- Email: [email protected]
Sequence analysis of arcelin 2, a lectin-like plant protein
Oene, 86 (1990) 171-176 Elsevier
171
GENE 03374
Sequence analysis of arcelin 2, a leetin-like plant protein (Recombinant DNA; primer extension; toxins; electrophoretic variants; transcripts; development; glycosylation sites)
Maliyakal E. John" and Christopher M. Long b ° Agracems, Middleton, W155562 (U.S.A.), and b Ceres. Emery~lle, CA 94608 (U.S.A.) Tel. (415)420-3300 Received by J. Messing: 10 July 1989 Revised: 25 September 1989 Accepted: 26 September 1989
SUMMARY
The nucleotide sequence ofthe cDNA clone encoding arcelin 2 (Arc2), one member of a family of closely related lectin-like plant toxins from wild bean accession, is presented. The sequence contains a 265-amino acid (aa) open reading frame and is 99.3 % homologous to Arcl, another of the four electrophoretic variants with proven antibiosis characters. These two proteins differ by four aa residues. Based on cross hybridizations of RNAs, it is assumed that Arc4 is more divergent than Arcl and Arc2. Furthermore, it is likely that at least three of the variants are polypeptides of similar size and the observed molecular weight differences between them are due to differences in the number of glycosylation sites.
INTRODUCTION
Arcelin (Arc) is a carbohydrate-binding protein that is found in noncultivated wild bean accessions. Schoonhoven etal. (1983) reported resistance to bean weevil (Acanthoscelides obtectus) and Mexican bean weevil (Zabrotes subfasclatus) in noncultivated common bean accessions. Subsequently, a novel lectin-like protein named arcelin was identified in the resistant plants and demonstrated to confer toxicity to bean bruchid pests (Romero-Andreas etal., 1986; Osborn etal., 1988a). Since bruchids form a serious threat to bean crops in a number of countries, Arc may have economic benefits if it is incorporated into cultivated bean varieties. Four electrophoretic variants of Arc have been described (Romero-Andreas etal., 1986; Osborn etal., Correspondence to: Dr. M.E. John, Agracetus, Middleton, Wl 53562 (U.S.A.) Tel. (608)836-7300; Fax (608)836-9710.
Abbreviations: aa, amino acid(s); Arc, arcelin; bp, base pair(s); eDNA, DNA complementary to RNA; DTT, dithiothreitol; kb, kilobase(s) or 1000 bp; M-MLV, Moloney murine leukemia virus; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; PAGE, polyacrylamide gel electrophoresis; PHA, phytohemagglutinin;SDS, sodium dodecyl sulfate; SSC, 0.15 M NaCI/0.015 M Na3" citrate pH 7.0. 0378-11191901503.50© 1990ElsevierSciencePublishersB.V.(BiomedicalDivision)
1986). The cDNA clone for Arcl has been sequenced and its antibiosis character established through insect feeding trials (Osborn etal., 1988a). Deglycosylated Arcl is a 29-kDa protein. It is structurally very close to another carbohydrate-binding bean protein, phytohemagglutinin (PHA), which is the major lectin in bean cultivars. A high degree of sequence homology, both at the aa (58 to 61~0) and nt (78 to 81~o) levels is observed between various PHAs and Arcl (Osborn et al., 1988a). PHA also confers toxicity to cowpea weevil when the protein was added to artificial cowpea seeds (Janzen etal., 1976). In this paper we describe the sequence of a second electrophoretic variant of Arc, Arc2. Arc I and Arc2 differ at six nt positions resulting in four aa changes. These differences result in the loss of a potential glycosylation site and may account for the observed Mr differences between Arcl and Arc2.
MATERIALS AND METHODS
All bean lines were supplied by Prof. Fredrick A. Bliss of the Department of Pomology, University of CaliforniaDavis. Phaseolus mlgaris lines that contain three of the Arc
172 variants will be referred to as Arcl(+ ), 2( + ) and 4(+ ), while near isogenic bean cultivars that d~.~not contain Arc will be referred to as Arcl(- ), 2(- ) and 4 ( - ). Developmen*. of these bean lines have been described (RomeroAndreas et al., 1986; Osborn et al., 1986). Immature beans were collected at seven, eleven and 15 days after fertili. zation, and mature beans (dry) were collected at 34 days atter fertilization. In vitro translation of mRNAs were carried out in rabbit reticulocyte lysate (Promega) using [ 35S]methionine (DuPont; 800 Ci/mmol) as radiolabel and the protein products separated on SDS-polyacrylamide gels (Laemmli, 1970). Northern blotting was done accordlug to Thomas (1980). (a) Cloning A 5-20~ sucrose gradient (12m l) was prepared in 100 mM Tris pH 7.5, 100 mM KCI and I mM EDTA. A 50/~g poly(A) ÷ RNA sample from eleven- and 15-day-old beans was denatured by heating at 65°C for 2 min and then layered onto the gradient. It was centrifuged (SW41) at 40000 RPM for 4 h at 4°C. Fractions (300/Jl) were collected and the RNA precipitated. Size-selected RNAs were used for cloning. We used the method of D'Alessio (1987) without modifications for eDNA cloning. The doublestranded DNA was tailed with dC residues and annealed with riG-tailed pBR322" vector (BRL). Escherichla coli (RRI) cells were transformed according to Hanahan (1985). Plasmid preparations, restriction analysis of DNA, agarose gel fractionation and purification of DNA by electroelution have been described (Ausubel et al., 1987). Screening of the eDNA library and preparation of 32p. labelled probes have been described (John et At., 1984; 1985). Filter hybridizations were carried out at 65'C for 18 h in 4 × SSC, I mM EDTA, 0.SYo SDS, 100/~g/ml of sonicated denatured salmon sperm DNA, 10/~g/ml polyadenylic acid and 10 × Denhardt's (1966) solution.
(b) Primer extension analysis Primer extension of Arc RNAs were essentially done as described by Dean et al. (1987). Oligomers were labelled with [y-32p]ATP (DuPont, 3000 Ci/mmol)using T4 polynucleotide kinase (Boehringer) and unincorporated nucleotides were removed by Sephadex G-25 chromatography. The primer-RNA hybridization reaction contained the following: 250 mM KCI/2 mM Tris pH 7.9/15 u of RNasin (Promega)/l mM DTT/3/4g poly(A) ÷ RNA/0.2 pmoi primer in a vol. of 10/41. Hybridization was carried out at different temperatures based on calculated dissociation temperature (Newman et ai., 1983) for 4 h. llybridized p/finer was extended using M-MLV reverse transcriptase (BRL) and products analyzed by 6 ~ sequencing gel
(Ausubel et al., 1987). Cloning ofthe extended product was carried out as described (D'Alessio, 1987). Recombinant clones were analyzed for insert sizes by SDS-agarose electrophoresis (Sekar, 1988) or polymerase chain reaction (Saiki et al., 1988) using appropriate primers. Sequence analysis of clones was done according to the methods of Chen and Seeburg (1985) and Tabor and Richardson (1987).
