Sensitive detection of potato spindle tuber and temperate fruit tree viroids by reverse transcription-polymerase chain reaction-probe capture hybridization

Journal of Virological Methods 80 (1999) 145 – 155 www.elsevier.com/locate/jviromet

Sensitive detection of potato spindle tuber and temperate fruit tree viroids by reverse transcription-polymerase chain reaction-probe capture hybridization A.M. Shamloul 1, A. Hadidi * Fruit Laboratory, Agricultural Research Ser6ice, US Department of Agriculture, Belts6ille, MD 20705, USA Received 11 November 1998; received in revised form 4 March 1999; accepted 5 March 1999

Abstract A rapid and sensitive assay for the specific detection of plant viroids using reverse transcription-polymerase chain reaction (RT-PCR) -probe capture hybridization (RT-PCR-enzyme-linked immunosorbent assay (ELISA)) was developed. The assay was applied successfully for the detection of potato spindle tuber viroid, peach latent mosaic viroid, or apple scar skin viroid from viroid infected leaf tissue. Clarified sap extract from infected leaf tissue was treated first with GeneReleaser™ polymeric matrix to remove inhibitors of RT-PCR reactions. Viroid cDNA was then synthesized and amplified using viroid specific primers in RT-PCR assays and the amplified viroid cDNA (amplicon) was digoxigenin (DIG) -labelled during the amplification process. The amplicon was then detected in a colorimetric hybridization system in a microtiter plate using a biotinylated cDNA capture probe. This system combines the specificity of molecular hybridization, the ease of the colorimetric protocol, and is at least 100-fold more sensitive than gel electrophoretic analysis in detecting the amplified product. Viroid cRNA may replace viroid cDNA as the capture probe. The cRNA probe was several fold more sensitive than the cDNA probe for viroid detection. Six to seven hours are needed to complete the RT-PCR-ELISA for viroid detection from infected leaf tissue. Published by Elsevier Science B.V. Keywords: Viroids; PSTVd; ASSVd; PLMVd; Detection; Amplification; RT-PCR-ELISA; cDNA probe; cRNA probe

1. Introduction Viroids are small, covalently closed, circular, single-stranded RNA molecules that contain 245 – * Corresponding author. Tel.: + 1-301-504-6460; fax: + 1301-504-5062. E-mail address: [email protected] (A. Hadidi) 1 Permanent address: Genetic Engineering Laboratory, Faculty of Science, South Valley University, Sohag, Egypt.

399 nucleotides and possess no protein coat or mRNA activity (Diener, 1987; Semancik, 1987; Sa¨nger, 1998; Singh and Dhar, 1998). Some viroids cause significant damage to the infected host crop, i.e., potato spindle tuber viroid (PSTVd), peach latent mosaic viroid (PLMVd), and apple scar skin viroid (ASSVd). Others, with no apparent effect on their primary host, may cause considerable damage to other crops located near the

0166-0934/99/$ - see front matter. Published by Elsevier Science B.V. PII: S 0 1 6 6 - 0 9 3 4 ( 9 9 ) 0 0 0 3 8 - 5

146

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155

infected host species. Diseases caused by infection with PSTVd, PLMVd, ASSVd, and others have had a major impact on crop production (Hadidi et al., 1991, 1997; Shamloul et al., 1995, 1997; Singh and Dhar, 1998). Rapid and specific detection of viroids is a prerequisite for their management and control. This laboratory introduced reverse transcription-polymerase chain reaction (RT-PCR) technology for rapid detection of plant viroids (Hadidi and Yang, 1990). Subsequently, RT-PCR has been used for successful detection of several viroids from their infected hosts (for reviews, see Hadidi et al., 1995; Candresse et al., 1998). The preparation of plant extracts suitable for RT-PCR and the detection of an amplified product by gel electrophoretic analysis, however, are still cumbersome and time consuming. There are several alternatives to the use of crude extracts or total nucleic acids for RT-PCR. One alternative, which has been utilized successfully in our laboratory, is the use of GeneReleaser™ polymeric matrix. This commercially available resin is used directly on clarified plant homogenate and is apparently able to remove RT-PCR inhibitors from a variety of host plants infected with viroids or other pathogens (Levy and Hadidi, 1993, 1994; Levy et al., 1994; Shamloul et al., 1995, 1997; Parakh et al., 1995; Hooftman et al., 1996; Nemchinov and Hadidi, 1996, 1998; Hadidi et al., 1997). Amplified PCR products are usually detected by electrophoretic analysis on agarose or polyacrylamide gels. After electrophoresis, gels have to be stained with ethidium bromide (agarose and polyacrylamide gels) or silver nitrate (polyacrylamide gels) and destained prior to viewing. Ethidium bromide is a carcinogen and must be specially treated for disposal. Silver nitrate staining may produce a high background and must be disposed of as hazardous waste. When a large number of samples has to be processed, gel electrophoretic analysis of the amplified product is labor intensive. To facilitate the detection process, we developed a simple and rapid procedure for the analysis of RT-PCR products amplified from viroid-infected tissue that can be performed in a microtiter plate. This method was developed according to the format of an enzyme-linked immunosorbent assay

