- Email: [email protected]
Sequence analysis of the gene encoding alternansucrase, a sucrose glucosyltransferase from Leuconostoc mesenteroides NRRL B-1355
FEMS Microbiology Letters 182 (2000) 81^85
www.fems-microbiology.org
Sequence analysis of the gene encoding alternansucrase, a sucrose glucosyltransferase from Leuconostoc mesenteroides NRRL B-1355 Martha A. Argu«ello-Morales, Magali Remaud-Simeon, Sandra Pizzut, Patricia Sarc°abal, Rene¨-Marc Willemot, Pierre Monsan * Centre de Bioinge¨nierie Gilbert Durand, UMR CNRS 5504, UMR INRA 792, INSA, 135 Avenue de Rangueil, 310077 Toulouse Cedex 4, France Received 6 October 1999; received in revised form 29 October 1999; accepted 4 November 1999
Abstract The gene encoding alternansucrase (ASR) from Leuconostoc mesenteroides NRRL B-1355, an original sucrose glucosyltransferase (GTF) specific to alternating K-1,3 and K-1,6 glucosidic bond synthesis, was cloned, sequenced and expressed into Escherichia coli. Recombinant enzyme catalyzed oligoalternan synthesis from sucrose and maltose acceptor. From sequence comparison, it appears that ASR possesses the same domains as those described for GTFs specific to either contiguous K-1,3 osidic bond or contiguous K-1,6 osidic bond synthesis. However, the variable region and the glucan binding domain are longer than in other GTFs (by 100 and 200 amino acids respectively). The N-catalytic domain which presents 49% identity with the other GTFs from L. mesenteroides possesses the three determinants potentially involved in the glucosyl enzyme formation. ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Alternansucrase; Sucrose glucosyltransferase; Alternan; Oligoalternan
1. Introduction Sucrose glucosyltransferases (GTF) are extracellular enzymes secreted by many strains of Leuconostoc mesenteroides and several species of oral streptococci [1]. These enzymes catalyze from sucrose the synthesis of an K-glucan and can also produce oligosaccharides at the expense of glucan synthesis when a sugar acceptor is introduced in the reaction mixture. These GTFs can be distinguished on the basis of the structure of the glucan they synthesize [1]. The enzymes which synthesize glucan exclusively composed of K-1,6 linkages in the main chain (dextran) are named dextransucrases whereas those which synthesize glucan with K-1,3 linkages in the main chain (mutan) are named mutansucrase. Both types of enzymes have been classi¢ed in the same group in the enzyme nomenclature under reference number EC 2.4.1.5. Among GTFs, alternansucrase (ASR), which is produced together with two other dextransucrases by L. mesenteroides NRRL B-1355, belongs to another group. Indeed, this enzyme is remark-
able because it synthesizes directly from sucrose a polymer of glucopyranosyl residues alternately linked by K-1,3 and K-1,6 osidic bonds in the main chain [2,3]. For this reason, it was classi¢ed under a reference number di¡erent from the number used for all other GTFs and received the reference EC 2.4.1.140. When incubated in the presence of a sugar acceptor like maltose, ASR keeps its speci¢city and catalyzes the formation of oligoalternans [3^5]. Whereas many genes encoding either dextransucrases or mutansucrases are available, no genes encoding ASR have been previously reported. The cloning of the asr gene appears essential to improve the understanding of the speci¢city of the various GTF groups. In the present communication we describe the cloning, sequencing and expression of the alternansucrase gene from L. mesenteroides NRRL B-1355. The primary structure of alternansucrase is analyzed. 2. Materials and methods 2.1. Bacterial strains, vectors and culture conditions
* Corresponding author. Tel.: +33 561 559 415; Fax: +33 561 559 400; E-mail : [email protected]
L. mesenteroides NRRL B-1355 was the source of the asr gene. Escherichia coli DH5K and pUC18 vector were
0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 5 7 2 - 8
FEMSLE 9148 16-12-99
82
M.A. Argu«ello-Morales et al. / FEMS Microbiology Letters 182 (2000) 81^85