RESULTS AND DISCUSSION
Insecticidal proteins from plants, animals and microbial sources have great potential for agricultural biotechnology in designing insect-resistant plants. The best known insecticidal protein that is being incorporated through genetic engineering into crop plants is the &endotoxin from Bacillus thuringiensis (Barton eta]., 1987; Vaeck eta]., 1987). A large number of other, but less well characterized, proteins such as inhibitors of trypsin, chymotrypsin and amylase (Marshall et al., 1975; Richardson et al., 1986), and ribosome-inactivating proteins (Stirpe and Barbieri, 1986) are also known. A carbohydrate binding PHA protein from common bean Phaseolus migaris L. (King et al., 1982) as well as recently identified Arc from Mexican wild beans (1'. mlgaris vat. aborigineus) may also be important in the protection of seeds from insects. (a) Identification of Arc clones The molecular weights of Arc variants are reported to be in the range of 35-42 kDa (Osborn et ai., 1986). We have tested this observation by examining the proteins from seven-, eleven- and 15-day-old, as well as mature beans of Arc ( + ) and ( - ) types by SDS-PAGE. As expected, pro. teins from Arcl( + ), 2( + ) and 4( + )contained bands ofthe predicted mobility that were absent from corresponding Arc ( - ) beans (see Osborn et al., 1986; data not shown). In order to enrich for RNAs that code for proteins of 20-45 kDa, we subjected eleven-day and 15-day RNAs from Arc2( + ) beans to sucrose density gradient centrifugation. Aliquots of RNA from fractions were translated in rabbit reticulocyte iysate and the radiolabelled proteins separated by SDS-PAGE. RNA fractions that corresponded to 20-4$-kDa proteins were then pooled and used for cloning. About 2000 clones were transferred to nitrocellulose and subjected to differential screening using cDNAs generated from poly(A) + RNA of 15-day Arc2( + ) and 2( - ) beans. This resulted in the identification of 60 putative Arc2 clones. Two clones pARC2-6 and pARC2-11 were further studied. These two clones cross-hybridized to each other and also to 28 other clones. The insert sizes for
173
pARC2-6 and pARC2-11 were 550 and SS0bp,
respec-
tively.
(b) Transcript size and developmental accumulation The presence o f R N A s corresponding to clone pARC2-6 was studied by Northern analysis. The insert o f the clone was hybridized to Northern blot containing poly(A) ÷ R N A from seven-, eleven-, 15-day and mature A r c 2 ( + ) beans (Fig. la). Hybridization was apparent only to seven-, eleven- and 15-day R N A s . The size o f the hybridizing
a
transcript is 950 nt. Dmsitometric scanning o f the autoradiosraph shows that thm~ is an a p p r o x i m a t e l y l ~ f o l d increase in the conomtration for this R N A at 15 days compared to seven-day seeds. Thus, R N A for p A R C 2 ~ appears at about seven days after fertilization a n d aecumu. lates through an eight-day period. Since we did not observe pARC2-6 R N A in mature brans, it is possl~ole that these transcripts are depleted due to their u~liyation in the biosynthesis of" protein during maturation o f the seed. A second Northern blot containing poly(A) + R N A s from 15-day and mature beans o f Arc2( + ) and ( - ) types as well C
b
ODD"
A
O..-
,-
tO
v,-
tO
,<
eC
4C ,~
2.0,--
2"0-
1.0B
0"56-
q,,, ym,
<<
< <
o .o o o o . o < < .<.<
Fla. I. Analysis of Arc2 RNA. Panel a: Transcript size and development accumulation of Arc2 RNA. Beans were Frozen in liquid nitroaen, powdered and then mixed (I: I0 weight to volume)in I00 mM Tris pH 8.0/20 mM EDTA/0.$% SDS/0.$% #.mercaptoethanol/0.$ M NaCI, then homogenizedwith a Polytron for 2 rain. The homogenate was extracted with an equal volume of'phenol: chloroform and then with chloroform. One-third volume of I0 M LiCI was added and the mixture kept at 4"C for 12 h. The precipitate was dissolved in a small volume of'water and the LiCI precipitation repeated. A final precipitation was done by addi~ 0.5 volume of 7.$ M ammonium acetate and two volumes of ethanol. Poly(A)+RNA was prepared by oliso(dT)-cellulose chromatoaraphy. Poly(A)+RNA (0.2 Pa) From seven-, eleven- and l$-day and mature (Arc2 + M) beans of Arc2(+ ) type were analyzed by Northern blot. RNA was size Fractionated by 1.25% agarose/formaldehydegel electrophoresis. EIectrophoresis was carried out at room temperature in 20 mM Hepes pH 7.8, 0.2 mM EDTA and I M formaldehyde.The RNA was then blotted to nitrocelluiose.The blot was hybridized to the 32P-labelledinsert of pARC2-6 (I x 10s cpm/#g; $ x 10s cpm/ml). The filter was washed at hiah stringency. Low- and hiah-stfingencywashings of the filters were carried out as follows: all solutions contained 0.2% SDS and I mM EDTA, in addition to SSC. Low.stringencywash was in 3 × SSC at 53"C for 20 min followed by two washes in 2 × SSC at $3°C and one wash in I × SSC for 20 rain at $3°C. For hiah stringency,filters were washed as above but with additional washes at 0.5 × SSC and 0.I × SSC, 53°C for 0.5 to 2 h. Origin (O) and size standards (in kb) are shown in the left mar~n. Panel b: Poly(A)+RNA (0.2/48) from mature beans of Arcl, 2 and 4 of(+ ) and ( - ) types were analyzed by Northern blot. The filter was hybridized to 32P-labelledinsert (I x I0s cpm/p8; 5 × 10s cpm/ml) ofclone pCONTARCM-ZThe blot was washed at hiah stringencyconditions(see panel a legend)~ Panel c: Poly(A)+RNAs (0.2 gg) from eleven- and 15-day-oldArcl(+ ) and 4( + ) beans were analyzed by Northern blot and the filter was hybridized to the nick-translated insert of pARC2-6 (I x 108 cpm/Fg; 5 × 10s cpm/ml). The blot was washed to a moderate stringency(,6,)0.5 × SSC at 53"C and then at more stringent conditions (B)0.I × SSC at 60"C (see panel a legend).