(ELISA). Biotinylated DNA oligonucleotides (capture probes) were hybridized to digoxigenin (DIG)-11-dUTP labelled RT-PCR amplicons from viroid-infected tissue. The amplicon/capture probe hybrid was captured on the surface of a streptavidin-coated microtiter plate (solid phase) via avidin-biotin interaction. The hybridized amplicon was then detected with an enzyme-conjugated anti-digoxigenin antibody. In this paper, we report the successful detection of PSTVd, ASSVd, and PLMVd from GeneReleaser™-treated extracts of their respective infected leaf tissue using the RT-PCR-ELISA system. We also report that DIG-labelled cRNAs may replace DIG-labelled cDNAs as the captured probes to increase the sensitivity of the assay

2. Materials and methods

2.1. Sources of plant materials Sources of PSTVd, PLMVd, and ASSVd have been described previously (Shamloul et al., 1995, 1997; Hadidi and Yang, 1990; Hadidi et al., 1991, 1997; Zhu et al., 1995). In addition, PSTVd-infected potato and tomato leaves infected with different PSTVd variants were kindly supplied by R.P. Singh and R.W. Hammond, respectively. PLMVd-infected peach leaves and apple leaves infected with three variants of ASSVd were generously supplied by L.J. Skrzeczkowski.

2.2. Leaf sap extraction and GeneReleaser™ treatment of the clarified sap A small disk of viroid infected or uninfected leaf tissue was ground with a disposable pestle (Kontes, Vineland, NY, USA) in a sterile 1.5 ml microfuge tube containing 150 ml of TE buffer (10 M Tris-HCl, 1 mM EDTA, pH 8.0) and approximately 20 mg of 120 grit carborundum. The homogenate was then centrifuged at 12 000 rpm for 5 min at 4°C (Eppendorf model 5415). One microlitre of the clarified sap was mixed with 23 ml of GeneReleaser™ (GR) polymeric matrix (BioVentures Inc. Murfreesboro, TN) and the mixture was covered with 50 ml of mineral oil. The

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155

mixture was then microwaved in a microwave oven at high power for 6 min as described (Levy et al., 1994).

2.3. cDNA synthesis and amplification A 20 ml aliquot of GR matrix containing the sample was added immediately after microwaving to an annealing reaction mixture containing 6 ml of 5 ×first-strand buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl2), 3 ml of 100 mM dithiothreitol (DTT), and 1 mg of complementary primer (Table 1). The mixture was heated for 5 min at 100°C, chilled on ice for 2 min and held at 37°C for 5 min. Twenty microlitres of reverse transcription reaction solution [4 ml of 5× first-strand buffer, 1 ml of 2 mM dATP, dGTP, dCTP each, 1.9 mM dTTP and 0.1 mM DIG-11-dUTP, 1 ml of RNasin (40 U/ml), 2 ml of 0.1 M DTT, 11 ml of sterile water, and 1 ml SuperScript II™ RNase H − reverse transcriptase (200 U/ml) (Life Technologies, Gaithersburg, MD, USA)] was mixed with the annealing reaction mixture and incubated at 42°C for 50 – 90 min.

2.4. PCR amplification-DIG labelling PCR-DIG labelling mixtures each contained 5 ml of 10×PCR buffer (1×10 mM Tris-HCl, pH 8.3, 50 mM KCl, and 0.001% gelatin), 3 ml of 25 mM MgCl2, 5 ml of 2 mM dATP, dCTP, dGTP,

147

5.7 mM dUTP and 0.3 mM DIG-11-dUTP, 2 ml of uracil DNA glycosylase (1 U/ml), 1 ml each of 6 mM complementary and homologous primers (Table 1), 2.5 units of AmpliTaq Gold™ DNA polymerase, and sterile water to a volume of 48 ml. Two microliters of cDNA mixture was added to the PCR reaction and the mixture was covered with 50 ml of mineral oil. The mixtures were incubated at room temperature for 10 min, then amplified with the following cycling parameters: 95°C for 9 min at first cycle to activate AmpliTaq Gold™ DNA polymerase; denaturation at 94°C for 45 s, primer annealing at 60°C for 1 min, and extension at 72°C for 2 min, for 30 cycles with a final extension at 72°C for 7 min.

