Sensitive detection of microRNA in complex biological samples by using two stages DSN-assisted target recycling signal amplification method

Biosensors and Bioelectronics 87 (2017) 358–364

Contents lists available at ScienceDirect

Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios

Sensitive detection of microRNA in complex biological samples by using two stages DSN-assisted target recycling signal amplification method Kai Zhang a,n, Ke Wang a, Xue Zhu a, Fei Xu b, Minhao Xie a a Key Laboratory of Nuclear Medicine, Ministry of Health, Jiangsu Key Laboratory of Molecular Nuclear Medicine, Jiangsu Institute of Nuclear Medicine, Wuxi, Jiangsu 214063, China b Department of Laboratory Medicine, Wuxi Municipal Women and Children Health Hospital, Wuxi, Jiangsu 214000, China

art ic l e i nf o

a b s t r a c t

Article history: Received 5 July 2016 Received in revised form 24 August 2016 Accepted 25 August 2016 Available online 26 August 2016

MicroRNA (miRNA) has become an important biomarker candidate for cancer diagnosis, prognosis, and therapy. In this study, we have developed a novel fluorescence method for sensitive and specific miRNA detection via duplex specific nuclease (DSN) signal amplification and demonstrated its practical application in biological samples. Malachite green (MG) was employed as a “label-free" signal transducer since fluorescence of MG could be enhanced by 100-fold when MG were binding to a G-quadruplex structure formed within the d(G2T)13G sequence. The proposed signal amplification strategy is an integrated “biological circuit” designed to initiate a cascade of enzymatic reactions in order to detect, amplify, and measure a specific miRNA sequence by using the isothermal cleavage property of a DSN. The circuit is composed of two molecular switches operating in series: the amplification reaction activated by a specific miRNA and the strand-displacement polymerization reaction designed to initiate molecular beacon-assisted amplification and signal transduction by using MG/G-quadruplex complex. The hsa-miR141 (miR141) was chosen as a target miRNA because its level specifically abnormal in a wide range of common human cancers including breast, lung, colon, and prostate cancer. The proposed method allowed quantitative sequence-specific detection of miR141 (with a detection limit of 1.03 pM) in a dynamic range from 1 pM to 10 μM, with an excellent ability to discriminate differences in miRNAs. Moreover, the detection assay was applied to quantify miR141 in cancerous cell lysates. On the basis of these findings, we believe that this proposed sensitive and specific assay has great potential as a miRNA quantification method for use in biomedical research and clinical diagnosis. & 2016 Elsevier B.V. All rights reserved.

Keywords: MiRNA DSN Amplification method Malachite green Cell lysates

1. Introduction MicroRNAs (miRNAs) are endogenous, short (19–23 nucleotides) single-stranded noncoding RNAs found in eukaryotic cells. Depending on the degree of complementarity with the 3′ untranslated region (UTR), miRNAs can degrade or block the translation of their target mRNAs, and thus play a significant regulatory role in various biological processes, such as gene expression, cell proliferation, apoptosis, viral defense, metabolism, hematopoietic differentiation and tumorigenesis (Garcia-Schwarz and Santiago, 2013; Liu et al., 2012; Qiu et al., 2013; Zhou et al., 2014). To date, over 1000 human miRNAs have been identified, which can target more than 30% of the human genome. Apart from being posttranscriptional regulators, an accumulating amount of evidence n

Corresponding author. E-mail address: [email protected] (K. Zhang).

http://dx.doi.org/10.1016/j.bios.2016.08.081 0956-5663/& 2016 Elsevier B.V. All rights reserved.

have proved that abnormal expression of certain miRNAs is closely related to a variety of diseases and disorders, especially cancers (Ge et al., 2014; Tu et al., 2013; Wang et al., 2014b; Xi et al., 2014). Thus, miRNAs have been regarded as potential targets in disease diagnosis and therapy, as well as new biomarkers for diseases such as cancers, cardiovascular, and autoimmune diseases (Wang et al., 2014a; Zhang et al., 2014, 2016). However, miRNA detection is challenged by the characteristics of miRNA, including small size, sequence homology among family members, low abundance in total RNA samples, and susceptibility to degradation (Labib et al., 2015; Sato et al., 2015). Therefore, strategies for sensitive and selective detection of miRNAs are in urgent need, especially for biomedical research and early clinical diagnosis. Several traditional methods have been exploited to detect miRNAs, including Northern blotting (Válóczi et al., 2004), realtime PCR (Varkonyi-Gasic and Hellens, 2011), and microarrays (Lee and Jung, 2011). However these methods have some intrinsic limitations, such as low sensitivity, poor specificity, and labor-