174 as Arc2 and Arc4(+ ) and ( - ) types were hybridized to pARC2-6 clone, pARC2-6 hybridizes only to 15-day Arc2( + ) bean RNA (not shown). In order to ascertain that the negative hybridization result is not due to degradation of mature seed RlqAs, we analyzed mature seed RNAs from Arcl(+ ), 2( + ), and 4(+ ) as well as the corresponding Arc(-) beans by Northern blot. The blot was then hybridized to a control clone, pCONTARCM-2, that is expressed in both Arc2(+) and 2 ( - ) beans. pCONTARCM-2 was identified during the differential screening ofthe Arc2( + ) eDNA library. As seen in Fig. lb, pCONTARCM-2 hybridizes to a single RNA species in all mature bean RNAs. Hence, the absence of hybridization of •pARC2-6 clone to mature bean RNA is due to the lack of corresponding transcripts. (c) Hybridization of pARC2-6 to Arcl(+), and Arc4(+) RNAs Structural or immunological similarities between the four Arc variants are not known. In order to assess structural relationship, we blotted eleven- and 15-day poly(A) + RNAs from Arcl(+) and Arc4(+) beans and hybridized the Northern blot to pARC2-6. At moderate stringency ofwash (0.5 × SSC and 53°C), strong hybridization to Arcl( + ) and weaker hybridization to Arc4( + ) is observed (Fig. lc). In both I and 4 type Arc beans pARC2.6 hybridizes to a transcript of 950 nt. When the stringency of the wash was increased to 0.1 × SSC and 60°C, the hybridization to Arel(+ ) RNA remained strong while about 90~o signal was lost from the Arc4( + ) RNA (Fig. lc). These results indicate that a closely related gene to pARC2-6, with varyin8 degrees of homology, is expressed in Arc1 and 4. Sequence homology between pARC2-6 and the corresponding gene in Arc 1( + ) is likely to be greater than that of Arc4( + ). (d) Sequence of Arc2 The inserts of pARC2-11 and pARC2-6 were sequenced using the dideoxynucleotide method. The insert in pARC2-11 is 846 bp long while pARC2-6 has an insert size of 528 bp. The two clones overlap at the 3' end and are identical to each other in the region where they overlap. Since the transcript size for pARC2-11 as deduced from Northern blots is 950 nt, it is likely that the clone lacks the 5' end of the corresponding RNA. In order to clone the 5' end, we carried out primer extension using two oligo: (,4) AACGTCTCGACGTrGAAGGA and (B) GAGCCGACGGGGACGAGAGC. Primer (A) and primer (B) are located 19 and 268 nt from the 5' end of pARC2-11, respectively. 32p-labelled primer(A) was hybridized to poly(A) + RNAs from 15-day-old Arc 1( + ),2( + ), and 4( + )
beans. The primer extended products were then analyzed on sequencing gels. The results indicate that the product is 107 nt long for Arcl( + ), 2(+ ) and 4( + ) RNAs (not shown). This is the length expected of the product, if the RNA for pARC2-11 is 68 nt more than its 5' end. Extended product of primer(B) and Arc2(+) RNA was cloned (clone pARC2-19.1, 325-bp insert) and subsequently sequenced. The 269 nt of clone pARC2-191 overlap with the 5' end ofpARC2-11 and are identical to it. The remaining 56 bp of pARC2-191 comprise the missing 5' region. Thus, pARC2-11 and pARC2-191 together give the complete sequence (902 bp). It has one long open reading frame (795 nt) with an ATG initiation codon at position l, forming a 265-aa protein (Fig. 2). The estimated size of the protein is 29.3 kDa. When nt sequences of pARC2-11 and pARC2-191 are compared with that of Arcl, it is seen that they are 99.3% similar. Thus, the protein encoded by pARC2-11 (and pARC2-191) is Arc2. There are 12 nt missing from the 5' non-translated region of Arc2. We assume that the 5' extension was not complete in pARC2-191 clone. Also, there are 22 nt missing from the non-coding 3' end of pARC2-11 compared to Arcl sequences (Osborn etal., 1988a). Sequence comparison of the remaining 902 bp shows that there are six single nt differences, of which four result in aa changes (Fig. 2). The N-terminal aa analysis of purified mature Arc l and its comparison to the nt-derived aa sequence, suggest a 21-an signal peptide. Also, the hydrophobicity of the 21 aa agrees with this function (Osborn et al., 1988a). Both Arc I and 2 are identical in the first 98 aa ofthe N terminus, The apparent Mr ofthe giycosylated form of Arcl is about 37.5 kDa while Arc2 is 35 and Arc4 is 42 kDa (see Fig. 1 in Osborn, et al. 1986). Identical size transcripts as well as the number of nt derived aa for Arcl and 2 suggest that the basis of Mr difference between these proteins is likely to be due to post-translational modifications. Since Arc is a giycoprotein (Osbom et 81. 19881)), the degree of giycosylation could be such a factor. A tripeptide, Asn-X-Thr (or Ser) where X can be any aa except aspartic acid, is considered to be the most likely site of giycosylations in proteins (for review see Hubbard and Ivatt, 1981 and references therein). Processed Arcl contains three such potential giycosylation sites (positions 33-35, 89-91 and 128-130), whereas Arc2 contains only two. The sequence, Asn-Thr.Thr at aa position 128-130 in type 1, is changed to Asn-Thr-Ala in type 2, and will not support giycosylation (Fig. 2). Similar changes in the giycosylation sites could also be responsible for Mr differences between Arc2 and Arc4, since Northern analysis and primer extensions indicate that all three Arc types are encoded by transcripts of the same size. Antibiosis properties of lectins and Arc are proposed to be due to the lysis of epithelial cells of the intestine by
175 lk
HetAlaSerSerAsnLeuLeuThr LeuAlaLeuPheLeuWllLeuLeu Thrll|sAlaAsnSerSerAsnAsp ATGGCTTCCTCCAACTTACTCACCCTAGCCCTCTTCCTTGTGCTTCT¢ACCCA . a z w c ~ pare 2-II" t AlaSerPheAsnVa161uThrPhe AsnLysThrAsnLeulleLeuGIn 61yAspAliIThrVaISerSerGlu AACAAAACCAA¢CTCATCCTCCAA 73 GCCTCCTTCAACGTCGAGACGTTC GlyHisLeuLeuLeuThrAsnVal
14S GGCCACTTACTACTAACCAATGTT
72
sGlyAsnGluGIuAspSerl4et GlyArgAIdJheTyrSerAldlPro CGAAGAGGACTCTATGGGCCGCGCCTTCTACTCCGCCCCC216 ~k
! leGlnl leAsnAspArgThrlle AspAsnLeuAlaSerPheSerThr AsnPheThrPheArglleAsnAIa AACTTCACATTCCGTATCAACGCT 288 217 ATCCAAATCAATGACAGAACCATCGACAACCTCGCCAGCTTCTCCACC lle LysAsnAsnGluAsnSerAlaTyr 289 AAGAACAATGAAAATTCCGCCTAT T t~k
ValGlySerArgProL~LeuLys GTCGGCTCTCGGCCCAAACTTAAA 360
2-191 "•rrc
GlyArgTyrLeuGlyLeuPheAsn 361 6GCCGTTATCTAGGTCTTTTCAAC ~A pAre 2-6 ThrWllSerAsnArglleGlu!le 433 ACCGTCAGCAACCGTATTGAAATC
HisThrValAluValValPhe~p CATACTGTGGCTGTGGTGTTCGAC
T
A1aThr61uSerCysAsnlqmG1y GCAACGGAGTCTTGCAATTTCGGC SO4
Asp HtsAsnAsnG1yG1ul.ysA1a61u WllArgl leThrTyrTyrSerPro LysAsnAspLeuArgValSerLeu AAGMCGACTTGAGGGTTTCTCT6 S76 GTTCGGATCACCTATTACTCCCCC 505 CACAACAACGGAGAAAAGGCCGA6 6 LeuTyrProSerSer61uG1uLys CysH|sValSerAlaThrValPro LeuGluLysGluValGluAspTrp C166AGNL~TTGAGGACTG6 648 S77 CTTTACCCTTCTTCGGAAGAAAA6TGCCACGTCTCTGCCACAGTGCC6 VtllSerValGlyPheSerAlaThr Ser61ySerl.ysl.ysG1uThrThr61uThrilisAsnValLeuSerTrp 6AAACGCACAACGTCCTCTCTT66 720 649 6TGAGCGTTGGGTTCTCTGCCA¢C TCAGGGTCGAAAAAAGAGACCACT s SerPheSerSerAsnPhelleash PheGL~uGlyl.ysLysSerGluArgSerAsn! I eLeuLeuAsnLys11• TCCAACATCCTCCTCMCAAGATC 792 721 TCTTTTTCTTCCAACTTCATCAAT TTTGAGGGCAAAAAATCTGAACGT A
Lee 793 ¢TCTAGACTCCCAAAGCCAGCTT¢ ACTGTGACAGTAAAACCTTCCTTA TACGCTAATAATGTTCATCTGTCA 864 865 CACAAACTACAATAAATAAAATCA GAGCAATAAATAAA902 C Fill, 2, Sequenceof Ar~2. The complete sequence was obtained from clones pare2- I ! (pAre2-6) and pare2-19 !. pare2- I 1 has an insert size of 846 bp. pare2.6 contains a smaller insert of 528 bp. $' ends ofpAre2-11 and pAre2-6 cDNAs are marked by rightward arrows, pAre2.191 is the primer extended clone and contains a 325-bp insert; the 3' end of its insert is marked by a lettward arrow. Difference between Arcl and 2 both at the nt and aa levels are 81yen.The nu©leotides are numbered. Potential 81ycosylationsites shared by Arc2 and I are marked by sinsle stars and those that are found only in Arel by double stars. Consensus poly(A)-addition signals m underlined. Accession number of the sequence in OonBank is M28470.
