- Email: [email protected]
Sense and antisense transcripts in the histone H1 (HIS-1) locus of Leishmania major
International Journal for Parasitology 33 (2003) 965–975 www.parasitology-online.com
Sense and antisense transcripts in the histone H1 (HIS-1) locus of Leishmania major Sabina I. Bellia,1, Se´verine Monnerata, Ce´dric Schaffa, Slavica Masinaa, Tanja Nolla, Peter J. Mylerb,c, Kenneth Stuartb,c, Nicolas Fasela,* a
Institute of Biochemistry, University of Lausanne, Ch. des Boveresses 155, Epalinges 1066, Switzerland b Seattle Biomedical Research Institute, Seattle, WA 98109-1653, USA c Department of Pathobiology, University of Washington, Seattle, WA 98195, USA Received 9 January 2003; received in revised form 29 April 2003; accepted 1 May 2003
Abstract Histone H1 in the parasitic protozoan Leishmania is a developmentally regulated protein encoded by two genes, HIS-1.1 and HIS-1.2. These genes are separated by , 20 kb of sequence and are located on the same DNA strand of chromosome 27. When Northern blots of parasite RNA were probed with HIS-1 strand-specific riboprobes, we detected sense and antisense transcripts that were polyadenylated and developmentally regulated. When the HIS-1.2 coding region was replaced with the coding region of the neomycin phosphotransferase gene, antisense transcription of this gene was unaffected, indicating that the regulatory elements controlling antisense transcription were located outside of the HIS-1.2 gene, and that transcription in Leishmania can occur from both DNA strands even in the presence of transcription of a selectable marker in the complementary strand. A search for other antisense transcripts within the HIS-1 locus identified an additional transcript (SC-1) within the intervening HIS-1 sequence, downstream of adenine and thymine-rich sequences. These results show that gene expression in Leishmania is not only regulated polycistronically from the sense strand of genomic DNA, but that the complementary strand of DNA also contains sequences that could drive expression of open reading frames from the antisense strand of DNA. These findings suggest that the parasite has evolved in such a way as to maximise the transcription of its genome, a mechanism that might be important for it to maintain virulence. q 2003 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. Keywords: Histone H1; Leishmania; Antisense transcription
1. Introduction In higher eukaryotes, gene expression is primarily controlled at the level of transcription initiation. In contrast, gene expression in trypanosomatids, such as Leishmania, is primarily regulated at the post-transcriptional level, and the mechanisms by which this occurs has been reviewed extensively elsewhere (Graham, 1995; Pays and Vanhamme, 1996; Ullu et al., 1996). Briefly, the genes in trypanosomatids are arranged into polycistronic transcription units that are processed to mono-cistronic mRNAs by a mechanism involving the trans-splicing of a ‘mini-exon’ (providing the 50 cap structure) to the primary transcript. It is * Corresponding author. Tel.: þ 41-21-6925-732; fax: þ41-21-6925-705. E-mail address: [email protected] (N. Fasel). 1 Present address: Institute for the Biotechnology of Infectious Diseases, University of Technology, Sydney, Gore Hill, N.S.W. 2065, Australia.
thought that this reaction is coupled to the polyadenylation of mRNA. This mechanism of RNA processing generates multiple mRNAs that can be differentially regulated in the free-living flagellated promastigote form, present in the gut of the insect, or in the non-motile amastigote form, found in the vertebrate host macrophage. Regulation of gene expression is further affected by the degree of maturation of the transcripts, their stability within the parasite, and the level of translation of the processed transcripts. Over recent years, extensive analysis of the Leishmania genome is providing further evidence for the presence of large transcriptional units within the genome (Myler et al., 1999). Based on bioinformatic programs specifically adapted for Leishmania, it was proposed that genes are organised into large clusters and transcribed from only one strand (Myler et al., 1999, 2000, 2001; Martinez-Calvillo et al., 2001). In other trypanosomatids such as Trypanosoma brucei,
0020-7519/03/$30.00 q 2003 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. doi:10.1016/S0020-7519(03)00126-7
966
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
the variant surface glycoprotein (VSG) and the protein, procyclin, are expressed at high levels within the parasite, and transcription of the genes encoding these proteins is unusual (Graham and Barry, 1995; Graham et al., 1996; Pays and Vanhamme, 1996). Unlike higher eukaryotes, transcription of the genes encoding VSG and procyclin is carried out by RNA polymerase I or a pol I-like enzyme. There is still some controversy regarding the presence of true RNA polymerase promoters in trypanosomes. There is little evidence to support the presence of RNA polymerase II or pol II-like enzymes in the transcription of genes in these parasites (Ben Amar et al., 1991; Lee, 1996; Graham et al., 1996). Nuclear run-on experiments have not provided evidence for the developmental regulation of transcriptional initiation or elongation by RNA pol II, and RNA pol II promoter trapping experiments in trypanosomes have not identified any RNA pol II elements (McAndrew et al., 1998; Patnaik et al., 1994). It was therefore proposed that in trypanosomes, RNA pol II initiation is favoured by genomic accessibility and double-strand transient melting of adenine and thymine (A/T)-rich sequences, that would serve as entry sites for polymerases on either strand (McAndrew et al., 1998; Swindle and Tait, 1996). Naturally occurring antisense transcripts have been described in both prokaryotes and eukaryotes, and are defined as complementary RNA sequences to sense RNA transcripts of an already known function (for a review, see Wagner and Simons, 1994; Vanhee-Brossollet and Vaquero, 1998). There have been a small number of reports documenting the presence of antisense transcripts in trypanosomatids. These transcripts have been detected in the dihydrofolate reductase-thymidylate synthase (DHFR-TS) locus of Leishmania and Crithidia fasciculata (Kapler and Beverley, 1989; Hughes et al., 1989). However, their presence remains circumstantial and the mechanisms regulating their expression are unclear. The two genes, sw3.0 and sw3.1, encoding histone H1 are identical in their 50 untranslated regions, and in their coding regions, but differ in their 30 untranslated regions (Belli et al., 1999). These genes have been subsequently renamed, HIS-1.1 and HIS-1.2, respectively, according to the genetic nomenclature for Trypanosoma and Leishmania (Clayton et al., 1998). The genes are transcribed from the same DNA strand, and it is likely that they are processed from the same polycistronic transcription unit. In this study, we have used the HIS-1 locus as a model to characterise the transcriptional organisation of genes in Leishmania, with specific emphasis on antisense transcription.
2. Materials and methods 2.1. Parasites The following parasites were used: Leishmania major promastigote strains MRHO/SU/59/P (LV39),
MRHO/IR/75/ER (IR75) and MHOM/JL/80/Friedlin (Friedlin); Leishmania guyanensis promastigote strain MHOM/BR/75/M5313; Leishmania panamensis promastigote strain MHOM/PA/71/LS94. All parasites were maintained at 26 8C in Dulbecco’s modified Eagle’s medium (DMEM; Gibco-BRL) on solid blood agar, supplemented with 10% foetal bovine serum (Seromed) and 10 mg/ml gentamicin. Alternatively, parasites were maintained in M199 (Gibco) supplemented with 10% foetal bovine serum (Seromed), 10 mg/ml gentamicin, 0.05 mM adenine, 0.5% hemin folate and 40 mM HEPES pH 7 (Gibco). 2.2. Analysis of HIS-1.1 and HIS-1.2 flanking sequences The HIS-1.1 and HIS-1.2 genes, including their flanking sequences, were cloned and sequenced as described previously (Fasel et al., 1994; Belli et al., 1999). Sequences were analysed using the program SEQUENCHER Version 3.1RC2 (Gene Codes Corporation) and LALIGN (Pearson and Lipman, 1990). The flanking regions of the HIS-1 genes were amplified from genomic DNA isolated from L. major strain LV39 parasites or from the cosmid L6577, which contains genomic DNA isolated from L. major strain Friedlin (Ivens and Smith, 1997). The flanking regions of the HIS-1.2 gene were amplified from genomic DNA isolated from the cosmid L2718. The flanking sequences of HIS-1 were amplified using the technique of inverse PCR (Ochman et al., 1990). The PCR was carried out using oligonucleotide primers orientated towards the 50 and 30 untranslated regions of the HIS-1.1 open reading frame. The following primers were used: UE-HIS-1 (50 ATAGACACGGTGCGGGGAGAGCTG3 0 ) and DH-HIS-1 (50 CGGGCTCTCTCGCGTTTTT CG30 ), or FLS-HIS-1 (50 AGCGGCGGAATTAGAGGACAT30 ) and FLA-HIS-1 (50 CACG TGCCCGAAGACGCATCAT30 ). Amplified products were subcloned into the vector pGEM-1 (Promega) and sequenced. Sequences corresponding to the flanking regions of the HIS-1.1 and HIS-1.2 genes were compared to the genomic sequence of the complete histone H1 locus obtained from the cosmid, L979 (GenBank Accession no. AC008242), shown previously to contain both histone H1 copies (Belli et al., 1999). The SC-1 gene was isolated from the cosmid L979 by the PCR using the 50 primer SC1 (50 CGCGGATCCTGTGTGTGTGTGTGTGTGTGTGTGCGTGTATGT30 ) located at position 20,537 bp in the cosmid L979 and the 30 primer SC2 (50 CCAAGCTTTCTCACTGACCCTGTC CCTC30 ) located at position 20,110 bp in the cosmid L979. The SC-1 gene was then cloned into the pCR2.1-TOPO-1 vector (Invitrogen). The insert was digested by Xba I and Bam H1, recloned into pGEM-1 and sequenced. The DNA was analysed using the software programs, MacVector 3.5e (International Biotechnologies Ltd), TestCode and Glimmer (Fickett, 1982; Salzberg et al., 1998).