2.5. Analysis of RT-PCR-DIG amplified products Five-microliters aliquots of RT-PCR DIG-labelled amplicons were analyzed on 6% polyacrylamide gels (11× 14×0.15 cm) or 2% agarose gels (6× 8 cm), in TBE buffer (89 mM Tris-HCl, 89 mM boric acid, 2.5 mM EDTA, pH 8.5) at 120 v for 2–2.5 h. BioLow™ DNA molecular weight markers (BioVentures, Mufreesboro, TN) were used to determine the size of RT-PCR unlabelled or DIG-labelled amplified products of PSTVd, PLMVd, and ASSVd. Gels were either stained with ethidium bromide (agarose and polyacrylamide gels) and visualized by UV illumination or they were stained with silver nitrate (polyacry-

Table 1 Viroid primers for RT-PCR-amplification Viroid

Primers

No. of bases

Sequence

Position

Amplified DNA (bp)

Reference

PSTVd

cPSTVd

20

69–88

359

Shamloul et al. (1997)

hPSTVd

25

cPLMVd

16

5%CCCTGAAGCGCTCCTCCGAG3% 5%-ATCCCCGGGGAAACCTGGAGCGAAC-3% 5%-AACTGCAGTGCTCCGT-3%

337

Shamloul et al. (1995)

hPLMVd

19

cASSVd

16

330

Hadidi and Yang (1990)

hASSVd

25

PLMVd

ASSVd

5%-CCCGATAGAAAGGCTAAGCACCTCG-3% 5%-CCTTCGTCGACGACGA-3% 5%-CCGGTGAGAAAGGAGCTGCCAGCAR-3%

89–113 100–115 116–139 82–97 98–122

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155

148

Table 2 Viroid capture cDNA probes Viroid

Probe

No. of bases

Sequence

Position

PSTVd PLMVd ASSVd

PSTVd-cap PLMVd-cap ASSVd-cap

21 21 22

5%-BIO-AGGAGTAATTCCCGCCGAAAC-3% 5%-BIO-GATCCAGGTACCGCCGTAGAA-3% 5%-BIO-CGCCTACAAGAACGTACGGTGT-3%

151–171 199–220 162–183

lamide gels). About 75 min were required for running agarose gels and staining with ethidium bromide, while it took about 3.5 h to run polyacrylamide gels and stain with silver nitrate.

2.6. Preparation of biotin-labelled 6iroid cDNA capture probe DNA oligonucleotides (21 – 22 nt in length) (capture probe, Table 2) were synthesized and biotinylated at Life Technologies, Inc. The DNA sequence of each capture probe was complementary to the internal nucleotide sequence of the amplified viroid DNA. The sequence of the probes were selected by using the primer analysis software ‘rawprimer’ from University of Wisconsin, Madison (http://alces.med.umn.edu/ rawprimer.html).

2.7. Preparation of biotin-labelled PSTVd cRNA capture probe One microliter of Spe I-linearized pCR™ 2.1 vector containing full-length PSTVd cDNA insert (Shamloul et al., 1997) was added to 2 ml of biotin RNA labelling mixture (10 mM ATP, CTP, GTP each, 6.5 mM UTP, and 3.5 mM biotin-16-UTP, pH 7.5), 2 ml of 10×transcription buffer (0.4 M Tris-HCl, pH 8.0, 60 mM MgCl2, 100 mM [DTT], 20 mM spermidine, and 100 mM NaCl), 2 ml of T7 RNA polymerase (2 U/ml), 1 ml of RNase inhibitor (1 U/ml), and brought to a final volume of 20 ml with diethylpyrocarbonate (DEPC)treated water. The transcription mixture was mixed gently and incubated for 2 h at 37°C, then 2 ml of RQ1 RNase-free DNase (1 U/ml) was added and the mixture was incubated for 15 min at 37°C. The mixture was centrifuged at 12 000 rpm (Eppendorf model 5415) for 20 min at 4°C

and then the precipitated pellet was washed with 70% ethanol. The pellet was dried under vacuum, resuspended in 100 ml of DEPC-treated water containing 1 ml of RNase inhibitor, incubated for 30 min at 37°C, and stored at − 80°C until used.