binding to the carbohydrate moieties ofthese proteins (King et al., 1982; Osborn et al., 1988a). The relative degrees of antibiosis of the different Arc variants are not known. If different Arcs differ in their carbohydrate binding capacities, then it is also likely that they may differ in their toxicity toward bruchids. Primary structures of Arc3 and 4 as well as determination of the insecticidal activities of these proteins may reveal interesting and potentially useful relationships between these variants.
ACKNOWLEDGEMENTS
We are thankful to Professor Frederick A. Bliss, University of California-Davis, for supplying the bean lines and also for his interest in this project. We are grateful to Dr. Winston J. Brill for his encouragement as well as his critical
reading ofthe manuscript. We acknowledge the expert technical assistance of Douglas DeMarini, Michael Petersen and Grant Johnson. We thank Dr. Ken Barton and Dr. Will Swain for their helpful suggestions.
REFERENCES Ausubel, F.M., Blent, R., Kingston, R.E., Moore, D.D., Seidman, J.O., Smith, J.A. and Struld, K.: Current Protocols in Molecular Biology. John Wiley Press, New York, 1987. Barton, K.A., Whit¢ley,H.R. and Yang,N.-S.:BacillustAur~Q~ns~endotoxin expressed in transgenic Nlcodanatalcum provides resistance to lepidopteran insects. Plant Physiol. 85 (1987) 1103-1109. Chen, E.Y. and Sceburg, P.H.: Supercoil sequencing: a fast simple method for sequencing plasmid DNA. DNA 4 (1985) 165-170. D'Alessio, JM., Noon, M.C., Ley III, H.L. and ~rard, O.F.: One-tul~ double stranded eDNA synthesis using cloned M-MLVreverie tran-
176 scriptase. Focus (Bethesda Research Laboratories, Gaithersburg, MD) 9 (1987) I-4. Dean, C., Favrean, M., Dunsmuir, P. and Bedbrook, J.: Confirmation of relative expression of Petunia rbcS genes. Nucleic Acids Res. 15 (1987) 4655-4668. Denhardt, D.T.: A membrane-filter technique for the detection of complementary DNA. Biochem. Biophys. Res. Commun. 23 (1966) 641-646. Hanahan, D.: Techniques for transformation of E. co/i. In Glover, D.M. (Ed.) DNA Cloning. A Practical Approach. Voi. L I1~ Press, Oxford, 1985, pp. 109-135. Hubbard, S.C. and Ivatt, RJ.: Synthesis and processing of asparaginelinked oligosaccharides. Atmu. Rev. Biochcm. 50 (1981) 555-583. Janzen, D.H., Juster, H.B. and Liener, I.E.: Insecticidal action of the phytohemagglutinin in black beans on a bruchid beetle. Science 192 (1976) 795-796. John, M.E., John, M.C., Ashley, P., MacDonald, RJ., Simpson, E.R. and Waterman, M.R.: Identification and characterization of cDNA clones specific for cholesterol side-chain cleavage cytochrome P-450. Prec. Natl. Acad. Sci. USA 81 (1984) 5628-5632. John, M.E., John, M.C., Simpson, E.R. and Waterman, M.R.: Regulation of cytochrome P-45011 gene expression by adrenocorticotropin. J. Biol. Chem. 260 (1985) 5760-5767. King, T.P., Pusztai, A. and Clarke, E.M.W.: Kidney bean (Phaseolus vu/ga~) lectin-induced lesions in rat small intestine. J. Comp. Pathol. 92 (1982) 357-373. Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680-685. Marshall, JJ. and Landa, C.M.: Purification and properties of phaseolamin, an inhibitor of a.amylase from the kidney bean, PhaseoAa vulgar. J. Biol. Chem. 250 (1975) 8030-8037. Newman, AJ., Ogden, R.C. and Abelson, J.: tRNA Gene transcription in yeast: effect of specified base substitutions in the intragenic promoter. Cell 35 (1983) 117-125. Osborn, T.C., Blake, T., Oepts, P. and Bliss, F,A.: Bean arcelin: genetic variation, inheritance, and linkage relationships of a novel seed pro-
rein of Phaseolusmlga~ L. Theor. Appl. Genet. 71 (1986) 847-855. Osborn, T.C.,Alexander,D.C., Sun, S.S.M.,Cardona, C. and Bliss,F.A.: Insecticidal activity and lectin homology of arcelin seed protein. Science 240 (1988a) 207-210. Osborn, T.C., Burow, M. and Bliss, F.A.: Purification and characterization of arcelin seed protein from common bean. Plant Physiol. 86 (1988b) 399-405. Richardson, M. et al.: The amino acid sequence and reactive (inhibitory) site ofthe major trypsin isoinhibitor (DE5) isolated from seeds ofthe Brazilian Carolina tree (Adenantherapavonina L.). Biochim. Biophys. Acta 872 (1986) 134-140. Romero-Andreas, J., Yandell, B.S. and Bliss, F.A.: Bean arcelin. Inheritance of a novel seed protein of Phaseolus m/garb L. and its effect on seed composition. Theor. Appl. Genet. 72 (1986) 123-128. Salki, R.K., Gelfand, D.H., Stoffel, S., Scharf, SJ., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A.: Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239 (1988) 487-491. Schoonhoven, A.V., Cardona, C. and Valor, J.: Resistance to the bean weevil and the Mexican bean weevil (Coleoptera: Bruchidae) in noncultivated common bean accessions. J. Econ. Entomol. 76 (1983) 1255-1259. Sekar, V.: A rapid screening procedure for the identification of recombinant bacterial clones. BioTechniques 5 (1987) 11-13. Stirpe, F. and Barbieri, L.: Ribosome-inactivating proteins up to date. FEBS Lett. 195 (1986) !-8. Tabor, S. and Richardson, C.C.: DNA sequence analysis with a modified bacteriophage T7 DNA Polymerase. Prec. Natl. Acad. Sci. USA 84 (I 987) 4767-477 !. Thomas, P.S.: Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Prec. Natl. Acad. Sci. USA 77 (1980) 5201-$205. Vaeck, M., Reynaerts, A., HoAe, H., Jansens, S., De Beuckeleer, M., Dean, C., Zabeau, M., Van Montagu, M. and Leemans, J.: Transganic plants protected from insect attack. Nature 328 (1987) 33-37.