used for all cloning steps. E. coli JM109 and pGEM-T vector were used for protein expression. E. coli was grown and maintained on Luria-Bertani (LB) medium supplemented when needed with ampicillin (100 Wg ml31 ), IPTG (50Wg ml31 ), and X-gal (40Wg ml31 ). 2.2. DNA extraction and manipulation Plasmid and genomic DNA of L. mesenteroides NRRL B-1355 were extracted from cells as previously described [6]. Restriction, modifying and DNA polymerases were used as recommended by the manufacturer. 2.3. Construction of the `pasr' probe Cells of L. mesenteroides NRRL B-1355 were ¢rst grown on sucrose medium to induce ASR. Eighty percent of the total GTF activity produced was found associated with the cell membrane [3]. Cells were harvested by centrifugation, concentrated 10-fold in sodium acetate bu¡er (20 mM, pH 5.4) and treated at 90³C for 5 min in the presence of Tris-HCl bu¡er (62.5 mM, pH 6.8), urea (6 M), sodium dodecyl sulfate (SDS, 4%, w/v), bromophenol blue (0.01%, w/v) and L-mercaptoethanol (10%, v/v) in order to release and denature GTFs. Following this SDS treatment, 300 Wl of the mixture was loaded on polyacrylamide gels. All the bands corresponding to GTF (dextransucrases and ASR which are still active) were excised and incubated separately for 24 h in 2 ml reaction mixture containing sucrose (100 g l31 ), maltose (50 g l31 ) and sodium acetate bu¡er (20 mM, pH 5.4) as previously described [7]. After total sucrose consumption, the oligosaccharides produced were analyzed by high performance liquid chromatography (HPLC). The protein with a molecular mass of approx. 220 000 was found to be ASR. Indeed, it synthesized only oligoalternans by acceptor reaction with maltose. ASR was then excised from the gel, dried and used as a pure ASR source for protein sequencing. From sequencing, two peptides (41-SFENVDGY and 49-GSEFLLAND) were selected and used to design degenerated primers. 41-dir: 5P-TT(T/C)GA(A/G)AA(T/C)GT(T/C/A/G)GA(T/C)GG(T/C/A/G)TA(T/C) and 49rev: 5P-(A/G/T)AT(A/G)TC(A/G)TT(A/G)GC(T/C/A/G)AG(T/C)AA(A/G)AA(T/C)TC. One ampli¢cation of 542 bp was obtained using genomic DNA of L. mesenteroides NRRL B-1355 as template. This probe speci¢c for alternansucrase was named `pasr'. 2.4. Southern hybridizations and screening of genomic libraries Digested chromosomal DNA of L. mesenteroides NRRL B-1355 was transferred onto N+ nylon membrane and ¢xed by exposure to UV radiation. High-stringency conditions (65³C, overnight) were used for hybridization using the `pasr' probe. Then, gene banks were constructed
from digested chromosomal DNA. The colonies were then screened by hybridization using the `pasr' probe. 2.5. DNA sequencing and sequence analysis DNA fragments were sequenced in both directions by Genome Express. Nucleotide sequence analysis was performed with the PCGene algorithm. The deduced amino acid sequence was analyzed using the algorithms PRODOM, BLAST and CLUSTAL. 2.6. Protein expression and preparation of enzyme extracts The following primers, ASR direct primer: 5P-AAAACTGCAGGTTCTTCTCTTACCTATTTTTATTTGTAATTCC and ASR reverse primer: 5P-AAAACTGCAGCCCTTAAGCTTGCAAAGCACGCTTATC, were used to amplify the asr gene using genomic DNA of L. mesenteroides NRRL B-1355 as template. Then, the asr gene was cloned into vector pGEM-T. Transformed E. coli JM109 grown overnight at 30³C were harvested by centrifugation and resuspended in sodium acetate bu¡er 20 mM, pH 5.4 and Triton X-100, 1% (v/v) until an absorbance of 80 at 600 nm was reached before sonication. GTF activity present in the supernatant of sonication was characterized. 2.7. Alternansucrase assays GTF activity measurements were performed as described previously [3]. ASR activity was determined by oligosaccharide synthesis performed at 30³C in sodium acetate bu¡er (20 mM, pH 5.4) supplemented with sucrose (100 g l31 ), maltose as acceptor (100 g l31 ), CaCl2 (0.05 g l31 ) and 0.5 U ml31 of ASR. The oligosaccharides synthesized were analyzed by HPLC, using a C18 column and water as eluent at a £ow rate of 0.5 ml min31 . Oligosaccharides were detected using a di¡erential refractometer. 2.8. Nucleotide sequence accession number The sequence of the entire asr gene has been submitted to the GenBank database under accession number AJ250173. 3. Results and discussion 3.1. Cloning and expression of the asr gene Fig. 1 describes the asr gene cloning steps. First, a HindIII library was screened using the `pasr' probe speci¢c for ASR. One recombinant plasmid, p2.2S, containing a HindIII insert of 2.2 kb was puri¢ed. Sequence analysis of the insert enabled an open reading frame with an initiation codon and a putative promoter to be identi¢ed. The sequence of the insert was found to be homologous to other
FEMSLE 9148 16-12-99
M.A. Argu«ello-Morales et al. / FEMS Microbiology Letters 182 (2000) 81^85
83
Fig. 1. Cloning of the asr gene from L. mesenteroides NRRL B-1355. P2.2S and p3S were isolated by screening of genomic libraries using the `pasr' probe. PBclI and pBcl5 were successively isolated using XhoI/HindIII and HindIII/BclI probes respectively.