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
2.3. RNA extraction and northern blot analysis RNA was extracted as described previously (Fasel et al., 1994). Poly(A)þ RNA was extracted using the FastTrack kit 2.0 mRNA isolation kit (Invitrogen). Cytoplasmic (15 mg) and poly(A)þ RNA (1 mg) were treated with glyoxal, separated on a 0.8% agarose gel and transferred to Genescreen Plus membrane (NEN Research Products) using a Vacublot apparatus (Fasel et al., 1994). Hybridisations and washings were carried out as described previously (Fasel et al., 1994). Sense and antisense riboprobes were transcribed from DNAs that had been cloned into pGEM-1. Plasmids were linearised using enzymes situated 30 of either the Sp6 or T7 RNA polymerase promoters prior to in vitro transcription, and labelling with a-32P-UTP as described previously (Noll et al., 1997; Sambrook and Russell, 2001). To detect transcripts antisense to the neomycin phosphotransferase gene, 233 nucleotides corresponding to the N-terminal coding region of the neomycin phosphotransferase gene were subcloned into pGEM-1 and transcribed in vitro using Sp6 RNA polymerase. 2.4. Transfections and homologous recombination Parasites were transfected according to established protocols (Beverley and Clayton, 1993). A clone of L. major strain IR75 (clone 6) was grown to logarithmic phase in M199 medium. Parasites (2 £ 108) were transfected with 80 mg of the targeting construct. The targeting construct was engineered as follows. The HIS-1 coding region was replaced with the neomycin phosphotransferase coding region (Neo), and upstream to this region, 146 bp of 50 sequence common to both HIS-1 copies was inserted. Downstream to the Neo coding region, pGEM-1 vector sequences were inserted as well as 500 bp of 30 sequence specific to HIS-1.2 (see Fig. 4A). The HIS-1 upstream and the HIS-1.2 downstream sequences contained the splice acceptor and polyadenylation sites. All sequences were ligated into the 2.9 kb pGEM-1 vector. When integrated into the genome, this construct could generate a transcript of 4.4 kb. The presence of pGEM-1 and Neo sequences enabled the targeted region to be easily identifiable in the transformants by Southern blotting. The transfection was performed using the Bio-Rad Gene Pulser under the following conditions: 500 mFD, 0.45 kV. After 24 h, the parasites were plated onto M199 agar in the presence of the antibiotic G418. Resistant clones were analysed by Southern blotting and PCR to ascertain that a single allele was eliminated (data not shown). Briefly, genomic DNA was isolated from parasites grown to stationary phase, restriction digested and analysed by Southern blotting according to established protocols (Belli et al., 1999; Sambrook and Russell, 2001). a-32P-dCTP labelled probes were prepared by random priming according to the manufacturer’s specifications (Boehringer Mannheim), and membranes were probed and washed as described
967
previously (Belli et al., 1999). Leishmania major IR75 parasites were transfected with the pX vector (Lebowitz et al., 1991), which encodes neomycin phosphotransferase but is lacking any HIS-1 sequences. This transfected cell line was used as a control in Northern blotting studies. 2.5. PCR Reverse transcribed cytoplasmic RNA was amplified using the primer oligodT (primer 1), and the HIS-1.1 flanking region oligonucleotide, primer 2 (50 TGCACCCCAGCGCAC30 ) or the HIS-1.2 flanking region specific oligonucleotide, primer 3 (50 TGATGTGCGTTCGCG30 ). Amplified products were separated on an agarose gel, transferred to a Genescreen Plus membrane and hybridised with a HIS-1 probe according to protocols published previously (Noll et al., 1997; Belli et al., 1999; Sambrook and Russell, 2001). 2.6. Primer extension The 33 nucleotide D2-sw3 oligonucleotide (50 -CCGAAGCTTGCCCGTGGCTGCACTGTA CGCTCTT-30 ) has 28 nucleotides that hybridises specifically to the HIS-1 gene copies (Fig. 4), and is located 14 nucleotides downstream of the stop codon. D2-sw3 was end-labelled with g-32P-ATP in the presence of T4 polynucleotide kinase and hybridised at 30 8C overnight to 10 mg of heat denatured cytoplasmic RNA. The reverse transcriptase reaction was performed in the presence of AMV reverse transcriptase for 1 h at 42 8C according to the protocol described by the supplier (Roche). The sample was then treated with DNase-free RNAse for 20 min at 37 8C, extracted with phenol chloroform and loaded on a 5% sequencing gel. The gel was dried and exposed.
3. Results 3.1. Detection of histone H1 antisense mRNAs in Leishmania The two copies of the gene encoding histone H1 are separated by , 20 kb of intergenic sequence on chromosome 27 in L. major. This entire locus, located in cosmid L979 has been fully sequenced (GenBank Accession No. AC008242). Two histone mRNAs of 621 and 756 bp in size, excluding the poly(A)þ tail, are synthesised from the HIS-1.1 and HIS-1.2 genes, respectively (Belli et al., 1999). The organisation of the HIS-1 transcriptional unit was analysed further to search for additional transcripts on both strands of the DNA using strand-specific riboprobes to the HIS-1.1 gene. The probe chosen recognised both HIS-1.1 and HIS-1.2 genes. Cytoplasmic and poly(A)þ RNA of L. major promastigotes (Fig. 1A) were analysed by Northern blotting using 32P-labelled riboprobes that specifically
968
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
Fig. 1. Analysis of histone H1 complementary transcripts in Leishmania species. (A) Cytoplasmic (10 mg; lanes a and c) and poly(A)þ RNA (1 mg; lanes b and d) isolated from L. major (strain LV39) were fractionated on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. Membranes were probed with a strand-specific riboprobe to detect anti-HIS-1 transcripts (lanes a and b) or to detect HIS-1 mRNAs (lanes c and d). (B) Cytoplasmic RNA isolated from L. major (strain LV39; lane a), L. guyanensis (lane b) and L. panamensis (lane c) was fractionated on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. The membrane was probed with a strand-specific probe to detect anti-HIS-1 transcripts and was exposed for 5 days (panel A, lanes a and b) and for 3 days (panel B, lanes a –c). The membrane probed to detect HIS-1 mRNAs was exposed for 12 h.
detected HIS-1 sense and antisense transcripts (anti-HIS-1 transcripts). Two HIS-1 sense transcripts of the expected size were detected in both cytoplasmic and poly(A)þ RNA fractions (Fig. 1A, lanes c and d), the smaller and the larger size transcripts being representative of transcription from the HIS-1.1and HIS-1.2 genes, respectively. When the membranes were probed with a probe complementary to the open reading frame of the HIS-1 gene, two antisense transcripts of 0.8 and 2.5 kb, were detected in both cytoplasmic and poly(A)þ RNA fractions (Fig. 1A, lanes a and b). The ratio of HIS-1 transcripts to anti-HIS-1 transcripts was estimated. Membranes were probed with sense and antisense riboprobes having the same specific activity. The level of expression of the anti-HIS-1 transcripts at steady state was about 20– 30 times less than the level of expression of HIS-1 steady state RNA (data not shown). The differences in size between the sense and antisense transcripts excluded the possibility that signals on Northern blots were due to the hybridisation of low levels of histone H1 probes that could have arisen by reverse priming during the synthesis of the anti-HIS-1 specific probe. The L. major specific HIS-1 probe was also used to probe RNA isolated from New World species of Leishmania. This probe recognised two antisense transcripts of 2.2 and 3.5 kb in L. guyanensis RNA (Fig. 1B, lane b) and L. panamensis RNA (Fig. 1B, lane c), indicating that histone H1 antisense transcription is not limited to Old World species (Fig. 1B, lane a). The difference in size of the antisense transcripts between Old and New World species are likely to be due to differences in size of the coding and flanking regions of the HIS-1 genes. HIS-1 transcripts and histone H1 polypeptides have been shown previously to be developmentally regulated, and
expressed at higher levels in metacyclic promastigotes than procyclic promastigotes (Noll et al., 1997). Using Northern blot analysis, an investigation was carried out to determine whether the anti-HIS-1 transcripts were developmentally regulated in promastigotes taken at different stages of growth (Fig. 2). Membranes were initially probed with the a-32P-labelled HIS-1 sense riboprobe, then stripped and reprobed with radioactively labelled a-tubulin, a gene known to be developmentally regulated in promastigotes (Coulson et al., 1996). During the differentiation of promastigotes into infective forms, the level of a-tubulin RNA (Fig. 2) increased at densities of 2.6 £ 107 –4.4 £ 107 parasites/ml (lanes d and e) and then decreased when densities reached 6.2 £ 107 – 8.5 £ 107 parasites/ml (lanes f and g). Similarly, anti-HIS-1 transcripts were developmentally regulated, with the highest levels of anti-HIS-1
Fig. 2. Developmental expression of anti-HIS-1 transcripts in L. major. Cytoplasmic RNA was isolated from L. major (strain LV39) parasites grown at densities of 3.8 £ 106/ml (lane a), 1.1 £ 107 /ml (lane b), 1.8 £ 107/ml (lane c), 2.6 £ 107/ml (lane d), 4.4 £ 107/ml (lane e), 6.2 £ 107/ml (lane f) and 8.5 £ 107/ml (lane g), fractionated (10 mg) on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. Membranes were probed with strand-specific riboprobes that recognise HIS-1 or anti-HIS-1 transcripts. Membranes were also probed with a riboprobe complementary to a-tubulin as a control for differentiation. The rRNA profile of the different samples is shown as loading control.
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
transcripts seen at densities of 2.6 £ 107 –4.4 £ 107 parasites/ml (lanes d and e), when compared with densities of 6.2 £ 107 – 8.5 £ 107 parasites/ml (lanes f and g). Unlike the HIS-1 transcripts where the maximum level of expression was obtained at the stationary phase of development, the maximum level of anti-HIS-1 transcripts was reached during the mid-logarithmic phase of parasite development (Fig. 2). However, like HIS-1, expression of the anti-HIS-1 transcripts was also detected in the intracellular, amastigote stage of the parasite (data not shown).
3.2. Mapping antisense transcripts to the HIS-1.1 and HIS-1.2 genes Two different sized anti-HIS-1 transcripts were detected in Leishmania (see Fig. 1). However, it was not clear to which HIS-1 gene they mapped. Mapping antisense transcripts is not a trivial task, since they are expressed at low levels within the cell, and they can be difficult to isolate by a simple reverse transcriptase-PCR approach due to the presence of interfering sense HIS-1 transcripts. Therefore, Northern blotting, using different strand-specific probes that
969
span the HIS-1.1 and HIS-1.2 genes, was carried out to address this question (Fig. 3). Probes used to map the anti-HIS-1 transcripts to the HIS-1 genes are shown in Fig. 3A. Probes I and II were derived from the HIS-1.1 region and were also present in the HIS-1.2 gene. Probe III is specific to sequences downstream of the HIS-1.1 gene and probe IV is specific to sequences downstream of HIS-1.2. Probe I, the most upstream probe with respect to HIS-1, did not recognise any anti-HIS-1 transcripts even when membranes were exposed to X-ray film for a long period of time (Fig. 3B, lane a). Additional Northern blot analysis to confirm this finding, showed that the 30 ends of both anti-HIS-1.1 and anti-HIS-1.2 transcripts could be mapped to the intervening sequence between probes I and II of both genes (data not shown). Probe II, derived from the entire HIS-1.1 gene, which also recognised the HIS-1.2 gene, detected both transcripts as expected (Fig. 3B, lane b). Probe III, derived from sequence downstream of the HIS-1.1 gene did not recognise any anti-HIS-1 transcripts (Fig. 3B, lane c), indicating that the 0.8 kb transcript started in the sequence recognised by probe II, and that the 2.5 kb antisense transcript was transcribed from the HIS-1.2 gene. Probe IV, derived from sequence
Fig. 3. Mapping of anti-HIS-1 transcripts to the HIS-1 locus. (A) Map of the HIS-1 locus in L. major (Belli et al., 1999), including restriction enzyme cleavage sites: E: Eco RI, H: Hinc II, N: Nru I, P: Pst I. HIS-1.1 and HIS-1.2 genes, defined by their splice acceptor and polyadenylation sites are represented by open boxes. Recognition sites of the strand-specific riboprobes to this locus are indicated. Riboprobe I maps to a 0.56 kb, Nru I/Pst I fragment; riboprobe II maps to the HIS-1 coding region; riboprobe III maps to a 0.7 kb Nru I/Eco RI fragment; and riboprobe IV maps to a 0.7 kb, Nru I/Pst I fragment downstream of HIS-1.2. Positions of primers 2 and 3, used to map the 50 regions of the antisense transcripts is shown. Open boxes represent the positions of the HIS-1.1 and HIS-1.2 coding regions. (B) Cytoplasmic RNA isolated from L. major (strain Friedlin) was fractionated on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. The membrane was cut into strips and analysed with riboprobes I to IV. (C) PCR amplified material using primers 2 and 1 (oligodT; lane a) or primers 3 and 1 (oligodT; lane b) was separated on an agarose gel, transferred to Genescreen Plus membrane and hybridised with a 32P-labelled HIS-1 probe.