171
GENE 03374
Sequence analysis of arcelin 2, a leetin-like plant protein (Recombinant DNA; primer extension; toxins; electrophoretic variants; transcripts; development; glycosylation sites)
Maliyakal E. John" and Christopher M. Long b ° Agracems, Middleton, W155562 (U.S.A.), and b Ceres. Emery~lle, CA 94608 (U.S.A.) Tel. (415)420-3300 Received by J. Messing: 10 July 1989 Revised: 25 September 1989 Accepted: 26 September 1989
SUMMARY
The nucleotide sequence ofthe cDNA clone encoding arcelin 2 (Arc2), one member of a family of closely related lectin-like plant toxins from wild bean accession, is presented. The sequence contains a 265-amino acid (aa) open reading frame and is 99.3 % homologous to Arcl, another of the four electrophoretic variants with proven antibiosis characters. These two proteins differ by four aa residues. Based on cross hybridizations of RNAs, it is assumed that Arc4 is more divergent than Arcl and Arc2. Furthermore, it is likely that at least three of the variants are polypeptides of similar size and the observed molecular weight differences between them are due to differences in the number of glycosylation sites.
INTRODUCTION
Arcelin (Arc) is a carbohydrate-binding protein that is found in noncultivated wild bean accessions. Schoonhoven etal. (1983) reported resistance to bean weevil (Acanthoscelides obtectus) and Mexican bean weevil (Zabrotes subfasclatus) in noncultivated common bean accessions. Subsequently, a novel lectin-like protein named arcelin was identified in the resistant plants and demonstrated to confer toxicity to bean bruchid pests (Romero-Andreas etal., 1986; Osborn etal., 1988a). Since bruchids form a serious threat to bean crops in a number of countries, Arc may have economic benefits if it is incorporated into cultivated bean varieties. Four electrophoretic variants of Arc have been described (Romero-Andreas etal., 1986; Osborn etal., Correspondence to: Dr. M.E. John, Agracetus, Middleton, Wl 53562 (U.S.A.) Tel. (608)836-7300; Fax (608)836-9710.
Abbreviations: aa, amino acid(s); Arc, arcelin; bp, base pair(s); eDNA, DNA complementary to RNA; DTT, dithiothreitol; kb, kilobase(s) or 1000 bp; M-MLV, Moloney murine leukemia virus; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; PAGE, polyacrylamide gel electrophoresis; PHA, phytohemagglutinin;SDS, sodium dodecyl sulfate; SSC, 0.15 M NaCI/0.015 M Na3" citrate pH 7.0. 0378-11191901503.50© 1990ElsevierSciencePublishersB.V.(BiomedicalDivision)
1986). The cDNA clone for Arcl has been sequenced and its antibiosis character established through insect feeding trials (Osborn etal., 1988a). Deglycosylated Arcl is a 29-kDa protein. It is structurally very close to another carbohydrate-binding bean protein, phytohemagglutinin (PHA), which is the major lectin in bean cultivars. A high degree of sequence homology, both at the aa (58 to 61~0) and nt (78 to 81~o) levels is observed between various PHAs and Arcl (Osborn et al., 1988a). PHA also confers toxicity to cowpea weevil when the protein was added to artificial cowpea seeds (Janzen etal., 1976). In this paper we describe the sequence of a second electrophoretic variant of Arc, Arc2. Arc I and Arc2 differ at six nt positions resulting in four aa changes. These differences result in the loss of a potential glycosylation site and may account for the observed Mr differences between Arcl and Arc2.
MATERIALS AND METHODS
All bean lines were supplied by Prof. Fredrick A. Bliss of the Department of Pomology, University of CaliforniaDavis. Phaseolus mlgaris lines that contain three of the Arc
172 variants will be referred to as Arcl(+ ), 2( + ) and 4(+ ), while near isogenic bean cultivars that d~.~not contain Arc will be referred to as Arcl(- ), 2(- ) and 4 ( - ). Developmen*. of these bean lines have been described (RomeroAndreas et al., 1986; Osborn et al., 1986). Immature beans were collected at seven, eleven and 15 days after fertili. zation, and mature beans (dry) were collected at 34 days atter fertilization. In vitro translation of mRNAs were carried out in rabbit reticulocyte lysate (Promega) using [ 35S]methionine (DuPont; 800 Ci/mmol) as radiolabel and the protein products separated on SDS-polyacrylamide gels (Laemmli, 1970). Northern blotting was done accordlug to Thomas (1980). (a) Cloning A 5-20~ sucrose gradient (12m l) was prepared in 100 mM Tris pH 7.5, 100 mM KCI and I mM EDTA. A 50/~g poly(A) ÷ RNA sample from eleven- and 15-day-old beans was denatured by heating at 65°C for 2 min and then layered onto the gradient. It was centrifuged (SW41) at 40000 RPM for 4 h at 4°C. Fractions (300/Jl) were collected and the RNA precipitated. Size-selected RNAs were used for cloning. We used the method of D'Alessio (1987) without modifications for eDNA cloning. The doublestranded DNA was tailed with dC residues and annealed with riG-tailed pBR322" vector (BRL). Escherichla coli (RRI) cells were transformed according to Hanahan (1985). Plasmid preparations, restriction analysis of DNA, agarose gel fractionation and purification of DNA by electroelution have been described (Ausubel et al., 1987). Screening of the eDNA library and preparation of 32p. labelled probes have been described (John et At., 1984; 1985). Filter hybridizations were carried out at 65'C for 18 h in 4 × SSC, I mM EDTA, 0.SYo SDS, 100/~g/ml of sonicated denatured salmon sperm DNA, 10/~g/ml polyadenylic acid and 10 × Denhardt's (1966) solution.
(b) Primer extension analysis Primer extension of Arc RNAs were essentially done as described by Dean et al. (1987). Oligomers were labelled with [y-32p]ATP (DuPont, 3000 Ci/mmol)using T4 polynucleotide kinase (Boehringer) and unincorporated nucleotides were removed by Sephadex G-25 chromatography. The primer-RNA hybridization reaction contained the following: 250 mM KCI/2 mM Tris pH 7.9/15 u of RNasin (Promega)/l mM DTT/3/4g poly(A) ÷ RNA/0.2 pmoi primer in a vol. of 10/41. Hybridization was carried out at different temperatures based on calculated dissociation temperature (Newman et ai., 1983) for 4 h. llybridized p/finer was extended using M-MLV reverse transcriptase (BRL) and products analyzed by 6 ~ sequencing gel
(Ausubel et al., 1987). Cloning ofthe extended product was carried out as described (D'Alessio, 1987). Recombinant clones were analyzed for insert sizes by SDS-agarose electrophoresis (Sekar, 1988) or polymerase chain reaction (Saiki et al., 1988) using appropriate primers. Sequence analysis of clones was done according to the methods of Chen and Seeburg (1985) and Tabor and Richardson (1987).