GTF-encoding genes. Another positive clone carrying a plasmid with a HindIII insert of 3 kb also homologous to other gtf genes was obtained. Then, two genomic libraries were screened successively with probes located at the C-terminal extremity of the isolated fragments in order to detect the stop codon. By these means, 835 additional base pairs located at the C-terminal part of the gene were obtained. The stop codon was then isolated using an inverse polymerase chain reaction (IPCR) approach. IASR inverse primer 5P-2405 GTTAACCAAAGTGCCAGAATTTGGACGG and IASR direct primer 5P-5374 GTCAGACGGTCTGGGTTGATAACCATGC were designed from the asr sequence. The reaction was carried out using the BglII circularized DNA fragments (5^8 kb) of L. mesenteroides NRRL B-1355 as template. An ampli¢cation of approximately 5 kb which contained a stop codon was obtained. Then, the entire gene, named asr, was cloned into pGEMT. No activity was detected in the culture supernatant of E. coli JM109 transformed by the recombinant plasmid. The sonicated cell extracts tested positive for GTF activity in the GTF assay. GTF activity reached 160 U l31 of culture. Oligosaccharides were synthesized by acceptor reaction in the presence of maltose. As shown in Fig. 2, recombinant enzyme, like native ASR, synthesized a high amount of 62 -O-K-nigerosylmaltose (peaks 2 and 3 corresponding to K- and L-anomers) [3]. Interestingly, two additional products (peaks a and b) were synthesized. They were not synthesized at a detectable level by the native
enzymes from L. mesenteroides NRRL B-1355 (alternansucrase and dextransucrase) and may correspond to products synthesized by alternansucrase that could be glucosylated preferentially by dextransucrase in the acceptor reaction. Their structure will be determined. In addition, 62 -O-K-isomaltosylmaltose, an oligodextran mainly synthesized by native dextransucrase from L. mesenteroides NRRL B-1355 (peak 4), is synthesized at a very low concentration by the recombinant enzyme [3,4,7]. From these observations, it can be concluded that the asr gene encodes ASR. 3.2. Sequence analysis The nucleotide sequence of the asr gene which is 6171 bp in length is preceded by a potential RBS `AGGGAG' located 8 bp upstream of an initiation codon. A potential promoter can be identi¢ed with a 310 sequence beginning at nt 160 `TATCAT' and a 335 sequence beginning at nt 138 `GTGATA'. A putative terminator sequence is present downstream of the stop codon (nt 6366). The asr gene encodes a protein of 2057 amino acids with a predicted pI of 5.1 and a molecular mass of 228 971. It is the largest GTF described until now. From the N-terminal part, a Gram-positive signal peptide sequence is identi¢ed. A cleavage site following amino acid 39 was predicted by the program of Nielsen et al. [8]. Then from aa 40 to 373, ASR displays a highly variable region which is
FEMSLE 9148 16-12-99
84
M.A. Argu«ello-Morales et al. / FEMS Microbiology Letters 182 (2000) 81^85
Fig. 2. HPLC analysis of the oligosaccharides obtained in the presence of sucrose and maltose, (top) with native GTFs from L. mesenteroides NRRL B-1355 and (bottom) with recombinant ASR (E. coli crude extract). Peak identi¢cation: F, fructose ; M, maltose; S, sucrose; 1, panose; 2, 3, 62 -O-K-nigerosylmaltose (K- and L-forms); 4, 62 -O-K-isomaltosylmaltose ; a, b, oligoalternans to be identi¢ed.
Fig. 3. Alignment of GTFs: GTF-J, Streptococcus salivarius ATCC 25975; GTF-K, S. salivarius ATCC 25975; GTF-D, S. mutans GS5; GTF-G S. gordonii; GTF-L, S. salivarius ATCC 25975; GTF-M, S. salivarius ATCC 25975; GTF-S, S. downei Mfe28; GTF-B, S. mutans GS5; GTF-C, S. mutans GS5; GTF-I, S. downei Mfe28; DSR-B, Leuconostoc mesenteroides NRRL B-1299; DSR-S, L. mesenteroides NRRL B-512F ; ASR, L. mesenteroides NRRL B-1355 (this work). Blocks A, B, C, D and E correspond to fragments of sequences highly conserved in glucansucrases that contain crucial amino acids (bold-face characters).
