Sequence analysis of porcine immunoglobulin light chain cDNAs

0161-5890/91$3.00+ 0.00 0 1991Pergamon Press plc

MolecularImmunology,Vol. 28, No. 8, pp. 877-880, 1991 Printed in Great Britain.

SEQUENCE

ANALYSIS OF PORCINE IMMUNOGLOBULIN LIGHT CHAIN cDNAs

BARBARAM. LAMMERS,KENNETH D. BEAMAN and Department

YOON

B. KIM*

of Microbiology and Immunology, University of Health Sciences/The Chicago Medical School, 3333 Green Bay Road, North Chicago, IL 60064, U.S.A. (First received 3 Oclober 1990; accepted 26 November

1990)

Abstract-A porcine cDNA library was constructed using poly(A)+ RNA isolated from the spleen of an adult Minnesota miniature swine. Screening the library with antisera specific for porcine immunoglobulin light chains resulted in the selection and isolation of two recombinant clones, PLC18 and PLC3, which encode for K and 1 light chains, respectively. These cDNAs contain sequence information for a portion of the variable region and all of the constant region. The lengths of the constant regions are 105 amino acids for 1 and 108 amino acids for K. The deduced amino acid sequences of porcine immunoglobulin light chains share a high degree of homology with similar sequences from other species in both the fourth framework region and the constant region.

INTRODUCTION

generally imprecise and contributes to the generation of antibody diversity (Tonegawa, 1983). Immunoglobulin proteins and genes from mice and man have been described in considerable detail. This is the result of the availability of both myeloma proteins and cell lines from these species. However, similar studies of immunoglobulins from other mammalian species as well as lower vertebrates has awaited the advances in the techniques of molecular biology, because of their lack of myeloma proteins and cell lines. And although data on lower vertebrates are increasing, outside of the rabbit and rodent, investigation in other mammalian species is relatively limited. We have been utilizing the porcine model in studies on the ontogeny of the immune system in piglets raised in germfree vs conventional environments (Kim et al., 1966, 1979; Setcavage and Kim, 1979). To investigate this more closely, we undertook to construct molecular probes for porcine immunoglobulin genes. Because of the lack of porcine myelomas we utilized spleen poly(A)+RNA as a source of immunoglobulin mRNA. Here we report the sequences for two cDNAs which encode for porcine immunoglobulin K and 1, light chains. We present their complete nucleotide and deduced amino acid sequences, and compare herein these sequences with related light chain sequences from other species.

Two types of immunoglobulin light chains, designated IC and 1, have been described. Although mammals appear to express both types of light chains, albeit at different ratios, it appears that lower vertebrates express either only K or 1, but not both (Schluter et al., 1989). Although K and 1 light chains differ considerably in their primary amino acid sequences (Kabat et al., 1987), they have similar molecular weights and three-dimensional structures. These similarities suggest that the genes controlling the two light chain types derived from a common ancestral gene which underwent duplication and subsequent divergent evolution (Hill et al., 1966). Immunoglobulin light chains are subdivided into variable (V) and constant (C) regions based upon amino acid sequence analysis. Sequence analysis of V regions both within and between species revealed three regions of greater sequence variability, termed complementarity determining regions (CDRs), which were flanked by four less variable framework regions (FRs) (Wu and Kabat, 1970). Analysis at the DNA level has shown that light chains are composed of three discrete gene segments: V, J and C. These gene segments are arranged tandemly along the chromosome and are juxtaposed following DNA rearrangement to form a complete light chain gene. The V gene segment encodes for the amino terminal 95 amino acids, and the J gene segment encodes for residues 97-107 for 1 or 108 for K, which constitutes FR4. The recombination between V and J gene segments at position 96, which generates a complete V region, is *Author to whom correspondence

MATERIALS AND Isolation

of poly(A)+

METHODS

RNA

Total RNA was isolated from the spleen of an adult Minnesota miniature swine by homogenization in guanidinium isothiocyanate and CsCl centrifugation as described by Ausubel et al. (1989). Poly(A)+ RNA was then isolated by chromatography on

should be addressed.