RESULTS AND DISCUSSION
Insecticidal proteins from plants, animals and microbial sources have great potential for agricultural biotechnology in designing insect-resistant plants. The best known insecticidal protein that is being incorporated through genetic engineering into crop plants is the &endotoxin from Bacillus thuringiensis (Barton eta]., 1987; Vaeck eta]., 1987). A large number of other, but less well characterized, proteins such as inhibitors of trypsin, chymotrypsin and amylase (Marshall et al., 1975; Richardson et al., 1986), and ribosome-inactivating proteins (Stirpe and Barbieri, 1986) are also known. A carbohydrate binding PHA protein from common bean Phaseolus migaris L. (King et al., 1982) as well as recently identified Arc from Mexican wild beans (1'. mlgaris vat. aborigineus) may also be important in the protection of seeds from insects. (a) Identification of Arc clones The molecular weights of Arc variants are reported to be in the range of 35-42 kDa (Osborn et ai., 1986). We have tested this observation by examining the proteins from seven-, eleven- and 15-day-old, as well as mature beans of Arc ( + ) and ( - ) types by SDS-PAGE. As expected, pro. teins from Arcl( + ), 2( + ) and 4( + )contained bands ofthe predicted mobility that were absent from corresponding Arc ( - ) beans (see Osborn et al., 1986; data not shown). In order to enrich for RNAs that code for proteins of 20-45 kDa, we subjected eleven-day and 15-day RNAs from Arc2( + ) beans to sucrose density gradient centrifugation. Aliquots of RNA from fractions were translated in rabbit reticulocyte iysate and the radiolabelled proteins separated by SDS-PAGE. RNA fractions that corresponded to 20-4$-kDa proteins were then pooled and used for cloning. About 2000 clones were transferred to nitrocellulose and subjected to differential screening using cDNAs generated from poly(A) + RNA of 15-day Arc2( + ) and 2( - ) beans. This resulted in the identification of 60 putative Arc2 clones. Two clones pARC2-6 and pARC2-11 were further studied. These two clones cross-hybridized to each other and also to 28 other clones. The insert sizes for
173
pARC2-6 and pARC2-11 were 550 and SS0bp,
respec-
tively.
(b) Transcript size and developmental accumulation The presence o f R N A s corresponding to clone pARC2-6 was studied by Northern analysis. The insert o f the clone was hybridized to Northern blot containing poly(A) ÷ R N A from seven-, eleven-, 15-day and mature A r c 2 ( + ) beans (Fig. la). Hybridization was apparent only to seven-, eleven- and 15-day R N A s . The size o f the hybridizing
a
transcript is 950 nt. Dmsitometric scanning o f the autoradiosraph shows that thm~ is an a p p r o x i m a t e l y l ~ f o l d increase in the conomtration for this R N A at 15 days compared to seven-day seeds. Thus, R N A for p A R C 2 ~ appears at about seven days after fertilization a n d aecumu. lates through an eight-day period. Since we did not observe pARC2-6 R N A in mature brans, it is possl~ole that these transcripts are depleted due to their u~liyation in the biosynthesis of" protein during maturation o f the seed. A second Northern blot containing poly(A) + R N A s from 15-day and mature beans o f Arc2( + ) and ( - ) types as well C
b
ODD"
A
O..-
,-
tO
v,-
tO
,<
eC
4C ,~
2.0,--
2"0-
1.0B
0"56-
q,,, ym,
<<
< <
o .o o o o . o < < .<.<
Fla. I. Analysis of Arc2 RNA. Panel a: Transcript size and development accumulation of Arc2 RNA. Beans were Frozen in liquid nitroaen, powdered and then mixed (I: I0 weight to volume)in I00 mM Tris pH 8.0/20 mM EDTA/0.$% SDS/0.$% #.mercaptoethanol/0.$ M NaCI, then homogenizedwith a Polytron for 2 rain. The homogenate was extracted with an equal volume of'phenol: chloroform and then with chloroform. One-third volume of I0 M LiCI was added and the mixture kept at 4"C for 12 h. The precipitate was dissolved in a small volume of'water and the LiCI precipitation repeated. A final precipitation was done by addi~ 0.5 volume of 7.$ M ammonium acetate and two volumes of ethanol. Poly(A)+RNA was prepared by oliso(dT)-cellulose chromatoaraphy. Poly(A)+RNA (0.2 Pa) From seven-, eleven- and l$-day and mature (Arc2 + M) beans of Arc2(+ ) type were analyzed by Northern blot. RNA was size Fractionated by 1.25% agarose/formaldehydegel electrophoresis. EIectrophoresis was carried out at room temperature in 20 mM Hepes pH 7.8, 0.2 mM EDTA and I M formaldehyde.The RNA was then blotted to nitrocelluiose.The blot was hybridized to the 32P-labelledinsert of pARC2-6 (I x 10s cpm/#g; $ x 10s cpm/ml). The filter was washed at hiah stringency. Low- and hiah-stfingencywashings of the filters were carried out as follows: all solutions contained 0.2% SDS and I mM EDTA, in addition to SSC. Low.stringencywash was in 3 × SSC at 53"C for 20 min followed by two washes in 2 × SSC at $3°C and one wash in I × SSC for 20 rain at $3°C. For hiah stringency,filters were washed as above but with additional washes at 0.5 × SSC and 0.I × SSC, 53°C for 0.5 to 2 h. Origin (O) and size standards (in kb) are shown in the left mar~n. Panel b: Poly(A)+RNA (0.2/48) from mature beans of Arcl, 2 and 4 of(+ ) and ( - ) types were analyzed by Northern blot. The filter was hybridized to 32P-labelledinsert (I x I0s cpm/p8; 5 × 10s cpm/ml) ofclone pCONTARCM-ZThe blot was washed at hiah stringencyconditions(see panel a legend)~ Panel c: Poly(A)+RNAs (0.2 gg) from eleven- and 15-day-oldArcl(+ ) and 4( + ) beans were analyzed by Northern blot and the filter was hybridized to the nick-translated insert of pARC2-6 (I x 108 cpm/Fg; 5 × 10s cpm/ml). The blot was washed to a moderate stringency(,6,)0.5 × SSC at 53"C and then at more stringent conditions (B)0.I × SSC at 60"C (see panel a legend).