2.8. Microwell capture hybridization assay The detection of DIG-labelled amplified DNA was carried out using the PCR-ELISA Detection System (Boehringer Mannheim Corp., Indianapolis, IN, USA). Samples were run in triplicates. Five-microliters of RT-PCR-DIG labelled amplified product were mixed with 20 ml of 0.25 M NaOH or heated at 100°C for 5 min, then chilled on ice for 2 min. The mixtures were kept at room temperature for 10 min, and then 200 ml of hybridization solution containing 50 ng/ml 5%-biotinylated DNA capture probe (21 or 22 nucleotides in length)(Table 2) or biotin-labelled cRNA capture probe (full-length, 359 nucleotides) were added. Two hundred microliters of each mixture were pipetted into an ELISA microtiter plate well coated with streptavidin (Boehringer Mannheim), and then the microtiter plate was covered with self adhesive tape (Scotch™, St. Paul, MN, USA) and kept in a water bath shaker at 55°C for 3 h. The hybridization solution was removed and the wells were washed six times with washing solution PBS-Tween (10 mM Na2HPO4, 10 mM NaH2PO4, 0.1 mM Na2EDTA, pH 6.8, 0.05% Tween-20) (Boehringer Mannheim). Two hundred microliters of polyclonal anti-DIG Fab fragments conjugated to peroxidase diluted 1:100 in Tris-HCl, pH 7.5 buffer (Boehringer Mannheim) were added to each well and the microtiter plates were shaken gently at 37°C for 30 min. Wells were then washed six times with the washing solution buffer. Two hundred microliters

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155

of substrate solution [100 mg/ml of 2,2%-azinobis(3-ethylbenzthiazoline-6-sulfonic acid) diammonium] were added to each well and microtiter plates were incubated for 30 min at 37°C in the dark with agitation. Solutions containing hybridized products were green in color. The absorbance of hybridized products were measured at 405 nm in an ELISA-reader (Multiskan Plus MK II 314). Results were expressed as net absorbance after the optical density of the blank solution was automatically subtracted for each well. Absorbance values in tables were the average reading of triplicate samples per treatment. About 3 h were needed for hybridization and reading the absorbance of the colorimetric reaction.

3. Results

3.1. Analysis of DIG-labelled 6iroid amplified products Unlabelled and DIG-labelled RT-PCR amplified cDNAs of ASSVd, PLMVd, and PSTVd from leaves of viroid-infected apple, peach, and potato plants, respectively, were analyzed by agarose gel electrophoresis (Fig. 1). The size of the unlabelled amplified cDNA of each viroid was as expected: 330 bp for ASSVd cDNA, 336 bp for PLMVd cDNA, and 359 bp for PSTVd cDNA (full length) (Fig. 1, lanes 1, 3, and 5, respectively). The electrophoretic mobility of the DIG-labelled cDNA of each viroid was relatively slower than that of its respective unlabelled cDNA (Fig. 1, lanes 2, 4, and 6). To determine whether RT-PCR products of viroid variants were labelled equally with DIG, we analyzed by polyacrylamide gels the DIG-labelled amplified products of three variants of PSTVd from potato plants and, indeed, DIG-labelled products were equally labelled and have the same electrophoretic mobility (Fig. 2, lanes 2 – 4). The mobility is slower than that of unlabelled PSTVd cDNA product (lane 1). The electrophoretic mobility of DIG-labelled PSTVd cDNA from PSTVd-infected tomato leaves was very similar to that of the cDNA amplified from viroid-infected potato (not shown).

149

The relative amount of synthesized DIG-labelled PSTVd cDNA was clearly related to the titer of the viroid in the initial clarified sap extract, with the highest amount synthesized from undiluted sap extract and the least amount from sap extract diluted 10 − 2 as detected in 2% agarose gel electrophoresis (not shown). No RT-PCR-DIG-labelled or unlabelled product was observed from sap diluted more than 10 − 2 from infected tissue or any dilution of sap extract from healthy leaves. Results similar to these obtained above for DIG-labelling the amplified PSTVd cDNA were also obtained for DIG-labelling PLMVd cDNA or variants of amplified ASSVd cDNA

3.2. Detection of 6iroid DIG-labelled RT-PCR products using 6iroid-specific capture probes in a microwell capture hybridization assay DIG-labelled viroid cDNA was analyzed by probe capture hybridization assay. The colorimet-

Fig. 1. Agarose gel electrophoretic analysis of RT-PCR (lanes 1, 3, and 5) and DIG-labelled RT-PCR (lanes 2, 4, and 6) products amplified from GeneReleaser™-treated leaf sap extracts from viroid-infected hosts. Molecular DNA marker with fragment sizes (bp) of 1000, 700, 525, 500, 400, 300, 200, 100, and 50 (M). RT-PCR and DIG-labelled RT-PCR products amplified from: ASSVd-infected apple leaves (lanes 1 and 2, respectively), PLMVd-infected leaves (lanes 3 and 4, respectively), and PSTVd-infected potato leaves (lanes 5 and 6, respectively).