K. Zhang et al. / Biosensors and Bioelectronics 87 (2017) 358–364

intensive steps. To overcome the shortcomings of the traditional methods, great efforts have been made to develop colorimetric (Tian et al., 2013), fluorescent (Larkey et al., 2014; Zhou et al., 2014), and electrochemical methods (Kilic et al., 2012) for miRNA detection. Among them, fluorescence miRNA assays have attracted much attention, because of the advantages of low cost, simple operation, and fast response. However, the reported fluorescence methods are always suffered from some intrinsic drawbacks. Thus, it is highly desirable to develop faster and simpler homogenous methods to assay miRNAs. Malachite green (MG) is a positively charged triphenylmethane (TPM) dyes which can be used as a fluorescence indicator. Recently, the application of MG, in biological methodologies has been gaining momentum as a result of their aptness for photodynamic therapy, the site-specific inactivation of RNA transcripts, RNA-aptamer-based fluorescence sensors, and the catalysis of chemical reactions. Bhasikuttan et al. reported an interesting phenomenon that the fluorescence of MG could be enhanced by 100-fold when MG were binding to a G-quadruplex structure formed within the d (G2T)13G sequence (Bhasikuttan et al., 2007). On the basis of this, they successfully developed a novel method for the detection of the G-quadruplex. On the other hand, duplex specific nuclease (DSN) enzyme is a nuclease isolated from hepatopancreas of the Kamchatka crab (Paralithodes camtschaticus) (Qiu et al., 2015; Xi et al., 2014; Yin et al., 2012; Zhang et al., 2014c). It displays a strong preference for cleaving double-stranded DNA (more than 10 base pairs) or DNA in DNA: RNA heteroduplexes, and is practically inactive toward single-stranded DNA, or single- or double-stranded RNA. DSN is known to be able to cleave DNA with a high preference in DNARNA hybrid duplexes, and could be used in microRNA detection. Thus, a DNA sequence that is complementary to microRNAs could potentially be used as a specific probe. A further improvement of sensitivity could be achieved by introduction of amplification methods into the DNA probe. In addition, molecular beacons (MBs) are single stranded oligonucleotide probes that possess a stem-and-loop structure. The loop portion of the molecule can report the presence of a specific complementary nucleic acid. The base pairs at the two ends of the MB are complementary to each other, forming the stem. When the probe encounters a target DNA or RNA molecule, it forms a hybrid that is more stable than the stem, and its rigidity and length preclude the simultaneous existence of the stem hybrid. Thus, the MB undergoes a spontaneous conformational reorganization that forces the stem apart. Therefore, the MBs may leads to signal change by combined the MB with other signal transducer when

359

hybridized to their target molecules. The miR141, a member of miR-200 family, was chosen as a target miRNA because its level is abnormal in a wide range of common human cancers (Yin et al., 2012). MiR141, is over-expressed in prostate, ovarian, and colorectal cancers and downregulated in hepatocellular, and renal cell carcinoma, raising a controversial issue about the role of miR141 in cancer progression (Du et al., 2009; Forman and Burley, 2006; Iorio et al., 2007). So, the assay miR141 in cancer cells is important. Inspired by the advantages of DSN and MG binding G-quadruplex, herein, we report a label-free homogeneous MBs based fluorescence biosensing strategy for sensitive detection of miR141 in cell extracts. This method is based on G-quadruplex, which should be very promising for its potential in detection of targets without the need for labeling or expensive equipment.