Abbreviurions: bp, base pairs; C, constant; CDR, complementarity determining regions; FR, framework region; J, joining; PLC, porcine light chain; V, variable. 877

878

BARBARAM. LAMMERSet

oligo(dT)-cellulose NJ).

(type 7; Pharmacia,

Piscataway,

Construction of cDNA library in iZAP

cDNA was synthesized and tailed with EcoRI adaptors following manufacturer’s specifications (Pharmacia). The cDNA was ligated into the expression vector 1ZAP (Stratagene, La Jolla, CA) and packaged with Gigapack Gold packaging mix (Stratagene). Immunoscreening

The library was screened antigenically with polyclonal rabbit anti-porcine immunoglobulin light chain antisera prepared in our laboratory (Setcavage and Kim, 1976) using the BB4 host strain (Stratagene). Plaques were screened at an initial density of 1 x 104/100mm plate. The plates were incubated at 42°C for 3.5 hr to initiate lysis and overlain by nitrocellulose filters previously soaked in 10 mM isopropyl-fi-thiogalactopyranoside (IPTG) and further incubated for 3.5 hr at 37°C. The filters were washed in TBST [lo mM Tris (pH 7.5)-150 mM NaC1-0.05% Tween-201 and blocked for 1 hr at room temperature in TBST containing 5% nonfat dry milk. After blocking, filters were incubated with primary antibody at 1:2000 dilution for 1 hr at room temperature, washed, and incubated with an alkaline phosphatase conjugated goat anti-rabbit IgG antisera (Boerhinger Manneheim, Indianapolis, IN) at 1: 5000. Positive clones were identified by reaction with Nitroblue Tetrazolium (NBT) and 5-bromo-4-chloro-3-indoyl phosphate (BCIP) in alkaline phosphatase buffer [lo0 mM Tris (pH 9.5)-100 mM NaCl-5 mM MgCl,]. For 10 ml of buffer, 66 ~1 of 50 mg/ml NBT in 70% dimethylformamide (DMF) and 33 ~1 of 50 mg/ml BCIP in DMF were added. Sequencing

The inserts of AZAP recombinants were removed following digestion with EcoRI and ligated into the replicative form of M13mp18. The cDNA clones were sequenced by the dideoxy chain termination technique (Sanger et al., 1977), using the enzyme Sequenase Version 2.0 (United Stated Biochemical, Columbus, OH). Sequencing of the entire clone was performed by obtaining a sequential series of overlapping subclones by the exonuclease activity of T4 DNA polymerase (Cyclone I Biosystems, International Biotechniques, Inc.). The cDNA sequences were analyzed using the IBI/Pustell DNA/ protein sequence analysis programs and the EMBL/ GenBank Library. RESULTS AND DISCUSSION

Isolation of recombinant clones

From 2 pg of poly(A) + RNA a cDNA library in the expression vector lZAP was prepared which contained 1.5 x lo6 recombinants. The library was

al.

screened antigenically with rabbit polyclonal antisera specific for porcine immunoglobulin light chains. Following partial sequence analysis of several positive clones, two were selected for further characterization: PLC18 which displayed sequence similarity to mammalian K chains, and PLC3 which displayed similarity to 1 chains. Nucleotide and deduced amino acid sequences