150

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155

viroid DIG-labelled cDNA were simultaneously analyzed by the aforementioned detection methods. Detection of DIG-labelled PLMVd cDNA by probe capture hybridization is 100–1000 fold more sensitive than its detection by ethidium bromide-stained agarose gel and is at least 100 times more sensitive than its detection by silver nitratestained polyacrylamide gel (Table 3). Detection of DIG-labelled PSTVd cDNA or ASSVd cDNA product by probe capture hybridization was also 100–1000 more sensitive than detection by polyacrylamide or agarose gel electrophoresis analyses, respectively.

3.4. Specificity of the 6iroid cDNA capture probe Fig. 2. Polyacrylamide gel electrophoresis analysis of RT-PCR and DIG labelled RT-PCR products amplified from GeneReleaser™-treated leaf extracts from potato plants infected with different variants of PSTVd. Molecular DNA marker (M) (see Fig. 1). RT-PCR product from PSTVd-infected potato (lane 1); DIG-labelled RT-PCR amplified products from potato leaves infected with the following PSTVd variants: Fredericton mild PSTVd (FM), Atlantic FM (lane 2), Chinese mild PSTVd (Chm), Yukon Gold Chm (lane 3), Yukon Gold FM variant of PSTVd (lane 4).

ric (visual, A; absorbance, B) dilution end point for the detection of DIG-labelled PLMVd cDNA product was 10 − 4 (sample 5) when a biotinylated PLMVd cDNA was used as the capture probe (Fig. 3). Color development was absent with products from healthy tissue, or buffer control samples (samples 7 and 8). The absorbance values of these negative control samples were 0.002 and 0.000, respectively. Similar results were obtained from colorimetric assays when DIG-labelled PSTVd cDNA or ASSVd cDNA product hybridized with its respective capture probe (result not shown).

3.3. Sensiti6ity of 6iroid detection by probe capture hybridization To determine the sensitivity of detection of viroid DIG-labelled RT-PCR product by probe capture hybridization analysis as compared to agarose or polyacrylamide gel electrophoretic analysis, 10-fold dilutions of reaction mixtures of

In experiments designed to test probe specificity during hybridization, PSTVd cDNA, PLMVd cDNA, and ASSVd cDNA capture probes (Table 4) hybridized only to their respective, complementary DIG-labelled RT-PCR amplified product (Table 4, Fig. 4).

3.5. Utilization of a cRNA capture probe for the hybridization assay To determine the possibility of replacing a cDNA capture probe with a cRNA probe, biotinylated PSTVd cDNA capture probe (21 nt) was replaced with a full length (359 nt) biotinylated PSTVd cRNA as the capture probe. The hybridization was done on RT-PCR-DIG labelled PSTVd product amplified from GeneReleaser™treated clarified sap extract of PSTVd-infected potato leaves. No loss of hybridization sensitivity was observed. On the contrary, the cRNA probe was found to be several fold more sensitive than the cDNA probe for the detection of RT-PCR DIG-labelled amplified PSTVd cDNA product(Table 5). From undiluted to 10 − 2 and from 10 − 3 to 10 − 5 dilution of the clarified sap extract of PSTVd-infected potato leaves, the PSTVd cRNA probe was 2–4- and 9–12-fold, respectively, more sensitive than the PSTVd cDNA probe. Detection of amplified DIG-labelled PSTVd cDNA with colorimetric methods was at least 1000-fold more sensitive than detection by gel electrophoresis analysis (Table 5). The sensitivity of detection of

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155

151

Fig. 3. Colorimetric detection of DIG-labeled PLMVd cDNA product as shown visually (A) or by absorbance value (B) of each hybridization assay. Hybridization assay of sample: 1, undiluted product; 2, 3, 4, 5, and 6 diluted 10 − 1, 10 − 2, 10 − 3, 10 − 4, and 10 − 5, respectively. Healthy peach and buffer controls (samples 7 and 8, respectively). Fig. 4. Specificity of viroid capture probe for the colorimetric detection of homologous and heterologous viroid amplified cDNA product. PSTVd cDNA capture probe was hybridized to amplified product from leaves of: uninfected tomato (A1), ASSVd-infected apple (A2), PLMVd-infected peach (A3), and PSTVd-infected tomato (A4). PLMVd cDNA capture probe was hybridized to amplified product from leaves of: uninfected peach (B1), PSTVd-infected tomato (B2), ASSVd-infected apple (B3), and PLMVd-infected peach (B4). ASSVd cDNA capture probe was hybridized to amplified product from leaves of: uninfected apple (C1), PSTVd-infected tomato (C2), PLMVd-infected peach (C3), and ASSVd-infected apple (C4).