2. Experimental section 2.1. Reagents Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) and Diethyl pyrocarbonate (DEPC) were purchased from Sigma-Aldrich Inc. (St. Louis, Missouri, USA). The strand sequences were purchased from Genscript Biotech. Co., Ltd. (Nanjing, China) with the sequences as shown in Table 1. Duplex-specific nuclease (DSN) was purchased from Newbornco Co., Ltd (Shenzhen, China). Malachite Green (MB) was obtained from J&K Scientific Ltd. (Shanghai, China). MiRNeasy Mini kit for MiRNA extraction was purchased from Qiagen (QIAGEN, Hilden, Germany). Fluorescence was measured by RF-5301PC Spectrofluorophotometer (Shimadzu, Japan). The samples were excited at 590 nm. Before use, miRNAs were diluted to appropriate concentrations with DEPC-treated water. The MB1 and MB2 were diluted with 10 mM HEPES (containing 100 mM NaCl, 25 mM KCl, 10 mM MgCl2, pH 7.0) to give the stock solutions. DEPC-treated deionized water was used in all experiments. 2.2. Cell culture HepG2 cells were cultured in Dulbecco's modified Eagle's medium (DMEM, GIBCO) supplemented with 10% fetal calf serum (FCS, Sigma), penicillin (100 μg mL
1), and streptomycin (100 μg mL
1) at 37 °C in a humidified atmosphere containing 5% CO2. 22Rv1 cell were cultured in RPMI medium 1640 supplemented with 10% fetal bovine serum (FBS) and 100 U mL
1

Table 1 Sequence information for the MB probe, and miRNAs used in this study. Name

sequence (5′-3′)a

MB1 MB2 MB2-a MB2-b MB2-c MB2-d miR141 miR429 Let-7a miR21

TTGGGTGACCATCTTTACCAGACAGTGTTACAGCCTACCTACCCATCACCCAA CCACCACCTTGGGTGATGGGTAGGTAGGCTGGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTG ACCACCTTGGGTGATGGGTAGGTAGGCTGGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTG CACCACCTTGGGTGATGGGTAGGTAGGCTGGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTG ACCACCACCTTGGGTGATGGGTAGGTAGGCTGGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTG CACCACCACCTTGGGTGATGGGTAGGTAGGCTGGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTG UAACACUGUCUGGUAAAGAUGG UAAUACUGUCUGGUAAAACCGU UGAGGUAGUAGGUUGUAUAGUU UAGCUUAUCAGACUGAUGUUGA

a In MB1, the letters in italics represent the sequences complementary to the target miRNA (miR141). In MB1 and MB2, the boldface letters represent the sequences complementary to each other to form the stems of the hairpin probes, respectively. The underlined letters in MB1 and MB2 represent the two segments of the complementary sequences between the two hairpin probes. In MB2 (MB2-a, MB2-b, MB2-c, and MB2-d), the letters in italics represent the sequences of the G-quadruplex sequences. In MB1, the underlined letters and boldface letters are 2-OMe-RNA sequences.

360

K. Zhang et al. / Biosensors and Bioelectronics 87 (2017) 358–364

room temperature for 3 min, followed by centrifugation at 12000 g at 4 °C for 15 min. Transfer the upper aqueous phase to a new collection tube and added with 1.5 volumes of 100% ethanol and mix thoroughly pipetting again. Finally, purification of the microRNA was carried out using a spin column format, as described in the protocol. The purified microRNA extracted from each cells was eluted with double-distilled water (14 mL) and stored at
20 °C before using. 2.5. Gel Electrophoresis The amplification products of the reaction were analyzed by 20% nondenaturating polyacrylamide gel electrophoresis (PAGE) in 0.5  TBE buffer (22.5 mM Tris-boric acid, 5 mM EDTA, pH 8.0) at a 120 V constant voltage at room temperature for 50 min by using gel electrophoresis mini-gels (Bio-Rad, Inc.). The gel was taken photograph under UV light after staining with GelRed for 15 min. The concentration of each strand is 1 μM. 2.6. Apparatus Cell lines were cultured in a water-jacketed CO2 incubator (Thermo 3111, Billups-Rothenberg, Del Mar, CA). The fluorescence spectra were obtained on a spectrofluorophotometer (RF-5301PC, Shimadzu, Japan).

Scheme 1. (A) Schematic illustration of the two stages DSN-assisted target recycling signal amplification strategy for the detection of target RNA. (B) The structure of the backbone-modified MB1: the green part and purple part are made of DNA modified with 2-OMe-RNA and the deep blue part is made of DNA.