970
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
downstream of the HIS-1.2 gene recognised a single 2.5 kb transcript (Fig. 3B, lane d), providing further evidence that the 2.5 kb anti-HIS-1 transcript maps to the HIS-1.2 gene, and the 0.8 kb anti-HIS-1 transcript maps to the HIS-1.1 gene copy. Additional mapping experiments using reverse transcriptase-PCR and specific downstream primers to the HIS-1.1 and HIS-1.2 genes were performed. When primer 3, located 30 to the HIS-1.2 gene, , 700 bp from the initiation codon of the HIS-1.2 copy (Fig. 3A), was used together with the oligodT primer 1, a specific cDNA PCR product was amplified (data not shown). When primer 2, located 30 to the HIS-1.1 gene, , 700 bp from the initiation codon was used, together with the oligodT primer 1 (Fig. 3A), no cDNA fragments were amplified (data not shown). Amplified products were analysed by agarose gel electrophoresis and Southern blotting using a a-32P-labelled HIS-1 probe (Fig. 3C). A specific product of , 750 bp was detected in PCRs using the oligodT primer 1 and primer 3 (Fig. 3C, lane b), and no product was detected in PCRs performed using oligodT primer 1 and primer 2 (Fig. 3C, lane a). These data confirmed that the 2.5 kb anti-HIS-1 transcript maps to the HIS-1.2 gene, and the 0.8 kb anti-HIS-1 transcript maps to the HIS-1.1 gene copy. From our mapping data, we can further conclude that the small antisense transcript commenced in the sequence recognised by probe II and not in the sequence recognised by probe III. This information was used to determine whether the smaller transcript was produced by transsplicing and whether the addition of the 39 nucleotides of the splice leader had occurred. To detect if the 0.8 kb transcript was modified, we performed a primer extension experiment. Cytoplasmic RNA was reverse transcribed using an end-labelled oligonucleotide (D2-sw3) that hybridised specifically to 28 nucleotides placed 14 nucleotides
downstream of the HIS-1 stop codon. An extended product of 80 nucleotides was only detected when Leishmania RNA was present in the reaction (Fig. 4, lane c). No product could be detected in the presence of yeast RNA (Fig. 4, lane b). When the length of the extended product was aligned with the histone HIS-1 sequence, the 30 end of the extended product mapped to an A/T-rich region due to 28 of the 33 nucleotides having hybridised specifically (Fig. 4, black arrow). However, it could also be postulated that the extended product contained a splice leader of 39 nucleotides, thus, enabling us to define the splice acceptor site. If this was the case, the 80 nucleotide extension product should have contained the 39 nucleotides of the splice leader. By subtracting the 39 nucleotides of the splice leader and the 33 nucleotides of the D2-sw3 oligonucleotide, the AG dinucleotide involved in the trans-splicing should have been identified. Interestingly, there was no potential AG acceptor splice site in this region (Fig. 4, open arrow) suggesting that the antisense transcript was not processed by the addition of a splice leader. Thus, the antisense transcript was either produced by simple cleavage of a long precursor RNA, or this region was used as an entry site for a RNA polymerase.
3.3. Antisense transcription of a selectable marker in the histone H1 locus Antisense transcription in the HIS-1 locus was analysed further. The targeting construct engineered (Fig. 5A) was designed to replace the HIS-1.2 coding region in L. major by homologous recombination with the coding region of the selectable marker neomycin phosphotransferase (Neo). However, only one allelic copy of the HIS-1.2 gene was disrupted. Attempts to eliminate the other HIS-1.2 allelic
Fig. 4. Determination of the 50 end of the antisense transcript by primer extension. A specific oligonucleotide was hybridised to 10 mg of cytoplasmic RNA from yeast (lane b) or Leishmania (lane c) and used in a primer extension reaction. The reaction product was separated on a 5% sequencing gel. pBR32 DNA was digested by Hae III, end-labelled and used as a molecular weight marker (lane a). The sequence 14 nucleotides downstream of the stop codon of the HIS-1 gene is shown. The 28 nucleotides of D2-sw3 (total 33 nucleotides) that hybridise to the HIS-1 genes are underlined. The black arrow indicates the 30 end of the extended product. The open arrow represents the predicted 30 end of the extended product if a splice leader was added to the transcript.
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
971
polyadenylation sites situated in the 50 and 30 histone H1 untranslated regions. This 4 kb transcript was not present in the wild type parasite IR75 (Fig. 5B, lane a) or in parasites transfected with the pX vector, which encodes neomycin phosphotransferase and is devoid of any of the HIS-1 sequences (Fig. 5B, lane c). In this case, the results suggest that antisense transcripts do not interfere with transcription of the sense transcripts in a way that would in turn affect the expression of the neomycin phosphotransferase gene that is essential for neomycin resistance of the transfected clones. It demonstrates also that Neo antisense transcripts are linked to the presence of the HIS-1 sequences and are not due to sequences present in the vector or in the phosphotransferase encoding gene. Some additional transcripts are detected in the Leishmania transfected lines. The origin of these transcripts is not known. In any case, it does not affect the interpretation of our results, since the 4 kb RNA is specifically expressed in the KO8 line and not in the pX line.
3.4. The HIS-1 locus contains adenine and thymine-rich sequences and encodes the additional antisense transcript, SC-1
Fig. 5. Homologous recombination of the HIS-1.2 gene with the Neo gene. (A) Schematic representation of the targeting construct used to replace the HIS-1.2 gene in HIS-1 locus. The direction of transcription of the inserted neomycin resistance gene (Neo) is indicated by an arrow. (B) Cytoplasmic RNA was isolated from the L. major strain IR78 (lane a), the transfected KO8 line (lane b) and the pX transfected line (lane c), fractionated on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. Membranes were hybridised with a 32P-labelled Neo sense riboprobe. The arrow indicates the 4.0 kb Neo antisense transcript detected in the KO8 parasite.
copy, as well as the HIS-1.1 gene copies were unsuccessful, suggesting that deletion of these genes could be lethal for the parasite. The presence of pGEM-1 vector and Neo sequences simplified the task of locating the integrated DNA in the transformants. Confirmation that only one of the two HIS-1.2 alleles was disrupted in the G418 resistant clones was verified by Southern blotting and PCR (data not shown). One robust clone, KO8, was chosen for further analysis. Poly(A)þ RNA was extracted from KO8 transformants and analysed by Northern blotting. Membranes were probed with an a-32P-labelled Neo probe to detect antisense expression of the selectable marked Neo. A 4 kb band corresponding to the expected size for an antisense transcript arising from the targeting construct was detected (Fig. 5B, lane b). This estimated size was based on the length of the different portions of the targeting construct together with the position of the splice acceptor and
Pol II promoters have not been described thus far in trypanosomatids. However, adenine and thymine (A/T)-rich sequences have been suggested to play a role as entry sites for RNA pol II in these parasites (Swindle and Tait, 1996; McAndrew et al., 1998). In the HIS-1 locus, A/T-rich sequences have been identified (Fig. 6A). The dashed horizontal line in Fig. 6A shows five regions with an A/T content of . 70% as identified by scanning the locus with a window size of 50 nucleotides using the MacVector 3.5 software. Two of these A/T-rich sequences were located upstream of the anti-HIS-1.1 and anti-HIS-1.2 transcripts (positions 8,237 – 8,259 bp and 27,518 – 27,626 bp, respectively, in the cosmid L979). An additional open reading frame was detected downstream of a third A/T-rich region (position 21,016 – 21,063 bp) in the HIS-1 locus. This open reading frame named SC-1 and present only once in the Leishmania genome (data not shown), was predicted to code for a polypeptide of 152 amino acids (position 20,569 – 20,114 bp). This coding region was positioned on the same strand as the HIS-1 antisense transcripts. The transcription of the SC-1 open reading frame was further analysed in vivo. Strand-specific probes to SC-1 were used to hybridise cytoplasmic RNA of amastigotes and promastigotes by Northern blotting. Using a single-stranded probe, complementary to the SC-1 open reading frame, a band corresponding to a transcript of 0.6 kb was detected in the amastigote stage of the parasite (Fig. 6B, lane b). Defined transcripts were not detected in the amastigote stage for the other strand (Fig. 6B, lane a). Conversely, multiple transcripts were detected in the promastigote stage when
972
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
Fig. 6. Adenine and thymine-rich sequences in the HIS-1 locus of Leishmania and detection of the additional antisense SC-1 transcript. (A) Percentage of adenine- and thymine-rich sequences in the HIS-1 locus using a window size of 50 nucleotides (MacVector 3.5). The dashed line across the graph corresponds to an adenine and thymine content of 70%. Open bars on the graph represent the positions of HIS-1.1 and HIS-1.2 coding regions. The three antisense transcripts are indicated by arrows and their position in the locus indicated with reference to the sequence of the L979 cosmid. The positions of the adenine and thymine-rich sequences are given in the text. (B) Cytoplasmic RNA was isolated from L. major amastigotes (lanes a and b) and promastigotes (lanes c and d) and treated with glyoxal and fractionated on a 0.8% agarose gel, then transferred to Genescreen Plus membrane. Membranes were probed with SC-1 riboprobes that recognise sense (lanes b and d) and antisense (lanes a and c) gene specific transcripts. The arrow indicates a 0.6 kb mRNA species corresponding to the SC-1 present on the same strand as the anti-HIS-1 transcripts.
using a single-stranded probe corresponding to the SC-1 open reading frame (Fig. 6B, lane c). Defined transcripts were not detected in the promastigote stage with a probe complementary to the SC-1 open reading frame. Considering that the SC-1 gene is present only once in the Leishmania genome, we can exclude the possibility that the transcripts detected were synthesised in another region of the genome.
4. Discussion The organisation of the histone H1 genes in the histone H1 locus of the Leishmania genome has been characterised previously (Noll et al., 1997; Belli et al., 1999). Here, we have provided novel evidence for the presence of overlapping, developmentally regulated, sense and antisense transcripts of the HIS-1.1 and HIS-1.2 genes in the HIS-1
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
locus. HIS-1 reaches maximum expression at the stationary phase of parasite growth, whereas the maximum levels of anti-HIS-1 expression is reached at a mid-logarithmic stage. An additional antisense transcript found on the same strand as the anti-HIS-1 transcripts, SC-1, was also predicted to be present in this locus due to its close proximity to adenine and thymine-rich sequences, proposed previously to serve as Pol II entry sites for antisense transcription in trypanosomatids (McAndrew et al., 1998). The presence of this antisense transcript in the parasites was confirmed by Northern blotting, and its expression was possibly developmentally regulated. Replacement of one allele of the HIS-1.2 gene with the selectable marker Neo, did not interfere with antisense transcription at this locus. In addition, it showed that the regulatory elements controlling antisense transcription of HIS-1.2 were located outside the HIS-1.2 gene. Thus the HIS-1.2þ/2 mutant parasite will provide an ongoing model to enable the future mapping of the regions controlling antisense transcription at the HIS-1 locus in Leishmania, as well as shed more light on the role of antisense transcription in these parasites. It has been shown that antisense RNAs bind to their cognate partners in various organisms to regulate gene expression (Wagner and Simons, 1994; Vanhee-Brossollet and Vaquero, 1998). These antisense RNAs are complementary to transcripts encoding functional proteins involved in diverse biological functions including hormonal response, control of proliferation, development and structure, and viral replication. In Caenorhabditis elegans and Drosophila, as well as in the trypanosomatid T. brucei, it has been shown that double-stranded RNA induces mRNA degradation (Fire et al., 1998; Kennerdell and Carthew, 1998; Ngo et al., 1998). In Leishmania amazonensis, it was shown that the episomal expression of a specific antisense mRNA can affect the level of expression of gp63 in promastigotes (Chen et al., 2000). In the HIS-1 locus in Leishmania, we were unable to demonstrate any interaction between the HIS-1 and anti-HIS-1 transcripts using an RNAse protection assay (T. Noll and N. Fasel, unpublished data). Recent experiments (S. Monnerat and N. Fasel, unpublished data) have suggested that both strands of DNA are transcribed at very different levels, and that the presence of low levels of antisense transcripts is a direct consequence of the low level of transcription of that strand. Thus, it still remains to be definitively determined whether natural antisense transcripts found in trypanosomatids can affect the level of expression of their sense counterparts. Mapping and primer extension studies using the D2-sw3 oligonucleotide revealed the presence of a distinct 50 end on the antisense HIS-1 RNAs, providing evidence that they could undergo active processing during maturation or that regions could be used as entry sites for RNA polymerase (Figs. 3 and 4). Thus far, it is likely that the splice leader sequence is absent from these antisense transcripts. Poly(A)þ antisense transcripts lacking a spliced leader
973
sequence have been identified previously in the DHFR-TS locus of Leishmania (Kapler and Beverley, 1989) and in the DHFR-TS gene of the non-pathogenic trypanosomatid, C. fasciculata (Hughes et al., 1989). These transcripts, that lack a spliced leader sequence, have been mapped to the amplified R region of methotrexate-resistant L. major parasites, and their presence has been ascribed to their episomal expression. The role, if any, of these antisense transcripts in trypanosomatids is not understood, and no evidence of the protein coding potential of the antisense transcripts from the DHFR-TS loci has been reported. Previously, two convergent transcription units overlapping by several kilobases and giving rise to mature transcripts were described in T. brucei (Liniger et al., 2001), demonstrating that sense and antisense transcription occurred from a single chromosomal locus. In this report, however, antisense transcription is observed in a locus with two convergent transcription units. This differs from the histone H1 locus in which antisense transcripts are complementary to the transcripts processed from the polycistronic transcription unit. Sequences generated from the Leishmania genome project and the determination of the precise location of low abundance expressed sequence tags (ESTs) will, in the future, reveal the role and prevalence of naturally occurring antisense transcripts in Leishmania. The data presented here raise the possibility that polymerase entry sites may exist. Type II promoters have not been described in Leishmania. A role for adenine and thymine-rich sequences in polymerase entry for antisense transcripts has been proposed (McAndrew et al., 1998). Relatively long adenine and thymine tracts have been shown to modulate nucleosome organisation in yeast by giving rise to an unusual DNA conformation, supporting the notion that they could facilitate the accessibility of polymerases to promoters (Shimizu et al., 2000). In the HIS-1 locus, five adenine and thymine-rich sequences were identified, and three investigated further for the presence of antisense transcripts. The two anti-HIS-1 transcripts in this locus were identified while investigating their sense HIS-1 counterparts. The SC-1 transcript was predicted by its position relative to an adenine and thymine-rich-sequence, and the presence of this transcript in amastigotes was confirmed by Northern blotting. No complementary mRNA on the polycistronic strand in the amastigote stage of the parasite has been detected. These results therefore indicate that the presence of a transcript on a DNA strand that is complementary to a large polycistronic transcription unit is not absolutely linked to the presence of a complementary RNA or to an open reading frame present on the sense strand. Taken together, these data support the possible role of adenine- and thymine-rich regions in modulating chromatin structure to favour transcription of Leishmania genes. A more detailed analysis of the transcriptional organisation of the complete locus of HIS-1 is now necessary, in parallel with a functional analysis of these sequences, to gain further insights into the
974
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
mechanisms of antisense gene regulation in Leishmania and the role that these transcripts play in controlling developmental gene expression in the parasite life cycle and during infection.