FEMSLE 9148 16-12-99
M.A. Argu«ello-Morales et al. / FEMS Microbiology Letters 182 (2000) 81^85
much longer than the corresponding region of the other GTFs (by 100 aa) [9]. The next 974 amino acids from the variable region de¢ne the catalytic domain. Sequence comparison of the catalytic domain revealed that ASR shares 49% identical and similar residues with other GTFs from L. mesenteroides strains. In particular, the ¢ve blocks of sequences which contain amino acids thought to play a role in catalysis can be easily identi¢ed in ASR (Fig. 3). Moreover, the three amino acids suggested to be involved in the catalytic triad by analogy with K-amylases [10] are easily identi¢ed in the ASR sequence: D635, E673, D767 of ASR. However, it is clear that ASR also possesses some stretches of sequences very di¡erent from all other GTFs even in usually highly conserved regions. The sequence just following the putative general acid catalyst (E673) and preceding the second aspartic acid of the triad (D767) is signi¢cantly longer and really di¡erent from the sequence observed in all other GTFs (Fig. 3). In addition, the tripeptide 768YDA following the second aspartic acid of the triad (D767) is really speci¢c for alternansucrase and very far from the consensus sequence SEV observed for other GTFs (Fig. 3). Finally, the C-terminus, also named glucan binding domain (GBD), begins at position 1348. Once again this domain is longer by 200 amino acids than the GBDs of all other GTFs sequenced up to now. On the basis of its sequence, ASR, which was previously classi¢ed under EC number 2.4.1.140, must be classi¢ed in family 70 of glucosylhydrolases like all other GTFs from L. mesenteroides (EC 2.4.1.5) [11]. However, the role of the very long variable region and GBD of ASR will have to be further investigated to be compared with other GTFs. In addition, sequence comparisons enabled us to locate regions very di¡erent from the consensus sequences encountered in other GTFs. Further work combining site-directed mutagenesis, random mutagenesis or hybrid enzyme construction is required to determine the role of these segments in GTF speci¢city.
85
Acknowledgements This work was supported by the European Program Alpha-Glucan Active Designer Enzymes (AGADEPL970022) and the Consejo Nacional de Ciencia y Tecnologia (CONACYT), Mexico. References [1] Mooser, G. (1992) Glycosidases and glycosyltransferases. In: The Enzymes, Vol. XX, pp. 187^221. Academic Press, New York. [2] Coªte¨, G.L. and Robyt, J.F. (1982) Isolation and partial characterisation of an extracellular glucansucrase from Leuconostoc mesenteroides NRRL B-1355 that synthesizes an alternating (1-6), (1-3)-K-Dglucan. Carbohydr. Res. 101, 57^74. [3] Lopez, A., Pelenc, V., Remaud, M., Biton, M., Michel, J.M., Lang, C., Paul, F. and Monsan, P. (1993) Production and puri¢cation of alternansucrase, a glucosyltransferase from Leuconostoc mesenteroides NRRL B-1355, for the synthesis of oligoalternans. Enzyme Microbiol. Technol. 15, 77^85. [4] Coªte¨, G.L. and Robyt, J.F. (1982) Acceptor reactions of alternansucrase from L. mesenteroides NRRL B-1355. Carbohydr. Res. 111, 127^142. [5] Smith, M.R., Zahnley, J.C. and Goodman, N. (1994) Glucosyltransferase mutants of Leuconostoc mesenteroides NRRL B-1355. Appl. Environ. Microbiol. 60, 2723^2731. [6] Monchois, V., Willemot, R.M., Remaud-Simeon, M., Croux, C. and Monsan, P. (1996) Cloning and sequencing of a gene coding for a novel dextransucrase from Leuconostoc mesenteroides NRRL B-1299 synthesizing only K(1-6) and K(1-3) linkages. Gene 182, 23^32. [7] Smith, M.R. and Zahnley, J.C. (1997) Leuconostoc mesenteroides B1355 mutants producing alternansucrase exhibiting decreases in apparent molecular mass. Appl. Environ. Microbiol. 63, 581^586. [8] Nielsen, H., Engelbrecht, J., Brunak, S. and von Heijne, G. (1997) Identi¢cation of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10, 1^6. [9] Monchois, V., Willemot, R.M. and Monsan, P. (1999) Glucansucrases: mechanism of action and structure-function relationships. FEMS Microbiol. Rev. 23, 131^151. [10] Devulapalle, K.S., Goodman, S.D., Gao, Q., Hemsley, A. and Mooser, G. (1997) Knowledge based model of glucosyltransferase from the oral bacteria group of mutans streptococci. Protein Sci. 6, 2489^2493. [11] Henrissat, B. and Bairoch, J. (1996) Updating the sequence based classi¢cation of glycosyl hydrolases. Biochem. J. 316, 695^696.