152

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155

Table 3 Comparison of sensitivity of detection RT-PCR-DIG labeled product of PLMVd by electrophoretic analysis on agarose or polyacrylamide gel and by colorimetric analysis of hybrids formed with biotinylated PLMVd cDNA capture probe Reaction mixture of amplicon

Detection method

Dilutionb

Gel electrophoresis

10−1 10−2 10−3 10−4 10−5

Amount (ng)

180 18 1.8 0.18 0.018

Colorimetric

Agarose

Polyacrylamide

Visual

Absorbancec

++ +a −a − −

+++ ++ + − −

++++ +++ ++ + +

2.26 1.26 0.83 0.46 0.10

a

+, Positive results; −, negative results. The number of positive signs indicate the relative intensity of the positive reaction. Five microliters of diluted sample was analyzed by agarose gel electrophoresis, polyacrylamide gel electrophoresis, or molecular hybridization. c Absorbance was measured at 405 nm. Absorbance of healthy control was 0.008. The minimum absorbance required for a positive reaction was 0.10. b

DIG-labelled or unlabelled amplified PSTVd cDNA by gel electrophoresis analysis was very similar (not shown)

4. Discussion These results demonstrate the successful use of RT-PCR-ELISA to detect directly viroids in sap extract from infected leaf tissue and indicates its feasibility as a rapid laboratory assay for detecting PSTVd, PLMVd, and ASSVd. Only 6 – 7 h are required for positive identification of the viroid from infected tissue. PCR-ELISA has been reported to be sensitive and/or specific for the detection of the targeted DNA (Kawai et al., 1994; Allen et al., 1995; Lungu et al., 1995; Zambardi et al., 1995). Moreover, RT-PCR-ELISA using a microtiter plate has been reported recently for the detection of the plant viruses potato Y (Hataya et al., 1994), tomato spotted wilt (Weekes et al., 1996), and plum pox (Olmos et al., 1997). Besides the safety of non-radioisotopic detection, the method of microtiter well hybridization has advantages of speed, suitability for a large number of samples, visual examination, and adaptation to automation. Primers used for RT-PCR amplification of PSTVd, PLMVd, or ASSVd have been previously shown to

be viroid-specific (Hadidi and Yang, 1990; Shamloul et al., 1995; Hadidi et al., 1997; Shamloul et al., 1997). The specificity of the capture probe for each viroid in this investigation was established by the lack of detectable hybridization of the capture probe to the amplified cDNA of the other two viroids and to the amplified products of uninfected tissue. The capture probe hybridized only with its complementary RT-PCR amplified product from viroid-infected leaf tissue. The specificity of the capture probe may suggest that RT-PCR-ELISA yields itself to the application of multiplex RTPCR, followed by detection of the amplified product of each pathogen in a separate hybridization reaction. The simultaneous detection of viroids in a single reaction by multiplex RT-PCR as well as the development of a multiplex PCR assay with many targets in a single set have been reported (Levy et al., 1992; Wang et al., 1998). To ensure the efficiency of hybridization reactions, excess probe was added to favor the formation of hybrids over re-annealing of PCR products and we purchased streptavidin-coated microtiter plates from the manufacturers of the system. Microtiter wells saturated with streptavidin are more likely to completely bind capture probe/DIG-labelled amplicon duplexes. Less streptavidin may lead to loss of probe/amplicon duplexes during washing steps.

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155

153

Table 4 Specificity of viroid capture probes Amplified product

Capture probe

Source of plant material

Hybrid formation Hybrid designation

Absorbance at 405 nm

Color development

Uninfected tomato ASSVd-infected apple PLMVd-infected peach PSTVd-infected tomato

PSTVd

A1 A2 A3 A4

0.004 0.001 0.030 2.991

− − − +

Uninfected peach PSTVd-infected tomato ASSVd-infected apple PLMVd-infected peach

PLMVd

B1 B2 B3 B4

0.034 0.044 0.071 2.460

− − − +

Uninfected apple PSTVd-infected tomato PLMVd-infected peach ASSVd-infected apple

ASSVd

C1 C2 C3 C4

0.003 0.007 0.020 3.115

− − − +

Table 5 Comparison of sensitivity of detection of RT-PCR-DIG labelled product of PSTVd amplified from GeneReleaser™-treated clarified sap extract of PSTVd-infected potato leaves as revealed by gel electrophoresis analysis or by colorimetric analysis of hybrids formed with biotinylated PSTVd cDNA or PSTVd cRNA probe Clarified extract PSTVd-infected potato leaves