penicillin-streptomycin at 37 °C in a humidified 5% CO2 incubator. Cell number was determined with a Petroff-Hausser cell counter (USA). 2.3. Amplification reactions All detection procedure included two sequential steps. For duplex-specific nuclease (DSN) amplification, a volume of 50 μL reaction mixture containing 1  DSN buffer (50 mM Tris-HCl, pH 8.0; 5 mM MgCl2, 1 mM DTT, 10 mM HEPES, 100 mM NaCl, and 25 mM KCl), 0.5 U DSN (dissolved in 25 mM Tris-HCl, pH 8.0; 50% glycerol), 20 U RNase inhibitor, and 1 μM MB1 and 1 μM MB2, and the target miRNA with different concentrations, were added in the above mentioned solution and incubated at 50 °C for 60 min. The control experiment was carried out under the same condition without adding miRNA. Subsequently, the reaction mixture was added 30 μL 10 mM EDTA and incubated at 60 °C for 5 min to inactive DSN enzyme. Samples were then incubated with 1 mM MG at room temperature for 1 h. After these steps, fluorescence intensities were measured by using Spectrofluorophotometer. 2.4. Preparation of miRNA extracts Circulating miR141 in cells was extracted using the human miRNeasy Mini kit according to the manufacturer's instruction. Briefly, the cells were collected and centrifuged at 3000 rpm for 5 min in a culture medium, washed once with PBS buffer, and then spun down at 3000 rpm for 5 min. The cell pellets were suspended in 1 mL of Qiazol lysis reagent and 20 U of RNase inhibitor, and then vortexed vigorously to completely lyse the cells and to obtain a homogenous lysate. 0.2 mL of cell and mixed by pipetting, followed by incubation at room temperature for 5 min to dissociate the nucleoprotein complexes. After adding 0.2 mL of chloroform, the mixture was vigorously vortexed for 15 s and incubated at

3. Results and discussion 3.1. The working principle The working principle of the two stages DSN-assisted target recycling signal amplification method based on two molecular beacons is illustrated in Scheme 1A. In this strategy, two molecular beacons (MB1 and MB2) were ingeniously designed. MB1 consists of three fragments: a target DNA sequence at 3′ end; eight-base long “interfering tail” at 5′ end that is complementary to part of the target DNA (hsa-miR-141, miR141) to prohibit the hybridization of target DNA and MB2; and a middle loop region that was designed to hybridize target RNA. MB2 also consists of three fragments: a G-quadruplex-forming sequence at the 3′ end; a eight-base long “interfering tail” at the 5′ end that is complementary to part of the G-rich sequence, and which prohibits the formation of the G-quadruplex; and a middle loop region that was designed to probe target DNA. In the absence of miRNA, the G-quadruplex shows low fluorescence intensity since MB1 and MB2 will not be recognized and digested by DSN. Upon addition of MG, the fluorescence signal of such a mixture was very weak due to the weak interaction between the G-rich sequence and MG. In the present of miRNA, the hybridization of the MB1 with miRNA opens the MB1 and become the substrate for DSN cleavage. Since DSN only cleaves DNA in the duplexed miRNA/MB1, the target miRNA and target DNA are subsequently released to hybridize with another MB1, and the released miRNA leads to a cyclic reaction. Theoretically, one miRNA sequence can initiate the cleavage of numerous MB1s and generation of more target DNA. Meanwhile, the released target DNA opens MB2 to form target DNA/MB2 duplex and the duplex become the substrate for DSN cleavage. Since DSN cleaves DNA in the duplex, the target DNA are subsequently released to hybridize with another MB2. And the cleavage also generates the G-rich oligomer, this released G-rich oligomer folds into a G-quadruplex structure and thus allows the formation of a fluorescence transducer in the presence of MG. The formed fluorescence transducer can give the fluorescence intensity. So, one miRNA sequence can initiate the cleavage of numerous MB1 and MB2, resulting in the highly sensitive detection of miRNA.

K. Zhang et al. / Biosensors and Bioelectronics 87 (2017) 358–364

361

Fig. 1. (A) Effect of the length of stem base pairs on the signal-to-background ratio for detecting target RNA. The concentration of target RNA was 100 nM. (B) The fluorescence intensity of the strategy under different conditions: (a) MB1 and MB2; (b) 100 nM target RNA, MB1 and MB2; (c) 0.5 U DSN, MB1 and MB2; (d) 100 nM target RNA, 0.5 U DSN, MB1 and MB2. (C) PAGE characterization of the products by the DSN-assisted amplification method. Lane (M): Marker. Lanes 1–6: (1) Target RNA; (2) MB1; (3) MB2; (4) MB1 þMB2; (5) MB1 þ MB2 þ Target RNA; (6) MB1 þMB2 þDSN; (7) MB1 þ MB2 þ Target RNA þ DSN. (D) fluorescence intensity versus the time in the present of (a) 10 pM and (b) 100 nM target RNA.