FEMSLE 9148 16-12-99
www.fems-microbiology.org
Sequence analysis of the gene encoding alternansucrase, a sucrose glucosyltransferase from Leuconostoc mesenteroides NRRL B-1355 Martha A. Argu«ello-Morales, Magali Remaud-Simeon, Sandra Pizzut, Patricia Sarc°abal, Rene¨-Marc Willemot, Pierre Monsan * Centre de Bioinge¨nierie Gilbert Durand, UMR CNRS 5504, UMR INRA 792, INSA, 135 Avenue de Rangueil, 310077 Toulouse Cedex 4, France Received 6 October 1999; received in revised form 29 October 1999; accepted 4 November 1999
Abstract The gene encoding alternansucrase (ASR) from Leuconostoc mesenteroides NRRL B-1355, an original sucrose glucosyltransferase (GTF) specific to alternating K-1,3 and K-1,6 glucosidic bond synthesis, was cloned, sequenced and expressed into Escherichia coli. Recombinant enzyme catalyzed oligoalternan synthesis from sucrose and maltose acceptor. From sequence comparison, it appears that ASR possesses the same domains as those described for GTFs specific to either contiguous K-1,3 osidic bond or contiguous K-1,6 osidic bond synthesis. However, the variable region and the glucan binding domain are longer than in other GTFs (by 100 and 200 amino acids respectively). The N-catalytic domain which presents 49% identity with the other GTFs from L. mesenteroides possesses the three determinants potentially involved in the glucosyl enzyme formation. ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Alternansucrase; Sucrose glucosyltransferase; Alternan; Oligoalternan
1. Introduction Sucrose glucosyltransferases (GTF) are extracellular enzymes secreted by many strains of Leuconostoc mesenteroides and several species of oral streptococci [1]. These enzymes catalyze from sucrose the synthesis of an K-glucan and can also produce oligosaccharides at the expense of glucan synthesis when a sugar acceptor is introduced in the reaction mixture. These GTFs can be distinguished on the basis of the structure of the glucan they synthesize [1]. The enzymes which synthesize glucan exclusively composed of K-1,6 linkages in the main chain (dextran) are named dextransucrases whereas those which synthesize glucan with K-1,3 linkages in the main chain (mutan) are named mutansucrase. Both types of enzymes have been classi¢ed in the same group in the enzyme nomenclature under reference number EC 2.4.1.5. Among GTFs, alternansucrase (ASR), which is produced together with two other dextransucrases by L. mesenteroides NRRL B-1355, belongs to another group. Indeed, this enzyme is remark-
able because it synthesizes directly from sucrose a polymer of glucopyranosyl residues alternately linked by K-1,3 and K-1,6 osidic bonds in the main chain [2,3]. For this reason, it was classi¢ed under a reference number di¡erent from the number used for all other GTFs and received the reference EC 2.4.1.140. When incubated in the presence of a sugar acceptor like maltose, ASR keeps its speci¢city and catalyzes the formation of oligoalternans [3^5]. Whereas many genes encoding either dextransucrases or mutansucrases are available, no genes encoding ASR have been previously reported. The cloning of the asr gene appears essential to improve the understanding of the speci¢city of the various GTF groups. In the present communication we describe the cloning, sequencing and expression of the alternansucrase gene from L. mesenteroides NRRL B-1355. The primary structure of alternansucrase is analyzed. 2. Materials and methods 2.1. Bacterial strains, vectors and culture conditions
* Corresponding author. Tel.: +33 561 559 415; Fax: +33 561 559 400; E-mail : [email protected]
L. mesenteroides NRRL B-1355 was the source of the asr gene. Escherichia coli DH5K and pUC18 vector were
0378-1097 / 00 / $20.00 ß 2000 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 9 9 ) 0 0 5 7 2 - 8
FEMSLE 9148 16-12-99
82
M.A. Argu«ello-Morales et al. / FEMS Microbiology Letters 182 (2000) 81^85