174 as Arc2 and Arc4(+ ) and ( - ) types were hybridized to pARC2-6 clone, pARC2-6 hybridizes only to 15-day Arc2( + ) bean RNA (not shown). In order to ascertain that the negative hybridization result is not due to degradation of mature seed RlqAs, we analyzed mature seed RNAs from Arcl(+ ), 2( + ), and 4(+ ) as well as the corresponding Arc(-) beans by Northern blot. The blot was then hybridized to a control clone, pCONTARCM-2, that is expressed in both Arc2(+) and 2 ( - ) beans. pCONTARCM-2 was identified during the differential screening ofthe Arc2( + ) eDNA library. As seen in Fig. lb, pCONTARCM-2 hybridizes to a single RNA species in all mature bean RNAs. Hence, the absence of hybridization of •pARC2-6 clone to mature bean RNA is due to the lack of corresponding transcripts. (c) Hybridization of pARC2-6 to Arcl(+), and Arc4(+) RNAs Structural or immunological similarities between the four Arc variants are not known. In order to assess structural relationship, we blotted eleven- and 15-day poly(A) + RNAs from Arcl(+) and Arc4(+) beans and hybridized the Northern blot to pARC2-6. At moderate stringency ofwash (0.5 × SSC and 53°C), strong hybridization to Arcl( + ) and weaker hybridization to Arc4( + ) is observed (Fig. lc). In both I and 4 type Arc beans pARC2.6 hybridizes to a transcript of 950 nt. When the stringency of the wash was increased to 0.1 × SSC and 60°C, the hybridization to Arel(+ ) RNA remained strong while about 90~o signal was lost from the Arc4( + ) RNA (Fig. lc). These results indicate that a closely related gene to pARC2-6, with varyin8 degrees of homology, is expressed in Arc1 and 4. Sequence homology between pARC2-6 and the corresponding gene in Arc 1( + ) is likely to be greater than that of Arc4( + ). (d) Sequence of Arc2 The inserts of pARC2-11 and pARC2-6 were sequenced using the dideoxynucleotide method. The insert in pARC2-11 is 846 bp long while pARC2-6 has an insert size of 528 bp. The two clones overlap at the 3' end and are identical to each other in the region where they overlap. Since the transcript size for pARC2-11 as deduced from Northern blots is 950 nt, it is likely that the clone lacks the 5' end of the corresponding RNA. In order to clone the 5' end, we carried out primer extension using two oligo: (,4) AACGTCTCGACGTrGAAGGA and (B) GAGCCGACGGGGACGAGAGC. Primer (A) and primer (B) are located 19 and 268 nt from the 5' end of pARC2-11, respectively. 32p-labelled primer(A) was hybridized to poly(A) + RNAs from 15-day-old Arc 1( + ),2( + ), and 4( + )
beans. The primer extended products were then analyzed on sequencing gels. The results indicate that the product is 107 nt long for Arcl( + ), 2(+ ) and 4( + ) RNAs (not shown). This is the length expected of the product, if the RNA for pARC2-11 is 68 nt more than its 5' end. Extended product of primer(B) and Arc2(+) RNA was cloned (clone pARC2-19.1, 325-bp insert) and subsequently sequenced. The 269 nt of clone pARC2-191 overlap with the 5' end ofpARC2-11 and are identical to it. The remaining 56 bp of pARC2-191 comprise the missing 5' region. Thus, pARC2-11 and pARC2-191 together give the complete sequence (902 bp). It has one long open reading frame (795 nt) with an ATG initiation codon at position l, forming a 265-aa protein (Fig. 2). The estimated size of the protein is 29.3 kDa. When nt sequences of pARC2-11 and pARC2-191 are compared with that of Arcl, it is seen that they are 99.3% similar. Thus, the protein encoded by pARC2-11 (and pARC2-191) is Arc2. There are 12 nt missing from the 5' non-translated region of Arc2. We assume that the 5' extension was not complete in pARC2-191 clone. Also, there are 22 nt missing from the non-coding 3' end of pARC2-11 compared to Arcl sequences (Osborn etal., 1988a). Sequence comparison of the remaining 902 bp shows that there are six single nt differences, of which four result in aa changes (Fig. 2). The N-terminal aa analysis of purified mature Arc l and its comparison to the nt-derived aa sequence, suggest a 21-an signal peptide. Also, the hydrophobicity of the 21 aa agrees with this function (Osborn et al., 1988a). Both Arc I and 2 are identical in the first 98 aa ofthe N terminus, The apparent Mr ofthe giycosylated form of Arcl is about 37.5 kDa while Arc2 is 35 and Arc4 is 42 kDa (see Fig. 1 in Osborn, et al. 1986). Identical size transcripts as well as the number of nt derived aa for Arcl and 2 suggest that the basis of Mr difference between these proteins is likely to be due to post-translational modifications. Since Arc is a giycoprotein (Osbom et 81. 19881)), the degree of giycosylation could be such a factor. A tripeptide, Asn-X-Thr (or Ser) where X can be any aa except aspartic acid, is considered to be the most likely site of giycosylations in proteins (for review see Hubbard and Ivatt, 1981 and references therein). Processed Arcl contains three such potential giycosylation sites (positions 33-35, 89-91 and 128-130), whereas Arc2 contains only two. The sequence, Asn-Thr.Thr at aa position 128-130 in type 1, is changed to Asn-Thr-Ala in type 2, and will not support giycosylation (Fig. 2). Similar changes in the giycosylation sites could also be responsible for Mr differences between Arc2 and Arc4, since Northern analysis and primer extensions indicate that all three Arc types are encoded by transcripts of the same size. Antibiosis properties of lectins and Arc are proposed to be due to the lysis of epithelial cells of the intestine by
175 lk
HetAlaSerSerAsnLeuLeuThr LeuAlaLeuPheLeuWllLeuLeu Thrll|sAlaAsnSerSerAsnAsp ATGGCTTCCTCCAACTTACTCACCCTAGCCCTCTTCCTTGTGCTTCT¢ACCCA . a z w c ~ pare 2-II" t AlaSerPheAsnVa161uThrPhe AsnLysThrAsnLeulleLeuGIn 61yAspAliIThrVaISerSerGlu AACAAAACCAA¢CTCATCCTCCAA 73 GCCTCCTTCAACGTCGAGACGTTC GlyHisLeuLeuLeuThrAsnVal
14S GGCCACTTACTACTAACCAATGTT
72
sGlyAsnGluGIuAspSerl4et GlyArgAIdJheTyrSerAldlPro CGAAGAGGACTCTATGGGCCGCGCCTTCTACTCCGCCCCC216 ~k
! leGlnl leAsnAspArgThrlle AspAsnLeuAlaSerPheSerThr AsnPheThrPheArglleAsnAIa AACTTCACATTCCGTATCAACGCT 288 217 ATCCAAATCAATGACAGAACCATCGACAACCTCGCCAGCTTCTCCACC lle LysAsnAsnGluAsnSerAlaTyr 289 AAGAACAATGAAAATTCCGCCTAT T t~k
ValGlySerArgProL~LeuLys GTCGGCTCTCGGCCCAAACTTAAA 360
2-191 "•rrc
GlyArgTyrLeuGlyLeuPheAsn 361 6GCCGTTATCTAGGTCTTTTCAAC ~A pAre 2-6 ThrWllSerAsnArglleGlu!le 433 ACCGTCAGCAACCGTATTGAAATC
HisThrValAluValValPhe~p CATACTGTGGCTGTGGTGTTCGAC
T
A1aThr61uSerCysAsnlqmG1y GCAACGGAGTCTTGCAATTTCGGC SO4
Asp HtsAsnAsnG1yG1ul.ysA1a61u WllArgl leThrTyrTyrSerPro LysAsnAspLeuArgValSerLeu AAGMCGACTTGAGGGTTTCTCT6 S76 GTTCGGATCACCTATTACTCCCCC 505 CACAACAACGGAGAAAAGGCCGA6 6 LeuTyrProSerSer61uG1uLys CysH|sValSerAlaThrValPro LeuGluLysGluValGluAspTrp C166AGNL~TTGAGGACTG6 648 S77 CTTTACCCTTCTTCGGAAGAAAA6TGCCACGTCTCTGCCACAGTGCC6 VtllSerValGlyPheSerAlaThr Ser61ySerl.ysl.ysG1uThrThr61uThrilisAsnValLeuSerTrp 6AAACGCACAACGTCCTCTCTT66 720 649 6TGAGCGTTGGGTTCTCTGCCA¢C TCAGGGTCGAAAAAAGAGACCACT s SerPheSerSerAsnPhelleash PheGL~uGlyl.ysLysSerGluArgSerAsn! I eLeuLeuAsnLys11• TCCAACATCCTCCTCMCAAGATC 792 721 TCTTTTTCTTCCAACTTCATCAAT TTTGAGGGCAAAAAATCTGAACGT A
Lee 793 ¢TCTAGACTCCCAAAGCCAGCTT¢ ACTGTGACAGTAAAACCTTCCTTA TACGCTAATAATGTTCATCTGTCA 864 865 CACAAACTACAATAAATAAAATCA GAGCAATAAATAAA902 C Fill, 2, Sequenceof Ar~2. The complete sequence was obtained from clones pare2- I ! (pAre2-6) and pare2-19 !. pare2- I 1 has an insert size of 846 bp. pare2.6 contains a smaller insert of 528 bp. $' ends ofpAre2-11 and pAre2-6 cDNAs are marked by rightward arrows, pAre2.191 is the primer extended clone and contains a 325-bp insert; the 3' end of its insert is marked by a lettward arrow. Difference between Arcl and 2 both at the nt and aa levels are 81yen.The nu©leotides are numbered. Potential 81ycosylationsites shared by Arc2 and I are marked by sinsle stars and those that are found only in Arel by double stars. Consensus poly(A)-addition signals m underlined. Accession number of the sequence in OonBank is M28470.