3.2. Feasibility study Since DSN can also cleave dsDNA, the stem of the MB and the hybridization part of target DNA/MB2 duplex is prone to digestion by DSN. To overcome this possible false positive signal, the MB1 is modified with 2-OMe-RNA on its stem and target DNA part. The 2-OMe-RNA differs from DNA in the 2-OMe on the pentose (Scheme 1B), which will not be recognized and cleaved by DSN (Lin et al., 2013). Moreover, we wanted to decrease the background signal in the control assay without the miRNAs. The background signal was probably derived from the nonspecific cleavage of the intramolecular DNA duplexes, resulting in the release of the G-quadruplex fragment. Although the DSN enzyme usually requires a DNA duplex of at least 10 bp for digestion, it may have low activity against short duplexes at a length of 9 bp. Therefore, we shortened the stem sequences to less bases. The fluorescence signal to background ratio (Fsig/Fback) was highly sensitive to the length of stem part of MB2. 100 nM miRNAs were employed and a series of MB2s by changing the length of stem from 6 to 10 base pairs (Table 1). As shown in Fig. 1A, the best fluorescence signal to background ratio was obtained when the length stem is 8 base pairs. This interesting phenomenon may be caused by the stability of the hairpin structure (6 base pairs (MB2-a) and 7 base pairs (MB2-b)) and the cleavage of the hairpin structure by the DSN (9 base pairs (MB2-c) and 10 base pairs(MB2-d)). Therefore, we chose the stem length of 8 base pairs for the detection in this study.

To verify the feasibility of quantitative detection, the fluorescence intensity changes under different conditions were investigated. As shown in Fig. 1B, the fluorescence intensity of a mixture of the MB1 and MB2 (curve a) and a mixture of the MB1 and MB2 with DSN (curve b) was relatively low. For the fluorescent intensity increase ratio without DSN and with DSN, we calculated by using this equation: (Ftarget
Fcontrol)/Fcontrol  100%, where Ftarget is the fluorescence intensity of adding target RNA and Fcontrol is the fluorescence intensity without adding target RNA. Upon addition of 100 nM target RNA to the above mixture without DSN, the fluorescence intensity increase was only 26.2%. However, when both target RNA (100 nM) and DSN were present in the solution, we observed 214.0% increase in the fluorescence intensity (curve d). The amplification reactions were further verified by using nondenaturing polyacrylamide gel electrophoresis (PAGE) (Fig. 1C), and the results showed that when target or DSN alone was added, no obvious target DNA was produced (line 5 and line 6). It is worth noting that in the presence of the MB1, MB2, target RNA and DSN, a G-rich oligomer was produced (line 7). To understand the time-dependent signal change of the method, kinetic studies have been performed by obtained the fluorescence intensity at designated time points after addition of 10 pM and 100 nM target RNA. As can be observed in Fig. 1D, most of the fluorescence change occurred in the first 40 min and the signals reached stable in about 60 min for both samples. Therefore, we chose the 60 min reaction time for the assay.

362

K. Zhang et al. / Biosensors and Bioelectronics 87 (2017) 358–364

Fig. 2. (A) Fluorescence intensity of the strategy for the assay of target RNA at different concentrations (0 pM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM, 100 nM, 1 μM, and 10 μM from a to i). (B) The relationship between the fluorescence intensity increase and the logarithm of concentration of target RNA. All data are taken from independent experiments with repetition for at least three times, and the presented data are the results of averaging.