used for all cloning steps. E. coli JM109 and pGEM-T vector were used for protein expression. E. coli was grown and maintained on Luria-Bertani (LB) medium supplemented when needed with ampicillin (100 Wg ml31 ), IPTG (50Wg ml31 ), and X-gal (40Wg ml31 ). 2.2. DNA extraction and manipulation Plasmid and genomic DNA of L. mesenteroides NRRL B-1355 were extracted from cells as previously described [6]. Restriction, modifying and DNA polymerases were used as recommended by the manufacturer. 2.3. Construction of the `pasr' probe Cells of L. mesenteroides NRRL B-1355 were ¢rst grown on sucrose medium to induce ASR. Eighty percent of the total GTF activity produced was found associated with the cell membrane [3]. Cells were harvested by centrifugation, concentrated 10-fold in sodium acetate bu¡er (20 mM, pH 5.4) and treated at 90³C for 5 min in the presence of Tris-HCl bu¡er (62.5 mM, pH 6.8), urea (6 M), sodium dodecyl sulfate (SDS, 4%, w/v), bromophenol blue (0.01%, w/v) and L-mercaptoethanol (10%, v/v) in order to release and denature GTFs. Following this SDS treatment, 300 Wl of the mixture was loaded on polyacrylamide gels. All the bands corresponding to GTF (dextransucrases and ASR which are still active) were excised and incubated separately for 24 h in 2 ml reaction mixture containing sucrose (100 g l31 ), maltose (50 g l31 ) and sodium acetate bu¡er (20 mM, pH 5.4) as previously described [7]. After total sucrose consumption, the oligosaccharides produced were analyzed by high performance liquid chromatography (HPLC). The protein with a molecular mass of approx. 220 000 was found to be ASR. Indeed, it synthesized only oligoalternans by acceptor reaction with maltose. ASR was then excised from the gel, dried and used as a pure ASR source for protein sequencing. From sequencing, two peptides (41-SFENVDGY and 49-GSEFLLAND) were selected and used to design degenerated primers. 41-dir: 5P-TT(T/C)GA(A/G)AA(T/C)GT(T/C/A/G)GA(T/C)GG(T/C/A/G)TA(T/C) and 49rev: 5P-(A/G/T)AT(A/G)TC(A/G)TT(A/G)GC(T/C/A/G)AG(T/C)AA(A/G)AA(T/C)TC. One ampli¢cation of 542 bp was obtained using genomic DNA of L. mesenteroides NRRL B-1355 as template. This probe speci¢c for alternansucrase was named `pasr'. 2.4. Southern hybridizations and screening of genomic libraries Digested chromosomal DNA of L. mesenteroides NRRL B-1355 was transferred onto N+ nylon membrane and ¢xed by exposure to UV radiation. High-stringency conditions (65³C, overnight) were used for hybridization using the `pasr' probe. Then, gene banks were constructed
from digested chromosomal DNA. The colonies were then screened by hybridization using the `pasr' probe. 2.5. DNA sequencing and sequence analysis DNA fragments were sequenced in both directions by Genome Express. Nucleotide sequence analysis was performed with the PCGene algorithm. The deduced amino acid sequence was analyzed using the algorithms PRODOM, BLAST and CLUSTAL. 2.6. Protein expression and preparation of enzyme extracts The following primers, ASR direct primer: 5P-AAAACTGCAGGTTCTTCTCTTACCTATTTTTATTTGTAATTCC and ASR reverse primer: 5P-AAAACTGCAGCCCTTAAGCTTGCAAAGCACGCTTATC, were used to amplify the asr gene using genomic DNA of L. mesenteroides NRRL B-1355 as template. Then, the asr gene was cloned into vector pGEM-T. Transformed E. coli JM109 grown overnight at 30³C were harvested by centrifugation and resuspended in sodium acetate bu¡er 20 mM, pH 5.4 and Triton X-100, 1% (v/v) until an absorbance of 80 at 600 nm was reached before sonication. GTF activity present in the supernatant of sonication was characterized. 2.7. Alternansucrase assays GTF activity measurements were performed as described previously [3]. ASR activity was determined by oligosaccharide synthesis performed at 30³C in sodium acetate bu¡er (20 mM, pH 5.4) supplemented with sucrose (100 g l31 ), maltose as acceptor (100 g l31 ), CaCl2 (0.05 g l31 ) and 0.5 U ml31 of ASR. The oligosaccharides synthesized were analyzed by HPLC, using a C18 column and water as eluent at a £ow rate of 0.5 ml min31 . Oligosaccharides were detected using a di¡erential refractometer. 2.8. Nucleotide sequence accession number The sequence of the entire asr gene has been submitted to the GenBank database under accession number AJ250173. 3. Results and discussion 3.1. Cloning and expression of the asr gene Fig. 1 describes the asr gene cloning steps. First, a HindIII library was screened using the `pasr' probe speci¢c for ASR. One recombinant plasmid, p2.2S, containing a HindIII insert of 2.2 kb was puri¢ed. Sequence analysis of the insert enabled an open reading frame with an initiation codon and a putative promoter to be identi¢ed. The sequence of the insert was found to be homologous to other
FEMSLE 9148 16-12-99
M.A. Argu«ello-Morales et al. / FEMS Microbiology Letters 182 (2000) 81^85
83
Fig. 1. Cloning of the asr gene from L. mesenteroides NRRL B-1355. P2.2S and p3S were isolated by screening of genomic libraries using the `pasr' probe. PBclI and pBcl5 were successively isolated using XhoI/HindIII and HindIII/BclI probes respectively.