binding to the carbohydrate moieties ofthese proteins (King et al., 1982; Osborn et al., 1988a). The relative degrees of antibiosis of the different Arc variants are not known. If different Arcs differ in their carbohydrate binding capacities, then it is also likely that they may differ in their toxicity toward bruchids. Primary structures of Arc3 and 4 as well as determination of the insecticidal activities of these proteins may reveal interesting and potentially useful relationships between these variants.
ACKNOWLEDGEMENTS
We are thankful to Professor Frederick A. Bliss, University of California-Davis, for supplying the bean lines and also for his interest in this project. We are grateful to Dr. Winston J. Brill for his encouragement as well as his critical
reading ofthe manuscript. We acknowledge the expert technical assistance of Douglas DeMarini, Michael Petersen and Grant Johnson. We thank Dr. Ken Barton and Dr. Will Swain for their helpful suggestions.
REFERENCES Ausubel, F.M., Blent, R., Kingston, R.E., Moore, D.D., Seidman, J.O., Smith, J.A. and Struld, K.: Current Protocols in Molecular Biology. John Wiley Press, New York, 1987. Barton, K.A., Whit¢ley,H.R. and Yang,N.-S.:BacillustAur~Q~ns~endotoxin expressed in transgenic Nlcodanatalcum provides resistance to lepidopteran insects. Plant Physiol. 85 (1987) 1103-1109. Chen, E.Y. and Sceburg, P.H.: Supercoil sequencing: a fast simple method for sequencing plasmid DNA. DNA 4 (1985) 165-170. D'Alessio, JM., Noon, M.C., Ley III, H.L. and ~rard, O.F.: One-tul~ double stranded eDNA synthesis using cloned M-MLVreverie tran-
176 scriptase. Focus (Bethesda Research Laboratories, Gaithersburg, MD) 9 (1987) I-4. Dean, C., Favrean, M., Dunsmuir, P. and Bedbrook, J.: Confirmation of relative expression of Petunia rbcS genes. Nucleic Acids Res. 15 (1987) 4655-4668. Denhardt, D.T.: A membrane-filter technique for the detection of complementary DNA. Biochem. Biophys. Res. Commun. 23 (1966) 641-646. Hanahan, D.: Techniques for transformation of E. co/i. In Glover, D.M. (Ed.) DNA Cloning. A Practical Approach. Voi. L I1~ Press, Oxford, 1985, pp. 109-135. Hubbard, S.C. and Ivatt, RJ.: Synthesis and processing of asparaginelinked oligosaccharides. Atmu. Rev. Biochcm. 50 (1981) 555-583. Janzen, D.H., Juster, H.B. and Liener, I.E.: Insecticidal action of the phytohemagglutinin in black beans on a bruchid beetle. Science 192 (1976) 795-796. John, M.E., John, M.C., Ashley, P., MacDonald, RJ., Simpson, E.R. and Waterman, M.R.: Identification and characterization of cDNA clones specific for cholesterol side-chain cleavage cytochrome P-450. Prec. Natl. Acad. Sci. USA 81 (1984) 5628-5632. John, M.E., John, M.C., Simpson, E.R. and Waterman, M.R.: Regulation of cytochrome P-45011 gene expression by adrenocorticotropin. J. Biol. Chem. 260 (1985) 5760-5767. King, T.P., Pusztai, A. and Clarke, E.M.W.: Kidney bean (Phaseolus vu/ga~) lectin-induced lesions in rat small intestine. J. Comp. Pathol. 92 (1982) 357-373. Laemmli, U.K.: Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680-685. Marshall, JJ. and Landa, C.M.: Purification and properties of phaseolamin, an inhibitor of a.amylase from the kidney bean, PhaseoAa vulgar. J. Biol. Chem. 250 (1975) 8030-8037. Newman, AJ., Ogden, R.C. and Abelson, J.: tRNA Gene transcription in yeast: effect of specified base substitutions in the intragenic promoter. Cell 35 (1983) 117-125. Osborn, T.C., Blake, T., Oepts, P. and Bliss, F,A.: Bean arcelin: genetic variation, inheritance, and linkage relationships of a novel seed pro-
rein of Phaseolusmlga~ L. Theor. Appl. Genet. 71 (1986) 847-855. Osborn, T.C.,Alexander,D.C., Sun, S.S.M.,Cardona, C. and Bliss,F.A.: Insecticidal activity and lectin homology of arcelin seed protein. Science 240 (1988a) 207-210. Osborn, T.C., Burow, M. and Bliss, F.A.: Purification and characterization of arcelin seed protein from common bean. Plant Physiol. 86 (1988b) 399-405. Richardson, M. et al.: The amino acid sequence and reactive (inhibitory) site ofthe major trypsin isoinhibitor (DE5) isolated from seeds ofthe Brazilian Carolina tree (Adenantherapavonina L.). Biochim. Biophys. Acta 872 (1986) 134-140. Romero-Andreas, J., Yandell, B.S. and Bliss, F.A.: Bean arcelin. Inheritance of a novel seed protein of Phaseolus m/garb L. and its effect on seed composition. Theor. Appl. Genet. 72 (1986) 123-128. Salki, R.K., Gelfand, D.H., Stoffel, S., Scharf, SJ., Higuchi, R., Horn, G.T., Mullis, K.B. and Erlich, H.A.: Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 239 (1988) 487-491. Schoonhoven, A.V., Cardona, C. and Valor, J.: Resistance to the bean weevil and the Mexican bean weevil (Coleoptera: Bruchidae) in noncultivated common bean accessions. J. Econ. Entomol. 76 (1983) 1255-1259. Sekar, V.: A rapid screening procedure for the identification of recombinant bacterial clones. BioTechniques 5 (1987) 11-13. Stirpe, F. and Barbieri, L.: Ribosome-inactivating proteins up to date. FEBS Lett. 195 (1986) !-8. Tabor, S. and Richardson, C.C.: DNA sequence analysis with a modified bacteriophage T7 DNA Polymerase. Prec. Natl. Acad. Sci. USA 84 (I 987) 4767-477 !. Thomas, P.S.: Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Prec. Natl. Acad. Sci. USA 77 (1980) 5201-$205. Vaeck, M., Reynaerts, A., HoAe, H., Jansens, S., De Beuckeleer, M., Dean, C., Zabeau, M., Van Montagu, M. and Leemans, J.: Transganic plants protected from insect attack. Nature 328 (1987) 33-37.