, R., Van Den Burg, J., Brakenhoff, J.P.J., Sloof, P., Van Boom, J. and Tromp, MC.: Major transcript of the frameshift coxll gene from Trypanosome mitochondria contains four nucleotides that are not encoded in the DNA. Cell 46 (1986) 819-826. Bonitz, S., Coruzzi, G., Thalenfeld, B., Tzagoloff, A. and Macino, G.: Assembly of the mitochondrial system: structure and nucleotide sequence of the gene coding for subunit of yeast cytochrome oxidase. J. Biol. Chem. 255 (1980) 11927-11941. Bonitz, S.G. and Tzagoloff, A.: Assembly of the mitochondrial membrane system. J. Biol. Chem. 255 (1986) 9075-9081. Breitenberger, CA., Browning, K.S., Alzner-DeWeerd, B. and RajBhandary, U.L.: RNA processing in Neurospora crassa mitochondria: use of transfer RNA sequences as signals. EMBO J. 4 (1985) 185-195. Burger, G., Helmer Citterich, M., Nelson, M.A., Werner, S. and Macino, G.: RNA processing in Neurospora crassa mitochondria: transfer RNAs punctuate a large precursor transcript. EMBO J. 4 (1985) 197-204. Campbell, A.L.: Episomes, Adv. Genet. 11 (1962) 101-146. Campbell, J.L., Budd, M., Gordon, C., Jong, A., Sweder, K., Oehm, A. and Gilbert, M.: Yeast DNA replication. Extrachromosomal elements in lower eukaryotes. In Hollaender, A. (Ed.), Basic Life Science. Plenum Press, New York, 1986, 463-478. Caron, F., Jacq, C. and Rouvibre-Yaniv, J.: Characterization of a histone-like protein extracted from yeast mitochondria. Proc. Natl. Acad. Sci. USA 76 (1979) 4265-4269. Cech, T.R., Tanner, N.K., Tinoco, I., Weir, B.R., Zucker, M. and Perlman, P.S.: Secondary structure of the Terrahymena ribosomal RNA intervening sequence: structural homology with fungal mitochondrial intervening sequences. Proc. Natl. Acad. Sci. USA 80 (1983) 3903-3907. Clewell, D.J. and Helinski, D.R.: Supercoiled circular DNA-protein complex in Escherichia colt purification and induced conversion to an open circular DNA form. Proc. Natl. Acad. Sci. USA 62 (1969) 1159-1166. Cobianchi, F., SenGupta, D.N., Zmudzka, B.Z. and Wilson, S.H.: Structure of rodent helix-destabilizing protein revealed by cDNA cloning. J. BiolChem. 261 (1985) 3536-3543. Collins, R.A., Stohl, L.L., Cole, M.D. and Lambowitz, A.M.: Characterization of a novel plasmid DNA found in mitochondria of N. crassa. Cell 24 (1981) 443-452. Cummings, D.J., Belcour, L. and Grandchamp, C.: Mitochondrial DNA from Podospora anserina. II. Properties of mutant DNA and multimeric circular DNA from senescent cultures. Mol. Gen. Genet. 171 (1979) 239-250. Cummings, D.J., MacNeil, LA., Domenico, J. and Matsuura, E.T.: Excision-amplification of mitochondrial DNA during

397 senescence in Podospora anserina DNA sequence analysis of three unique plasmids. J. Mol. Biol. 185 (1985) 659-680. Davies, R.W., Waring, R.B., Ray, J.A., Brown, T.A. and Scazzochio, C.: Making ends meet: a model for RNA splicing in fungal mitochondria. Nature 300 (1982) 719-724. De Vries, H., Haima, P., Brinker M. and De Jonge, J.C.: The Neurospora mitochondrial genome: the region coding for the polycistronic cytochrome oxidase subunit I transcript is preceded by a transfer RNA gene. FEBS Lett. 179 (1985) 337-342. de Zamaroczy, M., Faugeron-Fonty, G., Baldacci, G., Goursot, R. and Bernardi, G.: The ori sequences of the mitochondrial genome of a wild-type strain: number, location, orientation and structure. Gene 32 (1984) 439-457. Francisi, S., Palleschi, C., Ragnini, A. and Frontali, L.: Analysis of transcripts of the major cluster of tRNA genes in the mitochondrial genome of S. cerevisiae. Nucleic Acids Res. 15 (1987) 6387-6402. Jacq, C., Lazowska, J. and Slonimski, P.P.: Sur un nouveau mtcanisme de la regulation de l’expression genetique. CR. Acad. Sci. (Paris) 290 (1980) 1-4. Jacquier, A. and Dujon, B.: An intron-encoded protein is active in a gene conversion process that spreads an intron into a mitochondrial gene. Cell 41 (1985) 383-394. Jamet-Vierny, C., Begel, 0. and Belcour, L.: Senescence in Podospora anserina: amplification of a mitochondrial DNA sequence. Cell 21 (1980) 189-194. Jamet-Viemy, C., Begel, O., and Belcour, L.: A 20 x lo3 base pairs mosaic gene identified on the mitochondrial chromosome of Podospora anserina. Eur. J. Biochem. 143 (1984) 389-394. Jong, Y.S, Aebersold, R. and Campbell, J.: Multiple species of single-stranded nucleic acid-binding proteins in Saccharomyces cerevisiae. J. Biol. Chem. 260 (1985) 16367-16374. Kan, N.C. and Gall, J.G.: The intervening sequence of the ribosomal RNA gene is highly conserved between two Tetrahymena species. Nucleic Acids Res. 10 (1982) 2809-2822. Koll, F., Begel, O., Keller, A.M., Vierny, C. and L. Belcour, L.: Ethidium bromide rejuvenation of senescent cultures of Podospora anseritra: loss of senescence-specific DNA and recovery of normal mitochondrial DNA. Curr. Genet. 8 (1984) 127-134. Koll, F., Belcour, L. and Viemy, C.: An llOO-bp sequence of mitochondrial DNA is involved in senescence process in Podospora: study of senescent and mutant cultures. Plasmid 14 (1985) 106-117. Koll, F., Begel, 0. and Belcour, L.: Insertion of short poly d(A) d(T) sequences at recombination junctions in mitochondrial DNA of Podospora. Mol. Gen. Genet. 209 (1987) 630-632. Kotylak, Z., Lazowska, J. and Slonimski, P.P.: Intron encoded proteins of mitochondria: key elements of gene expression and genomic evolution. In Quagliariello E., Slater, E.C., Palmieri, F., Saccone, C. and Kroon, A.M. (Eds.), Acbievements and Perspectives of Mitochondrial Research, Volume II: Biogenesis. Elsevier, Amsterdam, 1985, pp. l-20. KUck, U., Osiewacz, H.D., Schmidt, U., Kappelhoff, B., Schulte, E., Stahl, U. and Esser, K.: The onset of senescence is affected by DNA rearrangements of a discontinuous mito-