Acknowledgements This work was supported by Grants No. 3100-59450.99 from the Swiss National Research Fund (FNRS) to N.F., who was a recipient of a Dr Max Cloe¨tta Fellowship (Switzerland) and Grant No. AI40599 and AI4102 from the National Institutes of Health to K.S. We thank Nancy Saravia for the gift of New World Leishmania species.
References Belli, S., Formenton, A., Noll, T., Ivens, A., Jacquet, R., Desponds, C., Hofer, D., Fasel, N., 1999. Leishmania major: histone H1 gene expression from the sw3 locus. Exp. Parasitol. 91, 151– 160. Ben Amar, M.F., Jefferies, D., Pays, A., Bakalara, B., Kendall, G., Pays, E., 1991. The actin gene promotor of Trypanosoma brucei. Nucleic Acids Res. 19, 5857– 5862. Beverley, S.M., Clayton, S.E., 1993. Transfection of Leishmania and Trypanosoma brucei by electroporation. Methods in molecular biology. Mol. Biol. 21, 333–348. Chen, D.Q., Kolli, B.K., Yadava, N., Lu, H.G., Gilman-Sachs, A., Peterson, D.A., Chang, K.P., 2000. Episomal expression of specific sense and antisense mRNAs in Leishmania amazonensis: modulation of gp63 level in promastigotes and their infection of macrophages in vitro. Infect. Immun. 68, 80 –86. Clayton, C., Adams, M., Almeida, R., Baltz, T., Barrett, M., Bastien, P., Belli, S., Beverley, S., Biteau, N., Blackwell, J., Blaineau, C., Boshart, M., Bringaud, F., Cross, G., Cruz, A., Degrave, W., Donelson, J., El-Sayed, N., Fu, G., Ersfeld, K., Gibson, W., Gull, K., Ivens, A., Kelly, J., Vanhamme, L., 1998. Genetic nomenclature for Trypasnosoma and Leishmania. Mol. Biochem. Parasitol. 97, 221 –224. Coulson, R.M.R., Connor, V., Chen, J.C., Ajiokia, J.W., 1996. Differential expression of Leishmania major beta-tubulin genes during the acquisition of promastigote infectivity. Mol. Biochem. Parasitol. 82, 227– 236. Fasel, N.J., Robyr, D.C., Maue¨l, J., Glaser, T.A., 1994. Identification of a histone H1-like gene expressed in Leishmania major. Mol. Biochem. Parasitol. 62, 321–323. Fickett, J.W., 1982. Recognition of protein coding regions in DNA sequences. Nucleic Acids Res. 10, 5303–5318. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C.C., 1998. Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans. Nature 391, 806– 811. Graham, S.V., 1995. Mechanisms of stage-regulated gene expression in kinetoplastida. Parasitol. Today 11, 217 –224. Graham, S.V., Barry, J.D., 1995. Transcriptional regulation of metacyclic variant surface glycoprotein gene expression during the life cycle of Trypanosoma brucei. Mol. Cell. Biol. 15, 5945–5956. Graham, S.V., Jefferies, D., Barry, J.D., 1996. A promotor directing alpha-amanitin-sensitive transcription of GARP, the major surface antigen of insect stage Trypanosoma congolense. Nucleic Acids Res. 24, 272 –281. Hughes, D.E., Shonekan, O.A., Simpson, L., 1989. Structure, genomic organization and transcription of the bifunctional dihydrofolate reductase – thymidylate synthase gene from Crithidia fasciculata. Mol. Biochem. Parasitol. 34, 155– 166.
Ivens, A.C., Smith, D.F., 1997. A global map of the Leishmania genome: preclude to genomic sequencing. Trans. R. Soc. Trop. Med. Hyg. 91, 111 –115. Kapler, G.M., Beverley, S.M., 1989. Transcriptional mapping of the amplified region encoding the dihydrofolate reductase–thymidyalte synthase of Leishmania major reveals a high density of transcripts, including overlapping and antisense RNAs. Mol. Cell. Biol. 9, 3959–3972. Kennerdell, J.R., Carthew, R.W., 1998. Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95, 1017–1026. LeBowitz, J.H., Coburn, C.M., Beverley, S.M., 1991. Simultaneous transient expression assays of the trypanosomatid parasite Leishmania using b-galactosidase and b-glucuronidase as reporter enzymes. Gene 103, 119–123. Lee, M.G.-S., 1996. An RN polymerase II promoter in the hsp 70 locus of Trypanosoma brucei. Mol. Cell. Biol. 16, 1220–1230. Liniger, M., Bodenmuller, K., Pays, E., Gallati, S., Roditi, I., 2001. Overlapping sense and antisense transcription units in Trypanosoma brucei. Mol. Microbiol. 40, 869 –878. Martinez-Calvillo, S., Sunkin, S.M., Yan, S., Fox, M., Stuart, K., Myler, P.J., 2001. Genomic organization and functional characterization of the Leishmania major Friedlin ribosomal RNA gene locus. Mol. Biochem. Parasitol. 116, 147– 157. McAndrew, M., Graham, S., Hartmann, C., Clayton, C., 1998. Testing promoter activity in the trypanosome genome: isolation of a metacyclic-type VSG promoter, and unexpected insights into RNA polymerase II transcription. Exp. Parasitol. 90, 65–76. Myler, P.J., Audleman, L., deVos, T., Hixson, G., Kiser, P., Lemley, C., Magness, C., Rickel, E., Sisk, E., Sunkin, S., Swartzell, S., Westlake, T., Bastien, P., Fu, G., Ivens, A., Stuart, K., 1999. Leishmania major Friedlin chromosome 1 has an unusual distribution of protein-coding genes. Proc. Natl Acad. Sci. USA 96, 2902–2906. Myler, P.J., Beverley, S.M., Cruz, A.K., Dobson, D.E., Ivens, A.C., McDonagh, P.D., Madhubala, R., Martinez-Calvillo, S., Ruiz, J.C., Saxena, A., Sisk, E., Sunkin, S.M., Worthey, E., Yan, S., Stuart, K.D., 2001. The Leishmania genome project: new insights into gene organization and function. Med. Microbiol. Immunol. 190, 9– 12. Myler, P.J., Sisk, E., McDonagh, P.D., Martinez-Calvillo, S., Schnaufer, A., Sunkin, S.M., Yan, S., Madhubala, R., Ivens, A., Stuart, K., 2000. Genomic organization and gene function in Leishmania. Biochem. Soc. Trans. 28, 527–531. Ngo, H., Tschudi, C., Gull, K., Ullu, E., 1998. Double-stranded RNA induces mRNA degradation in Trypanosoma brucei. Proc. Natl Acad. Sci. USA 95, 14687–14692. Noll, T., Desponds, C., Belli, S.I., Glaser, T.A., Fasel, N.J., 1997. Histone H1 expression varies during the Leishmania major life cycle. Mol. Biochem. Parasitol. 84, 215 –227. Ochman, H., Medhora, M.M., Garza, D., Hartl, D.L., 1990. Amplification of flanking sequences by inverse PCR. PCR Protocols. A Guide to Methods and Applications, M.A. Imis, D.H. Geefand, J.J. Sninsky and T.J. White, (eds), pp 219–227 Academic Press, San Diego. Patnaik, P.K., Bellofatto, V., Hartree, D., Cross, G.A., 1994. An episome of Trypanosoma brucei can exist as an extrachromosal element in a broad range of trypanosomatids but shows different requirements for stable replication. Mol. Biochem. Parasitol. 66, 153–156. Pays, E., Vanhamme, L., 1996. Developmental regulation of gene expression in African trypanosomes. In: Smith, D.F., Parsons, M. (Eds.), Molecular Biology of Parasitic Protozoa, Oxford University Press, Oxford, pp. 88–114. Pearson, W.R., Lipman, D.J., 1990. Improved tools for biological sequence analysis. Proc. Natl Acad. Sci. USA 85, 2444– 2448. Salzberg, S.L., Delcher, A.L., Kasif, S., White, O., 1998. Microbial gene identification using interpolated Markov models. Nucleic Acids Res. 26, 544–548. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a Laboratory
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975 Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Shimizu, M., Mori, T., Sakuria, T., Shindo, H., 2000. Destabilization of nucleosomes by an unusual DNA conformation adopted by poly(dA) poly(dT) tracts in vivo. EMBO J. 19, 3358–3365. Swindle, J., Tait, A., 1996. Trypanosmatid genetics. Molecular Biology of Parasitic Protozoa, IRL Press, New York, NY, pp. 6–34.
975
Ullu, E., Tschudi, C., Gu¨nzl, A., 1996. Trans-splicing in trypanosomatid protozoa. In: Smith, D.F., Parsons, M. (Eds.), Molecular Biology of Parasitic Protozoa, Oxford Press, Oxford, pp. 115–133. Vanhee-Brossollet, C., Vaquero, C., 1998. Do natural antisense transcripts make sense in eukaryotes? Gene 211, 1–9. Wagner, E.G., Simons, R.W., 1994. Antisense RNA control in bacteria, phages, and plasmids. Annu. Rev. Microbiol. 211, 1–9.