GTF-encoding genes. Another positive clone carrying a plasmid with a HindIII insert of 3 kb also homologous to other gtf genes was obtained. Then, two genomic libraries were screened successively with probes located at the C-terminal extremity of the isolated fragments in order to detect the stop codon. By these means, 835 additional base pairs located at the C-terminal part of the gene were obtained. The stop codon was then isolated using an inverse polymerase chain reaction (IPCR) approach. IASR inverse primer 5P-2405 GTTAACCAAAGTGCCAGAATTTGGACGG and IASR direct primer 5P-5374 GTCAGACGGTCTGGGTTGATAACCATGC were designed from the asr sequence. The reaction was carried out using the BglII circularized DNA fragments (5^8 kb) of L. mesenteroides NRRL B-1355 as template. An ampli¢cation of approximately 5 kb which contained a stop codon was obtained. Then, the entire gene, named asr, was cloned into pGEMT. No activity was detected in the culture supernatant of E. coli JM109 transformed by the recombinant plasmid. The sonicated cell extracts tested positive for GTF activity in the GTF assay. GTF activity reached 160 U l31 of culture. Oligosaccharides were synthesized by acceptor reaction in the presence of maltose. As shown in Fig. 2, recombinant enzyme, like native ASR, synthesized a high amount of 62 -O-K-nigerosylmaltose (peaks 2 and 3 corresponding to K- and L-anomers) [3]. Interestingly, two additional products (peaks a and b) were synthesized. They were not synthesized at a detectable level by the native
enzymes from L. mesenteroides NRRL B-1355 (alternansucrase and dextransucrase) and may correspond to products synthesized by alternansucrase that could be glucosylated preferentially by dextransucrase in the acceptor reaction. Their structure will be determined. In addition, 62 -O-K-isomaltosylmaltose, an oligodextran mainly synthesized by native dextransucrase from L. mesenteroides NRRL B-1355 (peak 4), is synthesized at a very low concentration by the recombinant enzyme [3,4,7]. From these observations, it can be concluded that the asr gene encodes ASR. 3.2. Sequence analysis The nucleotide sequence of the asr gene which is 6171 bp in length is preceded by a potential RBS `AGGGAG' located 8 bp upstream of an initiation codon. A potential promoter can be identi¢ed with a 310 sequence beginning at nt 160 `TATCAT' and a 335 sequence beginning at nt 138 `GTGATA'. A putative terminator sequence is present downstream of the stop codon (nt 6366). The asr gene encodes a protein of 2057 amino acids with a predicted pI of 5.1 and a molecular mass of 228 971. It is the largest GTF described until now. From the N-terminal part, a Gram-positive signal peptide sequence is identi¢ed. A cleavage site following amino acid 39 was predicted by the program of Nielsen et al. [8]. Then from aa 40 to 373, ASR displays a highly variable region which is
FEMSLE 9148 16-12-99
84
M.A. Argu«ello-Morales et al. / FEMS Microbiology Letters 182 (2000) 81^85
Fig. 2. HPLC analysis of the oligosaccharides obtained in the presence of sucrose and maltose, (top) with native GTFs from L. mesenteroides NRRL B-1355 and (bottom) with recombinant ASR (E. coli crude extract). Peak identi¢cation: F, fructose ; M, maltose; S, sucrose; 1, panose; 2, 3, 62 -O-K-nigerosylmaltose (K- and L-forms); 4, 62 -O-K-isomaltosylmaltose ; a, b, oligoalternans to be identi¢ed.
Fig. 3. Alignment of GTFs: GTF-J, Streptococcus salivarius ATCC 25975; GTF-K, S. salivarius ATCC 25975; GTF-D, S. mutans GS5; GTF-G S. gordonii; GTF-L, S. salivarius ATCC 25975; GTF-M, S. salivarius ATCC 25975; GTF-S, S. downei Mfe28; GTF-B, S. mutans GS5; GTF-C, S. mutans GS5; GTF-I, S. downei Mfe28; DSR-B, Leuconostoc mesenteroides NRRL B-1299; DSR-S, L. mesenteroides NRRL B-512F ; ASR, L. mesenteroides NRRL B-1355 (this work). Blocks A, B, C, D and E correspond to fragments of sequences highly conserved in glucansucrases that contain crucial amino acids (bold-face characters).