The complete nucleotide sequence and deduced amino acid sequence, numbered according to Kabat et al. (1987) for clones PLC18 and PLC3 are shown in Figs 1A and B, respectively. Both of these cDNA clones begin within the V region and terminate in the 3’ untranslated region, and, although both contain the characteristic AATAAA polyadenylation signal in the 3’ untranslated region, a poly(A) tail was not found associated with PLC18. Northern blot analysis was performed with total splenic RNA to determine the size of the full-length transcripts for these messages, and both were found to be approximately 900 bases in length (data not shown), a length similar to that seen in other species for light chain messages (Anderson et al., 1985; Bothwell et al., 1982; Foley and Beh, 1989). PLC18, which encodes for a porcine K light chain (Fig. lA), is 731 bp and begins within FR2. This cDNA contains message for all but the amino terminal 38 amino acid residues of the V region. The length of the C region encoded for by this clone is 108 amino acids. The carboxy terminal nine amino acids deduced from the sequence for this porcine K light chain are in agreement with those previously sequenced by Hood et al. (1967) and Novotny et al. (1969). As seen here, the porcine K light chain terminates with CysGlu-Ala. The presence of a carboxy terminal dipeptide after the Cys residue at position 214 in the porcine ICchain is a unique feature among mammalian K light chains, for all other K light chains studied to date terminate with a Cys residue (Hood et al., 1967; Kabat et al., 1987). Interestingly, the only K light chain described in a lower vertebrate, which was found in the bullfrog Rana catesbiana, also possesses a dipeptide (Thr-Phe) after the carboxy terminal Cys residue (Mikoryak and Steiner, 1988). PLC3 encodes for a porcine /, light chain (Fig. 1B). This cDNA is 709 bp and has message for all but the first 33 amino acids of the V region, and encodes for a C region of 105 amino acids. The deduced amino acid sequence of the C region of PLC3, together with the J gene segment (FR4), is identical with the amino acid sequence of porcine 1 light chains determined previously by Novotny et al. (1977) from a mixture of normal immunoglobulins. Over the remainder of the V region which could be compared, only five residues were found to differresidues 36,46 and 47 in FR2 and residues 91 and 93 in CDR3.

879

Porcine light chain immunoglobulin cDNAs

A. CDRZ 40 Lys Pro Gly Gln Ser Pro Gln Leu Leu Ile Val Glu Ala Ser Asp Arg Ala Se AG AAA CCA GGC CAG TCT CCA CAG CTC CTG ATC GTT GAG GCT TCC GAC AGG GCC TC

60 FR3 Gly Val Pro Asp Arg Phe GGG GTC CCA GAC AGG TTC

74

SO 70 Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile Asn Ser Val Glu Ala Glu Asp Ala Gly Val Tyr Tyr AGC GGC AGT GGG TCA GGC ACA GAT TTC ACC CTG AAA ATC AAC AGC GTG GAG GCT GAG GAT GCA GGA GTT TAT TAC

149

k FR4 100 CDR3 Cys His Gln Phe Lys Glu Phe Pro Arg Thr Phe Gly Gln Gly Thr Lys Leu Glu Leu Lys Arg la Asp Ala Lys TGC CAC CM TTT AAA GAA TTT CCT CGG ACG TTC GGC CAA GGA ACC AAG CTG GAA CTC AAA CGG FGCT GAT FCC AAG

224

* 120 130 Pro Ser Val Phe Ile Phe Pro Pro Ssr Lys Glu Gln Leu Ala The Pro Thr Vsl Ser Val Vsl Cys Leu Ile Asn CCA TCC GTC TTC ATC TTC CCG CCA TCG AAG GAG CAG TTA GCG ACC CCA ACT GTC TCT GTG GTG TGC TTG ATC AAT

299

160 140 150 Asn Phe Phe Pro Arg Glu Ile Ser Val Lys Trp Lys Val Asp Gly Val Val Gln Ser Ser Gly His Pro Asp Ser AAC TTC TTC CCC AGA GAA ATC AGT GTC AAG TGG AAA GTG GAT GGG GTG GTC CAA AGC AGT GGT CAT CCG GAT AGT

374

170 180 Val Thr Glu Gln Asp Ser Lys Asp Ser Thr Tyr Ser Leu Ser Ser Thr Ser Ser Leu Pro Thr Ser Gln Tyr Leu GTC ACA GAG CAG GAC AGC AAG GAC AGC ACC TAC AGC CTC AGC AGC ACC CTC TCG CTG CCC ACG TCA CAG TAC CTA