Sense and antisense transcripts in the histone H1 (HIS-1) locus of Leishmania major Sabina I. Bellia,1, Se´verine Monnerata, Ce´dric Schaffa, Slavica Masinaa, Tanja Nolla, Peter J. Mylerb,c, Kenneth Stuartb,c, Nicolas Fasela,* a
Institute of Biochemistry, University of Lausanne, Ch. des Boveresses 155, Epalinges 1066, Switzerland b Seattle Biomedical Research Institute, Seattle, WA 98109-1653, USA c Department of Pathobiology, University of Washington, Seattle, WA 98195, USA Received 9 January 2003; received in revised form 29 April 2003; accepted 1 May 2003
Abstract Histone H1 in the parasitic protozoan Leishmania is a developmentally regulated protein encoded by two genes, HIS-1.1 and HIS-1.2. These genes are separated by , 20 kb of sequence and are located on the same DNA strand of chromosome 27. When Northern blots of parasite RNA were probed with HIS-1 strand-specific riboprobes, we detected sense and antisense transcripts that were polyadenylated and developmentally regulated. When the HIS-1.2 coding region was replaced with the coding region of the neomycin phosphotransferase gene, antisense transcription of this gene was unaffected, indicating that the regulatory elements controlling antisense transcription were located outside of the HIS-1.2 gene, and that transcription in Leishmania can occur from both DNA strands even in the presence of transcription of a selectable marker in the complementary strand. A search for other antisense transcripts within the HIS-1 locus identified an additional transcript (SC-1) within the intervening HIS-1 sequence, downstream of adenine and thymine-rich sequences. These results show that gene expression in Leishmania is not only regulated polycistronically from the sense strand of genomic DNA, but that the complementary strand of DNA also contains sequences that could drive expression of open reading frames from the antisense strand of DNA. These findings suggest that the parasite has evolved in such a way as to maximise the transcription of its genome, a mechanism that might be important for it to maintain virulence. q 2003 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. Keywords: Histone H1; Leishmania; Antisense transcription
1. Introduction In higher eukaryotes, gene expression is primarily controlled at the level of transcription initiation. In contrast, gene expression in trypanosomatids, such as Leishmania, is primarily regulated at the post-transcriptional level, and the mechanisms by which this occurs has been reviewed extensively elsewhere (Graham, 1995; Pays and Vanhamme, 1996; Ullu et al., 1996). Briefly, the genes in trypanosomatids are arranged into polycistronic transcription units that are processed to mono-cistronic mRNAs by a mechanism involving the trans-splicing of a ‘mini-exon’ (providing the 50 cap structure) to the primary transcript. It is * Corresponding author. Tel.: þ 41-21-6925-732; fax: þ41-21-6925-705. E-mail address: [email protected] (N. Fasel). 1 Present address: Institute for the Biotechnology of Infectious Diseases, University of Technology, Sydney, Gore Hill, N.S.W. 2065, Australia.
thought that this reaction is coupled to the polyadenylation of mRNA. This mechanism of RNA processing generates multiple mRNAs that can be differentially regulated in the free-living flagellated promastigote form, present in the gut of the insect, or in the non-motile amastigote form, found in the vertebrate host macrophage. Regulation of gene expression is further affected by the degree of maturation of the transcripts, their stability within the parasite, and the level of translation of the processed transcripts. Over recent years, extensive analysis of the Leishmania genome is providing further evidence for the presence of large transcriptional units within the genome (Myler et al., 1999). Based on bioinformatic programs specifically adapted for Leishmania, it was proposed that genes are organised into large clusters and transcribed from only one strand (Myler et al., 1999, 2000, 2001; Martinez-Calvillo et al., 2001). In other trypanosomatids such as Trypanosoma brucei,
0020-7519/03/$30.00 q 2003 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. doi:10.1016/S0020-7519(03)00126-7
966
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
the variant surface glycoprotein (VSG) and the protein, procyclin, are expressed at high levels within the parasite, and transcription of the genes encoding these proteins is unusual (Graham and Barry, 1995; Graham et al., 1996; Pays and Vanhamme, 1996). Unlike higher eukaryotes, transcription of the genes encoding VSG and procyclin is carried out by RNA polymerase I or a pol I-like enzyme. There is still some controversy regarding the presence of true RNA polymerase promoters in trypanosomes. There is little evidence to support the presence of RNA polymerase II or pol II-like enzymes in the transcription of genes in these parasites (Ben Amar et al., 1991; Lee, 1996; Graham et al., 1996). Nuclear run-on experiments have not provided evidence for the developmental regulation of transcriptional initiation or elongation by RNA pol II, and RNA pol II promoter trapping experiments in trypanosomes have not identified any RNA pol II elements (McAndrew et al., 1998; Patnaik et al., 1994). It was therefore proposed that in trypanosomes, RNA pol II initiation is favoured by genomic accessibility and double-strand transient melting of adenine and thymine (A/T)-rich sequences, that would serve as entry sites for polymerases on either strand (McAndrew et al., 1998; Swindle and Tait, 1996). Naturally occurring antisense transcripts have been described in both prokaryotes and eukaryotes, and are defined as complementary RNA sequences to sense RNA transcripts of an already known function (for a review, see Wagner and Simons, 1994; Vanhee-Brossollet and Vaquero, 1998). There have been a small number of reports documenting the presence of antisense transcripts in trypanosomatids. These transcripts have been detected in the dihydrofolate reductase-thymidylate synthase (DHFR-TS) locus of Leishmania and Crithidia fasciculata (Kapler and Beverley, 1989; Hughes et al., 1989). However, their presence remains circumstantial and the mechanisms regulating their expression are unclear. The two genes, sw3.0 and sw3.1, encoding histone H1 are identical in their 50 untranslated regions, and in their coding regions, but differ in their 30 untranslated regions (Belli et al., 1999). These genes have been subsequently renamed, HIS-1.1 and HIS-1.2, respectively, according to the genetic nomenclature for Trypanosoma and Leishmania (Clayton et al., 1998). The genes are transcribed from the same DNA strand, and it is likely that they are processed from the same polycistronic transcription unit. In this study, we have used the HIS-1 locus as a model to characterise the transcriptional organisation of genes in Leishmania, with specific emphasis on antisense transcription.
2. Materials and methods 2.1. Parasites The following parasites were used: Leishmania major promastigote strains MRHO/SU/59/P (LV39),
MRHO/IR/75/ER (IR75) and MHOM/JL/80/Friedlin (Friedlin); Leishmania guyanensis promastigote strain MHOM/BR/75/M5313; Leishmania panamensis promastigote strain MHOM/PA/71/LS94. All parasites were maintained at 26 8C in Dulbecco’s modified Eagle’s medium (DMEM; Gibco-BRL) on solid blood agar, supplemented with 10% foetal bovine serum (Seromed) and 10 mg/ml gentamicin. Alternatively, parasites were maintained in M199 (Gibco) supplemented with 10% foetal bovine serum (Seromed), 10 mg/ml gentamicin, 0.05 mM adenine, 0.5% hemin folate and 40 mM HEPES pH 7 (Gibco). 2.2. Analysis of HIS-1.1 and HIS-1.2 flanking sequences The HIS-1.1 and HIS-1.2 genes, including their flanking sequences, were cloned and sequenced as described previously (Fasel et al., 1994; Belli et al., 1999). Sequences were analysed using the program SEQUENCHER Version 3.1RC2 (Gene Codes Corporation) and LALIGN (Pearson and Lipman, 1990). The flanking regions of the HIS-1 genes were amplified from genomic DNA isolated from L. major strain LV39 parasites or from the cosmid L6577, which contains genomic DNA isolated from L. major strain Friedlin (Ivens and Smith, 1997). The flanking regions of the HIS-1.2 gene were amplified from genomic DNA isolated from the cosmid L2718. The flanking sequences of HIS-1 were amplified using the technique of inverse PCR (Ochman et al., 1990). The PCR was carried out using oligonucleotide primers orientated towards the 50 and 30 untranslated regions of the HIS-1.1 open reading frame. The following primers were used: UE-HIS-1 (50 ATAGACACGGTGCGGGGAGAGCTG3 0 ) and DH-HIS-1 (50 CGGGCTCTCTCGCGTTTTT CG30 ), or FLS-HIS-1 (50 AGCGGCGGAATTAGAGGACAT30 ) and FLA-HIS-1 (50 CACG TGCCCGAAGACGCATCAT30 ). Amplified products were subcloned into the vector pGEM-1 (Promega) and sequenced. Sequences corresponding to the flanking regions of the HIS-1.1 and HIS-1.2 genes were compared to the genomic sequence of the complete histone H1 locus obtained from the cosmid, L979 (GenBank Accession no. AC008242), shown previously to contain both histone H1 copies (Belli et al., 1999). The SC-1 gene was isolated from the cosmid L979 by the PCR using the 50 primer SC1 (50 CGCGGATCCTGTGTGTGTGTGTGTGTGTGTGTGCGTGTATGT30 ) located at position 20,537 bp in the cosmid L979 and the 30 primer SC2 (50 CCAAGCTTTCTCACTGACCCTGTC CCTC30 ) located at position 20,110 bp in the cosmid L979. The SC-1 gene was then cloned into the pCR2.1-TOPO-1 vector (Invitrogen). The insert was digested by Xba I and Bam H1, recloned into pGEM-1 and sequenced. The DNA was analysed using the software programs, MacVector 3.5e (International Biotechnologies Ltd), TestCode and Glimmer (Fickett, 1982; Salzberg et al., 1998).
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
2.3. RNA extraction and northern blot analysis RNA was extracted as described previously (Fasel et al., 1994). Poly(A)þ RNA was extracted using the FastTrack kit 2.0 mRNA isolation kit (Invitrogen). Cytoplasmic (15 mg) and poly(A)þ RNA (1 mg) were treated with glyoxal, separated on a 0.8% agarose gel and transferred to Genescreen Plus membrane (NEN Research Products) using a Vacublot apparatus (Fasel et al., 1994). Hybridisations and washings were carried out as described previously (Fasel et al., 1994). Sense and antisense riboprobes were transcribed from DNAs that had been cloned into pGEM-1. Plasmids were linearised using enzymes situated 30 of either the Sp6 or T7 RNA polymerase promoters prior to in vitro transcription, and labelling with a-32P-UTP as described previously (Noll et al., 1997; Sambrook and Russell, 2001). To detect transcripts antisense to the neomycin phosphotransferase gene, 233 nucleotides corresponding to the N-terminal coding region of the neomycin phosphotransferase gene were subcloned into pGEM-1 and transcribed in vitro using Sp6 RNA polymerase. 2.4. Transfections and homologous recombination Parasites were transfected according to established protocols (Beverley and Clayton, 1993). A clone of L. major strain IR75 (clone 6) was grown to logarithmic phase in M199 medium. Parasites (2 £ 108) were transfected with 80 mg of the targeting construct. The targeting construct was engineered as follows. The HIS-1 coding region was replaced with the neomycin phosphotransferase coding region (Neo), and upstream to this region, 146 bp of 50 sequence common to both HIS-1 copies was inserted. Downstream to the Neo coding region, pGEM-1 vector sequences were inserted as well as 500 bp of 30 sequence specific to HIS-1.2 (see Fig. 4A). The HIS-1 upstream and the HIS-1.2 downstream sequences contained the splice acceptor and polyadenylation sites. All sequences were ligated into the 2.9 kb pGEM-1 vector. When integrated into the genome, this construct could generate a transcript of 4.4 kb. The presence of pGEM-1 and Neo sequences enabled the targeted region to be easily identifiable in the transformants by Southern blotting. The transfection was performed using the Bio-Rad Gene Pulser under the following conditions: 500 mFD, 0.45 kV. After 24 h, the parasites were plated onto M199 agar in the presence of the antibiotic G418. Resistant clones were analysed by Southern blotting and PCR to ascertain that a single allele was eliminated (data not shown). Briefly, genomic DNA was isolated from parasites grown to stationary phase, restriction digested and analysed by Southern blotting according to established protocols (Belli et al., 1999; Sambrook and Russell, 2001). a-32P-dCTP labelled probes were prepared by random priming according to the manufacturer’s specifications (Boehringer Mannheim), and membranes were probed and washed as described
967
previously (Belli et al., 1999). Leishmania major IR75 parasites were transfected with the pX vector (Lebowitz et al., 1991), which encodes neomycin phosphotransferase but is lacking any HIS-1 sequences. This transfected cell line was used as a control in Northern blotting studies. 2.5. PCR Reverse transcribed cytoplasmic RNA was amplified using the primer oligodT (primer 1), and the HIS-1.1 flanking region oligonucleotide, primer 2 (50 TGCACCCCAGCGCAC30 ) or the HIS-1.2 flanking region specific oligonucleotide, primer 3 (50 TGATGTGCGTTCGCG30 ). Amplified products were separated on an agarose gel, transferred to a Genescreen Plus membrane and hybridised with a HIS-1 probe according to protocols published previously (Noll et al., 1997; Belli et al., 1999; Sambrook and Russell, 2001). 2.6. Primer extension The 33 nucleotide D2-sw3 oligonucleotide (50 -CCGAAGCTTGCCCGTGGCTGCACTGTA CGCTCTT-30 ) has 28 nucleotides that hybridises specifically to the HIS-1 gene copies (Fig. 4), and is located 14 nucleotides downstream of the stop codon. D2-sw3 was end-labelled with g-32P-ATP in the presence of T4 polynucleotide kinase and hybridised at 30 8C overnight to 10 mg of heat denatured cytoplasmic RNA. The reverse transcriptase reaction was performed in the presence of AMV reverse transcriptase for 1 h at 42 8C according to the protocol described by the supplier (Roche). The sample was then treated with DNase-free RNAse for 20 min at 37 8C, extracted with phenol chloroform and loaded on a 5% sequencing gel. The gel was dried and exposed.