Detection method

Dilution

Colorimetric

100 10−1 10−2 10−3 10−4 10−5

Gel electrophoresis

+a + + −a − −

cDNA probe

cRNA probe

1.182b 0.763 0.664 0.258 0.190 0.149

3.149b 3.048 2.984 2.388 2.261 1.553

a

+, Positive results; −, negative results. Absorbance was measured at 405 nm. The minimum absorbance required for a positive reaction was 0.10. Absorbance values shown were obtained in a typical experiment. b

The sensitivity of RT-PCR-ELISA for viroid detection increased by several fold when a 21-nucleotides capture cDNA probe was replaced with the 359 nucleotides long cRNA probe. These results indicate that: i) RNA can replace DNA as a capture probe; ii) the sensitivity of hybridization may have increased because the RNA-DNA hybrid is more stable than the DNA-DNA hybrid and be-

cause the 359 bp probe is 12–13-fold larger than the 21 bp probe. The detection of DIG-labelled RT-PCR products by microwell capture hybridization assay is 100–1000-fold more sensitive than the sensitivity of analysis of the amplified product by agarose or polyacrylamide gel electrophoresis. Consequently, the use of ethidium bromide or silver nitrate is no longer needed.

154

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155

Both RT-PCR-ELISA and TaqMan™ assays for pathogen detection have two levels of specificity based on RT-PCR primers and an internal hybridization probe. We have not compared TaqMan™ with RT-PCR-ELISA for the sensitivity of viroid detection. However, RT-PCR-ELISA system has the following advantages over the TaqManTM system: i) it does not require expensive equipment (i.e., sequence detection using TaqMan™ probes); ii) inexpensive synthesis of the capture probe; cDNA or cRNA probe may be used; iii) the colorimetric systems in microtiter plates are simple and color results can be read with the naked eye; iv) potential utilization of multiplex RT-PCR; v) RT-PCR-ELISA assay has the potential for being adapted to quantitative format and for automation (Zerbini et al., 1995). These qualities, coupled with the specificity, sensitivity, and speed of the assay, make this an attractive tool for diagnosis of plant pathogens. The development of RT-PCR-ELISAs for PSTVd, PLMVd, and ASSVd should greatly assist in controlling these viroids for certification and quarantine programs.

Acknowledgements This investigation was partially supported by USAID grant no. PCE-G-00-98-00009-00.

References Allen, R.D., Pelletl, P.E., Stewart, J.A., Koopman, M., 1995. Nonradioactive PCR-enzyme-linked immunosorbent assay method for detection of human cytomegalovirus DNA. J. Clin. Microbiol. 33, 725–728. Candresse, T., Hammond, R.W., Hadidi, A., 1998. Detection and identification of plant viruses and viroids using polymerase chain reaction. In: Hadidi, A., Khetarpal, R.K., Koganezawa, H. (Eds.), Plant Virus Disease Control. APS Press, St. Paul, MN, pp. 399–416. Diener, T.O., 1987. The Viroid. Plenum Press, New York, NY. Hadidi, A., Yang, X., 1990. Detection of pome fruit viroids by enzymatic cDNA amplification. J. Virol. Methods 30, 261– 270. Hadidi, A., Hansen, A.J., Parish, C.L., Yang, X., 1991. Scar skin and dapple apple viroids are seed borne and persistent in infected apple trees. Res. Virol. 142, 289–296.