449

* 190 200 210 Ser His Asn Leu Tyr Ser Cys Glu Val Thr His Lys Thr Leu Ala Ser Pro Leu Val Thr Ser Phe Asn Arg Asn AGT CAT AAT TTA TAT TCC TGT GAG GTC ACC CAC AAG ACC CTG GCC TCC CCT CTG GTC ACA AGC TTC AAC AGG AAC

524

216 Glu Cys Glu Ala Ter GAG TGT GAG GCT TAG

614

I

5

AGGCCCACAGGCCCCCTGGCCTGCCCCCCA~CC~~~CCCTCCCCACCTCAG~CTCAG~CCCTTACCC~G

714

GTGAAAGTGAACCTTGC

731

B. CDRZ FR3 40 FR2 Gly Trp Tyr Gln Gln Thr Pro Gly Gln Pro Pro Arg Leu Leu Ile Tyr Gln Thr Asn Ser Arg Pro Thr Gly CC GGC TGG TAC CAG CAG ACA CCA GGC CAG CCT CCC CGA CTA CTG ATC TAC CAA ACA AAC AGC CGC CCG ACT GGG

74

70 SO Val Pro Ser Arg Phe Ser Gly Ala Ile Ser Gly Asn LyS Ala The Leu Thr Ile Thr Gly Ala Gln Ala Glu Asp GTC ccc AGT CGC TTC TCT GGA GCC ATC TCT GGC AAC AAA GCC ACC CTC ACC ATC ACG GGG Gee CAG GCT GAG GAC

149

FR4 100 CDR3 Glu Ala Asp Tyr Phe Cys Ala Leu Glu Lys Asn Ser Tyr Asn Vsl Pro Phe Gly Gly Gly Thr His Leu Thr Vsl GAG GCC GAC TAC TTC TGTI GCT CTG GAG AAA AAT TCT TAT AAT GTT CCC I TTC GGC GGT GGG ACC CAT CTG ACC GTC

224

120 110 130 Ch beg ~1~ Gin pro Lys Ala Ala Pro Thr Val Asn Leu Phe Pro Pro Ser Ser Glu Glu Leu Gly Thr Asn Lys Ala CTC GGT CAG CCC AAG GCC GCT CCC ACG GTC AAC CTC TTC CCG CCC TCC TCT GAG GAG CTC GGC ACC AAC AAG GCC

299

* 140 1.50 Thr Leu Val Cys Leu Ile Ser Asp Phe Tye Pro Gly Ala Vsl Thr Val Thr Trp Lys Ala Gly Gly Thr Thr Val ACC CTG GTG TGT CTA ATA AGT GAC TTC TAC CCG GGC GCC GTG ACG GTG ACC TGG AGG GCA GGC GGC ACC ACC GTC

374

168 170 160 180 Thr Gln Gly Val Glu Thr Thr Lys Pro Ser LyS Gln Ser Asn Asn Lys Tyr Ala Ala Ser Ser Tyr Leu Ala Leu ACC CAG GGC GTG GAG ACC ACC AAG CCC TCG AAA CAG AGC AAC AAC AAG TAC GCG GCC AGC AGC TAC CTG GCC CTG

449

* 190 200 203 Ser Ala Ser Asp Trp Lys Ser Ser Ser Gly Phe Thr Cys Gln Val Thr His Glu Gly Thr Ile Val Glu Lys Thr TCC GCC AGT GAC TGG AAA TCT TCC AGC GGC TTC ACC TGC CAG GTC ACC CAC GAG GGG ACC ATT GTG GAG AAG ACA