3. Results 3.1. Detection of histone H1 antisense mRNAs in Leishmania The two copies of the gene encoding histone H1 are separated by , 20 kb of intergenic sequence on chromosome 27 in L. major. This entire locus, located in cosmid L979 has been fully sequenced (GenBank Accession No. AC008242). Two histone mRNAs of 621 and 756 bp in size, excluding the poly(A)þ tail, are synthesised from the HIS-1.1 and HIS-1.2 genes, respectively (Belli et al., 1999). The organisation of the HIS-1 transcriptional unit was analysed further to search for additional transcripts on both strands of the DNA using strand-specific riboprobes to the HIS-1.1 gene. The probe chosen recognised both HIS-1.1 and HIS-1.2 genes. Cytoplasmic and poly(A)þ RNA of L. major promastigotes (Fig. 1A) were analysed by Northern blotting using 32P-labelled riboprobes that specifically
968
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
Fig. 1. Analysis of histone H1 complementary transcripts in Leishmania species. (A) Cytoplasmic (10 mg; lanes a and c) and poly(A)þ RNA (1 mg; lanes b and d) isolated from L. major (strain LV39) were fractionated on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. Membranes were probed with a strand-specific riboprobe to detect anti-HIS-1 transcripts (lanes a and b) or to detect HIS-1 mRNAs (lanes c and d). (B) Cytoplasmic RNA isolated from L. major (strain LV39; lane a), L. guyanensis (lane b) and L. panamensis (lane c) was fractionated on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. The membrane was probed with a strand-specific probe to detect anti-HIS-1 transcripts and was exposed for 5 days (panel A, lanes a and b) and for 3 days (panel B, lanes a –c). The membrane probed to detect HIS-1 mRNAs was exposed for 12 h.
detected HIS-1 sense and antisense transcripts (anti-HIS-1 transcripts). Two HIS-1 sense transcripts of the expected size were detected in both cytoplasmic and poly(A)þ RNA fractions (Fig. 1A, lanes c and d), the smaller and the larger size transcripts being representative of transcription from the HIS-1.1and HIS-1.2 genes, respectively. When the membranes were probed with a probe complementary to the open reading frame of the HIS-1 gene, two antisense transcripts of 0.8 and 2.5 kb, were detected in both cytoplasmic and poly(A)þ RNA fractions (Fig. 1A, lanes a and b). The ratio of HIS-1 transcripts to anti-HIS-1 transcripts was estimated. Membranes were probed with sense and antisense riboprobes having the same specific activity. The level of expression of the anti-HIS-1 transcripts at steady state was about 20– 30 times less than the level of expression of HIS-1 steady state RNA (data not shown). The differences in size between the sense and antisense transcripts excluded the possibility that signals on Northern blots were due to the hybridisation of low levels of histone H1 probes that could have arisen by reverse priming during the synthesis of the anti-HIS-1 specific probe. The L. major specific HIS-1 probe was also used to probe RNA isolated from New World species of Leishmania. This probe recognised two antisense transcripts of 2.2 and 3.5 kb in L. guyanensis RNA (Fig. 1B, lane b) and L. panamensis RNA (Fig. 1B, lane c), indicating that histone H1 antisense transcription is not limited to Old World species (Fig. 1B, lane a). The difference in size of the antisense transcripts between Old and New World species are likely to be due to differences in size of the coding and flanking regions of the HIS-1 genes. HIS-1 transcripts and histone H1 polypeptides have been shown previously to be developmentally regulated, and
expressed at higher levels in metacyclic promastigotes than procyclic promastigotes (Noll et al., 1997). Using Northern blot analysis, an investigation was carried out to determine whether the anti-HIS-1 transcripts were developmentally regulated in promastigotes taken at different stages of growth (Fig. 2). Membranes were initially probed with the a-32P-labelled HIS-1 sense riboprobe, then stripped and reprobed with radioactively labelled a-tubulin, a gene known to be developmentally regulated in promastigotes (Coulson et al., 1996). During the differentiation of promastigotes into infective forms, the level of a-tubulin RNA (Fig. 2) increased at densities of 2.6 £ 107 –4.4 £ 107 parasites/ml (lanes d and e) and then decreased when densities reached 6.2 £ 107 – 8.5 £ 107 parasites/ml (lanes f and g). Similarly, anti-HIS-1 transcripts were developmentally regulated, with the highest levels of anti-HIS-1
Fig. 2. Developmental expression of anti-HIS-1 transcripts in L. major. Cytoplasmic RNA was isolated from L. major (strain LV39) parasites grown at densities of 3.8 £ 106/ml (lane a), 1.1 £ 107 /ml (lane b), 1.8 £ 107/ml (lane c), 2.6 £ 107/ml (lane d), 4.4 £ 107/ml (lane e), 6.2 £ 107/ml (lane f) and 8.5 £ 107/ml (lane g), fractionated (10 mg) on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. Membranes were probed with strand-specific riboprobes that recognise HIS-1 or anti-HIS-1 transcripts. Membranes were also probed with a riboprobe complementary to a-tubulin as a control for differentiation. The rRNA profile of the different samples is shown as loading control.
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
transcripts seen at densities of 2.6 £ 107 –4.4 £ 107 parasites/ml (lanes d and e), when compared with densities of 6.2 £ 107 – 8.5 £ 107 parasites/ml (lanes f and g). Unlike the HIS-1 transcripts where the maximum level of expression was obtained at the stationary phase of development, the maximum level of anti-HIS-1 transcripts was reached during the mid-logarithmic phase of parasite development (Fig. 2). However, like HIS-1, expression of the anti-HIS-1 transcripts was also detected in the intracellular, amastigote stage of the parasite (data not shown).
3.2. Mapping antisense transcripts to the HIS-1.1 and HIS-1.2 genes Two different sized anti-HIS-1 transcripts were detected in Leishmania (see Fig. 1). However, it was not clear to which HIS-1 gene they mapped. Mapping antisense transcripts is not a trivial task, since they are expressed at low levels within the cell, and they can be difficult to isolate by a simple reverse transcriptase-PCR approach due to the presence of interfering sense HIS-1 transcripts. Therefore, Northern blotting, using different strand-specific probes that
969
span the HIS-1.1 and HIS-1.2 genes, was carried out to address this question (Fig. 3). Probes used to map the anti-HIS-1 transcripts to the HIS-1 genes are shown in Fig. 3A. Probes I and II were derived from the HIS-1.1 region and were also present in the HIS-1.2 gene. Probe III is specific to sequences downstream of the HIS-1.1 gene and probe IV is specific to sequences downstream of HIS-1.2. Probe I, the most upstream probe with respect to HIS-1, did not recognise any anti-HIS-1 transcripts even when membranes were exposed to X-ray film for a long period of time (Fig. 3B, lane a). Additional Northern blot analysis to confirm this finding, showed that the 30 ends of both anti-HIS-1.1 and anti-HIS-1.2 transcripts could be mapped to the intervening sequence between probes I and II of both genes (data not shown). Probe II, derived from the entire HIS-1.1 gene, which also recognised the HIS-1.2 gene, detected both transcripts as expected (Fig. 3B, lane b). Probe III, derived from sequence downstream of the HIS-1.1 gene did not recognise any anti-HIS-1 transcripts (Fig. 3B, lane c), indicating that the 0.8 kb transcript started in the sequence recognised by probe II, and that the 2.5 kb antisense transcript was transcribed from the HIS-1.2 gene. Probe IV, derived from sequence
Fig. 3. Mapping of anti-HIS-1 transcripts to the HIS-1 locus. (A) Map of the HIS-1 locus in L. major (Belli et al., 1999), including restriction enzyme cleavage sites: E: Eco RI, H: Hinc II, N: Nru I, P: Pst I. HIS-1.1 and HIS-1.2 genes, defined by their splice acceptor and polyadenylation sites are represented by open boxes. Recognition sites of the strand-specific riboprobes to this locus are indicated. Riboprobe I maps to a 0.56 kb, Nru I/Pst I fragment; riboprobe II maps to the HIS-1 coding region; riboprobe III maps to a 0.7 kb Nru I/Eco RI fragment; and riboprobe IV maps to a 0.7 kb, Nru I/Pst I fragment downstream of HIS-1.2. Positions of primers 2 and 3, used to map the 50 regions of the antisense transcripts is shown. Open boxes represent the positions of the HIS-1.1 and HIS-1.2 coding regions. (B) Cytoplasmic RNA isolated from L. major (strain Friedlin) was fractionated on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. The membrane was cut into strips and analysed with riboprobes I to IV. (C) PCR amplified material using primers 2 and 1 (oligodT; lane a) or primers 3 and 1 (oligodT; lane b) was separated on an agarose gel, transferred to Genescreen Plus membrane and hybridised with a 32P-labelled HIS-1 probe.