Hadidi, A., Levy, L., Podlecckis, E.V., 1995. Polymerase chain reaction technology in plant pathology. In: Singh, R.P., Singh, U.S. (Eds.), Molecular Methods in Plant Pathology. CRC/Lewis Press, Boca Raton, FL, pp. 167 – 187. Hadidi, A., Giunchedi, L., Shamloul, A.M., Poggi-Pollini, C., Amer, M.A., 1997. Occurrence of peach latent mosaic viroid in stone fruits and its transmission with contaminated blades. Plant Dis. 81, 154 – 158. Hataya, T., Inoue, A.K., Shikata, E., 1994. A PCR-microplate hybridization method for plant virus detection. J. Virol. Methods 46, 223 – 236. Hooftman, R., Arts, M.J., Shamloul, A.M., Van Zaayen, A., Hadidi, A., 1996. Detection of chrysanthemum stunt viroid by reverse transcription-polymerase chain reaction and by tissue blot hybridization. Acta Hort. 432, 120 – 128. Kawai, S., Maekawajiri, S., Tokunaga, K., Jujo, T., Yamane, A., 1994. A simple method of HLA-DRB typing using enzymatically amplified DNA and immoblized probes on microtiter plate. Hum. Immunol. 41, 121 – 126. Levy, L., Hadidi, A., 1993. Rapid and simple preparation of samples for PCR from tissue containing viruses, viroids, and MLO’s. Phytopathology 83, 1378. Levy, L., Hadidi, A., 1994. A simple and rapid method for processing tissue infected with plum pox potyvirus for use with specific 3’ non-coding region RT-PCR assays. EPPO Bull. 24, 595 – 604. Levy, L., Hadidi, A., Garnsey, S.M., 1992. Reverse transcription-polymerase chain reaction assays for the rapid detection of citrus viroids using multiplex primer sets. Proc. Int. Soc. Citricult. 2, 800 – 803. Levy, L., Lee, I-M., Hadidi, A., 1994. Simple and rapid preparation of infected plant tissue extracts for PCR amplification of viruses, viroids, and MLO’s. J. Virol. Methods 49, 295 – 304. Lungu, O., Sun, X.W., Wright, T.C., Ferenczy, A., Richart, R.M., Silverstein, S., 1995. A polymerase chain reactionenzyme-linked immunosorbent assay method for detection human papillomavirus in cervical carcinomas and highgrade cervical cancer precursors. Obstet. Gynecol. 85, 337 – 342. Nemchinov, L., Hadidi, A., 1996. Characterization of the sour cherry strain of plum pox virus. Phytopathology 86, 575 – 580. Nemchinov, L., Hadidi, A., 1998. Specific nucleotide primers for the direct detection of plum pox potyvirus-cherry subgroup. J. Virol. Methods 70, 231 – 234. Olmos, A., Cambra, M., Dasi, M.A., Candresse, T., Esteban, O., Gorris, M.T., Asensio, M., 1997. Simultaneous detection and typing of plum pox potyvirus (PPV) isolates by Heminested-PCR and PCR-ELISA. J. Virol. Methods. 68, 127 – 137. Parakh, D.R., Shamloul, A.M., Hadidi, A., Scott, S.W., Waterworth, H.E., Howell, W.E., Mink, G.I., 1995. Detection of prune dwarf ilarvirus from infected stone fruits using reverse transcription-polymerase chain reaction. Acta Hort. 386, 421 – 430.

A.M. Shamloul, A. Hadidi / Journal of Virological Methods 80 (1999) 145–155 Sa¨nger, H.L., 1998. Classification of the small plant pathogenic RNAs. Acta Hort. 472, 553–554. Semancik, J.S., 1987. Viroids and Viroid-like Pathogens. CRC Press, Boca Raton, FL. Shamloul, A.M., Hadidi, A., Minafra, A., Giunchedi, L., Waterworth, H.E., Allam, E.K., 1995. Peach latent mosaic viroid: Nucleotide sequencing of an Italian isolate, sensitive detection by RT-PCR and cRNA probe, and geographical distribution. Acta Hort. 386, 522–530. Shamloul, A.M., Hadidi, A., Zhu, S.F., Singh, R.P., Sagredo, B., 1997. Sensitive detection of potato spindle tuber viroid using RT-PCR and identification of a viroid variant naturally infecting pepino plants. Can. J. Plant Pathol. 19, 89– 96. Singh, R.P., Dhar, A.K., 1998. Detection and management of plant viroids. In: Hadidi, A., Khetarpal, R.K., Koganezawa, H. (Eds.), Plant Virus Disease Control. APS Press, St. Paul, MN, pp. 428–447. Wang, D.G., Fan, J-B., Siao, C-J., Berno, A., et al., 1998. Large-scale identification, mapping, and genotyping of sin-

.

155

gle-nucleotide polymorphisms in the human genome. Science 280, 1077 – 1082. Weekes, R., Barker, I., Wood, K.R., 1996. An RT-PCR test for the detection of tomato spotted wilt tospovirus incorporating immunocapture and colorimetric estimation. J. Phytopathol. 144, 575 – 580. Zambardi, G., Druetta, A., Roure, C., Fouque, B., Girardo, P., Chypre, C., Marchand, J., Freney, J., Fleurette, J., 1995. Rapid diagnosis of Mycobacterium tuberculosis infections by an ELISA-like detection polymerase chain reaction products. Mol. Cell Probes 9, 91 – 99. Zerbini, M., Gibellini, D., Musiani, M., Venturoli, S., Gallinella, G., Gentilomi, G., 1995. Automated detection of digoxigenin-labeled B19 parvovirus amplicons by capture hybridization assay. J. Virol. Methods 55, 1 – 9. Zhu, S.F., Hadidi, A., Hammond, R.W., Yang, X., Hansen, A.J., 1995. Necleotide sequence and secondary structure of pome fruit viroids from dapple apple diseased apples, pear rusty skin diseases pears and apple scar skin symptomless pears. Acta Hort. 386, 554 – 559.