3.3. Sensitivity of the sensing system To test whether the strategy can be used to detect target RNA effectively and quantitatively, experiments were carried out and the results were depicted in Fig. 2. As shown in Fig. 2A, the fluorescence signal intensity increased when the concentration of target RNA was increased from 0 to 10 μM, indicating that the release of the quadruplex-forming oligomer is highly dependent on the concentration of target RNA. Fig. 2B shows the corresponding calibration plot of the concentration of target RNA versus the fluorescence intensity, in which the detection limit was calculated to be 1.03 pM according to the responses of the blank tests plus 3 times the standard deviation (3s). The fitting equation of the curve shown in Fig. 2B is Y¼224.4þ69.9lgX (R2 ¼0.995), where Y is the fluorescence intensity and X is the concentrations of target miRNA. Such a low detection limit for target miRNA is even lower than some existing signal amplification methods (Yu et al., 2014; Zhang et al., 2014b). 3.4. The specificity test The selectivity of this assay was further investigated by adding miR21, miR429, and Let-7a with the same concentration (100 nM) into the reaction system, respectively, in which MB1 containing a perfectly complementary segment to miR141 was adopted. As shown in Fig. 3, low fluorescence intensity was detected in the presence of miR21, miR429, and Let-7a, which was slightly higher than that in the control experiment, whereas a significant increase of fluorescence intensity was observed when miR141 was present. The results demonstrated that the miRNA biosensing approach showed a high selectivity toward the target miRNA. Thus, the asproposed homogeneous amplification miRNA assay exhibited high sequence specificity to discriminate target miRNA from other miRNAs. 3.5. Measurement of endogenous miRNA To demonstrate the capability of the proposed method in real sample analysis, we perform the miRNA assay using total RNA sample extracted from HepG2 cell lines and 22Rv1 cell lines. The concentration of total RNA (4 ng/μL) was determined by

Fig. 3. Specificity test, comparing the signals form the miR141 and other miRNAs. Concentrations of all the miRNAs are 100 nM. All the data are taken from independent experiments with repetition for at least three times, and the presented data are the results of averaging.

measuring the absorbance at 260 nm with a spectrophotometer. The extracted total RNA sample (1 μL, 4 ng in total) was added to reaction solution for measurement. As shown in Fig. 4A and Fig. 4B. The fluorescence intensity produced by 4 ng of total RNAs from HepG2 and 22Rv1 cell lines can be distinguished well from that produced by the blank. According to the simultaneously constructed calibration curve (curve b and d in Fig. 4A) and the columns (column b and column d in Fig. 4B), the amount of miR141 in the miRNAs sample from HepG2 cell lines and miRNAs samples from 22Rv1 cell lines is estimated to be 2.02  109 copies/ μg (13.4 amol in 1 μL) and 8.53  109 copies/μg (56.6 amol in 1 μL), respectively. For further evaluation of its performance in real sample analysis, 20 amol miR141 is spiked into extracted miRNAs for the assay (curve c and curve e in Fig. 4A, and column d and column e in Fig. 4B), and the amount of miR141 in the spiked samples are estimated to be 32.9 amol with a recovery ratio of 97.5% in HepG2 cell lines and 77.2 amol with a recovery ratio of 103.0% in 22Rv1 cell lines, respectively. These results showed that the interference of real samples could be overcome since the max acceptable range of recovery is 80–120% (Cordell et al., 2014).

K. Zhang et al. / Biosensors and Bioelectronics 87 (2017) 358–364

363

Fig. 4. (A) Variance of fluorescence intensity in response to the control sample (curve a), 4 ng of total RNA sample from HepG2 cell lines (curve b), 20 amol synthesized miR141 and 4 ng of total RNA sample from HepG2 cell lines (curve c), 4 ng of total RNA sample from 22Rv1 cell lines (curve d), and 20 amol synthesized miR141 and 4 ng of total RNA sample from 22Rv1 cell lines (curve e). (B) Histograms for the different kinds samples: a) control sample; b) 4 ng of total RNA sample from HepG2 cell lines; and c) 20 amol synthesized miR141 and 4 ng of total RNA sample from HepG2 cell lines, d) 4 ng of total RNA sample from 22Rv1 cell lines, and e) 20 amol synthesized miR141 and 4 ng of total RNA sample from 22Rv1 cell lines, respectively. All the data are taken from independent experiments with repetition for at least three times, and the presented data are the results of averaging.

4. Conclusions In summary, we have developed a label-free homogeneous biosensing strategy for sensitive detection of miRNA in cell extracts by coupling the DSN-aided two-stage signal amplification with the fluorescence property of MG bond G-quadruplex. This method utilizes two MB probe which modified 2-OMe-RNA to transform the concentration of target miRNA into two-stage amplification and distinct fluorescent signal. In addition to good sensitivity for miRNA assay, this strategy exhibits excellent selectivity to distinguish different miRNAs. Furthermore, this method exhibits additional advantages of simplicity and low cost, since expensive labeling and sophisticated probe immobilization processes are avoided. Therefore, the as-proposed label-free homogeneous fluorescence miRNA assay may become an alternative method for simple and sensitive miRNA detection and has great potential to be applied in miRNA-related clinical diagnostics and biochemical research.