970
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
downstream of the HIS-1.2 gene recognised a single 2.5 kb transcript (Fig. 3B, lane d), providing further evidence that the 2.5 kb anti-HIS-1 transcript maps to the HIS-1.2 gene, and the 0.8 kb anti-HIS-1 transcript maps to the HIS-1.1 gene copy. Additional mapping experiments using reverse transcriptase-PCR and specific downstream primers to the HIS-1.1 and HIS-1.2 genes were performed. When primer 3, located 30 to the HIS-1.2 gene, , 700 bp from the initiation codon of the HIS-1.2 copy (Fig. 3A), was used together with the oligodT primer 1, a specific cDNA PCR product was amplified (data not shown). When primer 2, located 30 to the HIS-1.1 gene, , 700 bp from the initiation codon was used, together with the oligodT primer 1 (Fig. 3A), no cDNA fragments were amplified (data not shown). Amplified products were analysed by agarose gel electrophoresis and Southern blotting using a a-32P-labelled HIS-1 probe (Fig. 3C). A specific product of , 750 bp was detected in PCRs using the oligodT primer 1 and primer 3 (Fig. 3C, lane b), and no product was detected in PCRs performed using oligodT primer 1 and primer 2 (Fig. 3C, lane a). These data confirmed that the 2.5 kb anti-HIS-1 transcript maps to the HIS-1.2 gene, and the 0.8 kb anti-HIS-1 transcript maps to the HIS-1.1 gene copy. From our mapping data, we can further conclude that the small antisense transcript commenced in the sequence recognised by probe II and not in the sequence recognised by probe III. This information was used to determine whether the smaller transcript was produced by transsplicing and whether the addition of the 39 nucleotides of the splice leader had occurred. To detect if the 0.8 kb transcript was modified, we performed a primer extension experiment. Cytoplasmic RNA was reverse transcribed using an end-labelled oligonucleotide (D2-sw3) that hybridised specifically to 28 nucleotides placed 14 nucleotides
downstream of the HIS-1 stop codon. An extended product of 80 nucleotides was only detected when Leishmania RNA was present in the reaction (Fig. 4, lane c). No product could be detected in the presence of yeast RNA (Fig. 4, lane b). When the length of the extended product was aligned with the histone HIS-1 sequence, the 30 end of the extended product mapped to an A/T-rich region due to 28 of the 33 nucleotides having hybridised specifically (Fig. 4, black arrow). However, it could also be postulated that the extended product contained a splice leader of 39 nucleotides, thus, enabling us to define the splice acceptor site. If this was the case, the 80 nucleotide extension product should have contained the 39 nucleotides of the splice leader. By subtracting the 39 nucleotides of the splice leader and the 33 nucleotides of the D2-sw3 oligonucleotide, the AG dinucleotide involved in the trans-splicing should have been identified. Interestingly, there was no potential AG acceptor splice site in this region (Fig. 4, open arrow) suggesting that the antisense transcript was not processed by the addition of a splice leader. Thus, the antisense transcript was either produced by simple cleavage of a long precursor RNA, or this region was used as an entry site for a RNA polymerase.
3.3. Antisense transcription of a selectable marker in the histone H1 locus Antisense transcription in the HIS-1 locus was analysed further. The targeting construct engineered (Fig. 5A) was designed to replace the HIS-1.2 coding region in L. major by homologous recombination with the coding region of the selectable marker neomycin phosphotransferase (Neo). However, only one allelic copy of the HIS-1.2 gene was disrupted. Attempts to eliminate the other HIS-1.2 allelic
Fig. 4. Determination of the 50 end of the antisense transcript by primer extension. A specific oligonucleotide was hybridised to 10 mg of cytoplasmic RNA from yeast (lane b) or Leishmania (lane c) and used in a primer extension reaction. The reaction product was separated on a 5% sequencing gel. pBR32 DNA was digested by Hae III, end-labelled and used as a molecular weight marker (lane a). The sequence 14 nucleotides downstream of the stop codon of the HIS-1 gene is shown. The 28 nucleotides of D2-sw3 (total 33 nucleotides) that hybridise to the HIS-1 genes are underlined. The black arrow indicates the 30 end of the extended product. The open arrow represents the predicted 30 end of the extended product if a splice leader was added to the transcript.
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
971
polyadenylation sites situated in the 50 and 30 histone H1 untranslated regions. This 4 kb transcript was not present in the wild type parasite IR75 (Fig. 5B, lane a) or in parasites transfected with the pX vector, which encodes neomycin phosphotransferase and is devoid of any of the HIS-1 sequences (Fig. 5B, lane c). In this case, the results suggest that antisense transcripts do not interfere with transcription of the sense transcripts in a way that would in turn affect the expression of the neomycin phosphotransferase gene that is essential for neomycin resistance of the transfected clones. It demonstrates also that Neo antisense transcripts are linked to the presence of the HIS-1 sequences and are not due to sequences present in the vector or in the phosphotransferase encoding gene. Some additional transcripts are detected in the Leishmania transfected lines. The origin of these transcripts is not known. In any case, it does not affect the interpretation of our results, since the 4 kb RNA is specifically expressed in the KO8 line and not in the pX line.
3.4. The HIS-1 locus contains adenine and thymine-rich sequences and encodes the additional antisense transcript, SC-1
Fig. 5. Homologous recombination of the HIS-1.2 gene with the Neo gene. (A) Schematic representation of the targeting construct used to replace the HIS-1.2 gene in HIS-1 locus. The direction of transcription of the inserted neomycin resistance gene (Neo) is indicated by an arrow. (B) Cytoplasmic RNA was isolated from the L. major strain IR78 (lane a), the transfected KO8 line (lane b) and the pX transfected line (lane c), fractionated on a 0.8% agarose gel and then transferred to Genescreen Plus membrane. Membranes were hybridised with a 32P-labelled Neo sense riboprobe. The arrow indicates the 4.0 kb Neo antisense transcript detected in the KO8 parasite.
copy, as well as the HIS-1.1 gene copies were unsuccessful, suggesting that deletion of these genes could be lethal for the parasite. The presence of pGEM-1 vector and Neo sequences simplified the task of locating the integrated DNA in the transformants. Confirmation that only one of the two HIS-1.2 alleles was disrupted in the G418 resistant clones was verified by Southern blotting and PCR (data not shown). One robust clone, KO8, was chosen for further analysis. Poly(A)þ RNA was extracted from KO8 transformants and analysed by Northern blotting. Membranes were probed with an a-32P-labelled Neo probe to detect antisense expression of the selectable marked Neo. A 4 kb band corresponding to the expected size for an antisense transcript arising from the targeting construct was detected (Fig. 5B, lane b). This estimated size was based on the length of the different portions of the targeting construct together with the position of the splice acceptor and
Pol II promoters have not been described thus far in trypanosomatids. However, adenine and thymine (A/T)-rich sequences have been suggested to play a role as entry sites for RNA pol II in these parasites (Swindle and Tait, 1996; McAndrew et al., 1998). In the HIS-1 locus, A/T-rich sequences have been identified (Fig. 6A). The dashed horizontal line in Fig. 6A shows five regions with an A/T content of . 70% as identified by scanning the locus with a window size of 50 nucleotides using the MacVector 3.5 software. Two of these A/T-rich sequences were located upstream of the anti-HIS-1.1 and anti-HIS-1.2 transcripts (positions 8,237 – 8,259 bp and 27,518 – 27,626 bp, respectively, in the cosmid L979). An additional open reading frame was detected downstream of a third A/T-rich region (position 21,016 – 21,063 bp) in the HIS-1 locus. This open reading frame named SC-1 and present only once in the Leishmania genome (data not shown), was predicted to code for a polypeptide of 152 amino acids (position 20,569 – 20,114 bp). This coding region was positioned on the same strand as the HIS-1 antisense transcripts. The transcription of the SC-1 open reading frame was further analysed in vivo. Strand-specific probes to SC-1 were used to hybridise cytoplasmic RNA of amastigotes and promastigotes by Northern blotting. Using a single-stranded probe, complementary to the SC-1 open reading frame, a band corresponding to a transcript of 0.6 kb was detected in the amastigote stage of the parasite (Fig. 6B, lane b). Defined transcripts were not detected in the amastigote stage for the other strand (Fig. 6B, lane a). Conversely, multiple transcripts were detected in the promastigote stage when
972
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
Fig. 6. Adenine and thymine-rich sequences in the HIS-1 locus of Leishmania and detection of the additional antisense SC-1 transcript. (A) Percentage of adenine- and thymine-rich sequences in the HIS-1 locus using a window size of 50 nucleotides (MacVector 3.5). The dashed line across the graph corresponds to an adenine and thymine content of 70%. Open bars on the graph represent the positions of HIS-1.1 and HIS-1.2 coding regions. The three antisense transcripts are indicated by arrows and their position in the locus indicated with reference to the sequence of the L979 cosmid. The positions of the adenine and thymine-rich sequences are given in the text. (B) Cytoplasmic RNA was isolated from L. major amastigotes (lanes a and b) and promastigotes (lanes c and d) and treated with glyoxal and fractionated on a 0.8% agarose gel, then transferred to Genescreen Plus membrane. Membranes were probed with SC-1 riboprobes that recognise sense (lanes b and d) and antisense (lanes a and c) gene specific transcripts. The arrow indicates a 0.6 kb mRNA species corresponding to the SC-1 present on the same strand as the anti-HIS-1 transcripts.
using a single-stranded probe corresponding to the SC-1 open reading frame (Fig. 6B, lane c). Defined transcripts were not detected in the promastigote stage with a probe complementary to the SC-1 open reading frame. Considering that the SC-1 gene is present only once in the Leishmania genome, we can exclude the possibility that the transcripts detected were synthesised in another region of the genome.
4. Discussion The organisation of the histone H1 genes in the histone H1 locus of the Leishmania genome has been characterised previously (Noll et al., 1997; Belli et al., 1999). Here, we have provided novel evidence for the presence of overlapping, developmentally regulated, sense and antisense transcripts of the HIS-1.1 and HIS-1.2 genes in the HIS-1
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
locus. HIS-1 reaches maximum expression at the stationary phase of parasite growth, whereas the maximum levels of anti-HIS-1 expression is reached at a mid-logarithmic stage. An additional antisense transcript found on the same strand as the anti-HIS-1 transcripts, SC-1, was also predicted to be present in this locus due to its close proximity to adenine and thymine-rich sequences, proposed previously to serve as Pol II entry sites for antisense transcription in trypanosomatids (McAndrew et al., 1998). The presence of this antisense transcript in the parasites was confirmed by Northern blotting, and its expression was possibly developmentally regulated. Replacement of one allele of the HIS-1.2 gene with the selectable marker Neo, did not interfere with antisense transcription at this locus. In addition, it showed that the regulatory elements controlling antisense transcription of HIS-1.2 were located outside the HIS-1.2 gene. Thus the HIS-1.2þ/2 mutant parasite will provide an ongoing model to enable the future mapping of the regions controlling antisense transcription at the HIS-1 locus in Leishmania, as well as shed more light on the role of antisense transcription in these parasites. It has been shown that antisense RNAs bind to their cognate partners in various organisms to regulate gene expression (Wagner and Simons, 1994; Vanhee-Brossollet and Vaquero, 1998). These antisense RNAs are complementary to transcripts encoding functional proteins involved in diverse biological functions including hormonal response, control of proliferation, development and structure, and viral replication. In Caenorhabditis elegans and Drosophila, as well as in the trypanosomatid T. brucei, it has been shown that double-stranded RNA induces mRNA degradation (Fire et al., 1998; Kennerdell and Carthew, 1998; Ngo et al., 1998). In Leishmania amazonensis, it was shown that the episomal expression of a specific antisense mRNA can affect the level of expression of gp63 in promastigotes (Chen et al., 2000). In the HIS-1 locus in Leishmania, we were unable to demonstrate any interaction between the HIS-1 and anti-HIS-1 transcripts using an RNAse protection assay (T. Noll and N. Fasel, unpublished data). Recent experiments (S. Monnerat and N. Fasel, unpublished data) have suggested that both strands of DNA are transcribed at very different levels, and that the presence of low levels of antisense transcripts is a direct consequence of the low level of transcription of that strand. Thus, it still remains to be definitively determined whether natural antisense transcripts found in trypanosomatids can affect the level of expression of their sense counterparts. Mapping and primer extension studies using the D2-sw3 oligonucleotide revealed the presence of a distinct 50 end on the antisense HIS-1 RNAs, providing evidence that they could undergo active processing during maturation or that regions could be used as entry sites for RNA polymerase (Figs. 3 and 4). Thus far, it is likely that the splice leader sequence is absent from these antisense transcripts. Poly(A)þ antisense transcripts lacking a spliced leader
973
sequence have been identified previously in the DHFR-TS locus of Leishmania (Kapler and Beverley, 1989) and in the DHFR-TS gene of the non-pathogenic trypanosomatid, C. fasciculata (Hughes et al., 1989). These transcripts, that lack a spliced leader sequence, have been mapped to the amplified R region of methotrexate-resistant L. major parasites, and their presence has been ascribed to their episomal expression. The role, if any, of these antisense transcripts in trypanosomatids is not understood, and no evidence of the protein coding potential of the antisense transcripts from the DHFR-TS loci has been reported. Previously, two convergent transcription units overlapping by several kilobases and giving rise to mature transcripts were described in T. brucei (Liniger et al., 2001), demonstrating that sense and antisense transcription occurred from a single chromosomal locus. In this report, however, antisense transcription is observed in a locus with two convergent transcription units. This differs from the histone H1 locus in which antisense transcripts are complementary to the transcripts processed from the polycistronic transcription unit. Sequences generated from the Leishmania genome project and the determination of the precise location of low abundance expressed sequence tags (ESTs) will, in the future, reveal the role and prevalence of naturally occurring antisense transcripts in Leishmania. The data presented here raise the possibility that polymerase entry sites may exist. Type II promoters have not been described in Leishmania. A role for adenine and thymine-rich sequences in polymerase entry for antisense transcripts has been proposed (McAndrew et al., 1998). Relatively long adenine and thymine tracts have been shown to modulate nucleosome organisation in yeast by giving rise to an unusual DNA conformation, supporting the notion that they could facilitate the accessibility of polymerases to promoters (Shimizu et al., 2000). In the HIS-1 locus, five adenine and thymine-rich sequences were identified, and three investigated further for the presence of antisense transcripts. The two anti-HIS-1 transcripts in this locus were identified while investigating their sense HIS-1 counterparts. The SC-1 transcript was predicted by its position relative to an adenine and thymine-rich-sequence, and the presence of this transcript in amastigotes was confirmed by Northern blotting. No complementary mRNA on the polycistronic strand in the amastigote stage of the parasite has been detected. These results therefore indicate that the presence of a transcript on a DNA strand that is complementary to a large polycistronic transcription unit is not absolutely linked to the presence of a complementary RNA or to an open reading frame present on the sense strand. Taken together, these data support the possible role of adenine- and thymine-rich regions in modulating chromatin structure to favour transcription of Leishmania genes. A more detailed analysis of the transcriptional organisation of the complete locus of HIS-1 is now necessary, in parallel with a functional analysis of these sequences, to gain further insights into the
974
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975
mechanisms of antisense gene regulation in Leishmania and the role that these transcripts play in controlling developmental gene expression in the parasite life cycle and during infection.