524

210 5 215 Vsl Thr Pro Ser Glu Cys Ala Ter GTG ACG CCC TCC GAG TGC GCC TAG

612

GTCCCTGGGCCCCCACCCTCAGGGGCCTGGA~~~~ACCCCCGTCGA~TCTCCCCCC~G

ACCCTGGTCCAGCCCAGCCCTTCCTCCTGCACCTGTCAACTCC CaRTAAACCGCCTCCTTGTCATTCAGAAAAAAAAAAAAAA

709

Fig. 1. Nucleotide and deduced amino acid sequences of PLCl8 (A) and PLC3 (B). Nucleotide residues are numbered to the right of each line. Amino acid numbering, and the boundaries of the FRs, CDRs, and the constant region are according to Kabat et al. (1987). ‘Cysteine residues predicted to participate in intradomainal disulfide bonding. $Cysteine residue predicted to participate in the H-L bond. The polyadenylation signal in the 3’ untranslated region is underlined. Sequence homologies

Table 1 presents a comparison of the deduced amino acid sequences of the J gene segment (FR4)

and C regions of porcine K and 1 light chains with related sequences from other species. As shown here, the relationship between J gene segments is much greater than that for C regions. Marchalonis and

880

BARBARA M. LAMMERSet al.

Table 1. Per cent amino acid identity of porcine light chain regions with comparable regions from other species” % Amino acid identity to porcine Human KFR4 CK 1FR4 C1

sob 64 89b 14

Rabbit 50 71 82 70

Mouse Sheep Cow 83h -j _ 62 ~ ~ 82 82 82 68 69 71

Chlcken ~ 73 63

“The sequences utilized for comparisons were from Kabat cl al. (1987), except sheep 1 (Foley and Beh, 1989) and cow i (Ivanov ef a/., 1988). bHomology to subgroups were mdividually calculated and the mean is shown. ‘--No data available.

Schluter (1990) have suggested that this conservation in evolution of J gene segments may be related to the requirement of these gene segments in the correct rearrangement of immunoglobulin genes. They have also shown that J gene segments in light chains can be distinguished from those of heavy chains in that FR4 of light chains initiates with Phe-Gly, whereas that of heavy chains begins with TrpGly (Marchalonis and Schluter, 1989). This dipeptide also initiates the J signature sequence which occurs in the amino terminal portion of FR4 and has the consensus sequence Phe-Gly-X-Thr-X-Leu/Val, which can be found in both of these porcine light chains (Fig. IA and B). The similarity between the two porcine C regions is approximately 32%, which is similar to the value observed between light chain types within species such as man and mouse (Nisonoff, 1984). The C region for the two light chain types have been found to be evolving at dissimilar rates, for the evolutionary divergence is greater among K C region genes than in i C regions (Barker et al., 1978; Mikoryak and Steiner, 1988). The consequence of this is reflected in the overall greater similarity observed between porcine 1. chains with human and mouse i chains as compared with that observed between porcine K chains and human and mouse K chains (Table 1). In addition, established phylogenetic relationships are not observed in the relationships among i light chains. In phylogeny, the sheep and cow are more closely related to the pig than is the human, but porcine 2 light chains are more similar to the human than to either the sheep or the cow. In conclusion, we report here the complete nucleotide sequences of cDNAs encoding for porcine K and 1. light chains. The production of well-characterized molecular probes will facilitate not only the study of expression of immunoglobulin genes in our porcine system, but will also assist in the study of the porcine immunoglobulin loci at the DNA level. REFERENCES Anderson M. L. M., Brown L., McKenzie E., Kellow J. E. and Young B. D. (1985) Cloning and sequence analysis of an Ig I light chain mRNA expressed in the Burkitt’s lymphoma cell line EB4. Nucleic Acids Res. 13,293 l-2941. Ausubel F. M., Brent R., Kingston R. E., Moore D. D., Seidman J. G., Smith J. A. and Struhl K. (Editors) (1989)

Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York. Barker W. C., Ketcham L. K. and Dayhoff M. 0. (1978) In Atlas of Protein Sequence and Structure (Edited by Dayhoff M. O.), Vol. 5, Suppl. 3, pp. 197-227. Natl. Biomed. Res. Found., Washington, DC. Bothwell A. L. M., Paskind M., Reth M., Imanishi-Kazi T., Rajewsky K. and Baltimore D. (1982) Somatic variants of murine immunoglobulin i light chains. Nature 298, 380-382. Foley R. C. and Beh K. J. (1989) Isolation and sequence of sheep IgH and L chain cDNA. J. Zmmun. 142, 70887 11. Hill R. L., Delaney R., Fellows R. E. and Lebovitz H. E. (1966) The evolutionary origins of the immunoglobulins. Proc. natn. Acad. Sci. U.S.A. 56, 1762-1769. Hood L.. Gray W. R., Sanders B. G. and Dreyer W. J. ( 1967) Light chain evolution. Cold Spring Harbor Lab. Symp. quant. Biol. 32, 133-146. Ivanov V. N., Karginov V. A., Morozov 1. V. and Gorodetsky S. I. (1988) Molecular cloning of a bovine immunoglobulin lambda chain cDNA. Gene 67, 4148. Kabat E. A., Wu T. T., Reid-Miller M., Perry H. M. and Gottesman K. S. (1987) Sequences of Proteins of Immuno/ogica/ Interest. U.S. Dept. of Health and Human Services, Public Health Service, National Institutes of Health. Bethesda, MD. Kim Y. B., Bradley G. and Watson D. W. (1966) Ontogeny of the immune response. I. Development of immunoglobulins in germfree and conventional colostrumdeprived piglets. J. Immun. 97, 5263. Kim Y. B., Setcavage T. M., Kim D. J., Chun H. G. and Scheffel J. W. (1979) Ontogenic development and differentiation of the immune system in the gnotobiotic miniature swine. Clin. expn. Gnotobiot. 7, 203-213. Marchalonis J. J. and Schluter S. F. (1989) Evolution of variable and constant domains and joining segments of rearranging immunoglobulins. FASEB J. 3, 246992479. Marchalonis J. J. and Schluter S. F. (1990) Phylogenetic studies with rearranging immunoglobulins. In Defense Molecules (Edited by Marchalonis J. J. and Reinisch C. L.) pp. 265-280. Alan R. Liss, New York. Mikoryak C. A. and Steiner L. A. (1988) Amino acid sequence of the constant region of immunoglobulin light chains from Rana catesbiana. Molec. Immun. 25,695.-703. Nisonoff A. (1984) Introduction to Molecular Immunolog!. Sinauer, Sunderland, MA. Novotny J., Franek F., Keil B. and Sorm F. (1969) Structural characteristics of pig immunoglobulin rc chains. FE&S Symp. 15, 193-198. Novotny J., Franek F., Margolies M. and Haber E. (1977) Amino acid sequence of normal (microheterogeneous) porcine immunoglobulin i chains. Biochemistry 16, 3765-3772. Sanger F., Nicklen S. and Coulson A. R. (1977) DNA sequencing with chain-terminating inhibitors. Proc. natn. Acad. Sci. U.S.A. 74, 5463-5467. Schluter S. F., Hohman V. S., Edmundson A. B. and Marchalonis J. J. (1989) Evolution of immunoglobulin light chains: cDNA clones specifying sandbar shark constant regions. Proc. natn. Acad. Sci. U.S.A. 86,9961- 9965. Setcavage T. M. and Kim Y. B. (1976) Characterization of porcine serum immunoglobulins IgG, IgM and IgA and the preparation of monospecific anti-chain sera. Immune chemistry 13, 643-652. Setcavage T. M. and Kim Y. B. (1979) Immunoglobulins of germfree colostrum-deprived and conventional colostrumfed miniature piglets. Clin. exp. Gnotobiot. 7, 139-144. Tonegawa S. (1983) Somatic generation of antibody diversity. Nature 302, 575-581. Wu T. T. and Kabat E. (1970) An analysis of the sequences of the variable regions of BenceeJones proteins and myeloma light chains and their implications for antibody complementarity. J. exp. Med. 132, 21 I-250.