FEMSLE 9148 16-12-99
M.A. Argu«ello-Morales et al. / FEMS Microbiology Letters 182 (2000) 81^85
much longer than the corresponding region of the other GTFs (by 100 aa) [9]. The next 974 amino acids from the variable region de¢ne the catalytic domain. Sequence comparison of the catalytic domain revealed that ASR shares 49% identical and similar residues with other GTFs from L. mesenteroides strains. In particular, the ¢ve blocks of sequences which contain amino acids thought to play a role in catalysis can be easily identi¢ed in ASR (Fig. 3). Moreover, the three amino acids suggested to be involved in the catalytic triad by analogy with K-amylases [10] are easily identi¢ed in the ASR sequence: D635, E673, D767 of ASR. However, it is clear that ASR also possesses some stretches of sequences very di¡erent from all other GTFs even in usually highly conserved regions. The sequence just following the putative general acid catalyst (E673) and preceding the second aspartic acid of the triad (D767) is signi¢cantly longer and really di¡erent from the sequence observed in all other GTFs (Fig. 3). In addition, the tripeptide 768YDA following the second aspartic acid of the triad (D767) is really speci¢c for alternansucrase and very far from the consensus sequence SEV observed for other GTFs (Fig. 3). Finally, the C-terminus, also named glucan binding domain (GBD), begins at position 1348. Once again this domain is longer by 200 amino acids than the GBDs of all other GTFs sequenced up to now. On the basis of its sequence, ASR, which was previously classi¢ed under EC number 2.4.1.140, must be classi¢ed in family 70 of glucosylhydrolases like all other GTFs from L. mesenteroides (EC 2.4.1.5) [11]. However, the role of the very long variable region and GBD of ASR will have to be further investigated to be compared with other GTFs. In addition, sequence comparisons enabled us to locate regions very di¡erent from the consensus sequences encountered in other GTFs. Further work combining site-directed mutagenesis, random mutagenesis or hybrid enzyme construction is required to determine the role of these segments in GTF speci¢city.
85
Acknowledgements This work was supported by the European Program Alpha-Glucan Active Designer Enzymes (AGADEPL970022) and the Consejo Nacional de Ciencia y Tecnologia (CONACYT), Mexico. References [1] Mooser, G. (1992) Glycosidases and glycosyltransferases. In: The Enzymes, Vol. XX, pp. 187^221. Academic Press, New York. [2] Coªte¨, G.L. and Robyt, J.F. (1982) Isolation and partial characterisation of an extracellular glucansucrase from Leuconostoc mesenteroides NRRL B-1355 that synthesizes an alternating (1-6), (1-3)-K-Dglucan. Carbohydr. Res. 101, 57^74. [3] Lopez, A., Pelenc, V., Remaud, M., Biton, M., Michel, J.M., Lang, C., Paul, F. and Monsan, P. (1993) Production and puri¢cation of alternansucrase, a glucosyltransferase from Leuconostoc mesenteroides NRRL B-1355, for the synthesis of oligoalternans. Enzyme Microbiol. Technol. 15, 77^85. [4] Coªte¨, G.L. and Robyt, J.F. (1982) Acceptor reactions of alternansucrase from L. mesenteroides NRRL B-1355. Carbohydr. Res. 111, 127^142. [5] Smith, M.R., Zahnley, J.C. and Goodman, N. (1994) Glucosyltransferase mutants of Leuconostoc mesenteroides NRRL B-1355. Appl. Environ. Microbiol. 60, 2723^2731. [6] Monchois, V., Willemot, R.M., Remaud-Simeon, M., Croux, C. and Monsan, P. (1996) Cloning and sequencing of a gene coding for a novel dextransucrase from Leuconostoc mesenteroides NRRL B-1299 synthesizing only K(1-6) and K(1-3) linkages. Gene 182, 23^32. [7] Smith, M.R. and Zahnley, J.C. (1997) Leuconostoc mesenteroides B1355 mutants producing alternansucrase exhibiting decreases in apparent molecular mass. Appl. Environ. Microbiol. 63, 581^586. [8] Nielsen, H., Engelbrecht, J., Brunak, S. and von Heijne, G. (1997) Identi¢cation of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10, 1^6. [9] Monchois, V., Willemot, R.M. and Monsan, P. (1999) Glucansucrases: mechanism of action and structure-function relationships. FEMS Microbiol. Rev. 23, 131^151. [10] Devulapalle, K.S., Goodman, S.D., Gao, Q., Hemsley, A. and Mooser, G. (1997) Knowledge based model of glucosyltransferase from the oral bacteria group of mutans streptococci. Protein Sci. 6, 2489^2493. [11] Henrissat, B. and Bairoch, J. (1996) Updating the sequence based classi¢cation of glycosyl hydrolases. Biochem. J. 316, 695^696.
FEMSLE 9148 16-12-99