Acknowledgements This work was supported by Grants No. 3100-59450.99 from the Swiss National Research Fund (FNRS) to N.F., who was a recipient of a Dr Max Cloe¨tta Fellowship (Switzerland) and Grant No. AI40599 and AI4102 from the National Institutes of Health to K.S. We thank Nancy Saravia for the gift of New World Leishmania species.
References Belli, S., Formenton, A., Noll, T., Ivens, A., Jacquet, R., Desponds, C., Hofer, D., Fasel, N., 1999. Leishmania major: histone H1 gene expression from the sw3 locus. Exp. Parasitol. 91, 151– 160. Ben Amar, M.F., Jefferies, D., Pays, A., Bakalara, B., Kendall, G., Pays, E., 1991. The actin gene promotor of Trypanosoma brucei. Nucleic Acids Res. 19, 5857– 5862. Beverley, S.M., Clayton, S.E., 1993. Transfection of Leishmania and Trypanosoma brucei by electroporation. Methods in molecular biology. Mol. Biol. 21, 333–348. Chen, D.Q., Kolli, B.K., Yadava, N., Lu, H.G., Gilman-Sachs, A., Peterson, D.A., Chang, K.P., 2000. Episomal expression of specific sense and antisense mRNAs in Leishmania amazonensis: modulation of gp63 level in promastigotes and their infection of macrophages in vitro. Infect. Immun. 68, 80 –86. Clayton, C., Adams, M., Almeida, R., Baltz, T., Barrett, M., Bastien, P., Belli, S., Beverley, S., Biteau, N., Blackwell, J., Blaineau, C., Boshart, M., Bringaud, F., Cross, G., Cruz, A., Degrave, W., Donelson, J., El-Sayed, N., Fu, G., Ersfeld, K., Gibson, W., Gull, K., Ivens, A., Kelly, J., Vanhamme, L., 1998. Genetic nomenclature for Trypasnosoma and Leishmania. Mol. Biochem. Parasitol. 97, 221 –224. Coulson, R.M.R., Connor, V., Chen, J.C., Ajiokia, J.W., 1996. Differential expression of Leishmania major beta-tubulin genes during the acquisition of promastigote infectivity. Mol. Biochem. Parasitol. 82, 227– 236. Fasel, N.J., Robyr, D.C., Maue¨l, J., Glaser, T.A., 1994. Identification of a histone H1-like gene expressed in Leishmania major. Mol. Biochem. Parasitol. 62, 321–323. Fickett, J.W., 1982. Recognition of protein coding regions in DNA sequences. Nucleic Acids Res. 10, 5303–5318. Fire, A., Xu, S., Montgomery, M.K., Kostas, S.A., Driver, S.E., Mello, C.C., 1998. Potent and specific genetic interference by double stranded RNA in Caenorhabditis elegans. Nature 391, 806– 811. Graham, S.V., 1995. Mechanisms of stage-regulated gene expression in kinetoplastida. Parasitol. Today 11, 217 –224. Graham, S.V., Barry, J.D., 1995. Transcriptional regulation of metacyclic variant surface glycoprotein gene expression during the life cycle of Trypanosoma brucei. Mol. Cell. Biol. 15, 5945–5956. Graham, S.V., Jefferies, D., Barry, J.D., 1996. A promotor directing alpha-amanitin-sensitive transcription of GARP, the major surface antigen of insect stage Trypanosoma congolense. Nucleic Acids Res. 24, 272 –281. Hughes, D.E., Shonekan, O.A., Simpson, L., 1989. Structure, genomic organization and transcription of the bifunctional dihydrofolate reductase – thymidylate synthase gene from Crithidia fasciculata. Mol. Biochem. Parasitol. 34, 155– 166.
Ivens, A.C., Smith, D.F., 1997. A global map of the Leishmania genome: preclude to genomic sequencing. Trans. R. Soc. Trop. Med. Hyg. 91, 111 –115. Kapler, G.M., Beverley, S.M., 1989. Transcriptional mapping of the amplified region encoding the dihydrofolate reductase–thymidyalte synthase of Leishmania major reveals a high density of transcripts, including overlapping and antisense RNAs. Mol. Cell. Biol. 9, 3959–3972. Kennerdell, J.R., Carthew, R.W., 1998. Use of dsRNA-mediated genetic interference to demonstrate that frizzled and frizzled 2 act in the wingless pathway. Cell 95, 1017–1026. LeBowitz, J.H., Coburn, C.M., Beverley, S.M., 1991. Simultaneous transient expression assays of the trypanosomatid parasite Leishmania using b-galactosidase and b-glucuronidase as reporter enzymes. Gene 103, 119–123. Lee, M.G.-S., 1996. An RN polymerase II promoter in the hsp 70 locus of Trypanosoma brucei. Mol. Cell. Biol. 16, 1220–1230. Liniger, M., Bodenmuller, K., Pays, E., Gallati, S., Roditi, I., 2001. Overlapping sense and antisense transcription units in Trypanosoma brucei. Mol. Microbiol. 40, 869 –878. Martinez-Calvillo, S., Sunkin, S.M., Yan, S., Fox, M., Stuart, K., Myler, P.J., 2001. Genomic organization and functional characterization of the Leishmania major Friedlin ribosomal RNA gene locus. Mol. Biochem. Parasitol. 116, 147– 157. McAndrew, M., Graham, S., Hartmann, C., Clayton, C., 1998. Testing promoter activity in the trypanosome genome: isolation of a metacyclic-type VSG promoter, and unexpected insights into RNA polymerase II transcription. Exp. Parasitol. 90, 65–76. Myler, P.J., Audleman, L., deVos, T., Hixson, G., Kiser, P., Lemley, C., Magness, C., Rickel, E., Sisk, E., Sunkin, S., Swartzell, S., Westlake, T., Bastien, P., Fu, G., Ivens, A., Stuart, K., 1999. Leishmania major Friedlin chromosome 1 has an unusual distribution of protein-coding genes. Proc. Natl Acad. Sci. USA 96, 2902–2906. Myler, P.J., Beverley, S.M., Cruz, A.K., Dobson, D.E., Ivens, A.C., McDonagh, P.D., Madhubala, R., Martinez-Calvillo, S., Ruiz, J.C., Saxena, A., Sisk, E., Sunkin, S.M., Worthey, E., Yan, S., Stuart, K.D., 2001. The Leishmania genome project: new insights into gene organization and function. Med. Microbiol. Immunol. 190, 9– 12. Myler, P.J., Sisk, E., McDonagh, P.D., Martinez-Calvillo, S., Schnaufer, A., Sunkin, S.M., Yan, S., Madhubala, R., Ivens, A., Stuart, K., 2000. Genomic organization and gene function in Leishmania. Biochem. Soc. Trans. 28, 527–531. Ngo, H., Tschudi, C., Gull, K., Ullu, E., 1998. Double-stranded RNA induces mRNA degradation in Trypanosoma brucei. Proc. Natl Acad. Sci. USA 95, 14687–14692. Noll, T., Desponds, C., Belli, S.I., Glaser, T.A., Fasel, N.J., 1997. Histone H1 expression varies during the Leishmania major life cycle. Mol. Biochem. Parasitol. 84, 215 –227. Ochman, H., Medhora, M.M., Garza, D., Hartl, D.L., 1990. Amplification of flanking sequences by inverse PCR. PCR Protocols. A Guide to Methods and Applications, M.A. Imis, D.H. Geefand, J.J. Sninsky and T.J. White, (eds), pp 219–227 Academic Press, San Diego. Patnaik, P.K., Bellofatto, V., Hartree, D., Cross, G.A., 1994. An episome of Trypanosoma brucei can exist as an extrachromosal element in a broad range of trypanosomatids but shows different requirements for stable replication. Mol. Biochem. Parasitol. 66, 153–156. Pays, E., Vanhamme, L., 1996. Developmental regulation of gene expression in African trypanosomes. In: Smith, D.F., Parsons, M. (Eds.), Molecular Biology of Parasitic Protozoa, Oxford University Press, Oxford, pp. 88–114. Pearson, W.R., Lipman, D.J., 1990. Improved tools for biological sequence analysis. Proc. Natl Acad. Sci. USA 85, 2444– 2448. Salzberg, S.L., Delcher, A.L., Kasif, S., White, O., 1998. Microbial gene identification using interpolated Markov models. Nucleic Acids Res. 26, 544–548. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: a Laboratory
S.I. Belli et al. / International Journal for Parasitology 33 (2003) 965–975 Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Shimizu, M., Mori, T., Sakuria, T., Shindo, H., 2000. Destabilization of nucleosomes by an unusual DNA conformation adopted by poly(dA) poly(dT) tracts in vivo. EMBO J. 19, 3358–3365. Swindle, J., Tait, A., 1996. Trypanosmatid genetics. Molecular Biology of Parasitic Protozoa, IRL Press, New York, NY, pp. 6–34.
975
Ullu, E., Tschudi, C., Gu¨nzl, A., 1996. Trans-splicing in trypanosomatid protozoa. In: Smith, D.F., Parsons, M. (Eds.), Molecular Biology of Parasitic Protozoa, Oxford Press, Oxford, pp. 115–133. Vanhee-Brossollet, C., Vaquero, C., 1998. Do natural antisense transcripts make sense in eukaryotes? Gene 211, 1–9. Wagner, E.G., Simons, R.W., 1994. Antisense RNA control in bacteria, phages, and plasmids. Annu. Rev. Microbiol. 211, 1–9.