Acknowledgment This work was supported by grants from the National Natural Science Foundation (81300787), the Natural Science Foundation of Jiangsu Province (BK20141103), the Major Project of Wuxi Municipal Health Bureau (ZS201401, Z201508), the Project of Jiangsu Provincial Commission of Health and Family Planning (No. H201546), and the Project of Wuxi Municipal Science and Technology Bureau (CSE31N1520).

References Bhasikuttan, A.C., Mohanty, J., Pal, H., 2007. Interaction of malachite green with guanine-rich single-stranded DNA: preferential binding to a G-quadruplex. Angew. Chem. Int. Ed. 46 (48), 9305–9307. Cordell, R., White, I., Monks, P., 2014. Validation of an assay for the determination of levoglucosan and associated monosaccharide anhydrides for the quantification of wood smoke in atmospheric aerosol. Anal. Bioanal. Chem. 406 (22), 5283–5292.

Du, Y., Xu, Y., Ding, L., Yao, H., Yu, H., Zhou, T., Si, J., 2009. Down-regulation of miR141 in gastric cancer and its involvement in cell growth. J. Gastroenterol. 44 (6), 556–561. Forman, D., Burley, V.J., 2006. Gastric cancer: global pattern of the disease and an overview of environmental risk factors. Best. Pract. Res. Clin. Gastroenterol. 20 (4), 633–649. Garcia-Schwarz, G., Santiago, J.G., 2013. Rapid high-specificity microRNA detection using a two-stage isotachophoresis assay. Angew. Chem. Int. Ed. 52 (44), 11534–11537. Ge, Z., Lin, M., Wang, P., Pei, H., Yan, J., Shi, J., Huang, Q., He, D., Fan, C., Zuo, X., 2014. Hybridization chain reaction amplification of microRNA detection with a ttrahedral DNA nanostructure-based electrochemical biosensor. Anal. Chem. 86 (4), 2124–2130. Iorio, M.V., Visone, R., Di Leva, G., Donati, V., Petrocca, F., Casalini, P., Taccioli, C., Volinia, S., Liu, C.-G., Alder, H., Calin, G.A., Ménard, S., Croce, C.M., 2007. MicroRNA signatures in human ovarian cancer. Cancer Res 67 (18), 8699–8707. Kilic, T., Topkaya, S.N., Ariksoysal, D.O., Ozsoz, M., Ballar, P., Erac, Y., Gozen, O., 2012. Electrochemical based detection of microRNA, mir21 in breast cancer cells. Biosens. Bioelectron. 38 (1), 195–201. Labib, M., Khan, N., Berezovski, M.V., 2015. Protein electrocatalysis for direct sensing of circulating microRNAs. Anal. Chem. 87 (2), 1395–1403. Larkey, N.E., Almlie, C.K., Tran, V., Egan, M., Burrows, S.M., 2014. Detection of miRNA using a double-strand displacement biosensor with a self-complementary fluorescent reporter. Anal. Chem. 86 (3), 1853–1863. Lee, J.M., Jung, Y., 2011. Two-temperature hybridization for microarray detection of label-free microRNAs with attomole detection and superior specificity. Angew. Chem. Int. Ed. 50 (52), 12487–12490. Lin, X., Zhang, C., Huang, Y., Zhu, Z., Chen, X., Yang, C.J., 2013. Backbone-modified molecular beacons for highly sensitive and selective detection of microRNAs based on duplex specific nuclease signal amplification. Chem. Commun. 49 (65), 7243–7245. Liu, Y.-Q., Zhang, M., Yin, B.-C., Ye, B.-C., 2012. Attomolar ultrasensitive microRNA detection by DNA-scaffolded silver-nanocluster probe based on isothermal amplification. Anal. Chem. 84 (12), 5165–5169. Qiu, L., Wu, C., You, M., Han, D., Chen, T., Zhu, G., Jiang, J., Yu, R., Tan, W., 2013. A targeted, self-delivered, and photocontrolled molecular beacon for mRNA detection in living cells. J. Am. Chem. Soc. 135 (35), 12952–12955. Qiu, X., Zhang, H., Yu, H., Jiang, T., Luo, Y., 2015. Duplex-specific nuclease-mediated bioanalysis. Trends Biotechnol. 33 (3), 180–188. Sato, S.-i, Watanabe, M., Katsuda, Y., Murata, A., Wang, D.O., Uesugi, M., 2015. Livecell imaging of endogenous mRNAs with a small molecule. Angew. Chem. Int. Ed. 54 (6), 1855–1858. Tian, T., Xiao, H., Zhang, Z., Long, Y., Peng, S., Wang, S., Zhou, X., Liu, S., Zhou, X., 2013. Sensitive and convenient detection of microRNAs based on cascade amplification by catalytic DNAzymes. Chem. – Eur. J. 19 (1), 92–95. Tu, Y., Li, W., Wu, P., Zhang, H., Cai, C., 2013. Fluorescence quenching of graphene oxide integrating with the site-specific cleavage of the endonuclease for sensitive and selective microRNA detection. Anal. Chem. 85 (4), 2536–2542. Válóczi, A., Hornyik, C., Varga, N., Burgyán, J., Kauppinen, S., Havelda, Z., 2004. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res 32 (22), e175.