chondrial gene in Podospora anserina. Curr. Genet. 9 (1985) 373-382. Lazarus, C.M., and Ktintzel, H.: Anatomy of amplified mitochondrial DNA in ‘ragged’ mutants of Aspergillus amstelodami: Excision points within protein genes and a common 215 bp segment containing a possible origin of replication. Curr. Genet. 4 (1981) 99-107. Lazowska, J., Jacq, C. and Slonimski, P.P.: Sequences of introns and flanking exons in wild-type and box3 mutants of cytochrome b reveals an interlaced splicing protein coded by an intron. Cell 22 (1980) 333-348. Macreadie, G., Scott, R.M., Zinn, R.A. and Butow, R.A.: Transposition of an intron in yeast mitochondria requires a protein encoded by that intron. Cell 41 (1985) 395-402. Maxam, A.M. and Gilbert, W.: Sequencing end-labelled DNA with base specific chemical cleavages. Methods Enzymol. 65 (1985) 499-560. Michel, F. and Dujon, B.: Conservation of secondary structures in two intron families including mitochondrial chloroplasts and nuclear encoded members. EMBO J. 2 (1983) 33-38. Michel, F. and Lang, F.: Mitochondrial class II introns encode proteins related to the reverse transcriptases of retroviruses. Nature 316 (1985) 641-643. Morelli, G. and Macino, G.: Two intervening sequences in the ATPase subunit 6 gene of Neurospora crassa: a short intron (93 bp) and a long intron that is stable after excision. J. Mol. Biol. 178 (1984) 491-507. Nelson, M.A. and Macino, G.: Structure and expression of the overlapping ND4L and ND5 genes ofNeurospora crassa mitochondria. Mol. Gen. Genet 206 (1987a) 307-317. Nelson, M.A. and Macino, G.: Three class I introns in the NDILINDS transcriptional unit of Neurospora crassa mitochondria. Mol. Gen. Genet. 206 (1987b) 3 18-325. Osiewacz, H.D., and Esser, K.: The mitochondrial plasmid of Podospora anserina: a mobile intron of a mitochondrial gene. Curr. Genet. 8 (1984) 299-305. Sainsard-Chanet, A. and Begel, 0.: Transformation of yeast and Podospora: innocuity of senescence-specific DNAs. Mol. Gen. Genet. 204 (1986) 443-451. Sancar, A., Williams, K.R., Chase, J.W. and Rupp, W.D.: Sequences of the ssb gene and protein. Proc. Natl. Acad. Sci. USA 78 (1981) 4274-4278. Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74 (1977) 5463-5467. Schmidt, U., Kosack, M. and Stahl, U.: Lariat RNA of a group II intron in a tllamentous fungus. Curr. Genet. 12 (1987) 291-295. Smith, G.R.: Chi hotspots of generalized recombination. Cell 34 (1983) 709-710. Stahl, U., Len&e, A., Tudzynski, P., Kuck, U. and Esser, K.: Evidence for plasmid-like DNA in a filamentous fungus, the ascomycete Podospora anserina. Mol. Gen. Genet. 162 (1978) 341-343. Turker, M.S., Domenico, J.M. and Cummings, D.J.: A novel family of mitochondrial plasmids associated with longevity mutants of Podospora anserina. J. Biol. Chem. 262 (1987a) 2250-2255.

398 Tucker, MS., Domenico, J.M. and Cummings, D.J.: Excisionamplification of mitochondrial DNA during senescence in Podospora onserina. A potential role for an 11 base-pair consensus sequence in the excision process. J. Mol. Biol. 198 (1987b) 171-185. Viemy, C., Keller, A.M., Begel, 0. and Belcour, L.: A sequence of mitochondrial DNA is associated with the onset of senescence in a fungus. Nature 297 (1982) 157-159. Waring, R.B. and Davies, R.W.: Assessment of a model for intron RNA secondary structure relevant to RNA selfsplicing - a review. Gene 28 (1984) 277-291.

Wright, R.M., Horrum, M.A. and Cummings, D.J.: Are mitochondrial structural genes selectively amplified during senescence in Podospora amerina? Cell 29 (1982) 505-515. Wright, R.M., Laping, J.L., Horrum, M.A. and Cummings, D.J.: Mitochondrial DNA from Podospora anserina. 3. Cloning, physical mapping and localization of ribosomal RNA genes. Mol. Gen. Genet. 185 (1982) 56-64. Communicated by J.K.C. Knowles.