364

K. Zhang et al. / Biosensors and Bioelectronics 87 (2017) 358–364

Varkonyi-Gasic, E., Hellens, R.P., 2011. Quantitative stem-loop RT-PCR for detection of microRNAs. In: Kodama, H., Komamine, A. (Eds.), RNAi and Plant Gene Function Analysis: Methods and Protocols. Humana Press, Totowa, NJ, pp. 145–157. Wang, K., Zhang, K., Lv, Z., Zhu, X., Zhu, L., Zhou, F., 2014a. Ultrasensitive detection of microRNA with isothermal amplification and a time-resolved fluorescence sensor. Biosens. Bioelectron. 57 (0), 91–95. Wang, S., Fu, B., Wang, J., Long, Y., Zhang, X., Peng, S., Guo, P., Tian, T., Zhou, X., 2014b. Novel amplex red oxidases based on noncanonical DNA structures: property studies and applications in microRNA detection. Anal. Chem. 86 (6), 2925–2930. Xi, Q., Zhou, D.-M., Kan, Y.-Y., Ge, J., Wu, Z.-K., Yu, R.-Q., Jiang, J.-H., 2014. Highly sensitive and selective strategy for microRNA detection based on WS2 nanosheet mediated fluorescence quenching and duplex-specific nuclease signal amplification. Anal. Chem. 86 (3), 1361–1365. Yin, B.-C., Liu, Y.-Q., Ye, B.-C., 2012. One-step, multiplexed fluorescence detection of microRNAs based on duplex-specific nuclease signal amplification. J. Am. Chem. Soc. 134 (11), 5064–5067. Yu, C.-Y., Yin, B.-C., Wang, S., Xu, Z., Ye, B.-C., 2014. Improved ligation-mediated PCR method coupled with T7 RNA polymerase for sensitive DNA detection. Anal.

Chem. 86 (15), 7214–7218. Zhang, K., Wang, K., Zhu, X., Xie, M., 2016. A one-pot strategy for the sensitive detection of miRNA by catalyst–oligomer-mediated enzymatic amplificationbased fluorescence biosensor. Sens. Actuators B: Chem. 223, 586–590. Zhang, K., Wang, K., Zhu, X., Gao, Y., Xie, M., 2014a. Rational design of signal-on biosensors by using photoinduced electron transfer between Ag nanoclusters and split G-quadruplex halves-hemin complexes. Chem. Commun. 50 (91), 14221–14224. Zhang, Q., Chen, F., Xu, F., Zhao, Y., Fan, C., 2014b. Target-triggered three-way junction structure and polymerase/nicking enzyme synergetic isothermal quadratic DNA machine for highly specific, one-step, and rapid microRNA detection at attomolar level. Anal. Chem. 86 (16), 8098–8105. Zhang, X., Wu, D., Liu, Z., Cai, S., Zhao, Y., Chen, M., Xia, Y., Li, C., Zhang, J., Chen, J., 2014c. An ultrasensitive label-free electrochemical biosensor for microRNA-21 detection based on a 2[prime or minute]-O-methyl modified DNAzyme and duplex-specific nuclease assisted target recycling. Chem. Commun. 50 (82), 12375–12377. Zhou, D.-M., Du, W.-F., Xi, Q., Ge, J., Jiang, J.-H., 2014. Isothermal nucleic acid amplification strategy by cyclic enzymatic repairing for highly sensitive microRNA detection. Anal. Chem. 86 (14), 6763–6767.